CN110964850B - Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene - Google Patents
Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene Download PDFInfo
- Publication number
- CN110964850B CN110964850B CN201911195097.5A CN201911195097A CN110964850B CN 110964850 B CN110964850 B CN 110964850B CN 201911195097 A CN201911195097 A CN 201911195097A CN 110964850 B CN110964850 B CN 110964850B
- Authority
- CN
- China
- Prior art keywords
- mosaic virus
- morinda officinalis
- detecting
- morinda
- ribosomal rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses identification of morinda officinalis mosaic virus, a ribosomal RNA gene of the morinda officinalis mosaic virus and application of the morinda officinalis mosaic virus. The morinda officinalis mosaic virus is separated and identified for the first time, the nucleotide sequence of the ribosome RNA gene of the morinda officinalis mosaic virus is obtained, the gene can be used for detecting the morinda officinalis mosaic virus, a primer capable of specifically detecting the morinda officinalis mosaic virus is designed, a method for detecting the morinda officinalis mosaic virus and a detection kit are further constructed, the method and the kit are simple and rapid to operate, the detection result is accurate and reliable, technical support is provided for rapid detection of the morinda officinalis mosaic virus, particularly inspection and quarantine work, and the method and the kit have important significance for monitoring and controlling related diseases caused by the morinda officinalis mosaic virus.
Description
Technical Field
The invention belongs to the field of biotechnology. More particularly, the invention relates to identification of morinda officinalis mosaic virus, a ribosomal RNA gene of the morinda officinalis mosaic virus and application of the morinda officinalis mosaic virus.
Background
Morinda officinalis (Morinda officinalis How) is a perennial plant of Morinda (Morinda) of Rubiaceae (Rubiaceae), is one of the four famous south-south Chinese medicines, and has the effects of tonifying liver and kidney and strengthening bones and muscles. In recent years, with the development of the health care industry of traditional Chinese medicine, morinda officinalis has been increasingly regarded as a traditional tonifying traditional Chinese medicine. Modern pharmacological research shows that morinda officinalis has the effects of resisting depression, improving memory, improving reproductive function, resisting stress and the like. The main propagation mode of morinda officinalis is cutting propagation and perennial plants, which create conditions for the occurrence and spread of diseases. The virus is accumulated in the plant body along with the asexual propagation generation by generation, and the yield and the quality of the morinda officinalis are seriously influenced. Therefore, detection of morinda citrifolia infected virus is especially important for early detection.
The existing plant virus detection methods mainly comprise biological detection methods, electron microscopy detection methods, serological detection methods, molecular biological detection methods and the like. The traditional biological detection is mainly used for detecting viruses which can cause serious diseases of crops and cannot be suitable for detecting plant viruses with light symptoms, no symptoms and low virus content. The method for detecting the plant virus in the molecular biology has incomparable advantages compared with the traditional detection method due to high sensitivity, good specificity and the like. However, the conventional molecular biological detection is based on the conventional molecular biological technology, and the important premise is that the biological characteristics, the genomic characteristics and the like of the virus are known in advance to a certain extent, and when the knowledge of unknown pathogens is extremely limited or completely lacked, the use of the detection methods is greatly limited.
At present, no reports related to the related pathogen and detection means of morinda officinalis mosaic disease exist. Therefore, the research on identification and detection of morinda officinalis infected virus has important significance for monitoring and controlling morinda officinalis mosaic disease.
Disclosure of Invention
The invention aims to solve the technical problem of overcoming the blank of the existing morinda officinalis mosaic virus detection technology and provides identification of morinda officinalis mosaic virus, a ribosomal RNA gene and application of the morinda officinalis mosaic virus.
The invention aims to provide a ribosomal RNA gene of morinda officinalis mosaic virus.
The invention also aims to provide application of the ribosomal RNA gene in detecting morinda officinalis mosaic virus and/or preparing a product for detecting morinda officinalis mosaic virus.
It is still another object of the present invention to provide a set of primers for detecting morinda citrifolia mosaic virus.
The invention also aims to provide application of the primer in detecting morinda officinalis mosaic virus and/or preparing a kit for detecting morinda officinalis mosaic virus.
It is still another object of the present invention to provide a method for detecting morinda citrifolia mosaic virus.
The invention also aims to provide a kit for detecting morinda officinalis mosaic virus.
The invention further aims to provide application of the method or the kit in detection of the morinda officinalis mosaic virus.
The above purpose of the invention is realized by the following technical scheme:
the invention firstly provides a ribosomal RNA gene of morinda officinalis mosaic virus, and the nucleotide sequence of the ribosomal RNA gene is shown as SEQ ID No. 1.
The ribosome RNA gene consists of an RNA1 gene, an RNA2 gene and an RNA3 gene, the total length of the sequence is 8765bp, and the nucleotide sequence of the RNA1 gene is shown as the base sequence 1-3421 in the sequence shown in SEQ ID NO. 1; the nucleotide sequence of the RNA2 gene is shown as the 3422 th-6500 th base sequence in the sequence shown in SEQ ID NO. 1; the nucleotide sequence of the RNA3 gene is shown as 6501-8765 base sequence in the sequence shown in SEQ ID NO. 1.
The application of the ribosomal RNA gene in detecting morinda officinalis mosaic virus and/or preparing a product for detecting morinda officinalis mosaic virus also belongs to the protection scope of the invention.
In addition, the invention also provides a group of primers for detecting the morinda officinalis mosaic virus, and the primers can amplify the sequence shown in SEQ ID NO.1 or the fragment thereof.
Preferably, the primer is a primer group F1/R1, a primer group F2/R2 or a primer group F3/R3, and the nucleotide sequences of the primers are respectively shown as SEQ ID NO. 2-SEQ ID NO. 7.
Nucleotide sequence of primer F1 (SEQ ID NO. 2): ATTCACTTCTCCACGGGTCG, respectively;
nucleotide sequence of primer R1 (SEQ ID NO. 3): TCAACCAGAACCCTACTAACA, respectively;
nucleotide sequence of primer F2 (SEQ ID NO. 4): TTGAACCACCGCCTATCTGT, respectively;
nucleotide sequence of primer R2 (SEQ ID NO. 5): GCCACAGCCTTACTCAACCT, respectively;
nucleotide sequence of primer F3 (SEQ ID NO. 6): TAACCCACGGTCGTATTGCT, respectively;
nucleotide sequence of primer R3 (SEQ ID NO. 7): CTAATACGCAACGAAATCACT are provided.
The application of the primer in detecting morinda officinalis mosaic virus and/or preparing a kit for detecting morinda officinalis mosaic virus also belongs to the protection scope of the invention.
The invention also provides a method for detecting the morinda officinalis mosaic virus, which is to detect whether the ribosomal RNA gene exists in the nucleic acid of a sample to be detected, and if so, the sample to be detected is positive to the morinda officinalis mosaic virus.
Preferably, the method for detecting morinda officinalis mosaic virus comprises the following steps: and (3) taking the nucleic acid of the sample to be detected as a template, and carrying out PCR amplification reaction by using the primer, wherein if the amplification result is positive, the sample to be detected is positive for the morinda officinalis mosaic virus.
In addition, the invention also provides a kit for detecting the morinda officinalis mosaic virus, and the kit comprises the primer.
The application of the method or the kit in detecting the morinda officinalis mosaic virus also belongs to the protection scope of the invention.
The invention has the following beneficial effects:
the morinda officinalis mosaic virus is separated and identified for the first time, and the nucleotide sequence of the ribosomal RNA gene of the morinda officinalis mosaic virus is obtained, so that the morinda officinalis mosaic virus can be applied to detection and monitoring of the morinda officinalis mosaic virus.
Meanwhile, primers capable of specifically detecting the morinda officinalis mosaic virus are designed by using the morinda officinalis mosaic virus ribosomal RNA gene, so that whether a sample to be detected is infected by the morinda officinalis mosaic virus can be accurately and quickly detected; based on the primers, the invention also provides a method for detecting the morinda officinalis mosaic virus and a detection kit, wherein the method and the kit are simple and rapid to operate, the detection result is accurate and reliable, technical support is provided for rapid detection of the morinda officinalis mosaic virus, particularly inspection and quarantine work, the method and the kit have important significance for monitoring and controlling related diseases caused by the morinda officinalis mosaic virus, and have very wide popularization and application prospects.
Drawings
FIG. 1 is a graph showing the results of cluster analysis of Morinda citrifolia mosaic virus and cucumber mosaic virus.
FIG. 2 is a graph showing the results of specific primers used to detect Morinda citrifolia mosaic virus.
Detailed Description
The present invention is further illustrated by the following specific examples, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Example 1 acquisition of ribosomal RNA Gene of Morinda citrifolia mosaic Virus
1. Experimental methods
The method for obtaining the ribosomal RNA gene of the morinda officinalis mosaic virus comprises the following specific steps:
s1, collecting diseased leaves of morinda officinalis;
s2, extracting total RNA of diseased morinda officinalis leaves;
s3, construction of a ribosomal RNA library: according to the construction process of the high-throughput sequencing library, the total RNA is constructed into a double-end high-throughput sequencing library with the fragment size of 500 bp;
s4, high-throughput sequencing;
s5, assembling sequence tags: adopting SPAdes v.3.5.0 software to assemble sequence tags, assembling sequencing fragments into contig sequences according to overlap (overlapping region) relation among short sequencing fragments, further assembling the contig sequences into scaffold sequences by combining the distance relation among double-end sequencing fragments on the basis of the contig sequences, and repairing vacant regions contained in the scaffold sequences by a gap supplementing strategy after the scaffold sequences are assembled to obtain the sequence tag sequences as complete as possible;
s6, sequence label annotation, diversity analysis and quantitative analysis: respectively comparing and analyzing the sequencing sequence tags with a bacterial library, a fungal library and a virus library of an nt database of NCBI, and performing comparison and analysis by adopting blastn v2.5.0+ software;
s7, screening suspected pathogens: detecting potential pathogens conforming to the disease symptoms according to the annotation information of the sequence tags, the retrieval information of the pathogen database and the report information of related documents, and carrying out primary judgment according to the sequence detection abundance;
generally, a certain amount of pathogen is needed to cause the host to be diseased, so the suspected pathogen is detected together according to the consistency of the related diseases of the suspected pathogen and the detection abundance of the pathogen.
2. Results of the experiment
The nucleotide sequence of the ribosome RNA gene of the morinda officinalis mosaic virus is shown as SEQ ID No.1, the ribosome RNA gene consists of RNA1 gene, RNA2 gene and RNA3 gene, the total sequence length is 8765bp, and the nucleotide sequence of the RNA1 gene is shown as the base sequence 1-3473 in the sequence shown as SEQ ID No. 1; the nucleotide sequence of the RNA2 gene is shown as the 3474 th-6551 th base sequence in the sequence shown in SEQ ID NO. 1; the nucleotide sequence of the RNA3 gene is shown as 6552-8806 base sequence in the sequence shown in SEQ ID NO. 1.
Through sequence comparison, the similarity between the ribosomal RNA gene of the morinda officinalis mosaic virus and the cucumber mosaic virus is only 95%, and sequence difference exists.
In addition, as shown in fig. 1, the results of the cluster analysis of morinda officinalis mosaic virus and cucumber mosaic virus show that the morinda officinalis mosaic virus and cucumber mosaic virus are different in sequence and are grouped into one single unit in fig. 1, and the morinda officinalis mosaic virus is different from the cucumber mosaic virus host, and the morinda officinalis mosaic virus cannot infect crops such as cucumber, and belongs to the same genus as the cucumber mosaic virus, but is not the same virus.
Example 2 method for detection of Morinda citrifolia mosaic Virus
1. Experimental methods
(1) PCR amplification reaction
Extraction of Total RNA from Morinda citrifolia mosaic Virus obtained in the examples Total RNA extracted was stored at-80 ℃ and the total RNA was reverse transcribed into a cDNA library. Designing specific primers (F1/R1 primer group, F2/R2 primer group and F3/R3 primer group), wherein the nucleotide sequences of the primers are respectively shown as SEQ ID NO. 2-SEQ ID NO.7 in Table 1; the cDNA library was used as a template for PCR detection, the PCR amplification system was shown in Table 2, and the amplification reaction product was subjected to agarose electrophoresis and recovered.
TABLE 1 specific primers used for PCR detection
TABLE 2 PCR amplification System
The PCR amplification procedure was: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, and annealing at 51-55 ℃ (the annealing temperature is determined according to the condition of the primers) for 30 s; extension is carried out for 30 s-1.5 min at 72 ℃ (the extension time is determined according to the length of the amplified fragment, 1min is needed for amplifying the 1kb fragment), and 35 cycles are carried out; final extension at 72 ℃ for 3 min.
(2) Sequence alignment
The recovered fragments were sequenced, and the sequencing results were compared with the nucleotide sequence (SEQ ID NO.1) of the ribosomal RNA gene of Morinda citrifolia mosaic virus to determine whether Morinda citrifolia mosaic virus was present on the leaves, and from this, it was possible to infer whether Morinda citrifolia mosaic virus was likely pathogenic.
2. The result of the detection
The results of the specific primers for detecting morinda citrifolia mosaic virus are shown in fig. 2, and it can be seen that the specific primers (F1/R1 primer set, F2/R2 primer set and F3/R3 primer set) can amplify corresponding target bands, and the amplification results are consistent with the assembly results of the ribosomal RNA genes of morinda citrifolia mosaic virus.
Example 3 detection of Morinda citrifolia mosaic disease
Randomly finding morinda officinalis leaves with typical mosaic symptoms in a field, and collecting; shearing lesion areas in the morinda officinalis leaves, fully grinding the sheared lesion materials by using liquid nitrogen, and extracting total RNA of the morinda officinalis diseased leaves; storing the extracted total RNA at-80 deg.c and reverse transcribing the total RNA into cDNA library; the specific amplification primers were the same as in example 2.
The detection result is shown in the same electrophoresis chart as that in FIG. 2, and the results show that the three groups of primers can amplify corresponding target bands.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> Guangzhou college of traditional Chinese medicine (Guangzhou institute of traditional Chinese medicine)
<120> identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 8806
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gcacgcaggg agaggctaag gcttaggcta tgctgatctc cgtgaatgtc tacacattcc 60
cgttttaatt acaagagcgt acggttcaat ccctgcctcc tctgtaatac taccctttga 120
aaaaccctct ctttcttaat cttttctctg aaattcctat ggcgacgtcc tcgttcaaca 180
tcaatgaatt ggtagcctcc cacggcgata aaggactact cgcgaccgcc ctcgttgata 240
agacagctca tgagcagctc gaggagcaat tacagcatca acgtagaggc cgtaaggtct 300
acatccgaaa tgttttgggt gtaaaggatt ctgaagtcat ccggaatcgg tatggaggaa 360
agtacgacct tcatcttacc cagcaggagt ttgctcccca cggcctagct ggtgccctcc 420
gcttgtgtga aactctcgat tgtctagact ctttcccttc atcaggtctg cggcaggacc 480
tcgtcttaga cttcggagga agttgggtca cacattacct ccgcggacac aacgtacact 540
gctgttcacc ctgtttgggt atccgcgata aaatgcgcca tgcggaacgt ttaatgaaca 600
tgcgcaagat catcctgaac gatccacaac agttcgatgg tcgacagccg gatttctgca 660
ctcagccggc tgtggattgc aaagtacaag cccactttgc tatatctatt catggaggtt 720
atgatatggg ctttagagga ctatgtgagg caatgaatgc tcacggaacc accattttga 780
agggaacgat gatgttcgat ggtgcaatga tgtttgacga ccagggtgta atacctgaac 840
ttaattgcca gtggaggaag attaggagtg ctttctctga gactgaagac gttacaccgt 900
tgtctggtaa acttaattcc acaatattct cccgcgttcg taaattcaag actatggtgg 960
cttttgattt catcaatgag tctaccatgt cttatgttca tgattgggag aatataaagt 1020
catttctgac agaccagacc tactcgtacc gagggatgac ttatggtatt gagcgttgcg 1080
ttattcacgc cggtattatg acgtataaga tcattggtgt acctgggatg tgcccacccg 1140
aactcattcg acactgtatt tggttcccct ctattaaaga ctatgttggt ctgaagattc 1200
ccgcgtcgca ggacttggtt gagtggaaaa cagtgcgtat tttaacgtca acattacgtg 1260
aaacggaaga gattgctatg agatgttaca gcgataagaa agcgtggatg gaacagttta 1320
aggttatttt aggtgtttta tctgcgaaat catctaccat tgttatcaat ggtatgtcca 1380
tgcaatctgg cgaacgcata gatatcaatg attaccacta tattggtttc gctattcttc 1440
tgcacacaaa aatgaagtat gaacagctgg gaaaaatgta tgatatgtgg aatgcttcga 1500
gcatctcgaa gtggttcgca gcgttgactc gtccgttgcg tgtgtttttc tccagcgttg 1560
ttcacgcact gttcccgact ttgagacccc gcgaggaaaa agaattcctg attaagctct 1620
ccaccttcgt tacttttaat gaagagtgct catttgatgg tggagaggaa tgggacgtga 1680
tatcatctgc tgcttacgtt gctacgcagg ctgttaccga tgggaagatt ttggctgcgc 1740
agaaagccga gaagctcgct gagaagcttg cacaacccgt gattgaggta tcggacagac 1800
ctgaggcgtc atctccaacg cctgatgata cggctgatgt ttgtggaaaa gagcaagagg 1860
tctcggaact tgactcttta tcagctcaga cacgttcccc catcactaga attgctgaaa 1920
gggctactgc tatgttggag tatgccgctt atgagaaaca gctgcacgac accacagtgt 1980
ctaatttgaa acgtatttgg aacatggcgg gtggtgatga caagagaaac tccctcgagg 2040
gtaatttgaa gtttgttttc gatacgtatt tcactgtcga tcccatggtg aatattcact 2100
tctccacggg tcggtggatg cgtcctgtac ccgaaggaat tgtttactct gttggttata 2160
atgaacgcgg tttaggtccg aagtcggatg gagagcttta catcgtcaac agtgagtgtg 2220
tgatttgtaa tagtgagtct ttgtctgctg tcactcgctc gcttcaggcc ccgactggaa 2280
ccattagtca agttgatggg gttgctggtt gcgggaagac cacggcgata aaatccattt 2340
ttgagccatc caccgacatg atcgttaccg ctaataagaa atccgcccat gatgttcgta 2400
tggcgctgtt taaatcgtcg gattccaaag aagcttgcac cttcgttcgt actgccgatt 2460
ctgtcctact taatgaatgt ccgactgtta gtagggttct ggttgatgag gttgtgctgc 2520
ttcactttgg tcaattgtgt gccgtgatgt ctaagttgaa ggctgtgcga gctatatgtt 2580
tcggggattc ggagcaaatt gctttttctt ctcgcgacgc ctcgtttgat atgcgtttct 2640
ctaagattat tcctgatgaa actagtgatg cggacactac attccgtagt ccacaagacg 2700
ttgtgccgct tgtgcgttta atggctacga aggctcttcc gaaaggaact cattcgaagt 2760
acacgaaatg ggtttctcaa tctaaagtga aaagatctgt tacatctcgt gccatcgcta 2820
gcgtgacatt ggttgacctg gattcttcca ggttttatat tacgatgacc caagctgata 2880
aggcctcact gatttcaaga gcgaaagaga tgaatttacc aaagactttc tgggacgaaa 2940
ggattaaaac tgtgcatgag tctcaaggca tttctgaaga tcatgttact ttggtaagat 3000
taaagagcac aaagtgtgac ctgttcaaga aattttcata ttgtcttgtt gccttgacga 3060
gacacaaggt cacgttccgc tacgagtatt gtggtgtact gaatggcgat ttaattgccg 3120
aatgtattgc tcgtgtttag cggactccct ccttgtgagg cgggagctga gttggcagtg 3180
ctgctataaa ctgtctgaag tcactaaaca catttgtggt gaacgggttg tccatccagc 3240
ttacggctaa aatggtcagt catggagaaa tccatgccag tagacttaca agtctctgag 3300
gtgcctttga aaccatctcc taggtttctt cggaaggact tcggtccgtg taccgctagt 3360
gcaagacgct agctttaggg tacgggcatc cccccattta atgggggtct cttaaaggag 3420
accatgactc gactcaaacg tctactaaac acaaagagaa aacacacagc acatacggtt 3480
caacccctgc ctcctctgta aaactcccta gactttctag tttctttctt ttctatggct 3540
tcccttgccc ccgctttctc actggccaat cttttgaatg gtacttacgg tgtagacact 3600
cccgaggaag tggaacgcgt gcgatctgag caacgcgaag aggctgctgc ggcttgtcgt 3660
aattacaagc ccctatccgc tgtggatgtc agcgagagtg tcacagagga tgcgcattcc 3720
ctccgagttc cagacggagc tccctctgaa gaggtgtctg ttgaacttgt tacttatggt 3780
gctgaagatt accttgaaaa atctgatgat gagctccttg tcgcttttga gacgatggtc 3840
aaacccatgc gtatcggaca gttatggtgc cctgcgttta ataaatgttc atttatttcc 3900
agcatagcta tggctagagc tttgcttttg gtacctaaca catccaaccg aaccatgaag 3960
tgttttgaag acctggtcgc ggctatttac actaaatccg atttctatta cgatgatgag 4020
tgtgaagccg atgatgttca gataaatatc tcgtctcgcg atgtacccgg ttattctttc 4080
gaaccgtggt cccgaacgtc tggatttgaa ccaccgccta tctgtgaggc gtgtgacatg 4140
atcatgtacc agtgcccttg ttttgatttt aatgctttaa agaaatcgtg cgctgagagg 4200
actttcgctg atgattatgt tattgaaggt ttagatggtg ttgttgacaa tgcaactttg 4260
ttgtccaact taggcccatt cttggtgcct gtgaaatgcc aatacgagaa atgtccaaca 4320
cccaccgtcg cgattcctcc gagtctaaat cgtgctactg atcgtgttga tatcaattta 4380
gttcaatcca tttgtgattc cactctgccc acgcatagca attatgacga ctcttttcat 4440
caagtgttcg tcgaaagtgc agattattcc attgatctgg accatgttag gcttcgacaa 4500
tccgatctca ttgcgaagat tccagattca gggcatatga taccggtttt gaataccggg 4560
agtggtcaca agagagtagg tacgacgaag gaggttctta cagcaatcaa gaaacgaaat 4620
gctgacgttc cagagctagg tgattccgtt aatctgtcta ggttgagtaa ggctgtggct 4680
gagagatttt tcgtctcgta cattaatggc aactctttag ccgccagcaa ctttgtcaat 4740
gtcgttagta acttccacga ctacatggaa aaatggaagt cttcaggtct ctcgtatgat 4800
gatcttccgg atcttcatgc tgagaatttg cagttttacg accacatgat aaaatctgat 4860
gtgaagcctg tcgttagcga cacattgaac attgacagac cggttccagc tactataacg 4920
tatcacaaga aaggtataac ctcccagttc tcaccgttat tcacagctct atttgagcgc 4980
ttccagagat gccttcgaga acgtattatt cttcctgttg gaaagatttc atcccttgag 5040
atgtcaggat ttgatgttaa gaacaaacat tgtctcgaga tcgatttatc caaattcgat 5100
aagtctcaag gtgaatttca tttgatgatt caggaacaca ttttgaatgg tctagggtgc 5160
ccagctccga taacgaagtg gtggtgtgat ttccaccgat tctcttacat tagagaccgt 5220
agagctggtg ttggtatgcc tatcagtttc cagagacgaa ctggtgatgc attcacttat 5280
tttggtaaca ccattgtcac tatggctgaa tttgcatggt gttacgacac cgaccaattc 5340
gaaaaacttt tattctcagg cgatgattct ctaggatttt ctgtgcttcc ccctgttggt 5400
gatccgagta aattcacgac tcttttcaac atggaagcta aggtgatgga gccagcagta 5460
ccatatattt gttcgaagtt cttactctct gacgagttcg gtaatacctt ttccgttcca 5520
gatccattgc gcgaggttca gcggttagga acaaagaaaa tcccctattc tgacaatgat 5580
gaattcctgt ttgctcactt catgagcttt gttgatcgat tgaagttttt ggaccgaatg 5640
actcagtctt gtatcgatca gctttcactc ttcttcgagt tgaaatacag gaagtctggg 5700
gcagaggctg ccttaatgtt aggcgccttc aagaaatata ccgctaattt ccagtcctac 5760
aaagaactct actattcaga tcgtcgtcag tgcgaattga tcaattcgtt tagttttgta 5820
gagttgagga ttgagcgttc gagttccatt aagcagcgaa agaagaaaga tggaattgaa 5880
cgaaggcgca atgacaaacg tcgaactcca actggcccgc atggtggagg tgaagagaca 5940
gaaacgaagg tctcacaaga agaatcgacg ggaacgatgt cacaaaagtc ccagcgagag 6000
agcgcgttca aatctcagac tgttccgcct cctaccgttc tatcaagtag atggttcgga 6060
actgatagag atgtaccgcc acgtgaatgt ggcggagttg tccgagtctg aggctcctcg 6120
ttatacgttg ccagcggaag atgaccatga tttcgacgat acagattggt tcgctggtaa 6180
cgagtgggcg gaaggagcat tctgaacctc tcctttcttt ctttctccag ttttctgagg 6240
ctggaactga gttggcagta ttgctacaaa ctgtctgaag tcactaaacg ttttacggtg 6300
aacgggttgt ccatccagct aacggctaaa atggtcagtc gtggagaaat ccacgccgga 6360
gacttacaag tctctgaggt gcctttgaaa ccatctccta ggtttcttcg gaaggacttc 6420
ggtccgtgta ccgctagtac aagatgctag ctttagggta cgggcatccc cccatttaat 6480
gggggtctct taaaggagac catgactcga ctcaaacgtc tactaaacac aaagagaaaa 6540
cacacagcac accgtaatct taccactgtg tgtgtgcgtg tgtgtgtgtg tcgagtcgtg 6600
ttgtccacac atttgagtcg tgctgtccgc acatttttct ttcagtgtgt tagattcccg 6660
aggcatggct ttccaaggta ccagtaggac tttaactcaa cagtcctcag cggctacgtc 6720
tgacgatctt caaaagatat tatttagccc tgaagccatc aagaaaatgg ctactgagtg 6780
tgacctaggc cggcatcatt ggatgcgtgc tgataatgcg atatcagtcc ggcccctcgt 6840
tcccgaagta acccacggtc gtattgcttc cttcttcaag tctggatatg atgttggtga 6900
attgtgctca aaaggatata tgagcgtccc tcaagtgttg tgtgctgtta ctcgaacagt 6960
ctccactgat gctgaagggt ccttgagaat ttacttagca gatctaggcg ataaggagct 7020
atctccaata gatggacaat gcgtttcatt acataaccat gatcttcccg ctttggtgtc 7080
tttccagccg acgtatgatt gtcctatgga aattgttggg aatcgcaagc ggtgttttgc 7140
agtcgtcatc gaaagacatg gttatgttgg gtataccggc accacagcta gcgtgtgtag 7200
taattggcaa gcacgatttt catccaagaa taacaactac actcatatcg cagctgggaa 7260
gactctagta ctgccgttca acagattagc tgagcaaacg aaaccgtcag ccgtcgctcg 7320
cctgttgaag tcgcaattga ataacataga atcctcgcaa tatgtcttga cgaatgcgag 7380
gatcaatcaa aatgcgcgca gtgagtccga ggaattaagt gagagccctc ccgtcgcaat 7440
cgggagttct tccgcgtccc gctccgaaac ctttagaccg caggtggtta acggtctcta 7500
gtgatttcgt tgcgtattag tatataagta tgtgtaagtc tgtacataat actatatcta 7560
tagtgtcctg tgtgagttga tacagtagac aactgtgacg cgatgccgtg ttgagaagag 7620
agcacatctg gttctagtaa atccacatca tagctttgag gttcaattcc tcttgctccc 7680
tgttgggaac ccttactttt tcacggatgc ttctccgcga gattgcgttt cgtctactta 7740
tccttagagt attgtgctgt gattttctct ttcgtagtag atttgagtcg agtcgagtca 7800
tggacaaatc tgaatcaacc agtgtcggtc gcaaccgtcg acgtcgtccg cgtcgtggtt 7860
cccgctccgt ttcttcctcc acggatgcta actttagagt cctgtcgcag cagctttcgc 7920
gacttaataa gacgttagca gctggtcgtc caactattaa ccacccaacc tttgtgggta 7980
gtgaacgctg taaacctggg tacacgttca cctcgattac cctgaaacca ccaaaaatag 8040
accgagggtc ttattatggt aaaaggttgt tgcttcctga ttcagtcacg gaattcgata 8100
agaagcttgt ttcgcgcatt caaattcgag ttaatccttt gccgaaattt gattctaccg 8160
tgtgggtgac agtccgaaaa gttcctgcct cgtcggactt gtccgttgcc gccatctctg 8220
ctatgttcgc ggacggagcc tcaccggtac tggtttatca gtatgccgca tccggagtcc 8280
aagccaacaa taagttgttg tatgatcttt cggcgatgcg cgctgatatt ggcgatatga 8340
gaaagtacgc cgttctcgtg tattcaaaag acgatgcgct tgagacggac gaattagtac 8400
ttcatgtcga cattgagcac caacgcattc ccacatctgg ggtgctccca gtttgaatcc 8460
gtgtttccca gaaccctccc tccgaatttt gtggcgggag ttgagttggt agttttgctt 8520
taaactgcct gaagtcacta aacgcactgc ggtgaacggg ttgtccatcc agcttacggc 8580
taaaatggtc agtcgtggag aaatccacgc cagcagactt acaagtctct gaggtgcctt 8640
tgaaaccatc tcctaggttt cttcggaagg acttcggtcc gtgtaccgct agtacaagat 8700
gctagcttta gggtacgggc atccccccat ttaatggggg tctcttaaag gagaccatga 8760
ctcgactcaa acgtctacta aacacaaaga gaaaacacac agcaca 8806
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
attcacttct ccacgggtcg 20
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcaaccagaa ccctactaac a 21
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttgaaccacc gcctatctgt 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gccacagcct tactcaacct 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
taacccacgg tcgtattgct 20
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ctaatacgca acgaaatcac t 21
Claims (8)
1. A ribosomal RNA gene of morinda officinalis mosaic virus is characterized in that the nucleotide sequence of the ribosomal RNA gene is shown as SEQ ID NO. 1.
2. Use of the ribosomal RNA gene of claim 1 for detecting Morinda citrifolia mosaic virus and/or for preparing a product for detecting Morinda citrifolia mosaic virus.
3. The primer combination for detecting the morinda officinalis mosaic virus is characterized in that the primer combination can simultaneously amplify a sequence shown as SEQ ID NO. 1; the primer combination consists of a primer group F1/R1, a primer group F2/R2 and a primer group F3/R3, and the nucleotide sequences of the primer combination are respectively shown as SEQ ID NO. 2-SEQ ID NO. 7.
4. Use of the primer combination of claim 3 for detecting morinda citrifolia mosaic virus and/or for preparing a kit for detecting morinda citrifolia mosaic virus.
5. A method for detecting morinda officinalis mosaic virus, which is characterized in that whether the ribosomal RNA gene in claim 1 exists in nucleic acid of a sample to be detected is detected, and if the ribosomal RNA gene exists, the sample to be detected is positive for morinda officinalis mosaic virus.
6. The method of claim 5, wherein the primer combination of claim 3 is used to perform PCR amplification reaction using the nucleic acid of the sample as the template, and if the amplification result is positive, the sample is positive for Morinda officinalis mosaic virus.
7. A kit for detecting morinda citrifolia mosaic virus, wherein the kit comprises the primer combination of claim 3.
8. Use of the kit of claim 7 for detecting morinda citrifolia mosaic virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911195097.5A CN110964850B (en) | 2019-11-28 | 2019-11-28 | Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911195097.5A CN110964850B (en) | 2019-11-28 | 2019-11-28 | Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110964850A CN110964850A (en) | 2020-04-07 |
| CN110964850B true CN110964850B (en) | 2021-07-09 |
Family
ID=70032033
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911195097.5A Active CN110964850B (en) | 2019-11-28 | 2019-11-28 | Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110964850B (en) |
-
2019
- 2019-11-28 CN CN201911195097.5A patent/CN110964850B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110964850A (en) | 2020-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wolf et al. | The evolution of chloroplast genes and genomes in ferns | |
| Matsumura et al. | SuperSAGE: a modern platform for genome-wide quantitative transcript profiling | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN111793704B (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN107164471B (en) | Molecular identification method for rapidly identifying truth of beauveria bassiana in traditional Chinese medicine stiff silkworm | |
| CN111893198A (en) | Specific molecular target for identifying staphylococcus albus, detection primer group and rapid detection method thereof | |
| CN108034733B (en) | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof | |
| CN112522434A (en) | Primer group and kit for simultaneously detecting multiple pathogenic fungi | |
| CN110964850B (en) | Identification of morinda officinalis mosaic virus, ribosomal RNA gene of morinda officinalis mosaic virus and application of ribosomal RNA gene | |
| JP5278919B2 (en) | Method for simultaneous detection of viroid PSTVd and TCDVd | |
| CN115786541B (en) | SNP molecular marker, primer probe, kit, method and application for identifying Brucella vaccine strain A19 | |
| CN115101126B (en) | Respiratory tract virus and/or bacterial subtype primer design method and system based on CE platform | |
| CN116042878A (en) | Kit and detection method for detecting and distinguishing Brucella | |
| CN115843318B (en) | Plant species identification method based on whole genome analysis and genome editing and application | |
| CN105803079B (en) | Specific primer and probe and method for fluorescence quantitative PCR detection circular rna-ZAP | |
| CN116004863A (en) | Primer pair for detecting and identifying rice bacterial leaf blight bacteria and application thereof | |
| CN115029345A (en) | Nucleic acid detection kit based on CRISPR and application thereof | |
| CN112266979A (en) | RPA detection primer based on watermelon mosaic virus conserved region, detection method and application thereof | |
| CN113718044A (en) | Primer, probe and kit for fluorescent quantitative detection of swine mycoplasma, mycoplasma microformis and new mycoplasma haemophilus | |
| KR101434832B1 (en) | Primers of polymerase chain reactions for the detection of Phytophthora species broken out on kind of fruit tree or seedling, and detection kits and methods thereof | |
| CN110894551A (en) | RAA constant-temperature fluorescence detection method and reagent for grass carp hemorrhagic disease type I virus (GCRV-I) | |
| CN112980974B (en) | Yersinia pestis identification method based on chromosome specific probe | |
| CN114438178B (en) | Detection method of human-mouse homologous mouse annular RNA gene sequence and application thereof | |
| CN113462799B (en) | Bacillus anthracis identification method based on chromosome specific probe | |
| CN110501414B (en) | Identification model, construction method and application of VIM type and SPM type metalloenzyme pseudomonas aeruginosa |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |