KR101174815B1 - Primer combination for diagnosing Tobacco rattle virus and uses thereof - Google Patents

Abstract

The present invention is a species specific diagnosis of TRV using a TRV diagnostic primer combination comprising one or more primer combinations selected from the primers represented by SEQ ID NOs: 1 to 15, a TRV diagnostic kit comprising the primer combination, and the primer combination. It is about a method.

The PSI test system of the present invention may be used for the industrialization of plant virus RT-PCR diagnostic kits and for the testing of TRV from plants in quarantine and clinical diagnosis.

Diagnosis, Tobacco Rattle Virus, RT-PCR, Eggplant, Nested PCR, Positive Control, Diagnostic System, Plant Quarantine

Description

Primer combination for diagnosing Tobacco rattle virus and uses approximately}

The present invention relates to a PCR (PCR) test system for diagnosing Tobacco rattle virus (TRV), which causes great damage to eggplants and crops. The PSI test system includes an optimal primer pair for TRV diagnosis and a matching primer pair, and a species specific primer bank and a positive control that can support it.

In the past, electron microscopy and serological methods (ELISA) were mainly used for the diagnosis of viruses. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among serological methods, the ELISA method is about 1000 times lower in sensitivity than the most commonly used diagnostic method or PSI, and often fails to diagnose due to unexpected nonspecific reaction of antibodies and test samples.

Currently, the diagnosis of RNA virus is the most commonly used RT-PCR method with high detection sensitivity and convenience. The development of species-specific primers is the most important for the diagnosis of the pathogen. No specific primers for diagnosing TRV have been patented.

TRV occurs mainly in eggplant crops and weeds in the natural state, and infectious means are known as contact infection by juice, transmission by nematodes and seed transmission. TRV requires diagnostic methods that can detect it from eggplants and plants imported as quarantine pathogens. Until now, ELISA has been mainly used for diagnosing TRV, but it is often misdiagnosed by nonspecific reaction of plant extract and antiserum. In addition, if the infection rate is low in the TRV infection, ELISA diagnosis is likely to fail the test. Thus, in order to detect viruses in these seeds, it is generally necessary to diagnose PSI with 1000 times higher detection sensitivity than ELISA. The quarantine site requires the diagnosis of various pathogens on a single test sample, which requires a lot of labor and test costs. Therefore, the development of the same test method for each pathogen is necessary. When diagnosing by PSI, it is necessary to establish pathogen-specific diagnostic primer banks and to test for positive and negative reactions in case of difficulty in discriminating due to the low intensity of specific reactions or for non-specific reactions with other nucleic acids. You need a system that can. On the other hand, when isolate-specific primers are used for diagnosis, the test may fail, and therefore, development of a species-specific primer capable of detecting all isolates present in a viral species is required.

The present invention has been made in accordance with the above demand, and there are strains or isolates having slightly different base sequences in TRV species. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus. Primers in the present invention are designed to work species specific. In other words, the nucleotide sequences known to date are collected within the species to search for common nucleotide sequences of all strains and isolates. The species-specific sequence was selected by excluding the nucleotide sequences of other viruses with a flexible relationship among the common nucleotide sequences. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual reverse transcriptase-polymerase chain reaction (RT-PCR) for each combination and did not have a nonspecific reaction with nucleic acids other than the target virus. In addition, the assay primer (nested primer) was developed together for the final selected primer combination. In addition, by securing a variety of diagnostic primer combinations for TRV to build a primer bank that can be tested for the positive and negative reactions to the PI. The plasmid cloned the primer design region of the TRV was prepared to obtain a positive control, and the nucleotide sequence was determined to confirm the positive reaction. In addition, the pH response conditions were identically developed in all virus and primer combinations to increase the test efficiency at the quarantine site.

In order to solve the above problems, the present invention provides a primer combination for TRV diagnostic comprising one or more primer combinations selected from the primers represented by SEQ ID NOs: 1 to 15.

In addition, the present invention provides a diagnostic kit for TRV comprising the primer combination.

In addition, the present invention provides a method for species-specific diagnosis of TRV using the above primer combination.

According to the present invention, the tobacco rattle virus (TRV) PSI test system can diagnose the TRV from plant seeds and tissues with a detection limit of 1,000 times or more than the conventional diagnostic method using antiserum. The TRV diagnostic primer included in the PSI test system has been developed to react with all TRV strains known to date and also includes tools for the validation of positive and negative responses. The test system of the present invention may be used for the testing of TRV in industrialization and quarantine of plant virus RT-PCR diagnostic kits.

In order to achieve the object of the present invention, the present invention provides a TRV diagnostic primer combination comprising at least one primer combination selected from the primers represented by SEQ ID NO: 1 to 15.

In the TRV diagnostic primer combination of the present invention, the forward primer is selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, and the reverse primer is SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 may be selected from the group consisting of. However, in the primer combination of the present invention, the forward primer should be located on the 5 'side rather than the reverse primer.

TRV diagnostic primer combinations of the invention are preferably primer combinations of SEQ ID NOs: 3 and 11 (combination 5); And it may include one or more selected from the group consisting of primer combinations (combination 7) of SEQ ID NO: 1 and 14.

TRV diagnostic primer combination of the present invention is more preferably a primer combination of SEQ ID NO: 3 and 11 (combination 5); And primer combinations of SEQ ID NOs: 1 and 14 (combination 7). By using two primer combinations simultaneously, TRV can be diagnosed more accurately.

TRV diagnostic primer combinations of the invention also include primer combinations of SEQ ID NOs: 4 and 12; And it may further comprise one or more selected from the group consisting of primer combinations of SEQ ID NO: 2 and 15. That is, the TRV diagnostic primer combination of the present invention has a verification function for the RT-PCR product of the primer TR-C45 / N22 combination and the TRV diagnostic primer combination 7 having the verification function for the RT-PCR product of the TRV diagnostic primer combination 5 Primer TR-C62 / N11 combinations may be further included. If the assay of the primary RT-PCR test result is necessary, i.e. to confirm that the RT-PCR product is a result derived from TRV, a PCR test is performed using the assayed primer for this primer combination. In this case, if the RT-PCR reaction result is derived from TRV, the assay PCR will show a positive reaction (see FIG. 4).

The primers may be at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 in the sequence of SEQ ID NOs: 1 to 15, depending on the sequence length of each primer. Oligonucleotides consisting of at least 24, segments of at least 24 contiguous nucleotides. For example, the primers of SEQ ID NO: 1 (23 oligonucleotides) are at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive in the sequence of SEQ ID NO: 1 And oligonucleotides consisting of fragments of nucleotides, wherein the primers of SEQ ID NO: 2 (21 oligonucleotides) are at least 16, at least 17, at least 18, at least 19, at least 20 within the sequence of SEQ ID NO: 2 Oligonucleotides consisting of segments of contiguous nucleotides.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

One or more primer combinations according to the invention; And a DNA fragment having a nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 17. The kits of the present invention may further comprise reagents required for RT-PCR, which reagents include, but are not limited to, forward primers and reverse primers, reverse transcriptases, ribonuclease inhibitors, heat resistant polymerases and The reaction buffer may include both reverse transcription buffer and PCR buffer, and the heat resistant polymerase may use EF Taq polymerase and the like, and the reverse transcriptase may be reverse transcriptase, for example, algae from various sources. Avian myeloblastosis virus-derived virus reverse transcriptase (AMV RTase), mouse leukemia virus-derived virus reverse transcriptase (MuLV RTase) and Rouse-associated virus 2 It may include a reverse transcriptase (Rous-associated virus 2 reverse transcriptase (RAV-2 RTase).

The kit may also include instructions. The guide is a printed document that explains how to use the kit, such as how to prepare reverse transcription buffer and PCR buffer, and the reaction conditions presented. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

DNA fragments having the nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 17 contained in the kit of the present invention can be used as a plasmid having the function of a positive control for RT-PCR or PCR reaction using TRV diagnostic primer combination (Fig. 5). That is, the DNA fragment having the nucleotide sequence of SEQ ID NO: 16 shows the TRV nucleotide sequence (2,489 bp) inserted into the positive control (TRV-T), and the DNA fragment having the nucleotide sequence of SEQ ID NO: 17 is the positive control (TRV-H). ) Shows the TRV base sequence (1,019 bp).

In order to achieve another object of the present invention, the present invention

Separating total RNA from plant samples;

Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using one or more primer combinations according to the present invention; And

It provides a method for species-specific diagnosis of TRV, comprising detecting the amplification product.

As a method for separating total RNA from a plant sample, a method known in the art may be used, for example, a phenol extraction method may be used. Using the isolated whole RNA as a template, one or more primer combinations according to one embodiment of the present invention may be used as a primer to amplify a target sequence by performing RT-PCR. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

In the method according to an embodiment of the present invention, the plant may be branched plants, bulbs or weeds, but is not limited thereto and may be included in the scope of the present invention as long as the plant can be infected with TRV.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example

Example 1 Design and Combination of TRV Diagnostic Primers

TRVs are rod-shaped, 22 nm wide and approximately 190 nm long and 50-115 nm long. The nucleic acid of TRV consists of one strand of RNA, the total nucleic acid is about 11 kb, RNA 1 is about 7 kb, RNA 2 is about 2-4 kb. Taxonomically, it belongs to the Tobravirus genus. TRV is mainly transmitted by juices and nematodes. The experimental host range is very wide, with over 400 species. Occurs in branches, bulbs and weeds in nature. The design of the diagnostic primers consisted of RNA 1 encoded four proteins.

The TRV consensus sequence search was made by multiple comparisons of the nucleotide sequences (Table 1) of seven TRV isolates known to date. The selected common sequences were searched for species-specific sequences compared to two viral sequences of Tobraviruses (Table 2), which are taxonomically similar to TRV. Of these species specific nucleotide sequences, 15 diagnostic primers satisfying primer conditions were designed (Table 3). The designed primer is shown in FIG. 1. Seven primer combinations were made using these primers, and RT-PCR products are shown in Table 4.

Table 1. TRV Isolation Sequences Used for Common Sequence Analysis

Separator or System Genbank accession no. Size (bp) Analysis genome TRV-ppK20 RNA1 AF314165 6791 RNA-1 TRV-ppK20 RNA1 AF406990 6791 RNA-1 TRV-PpK20 .i RNA1 AF166084 6791 RNA-1 TRV-SYM RNA1 X06172 6791 RNA-1 TRV-SYM RNA1 D00155 6791 RNA-1 TRV-ORY.i RNA1 AF034622 6790 RNA-1 TRV-Pp085 RNA1 AJ586803 6617 RNA-1

Table 2. Tobravirus Sequences Used in Species Specific Sequence Analysis

virus Genbank accession no. Size (bp) Analysis genome Pepper ringspot virus-CAM L23972 6828 RNA-1 Pea early-browing virus-SP5 X14006 7073 RNA-1

Table 3. Diagnostic Primers Designed from TRV Species Common Sequences

primer order SEQ ID NO: Length Position ^a Forward TRV-N10 GGCCGTGAAGAACAAGCAAAGTG One 23 1,459-1,481 TR-N11 GATTCTCGAGATTTACAGTTG 2 21 1,484-1,504 TRV-N20 CGCGGTCGAAAGGATGAGTGATTA 3 24 2,782-2,805 TR-N22 GTAAGTCGACAATGATTGTC 4 20 2,928-2,947 TRV-N30 AGCGGCTTACGACTTTGTTGAG 5 22 4,540-4,561 TRV-N40 TCGTGCCAGATCCGGTAAAAGTTC 6 24 4,998-5,021 TRV-N50 GTGTGCGGAAAATAATTGTGGATGG 7 25 6,233-6,257 Reverse TRV-C10 CCAAACGCCAATCTCAAACAGT 8 22 6,572-6,593 TRV-C20 CCGGGTTCAATTCCTTATCGTTTTC 9 25 5,246-5,270 TRV-C30 ACTTTTACCGGATCTGGCACGAAC 10 24 4,995-5,019 TRV-C40 TCCCGGAAACAAAGCGTCGTA 11 21 3,857-3,877 TR-C45 GAAGGAAAGTTATGTACTGAG 12 21 3,447-3,467 TRV-C50 CCGGCCTTTTTGGTAATCT 13 19 2,459-2,477 TRV-C60 TTGTACCGCTTGTTTCCCCTCTT 14 23 2,314-2,338 TR-C62 TGCTCCATGATCTCCTCATC 15 20 2,222-2,241

^a Location is Genbank accession no. Created based on AF314165.

Table 4. TRV Diagnostic Primer Combinations and RT-PCR Expected Products

Combination Reverse Position ^b Forward Position ^b Product (bp) One TRV-C10 6,572-6,593 TRV-N50 6,233-6,257 340 2 TRV-C20 5,246-5,270 TRV-N40 4,998-5,021 273 3 TRV-C20 5,246-5,270 TRV-N30 4,540-4,561 731 4 TRV-C30 4,995-5,019 TRV-N30 4,540-4,561 480 5 TRV-C40 3,857-3,877 TRV-N20 2,782-2,805 1,096 N ^a TR-C45 3,447-3,467 TR-N22 2,928-2,947 539 6 TRV-C50 2,459-2,477 TRV-N10 1,459-1,481 1,019 7 TRV-C60 2,314-2,338 TRV-N10 1,459-1,481 880 N ^a TR-C62 2,222-2,241 TR-N11 1,484-1,504 757

^a Nested primer combination.

^b Primer position is Genbank accession no. Created based on AF314165.

Example 2: TRV Diagnostic Primer Bank Construction and Selection of Optimal Primer Combinations

The designed TRV primers were selected in seven combinations (Table 4) to select the most effective primer combinations for diagnosis through RT-PCR assays with TRV and various related viruses. Selection of the optimal diagnostic primer combination consisted of three steps. The first is the selection by RT-PCR with TRV infected plants, the second is the analysis of nonspecific responses to bromoviride virus with taxonomic similarity, and the third is the infection of gourds and plants, TRV's natural host. Selection via RT-PCR analysis with virus.

Total RNA isolation and RT-PCR methods used in the present invention are as follows.

Total RNA isolation : Total RNA isolation kit (Prophenol), TRIzol (Invitrogen Co.), and easy-spin TM Total RNA Kit (iNtRON Co.) were commercially available.

RT-PCR : Reverse transcription reaction consists of 0.5 μl total RNA isolated, 12.5 pmole downstream primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM). DTT, pH 8.5) 5 μl of the reaction solution containing 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. . The polymerase chain reaction was carried out in 5 μl of reverse transcriptase and 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15). 2 μl of mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5X TBE buffer and 1.5% agarose gel followed by staining with ethidium bromide.

In the RT-PCR assay with TRV infected plants, TRV specific responses were confirmed in all seven primer combinations (FIG. 2). Among them, six primer combinations (combination 2, 3, 4, 5, 6, 7) were selected which were excellent in intensity of reaction and did not show nonspecific reactions that interfere with diagnosis.

The six primer combinations selected above finally selected two (combination 5, 7) primer combinations from RT-PCR analysis with 10 viruses associated with TRV host plants (FIG. 4). The 10 viruses used to analyze nonspecific responses with host-associated viruses are: Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Potato virus Y (PVY), Ribgrass mosaic virus (RMV), Tobacco mild green mosaic virus (TMGMV), Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV).

Based on these results, when diagnosing TRV from seeds or plants, RT-PCR is first performed using primer combinations 5 and 7 selected as optimal diagnostic primers. If this diagnosis is insufficient, verification can be made using a combination of other primers from the TRV diagnostic primer bank.

Example 3: Example of Diagnosis and Verification of TRV

At the test site, the first diagnosis is performed using Combination 5 and Combination 7 as optimal primers for TRV diagnosis. If the assay of the primary RT-PCR test result is necessary, i.e. to confirm that the RT-PCR product is a result derived from TRV, a PCR test is performed using the assayed primer for this primer combination. At this time, if the RT-PCR reaction result is derived from TRV, the assay shows a positive reaction in PCR (FIG. 4). In addition, a positive control was prepared containing the entire region in which the primers were designed to easily identify PCR products derived from such TRV primer banks of the present invention. This positive control can be used as a positive control in the PCR test (Fig. 5), and also to determine the base sequence of the inserted region of the positive control plasmid in order to easily compare the nucleotide sequence of the PCR product to be identified (Fig. 6). , FIG. 7).

When the diagnostic method of the present invention is carried out, it is possible to precisely diagnose TRV infection from seeds or plants of eggplant family. It is also possible to industrialize RT-PCR diagnostic kits for plant viruses. By implementing the present invention will be able to minimize the damage of TRV in domestic gourds and crops, it can be easily utilized at the border quarantine site can effectively block the influx of eggplant and plant seeds infected with TRV from foreign countries.

1 shows the TRV primer position. The location is Genbank accession no. It was written based on AF314165.

2 assays for specificity with TRV of seven primer combinations. Total RNA extracted from tobacco leaf tissues infected with TRV as RT-PCR template was used, see Table 4 for 1-7 primer combinations.

Figure 3 shows the results of RT-PCR analysis of the selected TRV primer combination and host-associated virus. 1: TRV, 2: AMV, 3: ArMV, 4: CMV, 5: PepMoV, 6: PVY, 7: RMV, 8: TMGMV, 9: TMV, 10: ToMV, 11: TSWV.

4 shows the results of (RT) PCR analysis of the optimal primer combination for TRV diagnosis and the primer combination for assay.

M: size marker

1: Optimal diagnostic primer combination 5 (1,096bp)

2: primer combination for assay for combination 5 (TR-C45 / N22) (539 bp)

3: Optimal diagnostic primer combination 7 (880bp)

4: primer combination for assay for combination 7 (TR-C62 / N11) (757 bp)

Figure 5 shows the PCR product of diagnostic primer combinations derived from TRV positive control.

M: size marker

1: TRV DNA fragment (1,019 bp) inserted into the positive control (TRV-H)

2: diagnostic primer combination 7 (880 bp)

3: TRV DNA fragment (2,489bp) inserted into the positive control (TRV-T)

4: diagnostic primer combination 5 (1,096 bp)

Figure 6 shows the TRV sequence (2,489bp) inserted into the positive control (TRV-T).

Figure 7 shows the TRV sequence (1,019bp) inserted into the positive control (TRV-H).

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer combination for diagnosing Tobacco rattle virus and uses          the <130> PN08263 <160> 17 <170> Kopatentin 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TRV-N10 primer <400> 1 ggccgtgaag aacaagcaaa gtg 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TR-N11 primer <400> 2 gattctcgag atttacagtt g 21 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TRV-N20 primer <400> 3 cgcggtcgaa aggatgagtg atta 24 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TR-N22 primer <400> 4 gtaagtcgac aatgattgtc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRV-N30 primer <400> 5 agcggcttac gactttgttg ag 22 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TRV-N40 primer <400> 6 tcgtgccaga tccggtaaaa gttc 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TRV-N50 primer <400> 7 gtgtgcggaa aataattgtg gatgg 25 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRV-C10 primer <400> 8 ccaaacgcca atctcaaaca gt 22 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TRV-C20 primer <400> 9 ccgggttcaa ttccttatcg ttttc 25 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TRV-C30 primer <400> 10 acttttaccg gatctggcac gaac 24 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TRV-C40 primer <400> 11 tcccggaaac aaagcgtcgt a 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TR-C45 primer <400> 12 gaaggaaagt tatgtactga g 21 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TRV-C50 primer <400> 13 ccggcctttt tggtaatct 19 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TRV-C60 primer <400> 14 ttgtaccgct tgtttcccct ctt 23 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TR-C62 primer <400> 15 tgctccatga tctcctcatc 20 <210> 16 <211> 2489 <212> DNA <213> Tobacco rattle virus <400> 16 cgcggtcgaa aggatgagtg attatgtcat agtatgcgat cagacttatc tttgcaataa 60 caggttgatc ttggacaact taagtgccct agatctagga ccggtcgact gttcttttga 120 attagtcgat ggtgtacctg gttgtggtaa gtcgacaatg attgtcaact cagctaatcc 180 ttgcgtcgat gtggttcttt ctactggaag agccgcaacc gacgacttga tcgagagatt 240 tgcgagcaaa ggttttccat gcaagttaaa gcggagagtg aagacggtag actccttttt 300 gatgcattgc gtcgacggtt ctttgaccgg agacgtgttg cattttgatg aagcactaat 360 ggctcatgct ggtatggttt acttttgcgc tcaaattgct agagcaaaga gatgtatctg 420 tcaaggggat caaaaccaaa tttccttcaa acctagagtg tctcaagttg acttgaggtt 480 ctcgagttta gtcggaaagt ttgatgttgt tactgaaaag agagagacgt acagaagtcc 540 ggccgatgtg gccgcagtac tgaataagtt ctacactgga gatgtcagaa cacataatgc 600 aactgctaat tcaatgacag taaggaagat tgtgtcgaag gaacaggttt ctttgaagcc 660 tggtgcccaa tacataactt tccttcaatc tgagaagaaa gagttgatga atttgttggc 720 attgaggaag gtggcggcta aggtgagcac agtgcacgag tctcaagggg aaacattcaa 780 agatgtggtc ctagttagga ctaaacctac agatgattca attgctagag gacgtgaata 840 tatgatcgtg gcactgtcgc gtcacacaca atcgcttgtg tacgagacgg taaaggagga 900 tgatgtgagc aaagaaatca gagaaagtgc tgcgcttaca aaggcggctt tggcaagatt 960 tttcgtcaca gaaaccgtct tatgacggtt tcggtctagg tttgatgtct tcagacatca 1020 tgaagggcct tgcgctgtcc cagattcagg tacgattacg gacttggaaa tgtggtacga 1080 cgctttgttt cctggaaatt cattgagaga ctcaagccta gacgggtatc tggtggcaac 1140 gactgactgc aacctgcggt tagacaatgt tacaatcaaa agtggaaatt ggaaagacaa 1200 gtttgtggaa aatgaaacgt ttctgaaacc ggttattcgt actgcgatgc ctgacaaaag 1260 gaaaactact cagttggaga gtttgttggc gttgcagaaa aggaaccaag cagcacctga 1320 tctgcaagag aatgtgcatg cgacagttct gatcgaagag acgatgaaga agctgaaatc 1380 tgttgtctac gatgtgggga agattcgggc tgatcccatt gttaacaggg ctcaaatgga 1440 gagatggtgg cggaaccaaa gcacagcggt tcaggctaag gtagtagcag atgtgcgaga 1500 attacatgag attgactatt cgtcttacat gtacatgatc aagtctgatg tgaaacccaa 1560 gactgacctg acacctcaat ttgaatattc ggctttgcag actgttgtgt atcatgagaa 1620 gttgattaac tcgttgtttg gtccaatttt caaagagatc aacgaacgca agttggatgc 1680 tatgcaacca cactttgtgt tcaacacaag gatgacatcg agtgacttaa acgatcgagt 1740 gaaattttta aacacagagg cggcttacga ctttgtcgaa atagacatgt ctaaattcga 1800 caagtcggca aatcgtttcc atttacagtt gcagttggag atttacaggt tgtttgggtt 1860 agatgagtgg gcggctttcc tttgggaggt gtcgcacact caaactactg tgagagacat 1920 tcaaaacggc atgatggcac atatctggta ccaacaaaaa agtggagatg ctgatactta 1980 taacgctaat tccgatagga ctctgtgtgc gcttctgtct gagttaccac tagagaaagc 2040 agtcatggtt acatatggtg gagatgattc gttgatcgca tttccaaggg gaacgcaatt 2100 caccgaccca tgtccaaagt tggctactaa gtggaatttt gagtgcaaga tttttaagta 2160 cgacgtccca atgttctgcg ggaagttttt gcttaaaacg tcgtcatgtt acgagtttgt 2220 gccagaccct gttaaagttc tgacaaagtt ggggaagaag agcataaagg acgtgcaaca 2280 tttagctgag atttatatct cactgaacga ttccaataga gctcttggga actacatggt 2340 agtgtccaaa ctttccgaat ctgtttcaga ccggtatttg tacaaaggtg attctgtcca 2400 tgcgctgtgt gcgctatgga agcatattaa gagttttaca gctctgtgta cattattccg 2460 agacgaaaac gataaggaat tgaacccgg 2489 <210> 17 <211> 1019 <212> DNA <213> Tobacco rattle virus <400> 17 ggccgtgaag aacaagcaaa gtgtagattc tcgagattta cagttgttgg ctcaaacttt 60 gctggtgaag gaacaagtgg cgagacctgt catgagggag ttgcgtgagg caattctgac 120 tgaaacgaaa cctatcacgt cattgactga cgtgctaggt ttaatatcaa gaaaactgtg 180 gaaacagttt gctaacaaga ttgcagtcgg cggatttgtt ggtatggttg gtactctaat 240 tggattctat ccaaggaagg tattgacttg ggcgaaggac acaacaaatg gtccagaact 300 gagttacgag aactcgcaca aaaccaaggt gatagtattt ttgagtgttg tgtatgccat 360 tggagggatc acgcttatgc gtcgagacat ccgagatgga ctggtgaaaa aactatgtga 420 tatgtttgat attaaacggg gggcccatgt cttagatgtt gagaatccgt gccgctatta 480 cgaaatcaat gatttcttta gcagtctgta ttcggcatct gagtccggtg agaccgtttt 540 accagattta tccgaggtaa aagccaagtc tgataagcta ttgcagcaga agaaagaaat 600 cgctgatgag tttcttagtg caaaattttc taactattct ggcagttcag tgagaacttc 660 cccgccatcg gtggtcggtt catctagaag cggactgggt ttgctgttgg aagacagtaa 720 cgtactaacc caagctagag ttggagtttc aagaaaagta gacgatgagg agatcatgga 780 gcagtttctg agtggtctta ttgacactga agtggagatt gacgagattg tttcggcctt 840 ttcggctgaa tgtgaaagag gggaaacaag cggtacaaag gtgttgtgca agcctttaac 900 accaccagga tttgagaacg tgttaccaac tgtcaaacct ttggttaaca agggtaaaac 960 ggtcaaacgt gtcgattact tccaagtgat gggaggtgaa agattaccaa aaaggccgg 1019  

Claims (8)

delete Primer combinations of SEQ ID NOs: 3 and 11; And one or more selected from the group consisting of primer combinations of SEQ ID NOs: 1 and 14. TRV species specific diagnostic primer combinations. The method of claim 2, further comprising: a primer combination of SEQ ID NOs: 3 and 11; And a combination of primers of SEQ ID NO: 1 and 14 for TRV species specific diagnostic primers. The method of claim 2, further comprising: a primer combination of SEQ ID NOs: 4 and 12; And one or more selected from the group consisting of primer combinations of SEQ ID NOs: 2 and 15. TRV species specific diagnostic primer combinations. A primer combination according to any one of claims 2 to 4; And DNA fragment having a nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 17, TRV species specific diagnostic kit. Separating total RNA from plant samples; Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using a primer combination according to any one of claims 2 to 4; And Detecting the amplification product. 7. The method of claim 6, wherein the plant is a branch plant, bulb or weed. The method of claim 6, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images