CN108034733B - DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof - Google Patents
DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof Download PDFInfo
- Publication number
- CN108034733B CN108034733B CN201810084450.1A CN201810084450A CN108034733B CN 108034733 B CN108034733 B CN 108034733B CN 201810084450 A CN201810084450 A CN 201810084450A CN 108034733 B CN108034733 B CN 108034733B
- Authority
- CN
- China
- Prior art keywords
- cuicoides
- culicoides
- gene
- dna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a DNA barcode standard sequence of Cuicoides kindred and a molecular identification method thereof, which are characterized in that a molecular biology DNA sequencing method is adopted to obtain CO I gene sequences of Cuicoides kindred such as Cuicoides longatus, Cuicoides semens neobambusicola, Cuicoides leucotrichia and the like, and then the species identification of the Cuicoides kindred is carried out according to the comparison result through the similarity comparison of the gene sequences. The molecular identification method for Cuicoides longata, Cuicoides neobambusae, Cuicoides albacaris and other Cuicoides culicoides is beneficial to realizing the rapid and accurate identification of the three Cuicoides.
Description
Technical Field
The invention relates to the field of insect species identification, in particular to a DNA bar code standard sequence of Cuicoides midges such as Cuicoides longus, Cuicoides sempervirens, Cuicoides albacaris and the like and a molecular identification method thereof.
Background
Culicoides (CulicoidesLatreille, 1809) belongs to the class Insecta (Insecta) diptera (diptera) ceratoponidae (ceratopathonide), is tiny, diverse, and widely distributed, with 1368 existing worldwide, 347 known in china, and new species are continually being discovered worldwide. A blood sucking midge is a midge capable of transmitting an insect-borne pathogen by sucking the blood of a ruminant animal, including CulicoidesCulicoidesLasiohelea genusLasioheleaGenus midgesLeptoconopsAnd genus midgesAustroconopsAnd the like. Among the blood sucking midges of the genus Culicoides, many pathogens transmitted by midge vectors include Bluetongue virus (BTV), epizootic hemorrhagic fever virus (EHDV), Schmallenberg virus (SBV), African Horse Sickness Virus (AHSV), and the like. Blood sucking midges are an important part in the epidemic transmission process of livestock, and if the control is not good, the outbreak is caused and huge economic loss is caused, so the method is closely related to the fields of medicine, veterinary medicine and the like. Therefore, accurate identification of disease vectors is a key step in monitoring and preventing midges from transmitting diseases.
At present, the traditional morphological identification method for midges firstly takes complete adults as research objects, which are easily limited by sex and development stage of the midges to cause difficulty in classification and identification, for example, the morphological structure and the limb-deficient insects at early stages such as midge eggs, larvae and pupae are difficult to identify, and the traditional morphological identification method for the midges has higher applicability only to male non-blood-sucking midges, but has poor effect on female medium blood-sucking midges. In addition, the method also has the defects of complex operation, strong professional property and the like. Finally, phenotypic plasticity and genetic variability of biting midges also contribute to misjudgment, particularly the taxonomic identification of closely related, closely related species. Culicoides longata, culicoides neobamicoides, culicoides albacaris and the like belong to kindred species of the subgenus bicystis, and the traditional morphological identification is extremely difficult. Therefore, a fast and accurate method is needed to make up for the shortcomings of the conventional morphological classification methods.
With the rapid development of molecular biology and bioinformatics, molecular identification based on DNA sequence analysis has become a common technical means for species identification, and the defects of traditional taxonomic identification are greatly compensated. The DNA barcode technology refers to a standard DNA fragment with enough variation and certain conservation in organisms, which is relatively short and easy to amplify. Therefore, as a standard target gene of a DNA barcode, the target gene must satisfy two conditions, one is that the target gene must have certain conservation, so that the universal primer design and the large-scale PCR amplification are facilitated; the second is to have sufficient variability to distinguish between different species, especially closely related species.
Insect mitochondrial DNA is a double-stranded closed-loop molecule consisting of 13 protein genes such as ND1-6, ND4L, CO I-CO III, ATPase6, ATPase8, Cytb and the like, 37 genes consisting of 22 tRNA genes and 2 rRNA genes (16S rRNA and 12S rRNA) and a non-coding segment containing a replication promoter. CO I, CO II, Cytb, 12S rRNA, 16SrRNA, ND4 and ND5 in mitochondrial genes are molecular markers with high application frequency at present, wherein the 12S rRNA and the 16S rRNA are not suitable to be used as bar-shaped coding genes due to the fact that a large number of insertion and deletion phenomena exist, the genes are highly conserved and the evolution is slow; ND4 and ND5 evolved too rapidly to design universal primers, limiting their use as target genes for comprehensive DNA identification systems. Compared with other genes, the CO I gene has the advantages of more conservative size and structure, large information content, capability of ensuring enough variation and easy amplification by a universal primer, only 1-2% of difference between different individuals in species, large difference between related species, more phylogenetic signals, more suitability for analyzing closely related biological groups, and most extensive use of molecular markers.
To date, the COI gene has been used for molecular identification of most biological groups (e.g., insects, birds, fish, nematodes, etc.) and thus is useful for molecular identification of blood sucking midges kindred. The molecular identification is combined with the traditional morphological classification method, so that the rapid and accurate identification of the kindred species of blood sucking midges is realized, and the discovery of the hidden species or new species in Culicoides is facilitated. At present, no COI gene sequences of related species of the Dicystia such as Culicoides longus, Culicoides neobambusae and Culicoides leucotrichae exist in GenBank. The invention provides DNA bar code standard gene sequences of Culicoides longata, Culicoides neobambusae and Cuicoides leucotrichae, which are beneficial to the rapid and accurate identification of three Culicoides kindred species and the shortening of species identification time.
Disclosure of Invention
The invention aims to provide a DNA barcode standard gene sequence of a culicoides kindred species and a molecular identification method thereof. A DNA bar code standard gene-COI gene sequence of Cuicoides midges such as Cuicoides longata, Cuicoides neobambusae and Cuicoides albacaris is obtained by a molecular biology DNA sequencing method, and the rapid and accurate identification of the Cuicoides midges such as Cuicoides longata, Cuicoides neobambusae and Cuicoides albacaris is realized by comparing the similarity of the gene sequences.
In order to achieve the purpose, the invention is realized by the following technical scheme:
by means of DNA template preparation and PCR reaction, the COI genes of Cuicoides species such as Cuicoides beak, Cuicoides neobambusae, Cuicoides leucotrichae and the like are amplified and increased by the synthesized primers, amplified PCR products can be used for detecting amplification results through agarose gel electrophoresis, and a strip sequence with the size of 650bp is specifically amplified and sent to a biological company for sequencing. The sequencing result is subjected to manual proofreading and sequence splicing, Blast similarity search is carried out in NCBI, the obtained sequence is ensured to be a target gene sequence, meanwhile, species identification of Cuicoides midges such as Cuicoides longata, Cuicoides neobambusae and Cuicoides leucotrichae is realized by means of morphological identification, and the species identification is rechecked by an authoritative specialist, so that the reliability of the result is ensured. The DNA bar code standard gene of Cuicoides, such as Cuicoides longrostinii, Cuicoides neobambusae, Cuicoides leucotrichi and the like, is a COI gene, and the sequence of the COI gene of Cuicoides longrostinii is shown as SEQ ID No. 1:
gatctgagca ggtatggtag gaacatctct tagaatacta attcgattag aattaggaca 60
tccaggatca ttaattggta atgaccaaat ttataatgta attgttacag ctcacgcatt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
ccctttaata ttaggagccc ctgatatagc ctttcctcgt ataaataata taagtttttg 240
gatactaccc ccttccatta ctttattatt aattagaagt cttgtagaaa atggagcagg 300
aactggttga acagtttatc cacctctttc tactaatatt tctcattcag gagcatctgt 360
agatttagct attttttctc ttcatttagc tggtattagt tctattctag gagcagtaaa 420
ttttattaca acaattataa atatgcgacc taaaggtata actatagatc gaataccatt 480
atttgtctga tcagttttaa ttacagcaat tcttttatta ctatctttac cagtattagc 540
tggagctatt actatacttc taacagatcg taatatcaat acttcttttt ttgacccgtc 600
agggggagga gacccaattc tttaccaaca tttattttga ttttttggtc 650
the CO I gene sequence of the new culicoides bambusae is shown as SEQ ID No. 2:
tttgagcagg tattattggg gcaaccttaa gattattaat tcgaatcgaattaagttacc 60
ctggaaatct ttttaataat gatcaattat ataatgtaat tgttacatct catgctttta 120
ttataatttt ttttatggtt atgccaatca taattggtgg atttggtaat tgattagtac 180
ccctgatatt aggggcccca gatatagctt tcccacggat aaataattta agattttgaa 240
tattaccccc ttctctttct cttttaatta taagaaattt tattgactct ggcccaggaa 300
ctggatgaac tgtatacccc ccactttcat cttatatggc ccaccctaat gcttcagtag 360
acttaactat tttttcatta catctagctg gaatttcttc cattctagga gctgtaaatt 420
ttattacaac aattataaat atacgacctg ctgggatagc aatagataat atacctttat 480
ttgtttgatc aatttttatt acaacaattc ttcttcttct atctttgcca gtattagcag 540
gcgcaattac tatactttta acagatcgta atattaatac ctcatttttt gaccccacag 600
gagggggaga ccctatccta tatcaacatt tattttgatt ttttggacat 650
the COI gene sequence of the white culicoides is shown as SEQ ID No. 3:
tgtctgagca ggaatagtag gtacttcttt aagaatacta attcgaaccg aattaggaca 60
cccaggggct ttaattggaa acgaccaaat ttataatgtt attgttacag cccatgcttt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
gcctttaata ttaggtgctc ctgatatggc atttccacga ataaataata taagattttg 240
aatactaccc ccttctatta ctttattatt aattagaagc ttagttgaaa atggagcagg 300
aactggttga actgtttacc ctcctctttc ttctaatatc tctcatgctg gagcttcagt 360
tgatttagca attttttcat tacatttagc aggtattaga tctattttag gagcagtaaa 420
ttttattact actattatta acatacgatc aaatgggata acttttgatc gaatgccttt 480
atttgtttga tctgtattaa ttactgctat tttacttctt ttatctttac cagtattagc 540
tggagctatc acaatacttt taacagatcg aaatattaat acatcatttt ttgatcctgc 600
tggaggagga gatcctattc tttatcaaca tttattttga ttttttggtc 65
the PCR primers of the DNA barcode standard gene sequences of the Cuicoides midges, such as Cuicoides longum, Cuicoides neobambusae, Cuicoides leucotrichae and the like are characterized in that the PCR primer sequences are respectively as follows:
a forward primer: 5 'TAAACTTCAGGGTGACCAAAAAATCA 3';
reverse primer: 5 'GGTCAACAAATCATAAAGATATTGG 3'.
The molecular identification method of Cuicoides midges such as Cuicoides longata, Cuicoides neobambusicola, Cuicoides leucotrichia and the like comprises the following steps:
1) separating and extracting DNA from midge tissues to be detected;
2) the DNA is taken as a template, and the adopted primers are as follows: a forward primer: 5 'TAAACTTCAGGGTGACCAAAAAATCA 3'; reverse primer: 5 'GGTCAACAAATCATAAAGATATTGG 3', amplifying the CO I gene of a culicoides kindred by polymerase chain reaction;
3) then taking a proper amount of products of the polymerase chain reaction in the step 2) to separate by agarose gel electrophoresis, judging whether the products are target bands or not according to the electrophoresis bands, if the products can specifically amplify bands with the size of about 650bp, cutting the PCR products into gel, purifying, and sending the gel to a biological company for sequencing;
4) through comparison and analysis of sequencing results, if the similarity between the CO I gene sequence of the Cuicoides species such as Cuicoides longata, Cuicoides neobambusae, Cuicoides albacanthi and the like and the similarity between the CO I gene sequence and the SEQ ID No. 1, the similarity between the CO I gene sequence and the SEQ ID No. 2 and the similarity between the CO I gene sequence and the SEQ ID No.3 are respectively more than 98%, the tissues to be detected of the Cuicoides midis judged to be the Cuicoides longata, the Cuicoides neobambusicola and the Cuicoides albacanthi.
The beneficial effect of adopting above-mentioned technical scheme is:
1) the method combines the traditional morphological identification and molecular identification methods, identifies the culicoides, and can ensure the accuracy and reliability of species identification.
2) Compared with the traditional morphological identification method, the established molecular identification method for the culicoides longrostinii, the new culicoides sempervirens and the culicoides albopictus can greatly shorten the identification time of the culicoides longrostinii, the new culicoides sempervirens and the culicoides albopictus.
3) Compared with the traditional morphological culicoides kindred species identification method, the method disclosed by the invention has the advantages that the culicoides kindred species identification is faster, more accurate and more reliable.
4) The invention fills the blank of the COI gene sequences of the culicoides longata, the new culicoides sempervirens and the culicoides albacaris in the GenBank database.
Drawings
FIG. 1 is a technical flow chart of the present invention.
FIG. 2 is an electropherogram of the results of PCR amplification of the CO I genes of Culicoides longata, Culicoides neobambusae and Culicoides leucotrichae. The numbering is as follows: lane 1 is a negative control, lanes 2-4 are the CO I genes of female Culicoides longus, Culicoides neobambusae and Culicoides leucotrichae, respectively, and a band of about 650bp in size is detected. M is 250bp DNA Ladder Marker.
FIG. 3 is an electropherogram of the result of PCR amplification of the CO I gene of female species of unknown Culicoides culans. The numbering is as follows: lane 1 is a negative control, and lanes 2, 3 and 4 are all the COI genes of female species of Culicoides unknown, and a band of about 650bp in size was detected. M is 250bpDNA Ladder Marker.
Detailed Description
Example 1 acquisition of the sequence of the CO I gene of Culicoides kindred species such as Culicoides longata, Culicoides neobambusae and Culicoides leucotrichae
1. Collecting and storing Cuicoides midge kindred species samples such as Cuicoides longata, Cuicoides neobambusae and Cuicoides leucotrichae
Cuicoides longata, Cuicoides neobambusae, Cuicoides leucotrichae and other Cuicoides are collected in field habitat of Yunnan province, Sichuan province and other provinces by a net scanning method and a lamp trapping method and stored in 95% alcohol. Dissect under the body sight glass with dissecting needle, make permanent mounting except chest, through authoritative specialist's appraisal, ensure the accuracy of appraisal result. The chest of closely related species such as culicoides longata, culicoides neobambusae, culicoides albacaris and the like are singly labeled and then subjected to molecular experiments.
2. Genomic DNA extraction
Respectively grinding the chest of stored Cuicoides longus, Cuicoides neobambusae, Cuicoides leucotrichae and other Cuicoides, extracting the genomic DNA of a single Cuicoides according to the specification of QIAGEN DNeasy Blood & Tissue Kit, and storing the extracted genomic DNA to-20 ℃ for later use.
3. Primer synthesis
The primers used in this example were as follows:
a forward primer: 5 'TAAACTTCAGGGTGACCAAAAAATCA 3'.
Reverse primer: 5 'GGTCAACAAATCATAAAGATATTGG 3'.
4. PCR amplification
The PCR reaction system of this example is as follows:
DNA template 1.5uL
Upstream primer (10 uM) 1uL
Downstream primer (10 uM) 1uL
2×PCR MasterMix 12.5uL
ddH2O 9uL
Total System 25uL
The PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 deg.C for 1min, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, and circulating for 35 times; finally, extension is carried out for 5min at 72 ℃.
5. PCR product identification and recovery
And (3) carrying out agarose gel electrophoresis on the PCR product, and judging whether the PCR product is a target band according to an electrophoresis band, wherein the electrophoresis map is shown in the attached figure 2. And (3) cutting and purifying the PCR product according to the agarose gel DNA recovery kit specification, and sending the purified product to a biological company for bidirectional sequencing.
6. CO I Gene sequence determination
The CO I gene sequences of Cuicoides such as Cuicoides longata, Cuicoides neobambusae and Cuicoides leucotrichae are compared, edited and spliced by artificial proofreading and bioinformatics software to obtain SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.
Example 2 identification of unknown culicoides
1. Collection and preservation of midge specimens
Midge specimens were collected from field habitats by a grid sweep method and a lamp induction method and stored in 95% alcohol. Dissect under the body mirror with dissecting needle, and make permanent mounting for morphological identification except chest. The midge chest is singly labeled and then subjected to molecular experiments.
2. Genomic DNA extraction
The preserved midges were ground at their chests, extracted for single unknown midges genomic DNA according to QIAGEN DNeasy Blood & Tissue Kit instructions and stored at-20 ℃ for future use.
3. Primer synthesis
The primers used in this example were as follows:
a forward primer: 5 'TAAACTTCAGGGTGACCAAAAAATCA 3'.
Reverse primer: 5 'GGTCAACAAATCATAAAGATATTGG 3'.
4. PCR amplification
The PCR reaction system of this example is as follows:
DNA template 1.5uL
Upstream primer (10 uM) 1uL
Downstream primer (10 uM) 1uL
2×PCR MasterMix 12.5uL
ddH2O 9uL
Total System 25uL
The PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 deg.C for 1min, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, and circulating for 35 times; finally, extension is carried out for 5min at 72 ℃.
5. PCR product identification and recovery
And (3) carrying out agarose gel electrophoresis on the PCR product, and judging whether the PCR product is a target band according to an electrophoresis band, wherein the electrophoresis map is shown in the attached figure 3. FIG. 3 shows that the unknown culicoides of example 2 also amplified specifically by PCR a product of approximately 650bp in size. And (3) cutting and purifying the PCR product according to the agarose gel DNA recovery kit specification, and sending the purified product to a biological company for bidirectional sequencing.
6. CO I Gene sequence determination
The results show that the similarity of the CO I gene sequences of unknown culicoides in the No. 2, No.3 and No. 4 lanes to the gene sequences of SEQ ID NO. 1, SEQ ID No. 2 and SEQ ID No.3 is greater than 98%, so that the unknown culicoides in the No. 2, No.3 and No. 4 lanes can be judged to correspond to culicoides longae, new culicoides bamicoides and culicoides albacaris respectively.
Sequence listing
<110> Zunyi medical college
<120> DNA barcode standard sequence of Culicoides kindred species and molecular identification method thereof
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>650
<212>DNA
<213> Culicoides longus CO I Gene (2 Ambystoma laterale x Ambystomajeffersonia)
<400>1
gatctgagca ggtatggtag gaacatctct tagaatacta attcgattag aattaggaca 60
tccaggatca ttaattggta atgaccaaat ttataatgta attgttacag ctcacgcatt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
ccctttaata ttaggagccc ctgatatagc ctttcctcgt ataaataata taagtttttg 240
gatactaccc ccttccatta ctttattatt aattagaagt cttgtagaaa atggagcagg 300
aactggttga acagtttatc cacctctttc tactaatatt tctcattcag gagcatctgt 360
agatttagct attttttctc ttcatttagc tggtattagt tctattctag gagcagtaaa 420
ttttattaca acaattataa atatgcgacc taaaggtata actatagatc gaataccatt 480
atttgtctga tcagttttaa ttacagcaat tcttttatta ctatctttac cagtattagc 540
tggagctatt actatacttc taacagatcg taatatcaat acttcttttt ttgacccgtc 600
agggggagga gacccaattc tttaccaaca tttattttga ttttttggtc 650
<210>2
<211>650
<212>DNA
<213> novel culicoides CO I gene (2 Ambystoma laterale x Ambystomajeffersonia)
<400>2
tttgagcagg tattattggg gcaaccttaa gattattaat tcgaatcgaa ttaagttacc 60
ctggaaatct ttttaataat gatcaattat ataatgtaat tgttacatct catgctttta 120
ttataatttt ttttatggtt atgccaatca taattggtgg atttggtaat tgattagtac 180
ccctgatatt aggggcccca gatatagctt tcccacggat aaataattta agattttgaa 240
tattaccccc ttctctttct cttttaatta taagaaattt tattgactct ggcccaggaa 300
ctggatgaac tgtatacccc ccactttcat cttatatggc ccaccctaat gcttcagtag 360
acttaactat tttttcatta catctagctg gaatttcttc cattctagga gctgtaaatt 420
ttattacaac aattataaat atacgacctg ctgggatagc aatagataat atacctttat 480
ttgtttgatc aatttttatt acaacaattc ttcttcttct atctttgcca gtattagcag 540
gcgcaattac tatactttta acagatcgta atattaatac ctcatttttt gaccccacag 600
gagggggaga ccctatccta tatcaacatt tattttgatt ttttggacat 650
<210>3
<211>650
<212>DNA
<213> Culicoides alboatii CO I Gene (2 Ambystoma laterale x Ambystomajeffersonia)
<400>3
tgtctgagca ggaatagtag gtacttcttt aagaatacta attcgaaccg aattaggaca 60
cccaggggct ttaattggaa acgaccaaat ttataatgtt attgttacag cccatgcttt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
gcctttaata ttaggtgctc ctgatatggc atttccacga ataaataata taagattttg 240
aatactaccc ccttctatta ctttattatt aattagaagc ttagttgaaa atggagcagg 300
aactggttga actgtttacc ctcctctttc ttctaatatc tctcatgctg gagcttcagt 360
tgatttagca attttttcat tacatttagc aggtattaga tctattttag gagcagtaaa 420
ttttattact actattatta acatacgatc aaatgggata acttttgatc gaatgccttt 480
atttgtttga tctgtattaa ttactgctat tttacttctt ttatctttac cagtattagc 540
tggagctatc acaatacttt taacagatcg aaatattaat acatcatttt ttgatcctgc 600
tggaggagga gatcctattc tttatcaaca tttattttga ttttttggtc 650
<210>4
<211>26
<212>DNA
<213> Forward primer (2 Ambystoma laterale x Ambystoma jeffersonanum)
<400>4
taaacttcag ggtgaccaaa aaatca 26
<210>5
<211>25
<212>DNA
<213> reverse primer (2 Ambystoma latex x Ambystoma jeffersonia)
<400>5
ggtcaacaaa tcataaagat attgg 25
Claims (4)
1. A DNA barcode standard gene of Cuicoides longata, which is characterized in that the DNA barcode standard gene is a COI gene and has a gene sequence SEQ ID No. 1:
gatctgagca ggtatggtag gaacatctct tagaatacta attcgattag aattaggaca 60
tccaggatca ttaattggta atgaccaaat ttataatgta attgttacag ctcacgcatt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
ccctttaata ttaggagccc ctgatatagcctttcctcgt ataaataata taagtttttg 240
gatactaccc ccttccatta ctttattatt aattagaagt cttgtagaaa atggagcagg 300
aactggttga acagtttatc cacctctttc tactaatatt tctcattcag gagcatctgt 360
agatttagct attttttctc ttcatttagc tggtattagt tctattctag gagcagtaaa 420
ttttattaca acaattataa atatgcgacc taaaggtata actatagatc gaataccatt 480
atttgtctga tcagttttaa ttacagcaat tcttttatta ctatctttac cagtattagc 540
tggagctatt actatacttc taacagatcg taatatcaat acttcttttt ttgacccgtc 600
agggggagga gacccaattc tttaccaaca tttattttga ttttttggtc 650。
2. a DNA barcode standard gene of New culicoides, which is characterized in that the DNA barcode standard gene is a CO I gene and has a gene sequence of SEQ ID No. 2:
tttgagcagg tattattggg gcaaccttaa gattattaat tcgaatcgaa ttaagttacc 60
ctggaaatct ttttaataat gatcaattat ataatgtaat tgttacatct catgctttta 120
ttataatttt ttttatggtt atgccaatca taattggtgg atttggtaat tgattagtac 180
ccctgatatt aggggcccca gatatagctt tcccacggat aaataattta agattttgaa 240
tattaccccc ttctctttct cttttaatta taagaaattt tattgactct ggcccaggaa 300
ctggatgaac tgtatacccc ccactttcat cttatatggc ccaccctaat gcttcagtag 360
acttaactat tttttcatta catctagctg gaatttcttc cattctagga gctgtaaatt 420
ttattacaac aattataaat atacgacctg ctgggatagc aatagataat atacctttat 480
ttgtttgatc aatttttatt acaacaattc ttcttcttct atctttgcca gtattagcag 540
gcgcaattac tatactttta acagatcgta atattaatac ctcatttttt gaccccacag 600
gagggggaga ccctatccta tatcaacatt tattttgatt ttttggacat 650。
3. a DNA barcode standard gene of Culicoides albuginea, which is a COI gene and has a gene sequence of SEQ ID No. 3:
tgtctgagca ggaatagtag gtacttcttt aagaatacta attcgaaccg aattaggaca 60
cccaggggct ttaattggaa acgaccaaat ttataatgtt attgttacag cccatgcttt 120
tattataatt ttttttatag taataccaat tataattgga gggtttggaa attgattagt 180
gcctttaata ttaggtgctc ctgatatggc atttccacga ataaataata taagattttg 240
aatactaccc ccttctatta ctttattatt aattagaagc ttagttgaaa atggagcagg 300
aactggttga actgtttacc ctcctctttc ttctaatatc tctcatgctg gagcttcagt 360
tgatttagca attttttcat tacatttagc aggtattaga tctattttag gagcagtaaa 420
ttttattact actattatta acatacgatc aaatgggata acttttgatc gaatgccttt 480
atttgtttga tctgtattaa ttactgctat tttacttctt ttatctttac cagtattagc 540
tggagctatc acaatacttt taacagatcg aaatattaat acatcatttt ttgatcctgc 600
tggaggagga gatcctattc tttatcaaca tttattttga ttttttggtc 650。
4. a method for molecular identification of culicoides closely related species, comprising the steps of:
1) separating and extracting DNA from midge tissues to be detected;
2) the DNA is taken as a template, and the adopted primers are as follows: a forward primer: 5 'GGTCAACAAATCATAAAGATATTGG 3'; reverse primer: 5 'TAAACTTCAGGGTGACCAAAAAATCA 3', amplifying the CO I gene of a culicoides kindred by polymerase chain reaction;
3) then taking a proper amount of products of the polymerase chain reaction in the step 2) to separate by agarose gel electrophoresis, judging whether the products are target bands or not according to the electrophoresis bands, if the products can specifically amplify bands with the size of about 650bp, cutting the PCR products into gel, purifying, and sending the gel to a biological company for sequencing;
4) through comparison and analysis of sequencing results, if the similarity between the CO I gene sequence of the corresponding Cuicoides culicoides, new Cuicoides culicoides, white Cuicoides and other Cuicoides culicoides is more than 98% with the sequence of SEQ ID No. 1, SEQ ID No. 2 or SEQ ID No.3, the tissue to be detected of the Cuicoides culicoides can be judged to be the Cuicoides culicoides, new Cuicoides culicoides or white Cuicoides culicoides.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810084450.1A CN108034733B (en) | 2018-01-29 | 2018-01-29 | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810084450.1A CN108034733B (en) | 2018-01-29 | 2018-01-29 | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108034733A CN108034733A (en) | 2018-05-15 |
| CN108034733B true CN108034733B (en) | 2020-05-05 |
Family
ID=62096871
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810084450.1A Expired - Fee Related CN108034733B (en) | 2018-01-29 | 2018-01-29 | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108034733B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055515A (en) * | 2018-08-28 | 2018-12-21 | 浙江海洋大学 | A kind of molecular biology method identifying Xinjiang Eerqisihe River north palpus loach cryptic species |
| CN109517909A (en) * | 2019-01-25 | 2019-03-26 | 河北国际旅行卫生保健中心 | A kind of kit and method for identifying Ryukyu's Storehouse midge |
| CN109810982A (en) * | 2019-03-08 | 2019-05-28 | 福建国际旅行卫生保健中心(福建出入境检验检疫局口岸门诊部) | The specific gene and its method for identifying molecules of short hairs Storehouse midge |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543364A (en) * | 2016-01-08 | 2016-05-04 | 福建国际旅行卫生保健中心 | Specific gene of Thailand culicoides and molecular identification method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543249B (en) * | 2016-01-08 | 2019-04-05 | 福建国际旅行卫生保健中心 | A kind of beauty Storehouse midge specific gene and its method for identifying molecules |
-
2018
- 2018-01-29 CN CN201810084450.1A patent/CN108034733B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543364A (en) * | 2016-01-08 | 2016-05-04 | 福建国际旅行卫生保健中心 | Specific gene of Thailand culicoides and molecular identification method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108034733A (en) | 2018-05-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108034733B (en) | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof | |
| CN110607359B (en) | Patinopecten yessoensis female specific marker combination and application | |
| CN105483261B (en) | A kind of specific gene and its method for identifying molecules of indigo plant abdomen Storehouse midge | |
| CN109652563B (en) | The minimally invasive Rapid identification PCR primer group of Shelled Turtle Trionyx Sinensis ZW sex chromosome type, site, method and kit | |
| CN105543249B (en) | A kind of beauty Storehouse midge specific gene and its method for identifying molecules | |
| CN102690829A (en) | A DNA bar code standard gene sequence for Taiwan Lasiohelea | |
| CN117004701B (en) | Molecular marker for sex identification of apostichopus japonicus and application | |
| CN108486121B (en) | Specific DNA sequence of Cuicoides spinuloides and molecular identification method thereof | |
| CN111118174B (en) | Macrobrachium rosenbergii sex identification method based on PCR and sequencing technology | |
| KR101054459B1 (en) | Specific primer and its use for distinguishing rice varieties | |
| CN111378764A (en) | Identification method of seven species of coe (coe of species) genes based on coe (cytochrome oxidase I) vector culicoides | |
| CN110541035A (en) | Sinocyclocheilus sinensis DNA barcode sequence and application thereof | |
| CN107988232A (en) | The DNA bar code standard sequence and its method for identifying molecules of a kind of open country Storehouse midge | |
| CN108486122A (en) | A kind of the DNA bar code standard sequence and its method for identifying molecules of South Mountain Storehouse midge | |
| CN105969907B (en) | Kit for detecting ST251 type pathogenic aeromonas hydrophila and application thereof | |
| CN109609666B (en) | Molecular detection primer for sweet potato chip blast bacteria and application thereof | |
| KR101395938B1 (en) | Pcr diagnosis using specific primer for bacteria that cause diseases of allomyrina dichotoma | |
| Khaier et al. | Molecular characterization of Eimeria acervulina in broiler chickens | |
| CN111172298B (en) | Blood sucking midge host identification method based on species COI gene | |
| CN110878308A (en) | Specific gene of Culicoides acutifolia and bimolecular marker identification method thereof | |
| CN111926087A (en) | DNA bar code for identifying unscheduled sp of flatfish and flatfish with transverse band, and identification method and application thereof | |
| CN113789370B (en) | Identification method for fertilization mode of channel catfish culture pond | |
| Avendaño‐Herrera et al. | Universal probe library assay for the detection of infectious pancreatic necrosis virus genogroups 1 and 5 in salmonid tissues. | |
| CN109706251B (en) | Kit and method for identifying culicoides flavipes | |
| CN108950033B (en) | Nano PCR kit for simultaneously detecting enterohemorrhagic escherichia coli O45 and O145 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200505 Termination date: 20220129 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |