CN109706251B - Kit and method for identifying culicoides flavipes - Google Patents
Kit and method for identifying culicoides flavipes Download PDFInfo
- Publication number
- CN109706251B CN109706251B CN201910186463.4A CN201910186463A CN109706251B CN 109706251 B CN109706251 B CN 109706251B CN 201910186463 A CN201910186463 A CN 201910186463A CN 109706251 B CN109706251 B CN 109706251B
- Authority
- CN
- China
- Prior art keywords
- primer
- culicoides
- seq
- flavipes
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for identifying Culicoides flavipes, a kit and a use method thereof, wherein the molecular marker comprises a CO I gene with a nucleotide sequence shown as SEQ ID NO.5 and Cyt with a nucleotide sequence shown as SEQ ID NO.6bGenes, said kit being capable of simultaneously amplifying said CO I gene and CytbA gene. The method adopts a method of combining two different molecular markers to identify the culicoides flavipes, is favorable for realizing the accurate identification of the culicoides flavipes, and shortens the identification time.
Description
Technical Field
The invention relates to the field of species identification, in particular to a kit and a method for identifying culicoides flavipes.
Background
Culicoides belongs to the phylum Arthropoda (arthopoda) class entomophyceae (Insecta) Diptera (Diptera) Culicoides (ceracoides) on the animal classification, is the largest genus of the family of the Culicoides, and is also the most widely distributed, most diverse, genus of the genus hematophagus that is most closely related to humans and animals, and is a transmission vector for a variety of important animal insect-borne diseases. In recent years, with global warming, culicoides have been improved to a certain extent in their ability to transmit insect-borne viruses, and culicoides also have been expanded in their distribution range to both poles of the earth and high-altitude areas, with an increased ability of culicoides populations to transmit insect-borne viruses to animals, and some traditional "non-vector" culicoides species have had the ability to transmit epidemic diseases. The entomopathogenic diseases transmitted by culicoides, such as bluetongue, vesicular stomatitis and the like, are spread and popular in some countries or regions around the world, which causes huge economic loss and poses serious threat to the development of animal husbandry. Culicoides paralavavescens (Culicoides paralavascens) belong to the genus Culicoides, and are distributed in Fujian, Hainan, Jiangsu, Guangdong, Guangxi, Yunnan, Taiwan and other places in China. The identification and recognition of blood sucking midges is the basis for monitoring and controlling the occurrence of diseases transmitted by midges and is also a core step in the field of disease prevention and control. At present, the identification of blood sucking midges is mainly realized by means of identifying morphological characteristics by taxonomic experts with abundant experience, and once a sample with incomplete control of kindred species and morphological characteristics is identified, the identification is very troublesome; moreover, morphological identification of blood-sucking midges needs to be completed by manufacturing a slide specimen, and the operation steps are complicated, long in period and high in difficulty, so that a new method needs to be found to make up for the defects of the traditional classification method.
The molecular identification technology is based on the analysis of genetic material DNA sequence to clarify the difference between species, and identify the species quickly and accurately on the molecular level. The molecular biology taxonomy is a product combining molecular biology, computer science and traditional taxonomy, is used as a brand-new taxonomy technology, greatly makes up for the defects of traditional morphological identification, and has attracted more and more attention of biologists. However, the molecular identification of midges at present mainly adopts a single gene as a molecular marker, and hybridization or gene penetration phenomena may exist, and particularly, accurate identification of species in the same compound group is difficult.
Disclosure of Invention
In response to the deficiencies of the prior art, the inventors tried the combined use of multiple molecular markers. The inventors, through extensive and inventive research, found that the combination of cytochrome C oxidase subunit i (co i) of mitochondrial dna (mtdna) and mitochondrial cytochrome b (cyt b) had an unexpected effect on the identification of culicoides flavipes, thereby completing the present invention.
In a first aspect, the invention provides a molecular marker for identifying Culicoides flavipes, which is characterized in that the molecular marker comprises a CO I gene with a nucleotide sequence shown as SEQ ID NO.5 and a Cyt b gene with a nucleotide sequence shown as SEQ ID NO. 6.
Since the CO I gene can be easily amplified by the universal primer while enough variation can be ensured, and the DNA sequence itself has few insertions and deletions (even a few are mainly distributed at the 3-terminal of the gene, the analysis of the result is not greatly influenced). Meanwhile, the gene has the common characteristics of protein coding genes, namely, the third base of the codon is not influenced by natural selection pressure and can be freely mutated, so that a fragment in the CO I gene is selected as a DNA strip coding gene.
Cyt b gene is one of the most clearly studied structures and functions of mtDNA. The gene has the advantages of relatively conservative size and structure and moderate evolution speed, can show stable inheritance in the same species, and has obvious genetic difference among different species.
In a second aspect, the invention provides a kit for identifying Culicoides flavipes, comprising a first primer group capable of amplifying a CO I gene according to the first aspect of the invention and a second primer group capable of amplifying a Cyt b gene according to the first aspect of the invention, wherein the first primer group comprises a first upstream primer having a nucleotide sequence shown in SEQ ID NO. 1 and a first downstream primer having a nucleotide sequence shown in SEQ ID NO. 2, and the second primer group comprises a second upstream primer having a nucleotide sequence shown in SEQ ID NO. 3 and a second downstream primer having a nucleotide sequence shown in SEQ ID NO. 4.
In some embodiments of the invention, in the kit, the first upstream primer and the first downstream primer are mixed together.
In some embodiments of the invention, the second upstream primer and the second downstream primer are mixed together in the kit.
In some embodiments of the invention, the first forward primer and the first downstream primer and the second forward primer and the second downstream primer are all mixed together in the kit.
In some embodiments of the invention, the kit further comprises dNTPs, a buffer, and a DNA polymerase.
In other embodiments of the invention, the kit further comprises 2 x Mastermix.
A third aspect of the invention provides a method of identifying unknown culicoides as culicoides flavipes, comprising the steps of:
1) extracting the total DNA of unknown culicoides;
2) carrying out PCR amplification by using the first primer group and the second primer group respectively obtained in the step 1) as templates;
3) sequencing the amplification product of the first primer set and the amplification product of the second primer set respectively,
the unknown culicoides is Culicoides flavipes if the sequence amplified by the first primer set has a similarity of 98% or more to SEQ ID NO.5 and the sequence amplified by the second primer set has a similarity of 98% or more to SEQ ID NO. 6.
In some embodiments of the invention, total DNA is extracted from chest tissue of unknown culicoides.
In some embodiments of the present invention, a process of detecting the PCR amplification product by gel electrophoresis is further included between step 2) or step 3).
In some embodiments of the invention, the first primer set amplification product fragment is about 650bp in length and the second primer set amplification product fragment is about 410bp in length.
In some embodiments of the present invention, the PCR reaction system for performing PCR amplification using the first primer set in step 2) is 25 μ L, wherein: template DNA 1. mu.L, first forward primer 0.5. mu.L, first downstream primer 0.5. mu.L, 2 × Mastermix 4.25. mu.L, plus ddH2O is up to a final volume of 25. mu.L.
Further, the PCR reaction procedure for performing PCR amplification using the first primer set in step 2) is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
In some embodiments of the present invention, the PCR reaction system for performing PCR amplification using the second primer set in step 2) is 25 μ L, wherein: template DNA 1. mu.L, first forward primer 0.5. mu.L, first downstream primer 0.5. mu.L, 2 × Mastermix 4.25. mu.L, plus ddH2O is up to a final volume of 25. mu.L.
Further, the PCR reaction procedure for performing PCR amplification using the first primer set in step 2) is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
In still other embodiments of the present invention, in step 2), the total DNA obtained in step 1) is used as a template for PCR amplification simultaneously using the first primer set and the second primer set according to the first aspect of the present invention.
In some embodiments of the invention, the PCR reaction system for the PCR amplification is 20 μ Ι _ wherein: template DNA 1. mu.L, first forward primer 0.5. mu.L, second reverse primer 0.5. mu.L, 2 XPMastermix 4.25. mu.L, plus ddH2O is up to a final volume of 25. mu.L.
Further, the PCR reaction procedure for the PCR amplification is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
The invention has the advantages of
The method adopts a method of combining two different molecular markers to identify the culicoides flavipes, is favorable for realizing the accurate identification of the culicoides flavipes, and shortens the identification time.
A preparation method of a micro-DNA template of the small insects is adopted, a synthesized primer is used for amplifying a CO I gene and a Cyt b gene of Culicoides flavipes through optimized PCR reaction conditions, and a PCR product sequence is sent to a professional biological company for determination. The sequencing results were manually collated, sequence spliced, and BLAST homology searches were performed in NCBI to ensure that the resulting sequences were the target sequences. Species identification of Culicoides flavipes is realized by morphological identification, and authority rechecking is carried out, so that the reliability of results is ensured.
Drawings
FIG. 1 shows the electrophoretogram of the PCR product of the CoI gene of Culicoides flavipes. Description of numbering: lanes 1-3 are all the COI genes of the female culicoides flavipes, a band of about 658bp is detected, and lane 4 is a negative control. M is 2000bp DNA Ladder Marker.
FIG. 2 shows the electrophoretogram of the PCR product of the Cyt b gene of Culicoides flavipes. Description of numbering: lanes 1-3 are Cytb genes of Culicoides flavocauda females, and the detected band is about 414bp, while lane 4 is a negative control. M is 2000bp DNA Ladder Marker.
FIG. 3 shows the result of PCR amplification of the CO I and Cytb genes of unknown Culicoides culicoides. The numbering is as follows: lane 1 is a positive control, lane 2 is the CO I and Cytb genes of female unknown Culicoides culans, and specific bands of about 658bp and 414bp can be detected simultaneously, and lane 3 is a blank control. M is 2000bp DNA Ladder Marker.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.
Examples
The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Example 1 acquisition of CO I and Cytb Gene sequences from Culicoides flavipes
1. Preparation of Helicoides flavipes DNA template
Other samples collected from the same batch and morphologically identified as Culicoides flavipes were taken and the extracted DNA samples were stored at-20 ℃ for future use using an improved extraction of small insect trace DNA (proceedings of the chapter of literature, methods of research and technical introduction to entomology [ M ]. Beijing: scientific Press, 2010.278-286).
2. Primer synthesis
The primers used in this example are shown in Table 1:
TABLE 1 primer information of related genes
3. PCR amplification
The PCR reaction system of this example is shown in Table 2.
TABLE 2PCR reaction System (25. mu.L system)
| Composition (I) | Volume (μ L) |
| |
1 |
| |
0.5 |
| |
0.5 |
| 2×Mastermix | 4.25 |
| ddH2O | 18.75 |
The reaction procedure of this example is shown in Table 3.
TABLE 3PCR reaction procedure
The PCR product was stored at 4 ℃ until use.
4. PCR amplification product detection
mu.L of the PCR amplification product was subjected to electrophoresis on a 1% agarose gel (130V, 35min electrophoresis). Ethidium bromide staining, detection by a gel imaging system, and an electrophoretogram are shown in figures 1 and 2.
5. Gene sequence determination
3-5 PCR amplification products with good effects are selected and sent to a biological company for purification and sequencing (the primers used for sequencing are the same as those used for PCR), and the obtained gene sequences are corrected and spliced to respectively obtain a CO I gene sequence and a Cyt b gene sequence of Culicoides flavipes, as shown below.
CO I Gene sequence (SEQ ID NO:5)
TACTTTATATTTTATTTTTGGAGCCTGAGCAGGTATAGTAGGCACATCATTA AGAATATTAATCCGTGCAGAATTAGGCCACCCCGGAGCTTTAATTGGTAATGAC CAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGT AATGCCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCCTTAATGGTAGG GGCGCCAGATATGGCTTTCCCTCGAATAAATAATATAAGATTTTGAATACTACC CCCTTCCTTAACTTTATTATTGATAAGAAGCCTAGTAGAAAATGGGGCAGGTAC AGGATGAACAGTATACCCTCCTCTTTCTTCTAATATTTCCCATGCTGGGGCATCC GTCGATTTAGCAATTTTTTCATTACATTTAGCTGGGATCTCTTCTATCTTAGGGG CAGTAAATTTTATTACTACAATTATTAATATACGTTCTAACGGGATTACTTTCGA CCGTATGCCCCTATTTGCCTGATCCGTTTTAATTACTGCAATTTTACTTCTTCTAT CTTTGCCAGTATTAGCCGGAGCTATCACTATACTTCTTACAGATCGTAATATTAA TACTTCATTTTTTGACCCGGCCGGAGGAGGAGACCCCATTCTTTACCAACATCTT TTC
Cyt b gene sequence (SEQ ID NO:6)
TAATTACAAATCTTTTATCTGCCGTACCTTATCTTGGATTAGACCTAG TCCAATGATTATGAGGAGGATTTGCCGTAGATAACGCTACCCTAACCCGC TTTTTTACATTTCATTTTCTTATACCTTTTATAATTATAGGAGCTACAATAA TTCATTTATTATTTTTACATCAAACAGGATCTAATAATCCATTAGGAATTA GAACAAATTCTAATAAAATCCCCTTTCATCCATATTTTACTTATAAGGATT TAGTAGGATTTATAGTATTAACAATAGTATTATTTATTTTATCCCTAGAAG CTCCCTATTTATTAGGAGACCCCGATAATTTTATTCCCGCTAATCCTTTAG TGACCCCTGTCCATATTCAACCCGAATGGTACTTTTTATTTGCATATGCAA TTTTACGAT
Example 2 identification of unknown culicoides
1. Collection and preservation of specimens
The samples were collected by lamp induction and frozen to death and directly stored in 95% alcohol.
2. Pretreatment of test samples
And taking a culicoides sample preserved in 95% alcohol, dissecting under a dissecting mirror, and preparing a slide sample for morphological identification from the rest parts except the chest. And (4) carrying out molecular biology experiments after the chest of the culicoides is singly numbered, and ensuring that the culicoides corresponds to the slide specimen one by one. If the preservation needs to be carried out for a long time, the PCR tube with the Culicoides chest tissue part is placed in a refrigerator at the temperature of minus 20 ℃ for freezing storage.
3. DNA template preparation
Unknown culicoides genomic DNA (edited by the chapter of civilian protocol. entomology research methods and technical introduction [ M ]. Beijing: scientific Press, 2010.278-286) was extracted by a small insect minim DNA template preparation method, and the extracted DNA samples were stored at-20 ℃ for later use.
4. Amplification of target Gene sequences
3.1 primer Synthesis
All primers in this example were the same as in example 1.
3.2PCR amplification
The PCR reaction system of this example is shown in Table 4.
TABLE 4 PCR reaction System (50. mu.L system)
| Composition (I) | Volume (μ L) |
| |
2 |
| LCO1490 | 0.5 |
| HCO2198 | 0.5 |
| CytbFW | 0.5 |
| CytbRW | 0.5 |
| 2×Mastermix | 8.5 |
| ddH2O | 37.5 |
The PCR reaction conditions were the same as in example 1.
3.3 detection of PCR amplification products and determination of Gene sequences
mu.L of the PCR amplification product was subjected to electrophoresis on a 1% agarose gel (130V, 35min electrophoresis). Ethidium bromide staining. The gel imaging system detects, and the electrophoresis map is shown in figure 3. As seen in FIG. 3, the unknown Culicoides specific amplification using the CO I primer pair and Cyt b primer pair simultaneously amplified fragments of about 658bp and about 414bp, and the products of 658bp and 414bp were sent to the Biocompany for sequencing. The result shows that the sequence with the size of about 658bp has more than 99 percent of homology with SEQ ID NO.5, and the sequence with the size of about 414bp also has more than 99 percent of homology with SEQ ID NO.6, thereby determining that the unknown culicoides is Culicoides flavipes.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Hebei international travel health care center
<120> kit and method for identifying Culicoides flavipes
<130> XY-2019-1-W-008
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggtcaacaaa tcataaagat attgg 25
<210> 2
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
taaacttcag ggtgaccaaa aaatca 26
<210> 3
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggacaaatat cattttgagg agcwacag 28
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
attactcctc ctaatttatt aggaattg 28
<210> 5
<211> 658
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tactttatat tttatttttg gagcctgagc aggtatagta ggcacatcat taagaatatt 60
aatccgtgca gaattaggcc accccggagc tttaattggt aatgaccaaa tttataatgt 120
aattgttaca gctcatgctt ttattataat tttttttata gtaatgccaa ttataattgg 180
tggatttgga aattgattag ttcccttaat ggtaggggcg ccagatatgg ctttccctcg 240
aataaataat ataagatttt gaatactacc cccttcctta actttattat tgataagaag 300
cctagtagaa aatggggcag gtacaggatg aacagtatac cctcctcttt cttctaatat 360
ttcccatgct ggggcatccg tcgatttagc aattttttca ttacatttag ctgggatctc 420
ttctatctta ggggcagtaa attttattac tacaattatt aatatacgtt ctaacgggat 480
tactttcgac cgtatgcccc tatttgcctg atccgtttta attactgcaa ttttacttct 540
tctatctttg ccagtattag ccggagctat cactatactt cttacagatc gtaatattaa 600
tacttcattt tttgacccgg ccggaggagg agaccccatt ctttaccaac atcttttc 658
<210> 6
<211> 414
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
taattacaaa tcttttatct gccgtacctt atcttggatt agacctagtc caatgattat 60
gaggaggatt tgccgtagat aacgctaccc taacccgctt ttttacattt cattttctta 120
taccttttat aattatagga gctacaataa ttcatttatt atttttacat caaacaggat 180
ctaataatcc attaggaatt agaacaaatt ctaataaaat cccctttcat ccatatttta 240
cttataagga tttagtagga tttatagtat taacaatagt attatttatt ttatccctag 300
aagctcccta tttattagga gaccccgata attttattcc cgctaatcct ttagtgaccc 360
ctgtccatat tcaacccgaa tggtactttt tatttgcata tgcaatttta cgat 414
Claims (8)
1. A molecular marker for identifying Culicoides flavipes is characterized by consisting of a CO I gene with a nucleotide sequence shown in SEQ ID NO.5 and a Cyt b gene with a nucleotide sequence shown in SEQ ID NO. 6.
2. A method of identifying unknown culicoides as yellow culicoides, comprising the steps of:
1) extracting the total DNA of unknown culicoides;
2) performing PCR amplification by using the first primer group and the second primer group respectively by using the total DNA obtained in the step 1) as templates; the first primer group consists of a first upstream primer of a nucleotide sequence shown by SEQ ID NO. 1 and a first downstream primer of a nucleotide sequence shown by SEQ ID NO. 2, and the second primer group consists of a second upstream primer of a nucleotide sequence shown by SEQ ID NO. 3 and a second downstream primer of a nucleotide sequence shown by SEQ ID NO. 4;
3) and respectively sequencing the amplification products of the first primer group and the second primer group, wherein if the sequence obtained by amplification of the first primer group has more than 98% of similarity with SEQ ID NO.5, and the sequence obtained by amplification of the second primer group has more than 98% of similarity with SEQ ID NO.6, the unknown culicoides is Culicoides flavipes.
3. The method of claim 2, wherein the PCR reaction system for performing PCR amplification using the first primer set in 2) is 25 μ L, and wherein: template DNA 1. mu.L, first forward primer 0.5. mu.L, first downstream primer 0.5. mu.L, 2 × Mastermix 4.25. mu.L, plus ddH2O to a final volume of 25. mu.L.
4. The method of claim 3, wherein the PCR reaction procedure for PCR amplification using the first primer set in step 2) is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
5. The method of claim 4, wherein the PCR reaction system for performing PCR amplification using the second primer set in 2) is 25 μ L, and wherein: template DNA 1. mu.L, second forward primer 0.5. mu.L, second reverse primer 0.5. mu.L, 2 XPastemix 4.25. mu.L, plus ddH2O to a final volume of 25. mu.L.
6. The method of claim 5, wherein the PCR reaction procedure for PCR amplification using the second primer set in step 2) is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
7. The method according to claim 2, wherein the total DNA obtained in step 1) is used as a template for PCR amplification simultaneously using the first primer set and the second primer set in step 2).
8. The method of claim 7, wherein the PCR reaction system for PCR amplification is 25 μ L, wherein: template DNA 1. mu.L, first forward primer 0.5. mu.L, second reverse primer 0.5. mu.L, second forward primer 0.5. mu.L, second reverse primer 0.5. mu.L, 2 XPMastermix 4.25. mu.L, plus ddH2O to a final volume of 25. mu.L,
the PCR reaction procedure for the PCR amplification is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 45s, annealing at 48 ℃ for 60s, extension at 72 ℃ for 60s, and 35 cycles; extension at 72 ℃ for 10 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186463.4A CN109706251B (en) | 2019-03-13 | 2019-03-13 | Kit and method for identifying culicoides flavipes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186463.4A CN109706251B (en) | 2019-03-13 | 2019-03-13 | Kit and method for identifying culicoides flavipes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706251A CN109706251A (en) | 2019-05-03 |
| CN109706251B true CN109706251B (en) | 2022-03-11 |
Family
ID=66266681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910186463.4A Active CN109706251B (en) | 2019-03-13 | 2019-03-13 | Kit and method for identifying culicoides flavipes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706251B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0178435A2 (en) * | 1984-08-31 | 1986-04-23 | Research Corporation | cDNA probe for the detection of bluetongue virus |
| CN103805609A (en) * | 2014-03-03 | 2014-05-21 | 福建国际旅行卫生保健中心 | Molecular identification method for lasiohelea taiwana |
| CN105543249A (en) * | 2016-01-08 | 2016-05-04 | 福建国际旅行卫生保健中心 | Culicoides bellulus specific gene and molecular identification method thereof |
| CN108384791A (en) * | 2018-02-08 | 2018-08-10 | 南昌市疾病预防控制中心 | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge |
| CN108486121A (en) * | 2018-01-25 | 2018-09-04 | 遵义医学院 | A kind of specific DNA sequence and its method for identifying molecules of C.punctatus |
| CN110004232A (en) * | 2019-03-08 | 2019-07-12 | 四川国际旅行卫生保健中心 | The specific gene of east Storehouse midge, the kit and method for identifying east Storehouse midge |
-
2019
- 2019-03-13 CN CN201910186463.4A patent/CN109706251B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0178435A2 (en) * | 1984-08-31 | 1986-04-23 | Research Corporation | cDNA probe for the detection of bluetongue virus |
| CN103805609A (en) * | 2014-03-03 | 2014-05-21 | 福建国际旅行卫生保健中心 | Molecular identification method for lasiohelea taiwana |
| CN105543249A (en) * | 2016-01-08 | 2016-05-04 | 福建国际旅行卫生保健中心 | Culicoides bellulus specific gene and molecular identification method thereof |
| CN108486121A (en) * | 2018-01-25 | 2018-09-04 | 遵义医学院 | A kind of specific DNA sequence and its method for identifying molecules of C.punctatus |
| CN108384791A (en) * | 2018-02-08 | 2018-08-10 | 南昌市疾病预防控制中心 | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge |
| CN110004232A (en) * | 2019-03-08 | 2019-07-12 | 四川国际旅行卫生保健中心 | The specific gene of east Storehouse midge, the kit and method for identifying east Storehouse midge |
Non-Patent Citations (1)
| Title |
|---|
| Genetic characterization and molecular identification of the bloodmeal sources of the potential bluetongue vector Culicoides obsoletus in the Canary Islands, Spain;Josué Martínez-de la Puente et al;《Parasites & Vectors》;20120624;第05卷(第147期);第1-7页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706251A (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103805609B (en) | A kind of lasiohelea taiwana molecular assay method | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN105543249A (en) | Culicoides bellulus specific gene and molecular identification method thereof | |
| CN110607359A (en) | Patinopecten yessoensis female specific marker combination and application | |
| CN105483261A (en) | Specific gene and molecular identification method of culicoides cyancus | |
| CN109880893B (en) | Specific DNA fragment for sex identification of mystus guttatus and application | |
| CN108034733B (en) | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof | |
| CN111440882A (en) | PCR (polymerase chain reaction) amplification primer for identifying Coryngodon dauricus species in North Pacific ocean by environmental DNA (deoxyribonucleic acid) detection as well as detection method and application thereof | |
| CN113637765B (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application thereof | |
| CN117004701B (en) | Molecular marker for sex identification of apostichopus japonicus and application | |
| CN112746116B (en) | Litopenaeus vannamei female DNA label sequence, primer and application thereof in sex identification | |
| CN108486121B (en) | Specific DNA sequence of Cuicoides spinuloides and molecular identification method thereof | |
| CN109706251B (en) | Kit and method for identifying culicoides flavipes | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN111154852B (en) | Specific DNA fragment for sex identification of spiny eels and application thereof | |
| CN108384791A (en) | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge | |
| CN111378764A (en) | Identification method of seven species of coe (coe of species) genes based on coe (cytochrome oxidase I) vector culicoides | |
| CN111118174A (en) | Macrobrachium rosenbergii sex identification method based on PCR and sequencing technology | |
| CN108342398A (en) | A kind of specific gene and its method for identifying molecules of open country Storehouse midge | |
| CN108486122A (en) | A kind of the DNA bar code standard sequence and its method for identifying molecules of South Mountain Storehouse midge | |
| CN110878308A (en) | Specific gene of Culicoides acutifolia and bimolecular marker identification method thereof | |
| CN106591426A (en) | COI gene standard complete sequence and molecular identification method of hoolock leuconedys | |
| CN110004232A (en) | The specific gene of east Storehouse midge, the kit and method for identifying east Storehouse midge | |
| CN111926087A (en) | DNA bar code for identifying unscheduled sp of flatfish and flatfish with transverse band, and identification method and application thereof | |
| CN111631174A (en) | Breeding method of Cyprinus carpiod |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |