CN108384791A - A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge - Google Patents
A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge Download PDFInfo
- Publication number
- CN108384791A CN108384791A CN201810131039.5A CN201810131039A CN108384791A CN 108384791 A CN108384791 A CN 108384791A CN 201810131039 A CN201810131039 A CN 201810131039A CN 108384791 A CN108384791 A CN 108384791A
- Authority
- CN
- China
- Prior art keywords
- storehouse midge
- beijing
- primer
- pcr
- midge
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0053—Oxidoreductases (1.) acting on a heme group of donors (1.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y109/00—Oxidoreductases acting on a heme group of donors (1.9)
- C12Y109/03—Oxidoreductases acting on a heme group of donors (1.9) with oxygen as acceptor (1.9.3)
- C12Y109/03001—Cytochrome-c oxidase (1.9.3.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of specific genes and its method for identifying molecules of Beijing Storehouse midge, it is characterised in that the COI gene orders that the Storehouse midge is obtained using molecular biology method carry out Identification of Species by the comparison of gene order similitude to the Storehouse midge.Storehouse midge method for identifying molecules in Beijing provided by the invention is advantageously implemented Beijing Storehouse midge and accurately and rapidly identifies.
Description
Technical field
The present invention relates to the present invention relates to species identification fields, more particularly to specific gene and its molecule mirror of Beijing Storehouse midge
Determine method.
Background technology
Storehouse midge of sucking blood is a kind of microminiature insect, can propagate and carry blue tongue disease, filariasis, Ao Luopuqie viruses, western Buddhist nun
Sieve river encephalapthy agent, is important one of medical insect.In recent years, with global warming, make Storehouse midge to a certain extent
The ability for propagating insect-borne diseases virus improves, and so that the distribution of medium Storehouse midge is expanded to terrestrial pole and high altitude localities, library
Midge population dispersion arboviruse increases to faunistic ability, some traditional " non-medium " Storehouse midge types are provided with propagation epidemic disease
Ability.The insect-borne diseases propagated by Storehouse midge such as blue tongue disease, vesicular stomatitis, applies Maron shellfish lattice disease etc. at deer epidemic hemorrhage,
The propagation of some global countries and prevalence, cause huge economic loss, serious prestige are constituted to animal husbandry development
The side of body.
It is recorded simultaneously according to pertinent literature, Heleidae known to the whole world has 5360 kinds of 125 category.Blood―sucking midges in Heleidae are Heleidaes
The general name that the animal species such as thorn people and poultry can be stung in insect, is one of important monoid of medical insect, type the whole world
Know there is 1503 kinds of 4 category, 4 categories include Bitting midge (Culicoides), Lasiohelea (Lasiohlea), Leptoconops
(Leptoconops) and Australia's midge category (Austroconops).Wherein Bitting midge is a maximum category and four big suctions in Heleidae
Blood midge is distributed the category that most wide, midge kind is most, most close with people and animals' relationship in belonging to, and inhales humans and animals blood, spreads the disease,
It is detrimental to health, animal husbandry development is influenced very big.Now know that Storehouse midge there are 1247 kinds, accounts for 23.3% of Heleidae known to the world, account for
The 83% of known 4 blood sucking midges category.Show that China Storehouse midge sociales are gradually prominent from south to north according to community diversity analysis result
Go out, and then south is higher than the north to diversity indices.There are 133 kinds in the Storehouse midge type that south China tropical rain forest area is found.
