KR101093235B1 - Specific primers for detection of Garlic latent virus, and uses thereof - Google Patents

Abstract

The present invention provides a GLV diagnostic primer set including at least one primer set selected from the primers represented by SEQ ID NOS: 1 to 7, a GLV diagnostic kit including the primer set, and species-specific diagnosis of GLV using the primer set. It is about a method.

The diagnostic method of the present invention diagnoses GLV (SLV) generated in garlic, which has not been possible in the diagnostic methods used, and has the highest detection limit at the same time. This diagnostic can be used to produce garlic virus free bottles.

Garlic, shallot, virus, diagnostic, RT-PCR, GLV, SLV

Description

Specific primers for detection of Garlic latent virus, and uses according to

The present invention relates to a species-specific primer and its use for diagnosing virus GLV (SLV) occurring in garlic, and more specifically, Garlic ( Shallot ) latent virus , GLV ( SLV)) relates to a primer set consisting of primers and combinations thereof capable of species-specific diagnosis.

For the diagnosis of garlic virus, electron microscopy and serological methods (ELISA) were used in the past. However, because filamentous viruses present in garlic exist in many species that are hard to distinguish from each other, species cannot be diagnosed by electron microscopy.

On the other hand, serological methods have been useful for the diagnosis of garlic virus, but garlic is naturally infected with many viruses, so it is difficult to accurately diagnose garlic virus with one or several antisera. In addition, the anti-serum production of the virus has a problem that it is very difficult to secure the pure garlic virus and garlic not infected with the virus. In addition, some viruses occurring in garlic are difficult to distinguish species by serological methods due to the non-specific reaction due to the classification similarity, and the detection limit is about 1000 times lower than that of molecular biological methods.

The most commonly used RT-PCR method among molecular biological diagnostics is the use of species specific primers. However, many of the primers published in this paper are difficult to use for the diagnosis of all garlic potential virus strains because they are selected without a taxonomic system (Tsuneyoshi et al., 1998. Arch Virol 143: 1093-1107 Chen et al., 2001. Arch Virol 146: 1841-1853; Chen et al. 2004. Arch Virol 149: 435-445).

Korean Patent Registration No. 10-0578000 discloses a primer set for diagnosing onion yellow atrophy virus of garlic and a method for diagnosing onion yellow atrophy virus using the same, but different from the primer set of the present invention.

The present invention has been made according to the above requirements, and since most garlics in the natural state are complexly infected with filamentous viruses that are difficult to distinguish from each other, electron microscopy and serological methods can be used to diagnose all infected viruses. Is impossible. In addition, since the virus occurring in garlic has a lot of tinnitus in the taxonomy, it is necessary to clearly classify the species by molecular biological methods. On the other hand, since there are significant variations between species (isolate) within the species (isolate) to develop a diagnostic primer that can overcome these variations.

In order to solve the above problems, the present invention provides a GLV diagnostic primer set comprising one or more primer sets selected from the primers represented by SEQ ID NOs: 1 to 7.

The present invention also provides a GLV diagnostic kit comprising the primer set.

The present invention also provides a method for species-specific diagnosis of GLV using the primer set.

According to the present invention, RT-PCR diagnosis using a specific primer for garlic latent virus (GLV) diagnosis can react with all strains of garlic latent virus (GLV) known so far, and the detection limit is more than 1,000 times that of the conventional antiserum-based diagnostic method. Have In addition, the new garlic market could be pioneered by industrializing the plant virus RT-PCR diagnostic kit and producing differentiated quality garlic through the production of garlic-free bottles.

In order to achieve the object of the present invention, the present invention provides a GLV diagnostic primer set comprising at least one primer set selected from the primers represented by SEQ ID NOs: 1-7.

In the GLV (SLV) diagnostic primer set of the present invention, the forward primer is selected from the group consisting of the primers of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7, and the reverse primer is SEQ ID NO: 2, SEQ ID NO: 4 and It may be selected from the group consisting of the primer of SEQ ID NO: 6. However, in the primer set of the present invention, the forward primer should be located on the 5 'side rather than the reverse primer.

The GLV (SLV) diagnostic primer set of the present invention is preferably a primer set of SEQ ID NOs: 1 and 2; Primer sets of SEQ ID NOs: 3 and 4; Primer sets of SEQ ID NOs: 5 and 6; And it may be selected from the group consisting of primer sets of SEQ ID NO: 7 and 6.

The GLV (SLV) diagnostic primer set of the present invention is more preferably a primer set of SEQ ID NOS: 1 and 2; Primer sets of SEQ ID NOs: 3 and 4; Primer sets of SEQ ID NOs: 5 and 6; And primer sets of SEQ ID NOs: 7 and 6.

Simultaneous diagnosis of GLV (SLV) can be achieved by using four primer sets simultaneously.

The primers may be at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 in the sequence of SEQ ID NO: 1 to SEQ ID NO: 7, depending on the sequence length of each primer. Oligonucleotides consisting of at least 24, segments of at least 24 contiguous nucleotides. For example, the primers of SEQ ID NO: 1 (23 oligonucleotides) are at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive in the sequence of SEQ ID NO: 1 And oligonucleotides consisting of fragments of nucleotides, wherein the primers of SEQ ID NO: 7 (25 oligonucleotides) are at least 16, at least 17, at least 18, at least 19, at least 20 within the sequence of SEQ ID NO: 7 , Oligonucleotides consisting of at least 21, at least 22, at least 23, at least 24 consecutive nucleotide segments.

In the present invention, all genetic information about viruses occurring in garlic was collected and the classification system was established using the nucleotide sequence of the envelope protein gene. Based on this classification system, we have developed a diagnostic primer specific for garlic (shallot) latent virus species occurring in domestic garlic.

Although many studies have been conducted on plant viruses occurring in garlic, it is difficult to diagnose them because the taxonomic system of these viruses is not established. To this end, they were systematically analyzed through their coat protein sequencing (FIG. 1) to establish the classification system of major viruses occurring in garlic, and to establish a diagnosis system for these viruses.

Within virus species, there are lines or isolates with slightly different sequences. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus. Primers in the present invention are designed to work species specific. In other words, the nucleotide sequences known to date are collected within the species to search for common nucleotide sequences of all strains and isolates. Then, species-specific sequences were selected by excluding base sequences possessed by other viruses with a flexible relationship among the common sequences. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual reverse transcriptase-polymerase chain reaction (RT-PCR) for each combination and did not have a nonspecific reaction with nucleic acids other than the target virus, and finally selected a combination having excellent sensitivity to the target virus.

Garlic is cultivated in Korea, four kinds of genus 1 virus (GLV, LYSV, GCLV, OYDV and Allexivirus) cause most of the disease. Among them, species-specific diagnostic primers were developed for garlic latent virus (GLV).

In the context of the present invention, GLV is used interchangeably with SLV.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

At least one primer set according to the present invention; And a reagent necessary for RT-PCR. In the kit of the present invention, the reagents required for the RT-PCR may be, for example, but not limited to, a forward primer and a reverse primer, a reverse transcriptase, a ribonuclease inhibitor, a heat resistant polymerase, a reaction buffer, and the like, and a reaction buffer Silver includes both reverse transcriptase and PCR buffer, and heat resistant polymerase may be EF Taq polymerase and the like, and reverse transcriptase is a reverse transcriptase originating from various sources, for example, avian myeloblastosis virus-derived reverse transcriptase. (avian myeloblastosis virus-derived virus reverse transcriptase (AMV RTase)), mouse leukemia virus-derived virus reverse transcriptase (MuLV RTase) and Rouse-associated virus 2 reverse transcriptase 2 reverse transcriptase (RAV-2 RTase).

The kit may also include instructions. The guide is a printed document that explains how to use the kit, such as how to prepare reverse transcription buffer and PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

In order to achieve another object of the present invention, the present invention

Separating total RNA from garlic samples;

Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using at least one primer set according to the present invention; And

It provides a method for species-specific diagnosis of GLV, comprising detecting the amplification product.

As a method for separating total RNA from garlic samples, a method known in the art may be used, for example, a phenol extraction method may be used. Using the isolated whole RNA as a template, one or more primer sets according to an embodiment of the present invention may be used as a primer to amplify a target sequence by performing RT-PCR. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, so that the target sequence can be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example

Example 1 Design, Selection and Specificity of GLV (SLV) Diagnostic Primer

The GLV consensus sequence search was made by multiple comparisons of the nucleotide sequences of 26 GLV isolates known to date (Table 1).

Table 1. GLV Isolation Sequences Used for Common Sequence Analysis

Separation Gene source Gene size (bp) SLV-LI-3C1 AB004803 946 SLV-SI-4C2 AB004802 1032 SLV-GC-2 AB004457 1379 SLV-CLC-1 AB004456 1292 SLV AB004454 1378 GLV-YH1 NC003557 8363 GLV-Wonju Z68502 8353 GLV D11161 3468 GLV-YH3 AJ292228 2978 GLV-YH2 AJ292227 1810 GLV-js Nanjing AJ409315 1909 GLV-sd Jinxiang AJ409316 1809 GLV-Xixia AJ307034 1808 GLV-bj Beijing AJ310199 1808 GLV-yn1 Yunnan AJ409317 1808 GLV-yn2 Yunnan AJ409318 1808 GLV-yn3 Yunnan AJ409319 1808 GLV-hub Wuhan AJ409314 1807 GLV-M77SEQLAST D73379 1644 GLV-RC-1 AB004565 1301 GLV-CLC-1 AB004458 1300 GLV-GNAB-9C2 AB004567 1033 GLV-CI-3C2 AB004686 1032 GLV-GCHI-3C1 AB004684 946 GLV-GUAE-13C1 AB004685 946 GLV AF314147 885

The selected common sequences were searched for species specific sequences compared to 9 viral sequences of Carlaviridae (Table 2), which are taxonomically similar to GLV.

Table 2. Nine Caravirus Genes Used to Find Species Specific Sequences

Caravirus Sequence Gene size (bp) Galric common latent virus X81138 1771 Hop latent virus NC002552 8612 Potato virus M NC001361 8533 Potato virus S NC007289 8478 Cowpea mild mottle virus AF024629 2511 Pea streak virus AF354652 2658 Blueberry scorch virus L25658 8512 Lily symptomless virus AJ516059 8394 Poplar mosaic virus X65102 8737

Of these species specific nucleotide sequences, eight diagnostic primers satisfying primer conditions were designed (Table 3).

Table 3. Designed GLV Diagnostic Primers

primer Sequence Length location ^a GL-N10 ATGCCTCTAAGTCCTCCGCCTGA (SEQ ID NO: 1) 23 6554-6576 GL-N20 TGCCACACGTCGGGGATAA (SEQ ID NO: 3) 19 6654-6672 GL-N25 CCTTTTGGTTCACTTTAGGTTTACA (SEQ ID NO: 5) 25 7043-7067 GL-N30 TATGGCTAACGAAGAAGAAGAACTC (SEQ ID NO: 7) 25 7084-7108 GL-C40 CGCTGTGTACCTAAAGTGAACCAAA (SEQ ID NO: 4) 25 7046-7070 GL-C30 TATTGAGTTCTTCTTCTTCGTTAGC (SEQ ID NO: 2) 25 7088-7122 GL-C20 TCTCCTTAAGTTTGTTGAACCT (SEQ ID NO: 8) 22 7235-7256 GL-C10 CGTTCACGCTAGACAATTCAGACAT (SEQ ID NO: 6) 25 7262-7286

^a Primer position is based on GLV-Wonju (Z68502).

The designed primer is shown in FIG. 2. The designed GLV primers were combined in 16 (Table 4), and RT-PCR was performed (FIG. 3).

Table 4. GLV Primer Combinations and RT-PCR Products

Combination primer Product size (bp) One GL-N10 GL-C40 517 2 GL-N10 GL-C30 559 3 GL-N10 GL-C20 703 4 GL-N10 GL-C10 733 5 GL-N10 GL-C05 1546 6 GL-N20 GL-C40 417 7 GL-N20 GL-C30 459 8 GL-N20 GL-C20 603 9 GL-N20 GL-C10 633 10 GL-N20 GL-C05 1446 11 GL-N25 GL-C20 214 12 GL-N25 GL-C10 244 13 GL-N25 GL-C05 1057 14 GL-N30 GL-C20 173 15 GL-N30 GL-C10 203 16 GL-N30 GL-C05 1016

GLV used for species-specific primer selection was used as RT-PCR template by separating the whole RNA from the leaves showing mosaic symptoms from naturally infected garlic. Total RNA isolation and RT-PCR methods used in the present invention are as follows.

Total RNA Isolation: Total RNA was isolated from 50 mg of virus infected leaf tissue using phenol. The isolated total RNA was finally washed three times with 75% ethanol, dried, dissolved in 50 μl of distilled water and used for RT-PCR analysis.

RT-PCR: Reverse transcription reaction consists of 0.5 μl total RNA isolated, 12.5 pmole reverse primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT) , pH 8.5) 1 μl, 0.5 μl of 10 mM dNTP, 10 U RNase inhibitor, and 5 μl of the reaction solution containing 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out in 5 μl of reverse transcription reaction with 12.5 pmole forward primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 2 μl of 15 mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds, and finally treated at 72 ° C for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5X TBE buffer and 1.5% agarose gel followed by staining with ethidium bromide.

RT-PCR was performed on the first selected primer pairs with other Caraviruses and viruses occurring in garlic (FIG. 4), and finally, 7 diagnostic primers and 4 primer pairs using the same were selected. Table 5).

Table 5. Final Selected GLV (SLV) Species Specific Primer Combinations

Combination Forward primer Reverse primer Product size (bp) 2 GL-N10 GL-C30 559 6 GL-N20 GL-C40 417 12 GL-N25 GL-C10 244 15 GL-N30 GL-C10 203

As can be seen in Figure 4, it can be seen that the four primer sets of the present invention can specifically detect or diagnose GLV.

When the diagnostic method of the present invention is carried out, industrialization of the RT-PCR diagnostic kit for garlic virus is possible first, and by using this diagnostic method, it is possible to produce disease-free garlic that is not infected with the virus. It is expected to be very large.

Figure 1 shows the establishment of the taxonomic system of viruses occurring in garlic using the envelope protein gene sequence. Isolators shown in red are domestic isolates.

2 shows the designed GLV primer position.

3 shows the RT-PCR results of 16 primer pairs in combination with GLV. Lanes 1 to 16 represent the GLV primer combinations 1 to 16 described in Table 4, respectively.

Figure 4 shows the RT-PCR results with other Carlavirus, garlic generating virus of the final selected garlic potential virus (GLV) primer combination.

A: LYSV (Leek yellow stripe virus)

B: GCLV (Garlic common latent virus)

C: OYDV (Onion yellow dwarf virus)

D: Allexivurs (Alexi virus)

PepMOV (Pepper mottle virus)

TBRV (Tomato black ring virus)

PVY (Potato virus Y)

CPMMV (Cowpea mild mottle virus)

PopMV (Poplar mosaic virus)

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Specific primers for detection of Garlic latent virus, and uses          the <130> PN08151A <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GL-N10 primer <400> 1 atgcctctaa gtcctccgcc tga 23 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GL-C30 primer <400> 2 tattgagttc ttcttcttcg ttagc 25 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GL-N20 primer <400> 3 tgccacacgt cggggataa 19 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GL-C40 primer <400> 4 cgctgtgtac ctaaagtgaa ccaaa 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GL-N25 primer <400> 5 ccttttggtt cactttaggt ttaca 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GL-C10 primer <400> 6 cgttcacgct agacaattca gacat 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GL-N30 primer <400> 7 tatggctaac gaagaagaag aactc 25 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GL-C20 primer <400> 8 tctccttaag tttgttgaac ct 22  

Claims (6)

delete delete Primer sets of SEQ ID NOs: 1 and 2; Primer sets of SEQ ID NOs: 5 and 6; And Garlic latent virus (GLV) species specific diagnostic primer set comprising a primer set of SEQ ID NO: 7 and 6. A primer set according to claim 3; And Garlic latent virus (GLV) species specific diagnostic kit, comprising a reagent required for RT-PCR. Separating total RNA from garlic samples; Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using the primer set according to claim 3; And A method for species-specific diagnosis of a Garlic latent virus (GLV), comprising detecting the amplification product. The method of claim 5, wherein the detection of the amplification product is carried out by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images