It can be seen that being to control midge to pass the important foundation of disease and the core of prevention and control of diseases to the precise Identification for Storehouse midge of sucking blood
Heart premise.But since blood sucking midge build is small, Morphological Identification is more complicated, while there is many with similar in a variety of inter-species
The complex (Complex) of hidden kind (Cryptic species) composition of feature or kind group (group), only small part experience
Abundant taxology expert could effectively identify its type.And the success or failure of Morphological Identification are also needed by making complete glass
Piece sample is completed, and preparation of specimen's process steps are cumbersome, and the period is long, difficulty is big.Therefore for Storehouse midge of sucking blood, there is an urgent need to one kind
New method improves efficiency and the accuracy of classification to make up the defect of conventional sorting methods.Wherein, Beijing Storehouse midge
(Culicoides morisitai), the country are distributed in Hebei, Shanxi, Taiwan, Guangdong, the ground such as Hubei.Therefore, a kind of needle is established
To the new discrimination method of Beijing Storehouse midge, Beijing Storehouse midge is quick and precisely identified and distinguished, it will help the investigation of potential medium is ground
Study carefully, to understand fully distributed quantity dynamic, the life habit of medium Storehouse midge, and grasps the activity rule of its each phase under various conditions
Rule carries out effectively anti-system, the control for China's medium transmissible disease and provides theoretical foundation.
Molecular classification technology is to illustrate the difference between species from molecular level so that hereditary material DNA sequence analysis is foundation
On quickly and accurately differentiate species, it is the product that molecular biology, computer science are combined with traditional taxonomy, as
A kind of brand-new taxology technology greatly compensates for the defect of traditional form identification.Wherein, DNA bar code technology (DNA
Barcoding) analyzed by the DNA sequence dna to a standard target gene, to quickly and accurately carry out species mirror
Fixed technology.In recent years, DNA bar code technology had proved to be an effective bioassay means, not only can be right
Conventional identification method makees strong supplement, and because it is more objective, accurate, breakthrough in the past depended on experience unduly, energy
Help the Evolvement etc. for identifying species, finding novel species and hidden kind, rebuilding species and higher level taxa.
As the standard target gene of DNA bar code, on the one hand must guard enough, it is big convenient for being carried out using universal primer
The amplification of range；On the other hand, enough variations distinguish different species.Therefore, identify that different species monoids needs
Select effective target gene.Currently, widely applied marker gene is ribosomes 12S and 16S in systematic growth research
Gene, but because it has a large amount of insertion and deficient phenomena, bar code gene should not be used as.13 present in mitochondrial genomes
Only cytochrome oxidase subunit I (CytochromeOxidaseSubunitI, COI), mitochondria are thin in a protein coding gene
Born of the same parents' pigment b (Cytb), ND4, ND5 this 4 genes meet gene be inserted into and deficient phenomena is less, length 900bp or so this two
A condition, but ND4, ND5 evolution are too fast, it is impossible to universal primer is designed, limits them as comprehensive DNA identification systems
Target gene.Therefore, people finally select a segment in COI genes as DNA bar code gene.
Currently, application of this method in Storehouse midge Molecular Identification is limited to a small number of Storehouse midges, such as patent
CN105483261A is related to the specific gene and its method for identifying molecules of blue abdomen Storehouse midge, and CN105543249A is related to a kind of beautiful library
Midge specific gene and its method for identifying molecules, a kind of specific gene of Thailand's Storehouse midges of CN105543364A and its Molecular Identification side
Method.The correlation technique to Beijing Storehouse midge is not set up in currently available technology also, the application innovation is using based on COI bases
The DNA bar code technology of cause carries out Molecular Identification to Storehouse midge of sucking blood, especially Beijing Storehouse midge.This method can be with traditional form
It learns identification method to use simultaneously, mutually prove, can not only solve the hardly possible of preparation of specimen present in Morphological Identification, sample incompleteness is not
It is complete fubaritic, there is a problem of that hidden kind is identified mistake, and be advantageously implemented the Rapid identification of Beijing Storehouse midge.
Also only have the COI gene orders of a small number of Storehouse midges in Genbank, but there is no the related gene sequence of Beijing Storehouse midge so far
Row.Another innovation of the invention is to have obtained the COI gene orders of Beijing Storehouse midge by this method.It is provided by the invention
Beijing Storehouse midge special gene sequence is advantageously implemented the Rapid identification of Beijing Storehouse midge, improves identification accuracy and efficiency.
Invention content
After having read the detailed description of preferred embodiment and appended claims, these and other mesh of the invention
, advantage and purposes will show those skilled in the art.The purpose of the present invention is to provide a kind of spies of Beijing Storehouse midge
Allogene sequence and its method for identifying molecules.Beijing Storehouse midge (Culicoides is obtained by molecular biology method
Morisitai) specific gene-COI gene orders can accurately and rapidly identify Beijing by the comparison of gene order similitude
Storehouse midge.
To achieve the above object, the present invention is achieved through the following technical solutions：
Using small insects trace DNA templet vegetation method, pass through improved PCR reaction conditions, synthetic primer amplification north
The COI genes of capital Storehouse midge, the PCR product after amplification send professional biotech firm to measure and carry out the splicing of sequence.Sequencing result is logical
Cross check and correction, and the Blast similarity searchings in NCBI by hand, it is ensured that gained sequence is target sequence.Beijing of the present invention
Storehouse midge specific gene is COI genes, and the COI gene orders of the Storehouse midge are as shown in SEQ ID No.1.
GATATTGGAACTCTATACTTTATTTTTGGGGCATGGGCCG 40
GAATAGTAGGAACGTCCCTGAGAATTTTAATTCGAGCAGA 80
ATTAGGGCACCCGGGGGCTCTAATTGGAAACGATCAAATT 120
TATAATGTGATTGTAACCGCCCATGCTTTTGTAATAATTT 160
TTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAA 200
TTGACTTGTTCCTTTAATGCTAGGGGCCCCTGATATAGCT 240
TTCCCCCGGATAAACAATATAAGTTTTTGAATACTCCCCC 280
CTTCTTTATCCTTATTATTAATTAGAAGTCTAGTAGAAAA 320
TGGAGCAGGTACAGGATGAACTGTTTACCCTCCTTTATCC 360
GCCAATGTTTCTCATGCAGGAGCTTCTGTTGACTTAGCTA 400
TCTTTTCTCTTCATTTGGCAGGAATTTCATCTATTTTAGG 440
GGCAGTTAATTTTATCACAACAATTATTAATATACGATCT 480
AATGGGATTACTTTTGATCGAATACCTCTTTTTGTTTGAT 520
CAGTTCTTATTACAGCTATTTTATTATTATTATCTTTACC 560
AGTTTTAGCAGGAGCTATCACTATATTATTAACAGATCGT 600
AATATTAATACTTCTTTCTTTGACCCTGCAGGAGGAGGAG 640
ACCCAATTTTATACCAACATTTATTTTGATTTTTTGGCCC 680
GGA 683
The PCR primer of Beijing Storehouse midge COI genes, it is characterised in that PCR primer sequence is：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 '
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 '.
The method for identifying molecules of Beijing Storehouse midge of the present invention, including：
1) the separation and Extraction DNA from Storehouse midge tissue to be measured；
2) using the DNA as template, primer that COI genes are used for：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 '
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 '
Beijing Storehouse midge COI genes are amplified by PCR (PCR)；
3) the COI gene outcomes after taking appropriate step 2) to expand are detached with agarose electrophoresis, after ethidium bromide (EB) dyeing
It is observed under gel imaging system, according to the judgement of the size of amplified production as a result, being about if energy specific amplification goes out size
The band of 683bp, send biotech firm to be sequenced；
4) according to sequencing result, if accordingly COI gene orders and the similitude of SEQ ID No.1 are 98% or more, i.e.,
It can determine whether that the insect tissue to be measured is Beijing Storehouse midge.
The Identification of Species of Beijing Storehouse midge is realized by Morphological Identification, and is checked through authoritative expert, ensure that identification knot
The accurate and reliability of fruit.The present invention can use agarose gel electrophoresis detection method to detect PCR amplification result.
Advantages of the present invention is：
1) method that the present invention is combined using traditional Morphological Identification with molecular identification, to the Storehouse midge of sucking blood
It is identified, it can be ensured that the accuracy and reliability of species identification.
2) compared with traditional Morphological Identification method, the method for identifying molecules for Beijing Storehouse midge that the present invention establishes can be effective
Improve the qualification time and accuracy of Beijing Storehouse midge.
Description of the drawings
Fig. 1 is Beijing Storehouse midge COI gene PCR amplification electroresis appraisal figures, and number is described as follows：Swimming lane 1 is negative right
According to swimming lane 2 is the COI genes of Beijing Storehouse midge female adult, and the band that detection size is about 683bp, M is the DNA of DM2000
Marker；
Fig. 2 is unknown Storehouse midge COI gene PCRs amplification electroresis appraisal figure, and number is described as follows：Swimming lane 1 is negative right
According to swimming lane 2 is the COI genes of unknown Storehouse midge female adult, and the band that detection size is about 683bp, M is the DNA of DM2000
Marker。
Specific implementation mode
It should be noted that in the absence of conflict, the features in the embodiments and the embodiments of the present application can phase
Mutually combination.Below in conjunction with embodiment, the present invention will be described in detail.
The acquisition of 1 Beijing Storehouse midge of embodiment (Culicoides morisitai) COI gene orders
1. the acquisition of Beijing Storehouse midge sample
Beijing Storehouse midge is the sample that mosquito luring lamp acquisition in field obtains, and 95% wine is directly stored in after the chilled execution of sample
In essence.Sample is identified after slide sample is made through authoritative expert, it is ensured that the accuracy of qualification result.Before preparation of specimen, picking
The chest and foot of Beijing Storehouse midge are used for the extraction of DNA.
2. the making of slide sample
Reference Ceratopogonidae Slide processing (Yu Yixin is edited,《Chinese Ceratopogonidae》, Beijing, military medicine science
Publishing house, 2006, pp1682-1683)
The preparation of 3.DNA templates
Using small insects trace DNA templet preparation method extract Beijing Storehouse midge DNA (Wen Lizhang edit,《Entomology research
Method and technology introduction》, Beijing：Science Press, 2010.pp：278-286), the DNA sample of extraction be stored in -20 DEG C it is standby
With.
4. primer synthesizes
This implementation the primer is as follows：Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 ', reverse primer
5’-TAAACTTCAGGGTGACCAAAAAATCA-3’
5.PCR is expanded
The PCR reaction systems of the present embodiment are as shown in table 1.
1. Beijing Storehouse midge COI gene PCRs reaction system (50 μ L systems) of table
| Ingredient | Volume (μ L) |
| Template | 5 |
| Mix primer (primer 1 and primer 2) | 2.5 |
| 2×PCR Master Mix | 25 |
| ddH2O | 17.5 |
Response procedures are as shown in table 2, and PCR product is stored in 4 DEG C and saves backup.
2 Beijing Storehouse midge COI gene PCR response procedures of table
| Step | Reaction temperature (DEG C) | Time | Recurring number |
| Pre-degeneration | 94 | 3min | - |
| Denaturation | 94 | 45s | 35 |
| Annealing | 50 | 45s | 35 |
| Extend | 72 | 60s | 35 |
| Extend | 72 | 10min | - |
6.PCR product amplifications detect
5 μ LPCR amplified productions are taken, with 1% agarose gel electrophoresis (150V voltages, 75mA electric currents, 30min).Bromine second
Ingot dyes, and gel imaging system detection, electrophoresis pattern is referring to Fig. 1.
7. gene sequencing
The 5-10 preferable pcr amplification product of electrophoresis detection effect of selection send two-way after purification by profession sequencing biotech firm
Sequencing (sequencing the primer is identical as PCR primer) is the COI genes of Beijing Storehouse midge after gained spliced gene sequence is calibrated
Sequence-SEQ ID No.1.
The identification of 2 unknown Storehouse midge of embodiment
1. the acquisition and preservation of sample
Scene lures method, extension morning in evening to take in row and trap using lamp, and harvest is directly stored in 95% after obtaining the chilled execution of sample
In alcohol.
The preparation of 2.DNA templates
Beijing Storehouse midge DNA is extracted using small insects trace DNA templet preparation method, specific method is the same as embodiment 1, extraction
DNA sample be stored in -20 DEG C it is spare.
3. the acquisition of objective gene sequence
3.1 primers synthesize
Using the unknown Storehouse midge DNA of acquisition as template, synthetic primer, the primer sequence is as follows：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 '
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 '
3.2.PCR amplification
The PCR reaction systems of the present embodiment are as shown in table 3.
3. unknown Beijing Storehouse midge COI gene PCRs reaction system (50 μ L systems) of table
The response procedures of the present embodiment are as shown in table 4, PCR product be stored in 4 DEG C it is spare.
4 Beijing Storehouse midge COI gene PCR response procedures of table
| Step | Reaction temperature (DEG C) | Time | Recurring number |
| Pre-degeneration | 94 | 3min | - |
| Denaturation | 94 | 45s | 35 |
| Annealing | 50 | 45s | 35 |
| Extend | 72 | 60s | 35 |
| Extend | 72 | 10min | - |
3.3 pcr amplification products detect and gene sequencing
5 μ LPCR amplified productions are taken, with 1% agarose gel electrophoresis (150V voltages, 75mA electric currents, 30min).Bromine second
Ingot dyes, and gel imaging system detection, electrophoresis pattern is referring to attached drawing 2.Find out that the unknown Storehouse midge of embodiment 2 also can be special by attached drawing 2
Specific amplification goes out the product that size is about 683bp, send professional biological order-checking company to be sequenced this product, as a result display and gene sequence
The similitude for arranging SEQ ID No.1 is 99.9%, thus can determine that the unknown Storehouse midge is Beijing Storehouse midge.
Although the present invention has been described in detail, it will be understood by those skilled in the art that in spirit and scope of the invention
Modification will be apparent.However, it should be understood that various aspects, different specific implementation mode that the present invention records
Each section and the various features enumerated can be combined or all or part of exchange.In above-mentioned each specific implementation mode, that
A little embodiments with reference to another embodiment can be combined suitably with other embodiment, this is will be by this field skill
Art personnel are to understand.In addition, it will be understood to those of skill in the art that the description of front is only exemplary mode, not purport
In the limitation present invention.
Sequence table
<110>Nanchang Municipal Center for Disease Control ＆ Prevention
<120>A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge
<130> 2018
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 683
<212> DNA
<213>Storehouse midge（Culicoides morisitai）
<400> 1
gatattggaa ctctatactt tatttttggg gcatgggccg gaatagtagg aacgtccctg 60
agaattttaa ttcgagcaga attagggcac ccgggggctc taattggaaa cgatcaaatt 120
tataatgtga ttgtaaccgc ccatgctttt gtaataattt tttttatagt tataccaatt 180
ataattggag gatttggaaa ttgacttgtt cctttaatgc taggggcccc tgatatagct 240
ttcccccgga taaacaatat aagtttttga atactccccc cttctttatc cttattatta 300
attagaagtc tagtagaaaa tggagcaggt acaggatgaa ctgtttaccc tcctttatcc 360
gccaatgttt ctcatgcagg agcttctgtt gacttagcta tcttttctct tcatttggca 420
ggaatttcat ctattttagg ggcagttaat tttatcacaa caattattaa tatacgatct 480
aatgggatta cttttgatcg aatacctctt tttgtttgat cagttcttat tacagctatt 540
ttattattat tatctttacc agttttagca ggagctatca ctatattatt aacagatcgt 600
aatattaata cttctttctt tgaccctgca ggaggaggag acccaatttt ataccaacat 660
ttattttgat tttttggccc gga 683
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ggtcaacaaa tcataaagat attgg 25
<210> 3
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
taaacttcag ggtgaccaaa aaatca 26
Claims (5)
1. a kind of Beijing Storehouse midge specific gene, which is characterized in that the gene is COI genes, is had such as SEQ ID No.1 institutes
The sequence shown.
2. the PCR primer of the C01 genes of Storehouse midge described in claim 1.
3. the PCR primer of the COI genes of the Storehouse midge described in claim 2, which is characterized in that preferred, PCR primer sequence difference
For：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 '
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 '.
4. a kind of method for identifying molecules of Beijing Storehouse midge, which is characterized in that include the following steps：
4.1 from Storehouse midge tissue to be measured separation and Extraction DNA；
4.2 using the DNA as template, the primer that COI genes are used for：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 ',
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 ' amplifies north by PCR (PCR)
Capital Storehouse midge COI genes；
4.3 take the COI gene outcomes after appropriate step 4.2 amplification to be detached with agarose electrophoresis, in gel after ethidium bromide staining
It is observed under imaging system, according to the judgement of the size of amplified production as a result, if energy specific amplification goes out the item that size is about 683bp
Band, sequencing；
4.4 according to sequencing result, if corresponding COI gene orders and the similitude of SEQ ID No.1 are 98% or more, you can sentence
The insect tissue to be measured that breaks is Beijing Storehouse midge.
5. a kind of method for identifying molecules of Beijing Storehouse midge, which is characterized in that include the following steps：
5.1. the acquisition and preservation of sample
Scene lures method, extension morning in evening to take in row and trap using lamp, and harvest is directly stored in 95% alcohol after obtaining the chilled execution of sample
In；
5.2.DNA the preparation of template
Beijing Storehouse midge DNA is extracted using small insects trace DNA templet preparation method, the DNA sample of extraction be stored in -20 DEG C it is standby
With；
5.3. the acquisition of objective gene sequence
Primer synthesizes：Using the unknown Storehouse midge DNA of acquisition as template, synthetic primer, the primer sequence is as follows：
Forward primer 5 '-GGTCAACAAATCATAAAGATATTGG-3 '
Reverse primer 5 '-TAAACTTCAGGGTGACCAAAAAATCA-3 '
PCR amplification：It is as follows that PCR reacts 50 μ L systems：5 μ L of template, forward primer and reverse primer mix 2.5 μ L, 2 × PCR
Master Mix 25μL、ddH2O 17.5μL；PCR product be stored in 4 DEG C it is spare；
5.4PCR amplified productions detect and gene sequencing
5 μ LPCR amplified productions are taken, with 1% agarose gel electrophoresis, 150V voltages, 75mA electric currents, 30min；Ethidium bromide contaminates
Color, gel imaging system detection, if specific amplification goes out the product that size is about 683bp, as a result sequencing is shown and gene sequence
The similitude for arranging SEQ ID No.1 is 99.9%, then can determine that as Beijing Storehouse midge.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131039.5A CN108384791A (en) | 2018-02-08 | 2018-02-08 | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131039.5A CN108384791A (en) | 2018-02-08 | 2018-02-08 | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108384791A true CN108384791A (en) | 2018-08-10 |
Family
ID=63074765
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810131039.5A Pending CN108384791A (en) | 2018-02-08 | 2018-02-08 | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108384791A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517909A (en) * | 2019-01-25 | 2019-03-26 | 河北国际旅行卫生保健中心 | A kind of kit and method for identifying Ryukyu's Storehouse midge |
| CN109706251A (en) * | 2019-03-13 | 2019-05-03 | 河北国际旅行卫生保健中心 | A kind of kit and method for identifying yellow Storehouse midge |
| CN111378764A (en) * | 2020-04-14 | 2020-07-07 | 遵义医科大学 | Identification method of seven species of coe (coe of species) genes based on coe (cytochrome oxidase I) vector culicoides |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805609B (en) * | 2014-03-03 | 2016-01-20 | 福建国际旅行卫生保健中心 | A kind of lasiohelea taiwana molecular assay method |
-
2018
- 2018-02-08 CN CN201810131039.5A patent/CN108384791A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805609B (en) * | 2014-03-03 | 2016-01-20 | 福建国际旅行卫生保健中心 | A kind of lasiohelea taiwana molecular assay method |
Non-Patent Citations (1)
| Title |
|---|
| YANGQING LIU等: "Molecular differentiation and species composition of genus Culicoides biting midges (Diptera: Ceratopogonidae) in different habitats in southern China", 《VETERINARY PARASITOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517909A (en) * | 2019-01-25 | 2019-03-26 | 河北国际旅行卫生保健中心 | A kind of kit and method for identifying Ryukyu's Storehouse midge |
| CN109706251A (en) * | 2019-03-13 | 2019-05-03 | 河北国际旅行卫生保健中心 | A kind of kit and method for identifying yellow Storehouse midge |
| CN109706251B (en) * | 2019-03-13 | 2022-03-11 | 河北国际旅行卫生保健中心 | Kit and method for identifying culicoides flavipes |
| CN111378764A (en) * | 2020-04-14 | 2020-07-07 | 遵义医科大学 | Identification method of seven species of coe (coe of species) genes based on coe (cytochrome oxidase I) vector culicoides |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103805609B (en) | A kind of lasiohelea taiwana molecular assay method | |
| CN108384791A (en) | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge | |
| CN105483261B (en) | A kind of specific gene and its method for identifying molecules of indigo plant abdomen Storehouse midge | |
| CN106048065B (en) | Mandarin sturgeon environment DNA detects PCR amplification primer and its detection method and application | |
| CN105543249B (en) | A kind of beauty Storehouse midge specific gene and its method for identifying molecules | |
| CN106086167A (en) | A kind of Rapid identification Carnis Pseudosciaenae, Carnis Pseudosciaenae and the primer sequence of Collichthys lucidus and method | |
| Temereva et al. | A new phoronid species, Phoronis embryolabi, with a novel type of development, and consideration of phoronid taxonomy and DNA barcoding | |
| CN110195126A (en) | SSR core primers group and its application based on bitter buckwheat full-length genome data mining | |
| CN108342398A (en) | A kind of specific gene and its method for identifying molecules of open country Storehouse midge | |
| CN105543364B (en) | A kind of specific gene and its method for identifying molecules of Thailand's Storehouse midge | |
| CN108034733A (en) | The DNA bar code standard sequence and its method for identifying molecules of a kind of Storehouse midge sibling species | |
| CN117144022A (en) | Long Lin Xiaodu RPA-LFD detection primer, probe and detection method | |
| CN110257528B (en) | Codling moth specific SS-COII primer and application thereof | |
| CN108486121B (en) | Specific DNA sequence of Cuicoides spinuloides and molecular identification method thereof | |
| Kulich et al. | Avipoxvirus in blackcaps (Sylvia atricapilla) | |
| CN108486122A (en) | A kind of the DNA bar code standard sequence and its method for identifying molecules of South Mountain Storehouse midge | |
| Guan et al. | Comparative analysis of the morphology, karyotypes and biochemical composition of muscle in Siniperca chuatsi, Siniperca scherzeri and the F1 hybrid (S. chuatsi♀× S. scherzeri♂) | |
| CN107988232A (en) | The DNA bar code standard sequence and its method for identifying molecules of a kind of open country Storehouse midge | |
| CN109234451A (en) | A kind of Tilapia mossambica parvovirus TiPV CPA detection primer and application | |
| CN106011251A (en) | Primer group, kit and method for identifying population genetic structure of Hemerocallis L. plants | |
| Lekesyte et al. | What's on the menu: Drosera rotundifolia diet determination using DNA data | |
| CN107523577B (en) | Specific DNA sequence for identifying furuncle swift moth | |
| CN110004232A (en) | The specific gene of east Storehouse midge, the kit and method for identifying east Storehouse midge | |
| CN109706251B (en) | Kit and method for identifying culicoides flavipes | |
| CN110964839A (en) | Method for detecting growth traits of cattle under assistance of SERPINA3-1 gene CNV marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180810 |