CN107523577B - Specific DNA sequence for identifying furuncle swift moth - Google Patents
Specific DNA sequence for identifying furuncle swift moth Download PDFInfo
- Publication number
- CN107523577B CN107523577B CN201710023904.XA CN201710023904A CN107523577B CN 107523577 B CN107523577 B CN 107523577B CN 201710023904 A CN201710023904 A CN 201710023904A CN 107523577 B CN107523577 B CN 107523577B
- Authority
- CN
- China
- Prior art keywords
- furuncle
- gene
- moth
- sequence
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0053—Oxidoreductases (1.) acting on a heme group of donors (1.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y109/00—Oxidoreductases acting on a heme group of donors (1.9)
- C12Y109/03—Oxidoreductases acting on a heme group of donors (1.9) with oxygen as acceptor (1.9.3)
- C12Y109/03001—Cytochrome-c oxidase (1.9.3.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific DNA sequence for identifying furuncle moth endo lita nodus (Chu and Wang,1985) (synonym: Phassus nodus Chu et Wang,1985), which is characterized in that the specific detection gene is a CO I gene and has a gene sequence SEQ ID NO. 1. The sequencing result is subjected to manual proofreading and sequence splicing, and Blast similarity search in NCBI (national center for Biotechnology information) is carried out to ensure that the obtained sequence is a specific target DNA sequence. The species identification of the furuncle and the bat moth is realized by morphological identification, thereby ensuring the reliability of results. The specific DNA sequence of the furuncle-bat moth provided by the invention is beneficial to realizing the rapid and accurate identification of different insect states and incomplete specimens of the furuncle-bat moth.
Description
Technical Field
The invention relates to a DNA barcode standard gene sequence of a furuncle moth, which is used for the rapid and accurate identification of the species.
Background
Furuncle bat mothEndoclita nodus(Chu and Wang,1985) (synonyms:Phassus nodusChuetwang,1985), Hepialidae (Hepialoid) Hepialidae (Paecilomyces: (Hepialidae)Endoclita) The insect is a common trunk-boring insect in southern areas of China, and particularly likes the species of the great green. The young insects eat the phloem and xylem, so that the harmful plants grow badly and the wood cannot be utilized by the light insects, and the heavy insects easily fall down or die. The larva can be parasitized by cordyceps to form an entomogenous fungi combination-cordyceps. The cordyceps sinensis is a special rare medicinal material, can enhance the immunity of the organism, nourish the lung and kidney, and has obvious inhibiting effect on lung cancer, liver cancer and the like. It can be used for treating chronic cough due to lung deficiency, asthma, hemoptysis due to pulmonary tuberculosis, night sweat, soreness of waist and knees due to kidney deficiency, sexual impotence, spermatorrhea, neurasthenia, and erythrocyte decline after chemotherapy and radiotherapy.
The accurate identification and identification of the furuncle and the bat moth are not only beneficial to forestry departments to take targeted measures to control the damage of the furuncle and the bat moth to forest trees, but also are the basis for the development and utilization of cordyceps sinensis resources of the worm, and are also the core steps for the research of the development relationship of the hepialidae molecular system. At present, the identification of the furuncle and the bat moth is mainly realized by an experienced insect classificator according to the morphological characteristics of adults, and the identification of other insect states needs to be raised to adults. Because the feeding period of the worm is long, the difficulty is high, particularly, the worm is more difficult to distinguish and identify on specimens with incomplete forms, different worm states and the stiff worm state of the larvae after being parasitized by cordyceps, and a new quick and accurate method is urgently needed to be found to make up the defects of the traditional morphological classification method.
The DNA Barcoding technology (DNA Barcoding) is a new biological identification system created by using the specificity and interspecies diversity of standard, sufficiently mutated, easily amplified and relatively short DNA fragments (DNA barcode) per se, and can rapidly and automatically identify the species. Briefly, this is a technique for rapid and accurate identification of species by using one or a few short DNA gene fragments as barcodes. In recent years, the bar code technology has proved to be an effective biological identification means, which not only can make a powerful supplement to the traditional identification method, but also can help identify species, discover new species and hidden species, reconstruct the evolution relationship of species and high-level order, etc. because it is more objective and accurate, breaks through the past over-dependence on experience.
The ideal DNA barcoding should meet the following criteria: (1) sufficient variability to distinguish between different species, while being relatively conservative; (2) it is necessary to have a standard DNA region to identify as many different taxa as possible; (3) the target DNA region should contain sufficient phylogenetic information to localize the species in a taxonomic system (family, genus, etc.); (4) should be a highly conserved primer design region to facilitate the design of universal primers; (5) the target DNA region should be short enough to facilitate amplification of the partially degraded DNA. At present, the marker genes widely used in phylogenetic studies are ribosomal 12S and 16S genes, but they are not suitable for use as barcode genes due to the large number of insertions and deletions. Cytochrome Oxidase Subunit I (CO I) genes in 13 protein coding genes existing in a mitochondrial genome meet the two conditions of less gene insertion and deletion phenomena and about 900bp in length, and a universal primer is easy to design, so that one fragment in the CO I genes is finally selected as a DNA strip coding gene. To date, many studies have demonstrated that the CO I gene is effective in the classification and identification of groups such as birds, fish, lepidopteran insects, mosquitoes, ants, and college, and therefore, the molecular identification of furuncle and moths can be performed by using a DNA barcode technology based on the CO I gene. The method is mutually proved with the traditional classification method, not only can solve the problem of species identification of different insect states and incomplete specimens of the furuncle and the moth, but also is beneficial to realizing the rapid identification of the insect. At present, no record of the furuncle bat moth exists in the National Center for Biotechnology Information (NCBI) database, and no report is made. The DNA barcode standard gene sequence provided by the invention can realize the rapid identification of the furuncle and the moth and shorten the identification time.
Disclosure of Invention
The invention aims to provide a DNA barcode standard gene sequence of a furuncle moth, and realize the rapid and accurate identification of the furuncle moth.
A DNA barcode standard detection gene for furuncle and moth is characterized in that the barcode standard detection gene is a COI gene and has a gene sequence SEQ ID NO. 1:
ttttattttt ggtatttgag caggaataat tggaacttcg ttaagattat taattcgaac 60
agaattaggt aatcctggat ctttaattgg agatgatcaa atttataatg taattgtaac 120
agcacatgct tttattataa ttttttttat agttatacct attataattg gtggatttgg 180
taattgatta gtacctttaa tattaggagc tcctgatata gcttttccac gattaaataa 240
tataagattt tgattattac ccccttcatt aatactatta atttctagaa gaattgtaga 300
aaatggagctggaacaggtt gaacagtcta tcccccatta tctgcaaata ttgcacatgc 360
tggtagatca gtggatttag caattttttc cttacattta gcaggtattt catctatttt 420
aggggcagtc aattttatta caactgtaat taatatacga tcggaaggaa tatcttttga 480
ccgaatacca ttatttgtat gaagagttgc aattactgct ttattacttt tattatcttt 540
acctgtatta gcaggagcta ttactatatt actaacagac cgaaatttaa atacttcatt 600
ttttgaccct gctgggggag gggatcctat tttataccaa catttatttt gatttttt 658。
the PCR primer of the DNA barcode standard detection gene of the furuncle and moth is characterized in that the sequence of the PCR primer is as follows:
forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3'
The reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3'.
The invention discloses a molecular identification method of a furuncle and bat moth, which comprises the following steps:
1) separating and extracting DNA from the tissue of the furuncle and the moth to be detected;
2) using this DNA as a template, a pair of primers: the forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3' and the reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3' are used for amplifying the CO I gene of the furuncle moth by polymerase chain reaction, and the PCR conditions are as follows: pre-denaturation at 94 ℃ for 10 min; 30s at 94 ℃, 30s at 55 ℃, 50s at 72 ℃ and 32 cycles; extension at 72 ℃ for 10 min. The PCR system is as follows: 2 XMastermix 12.5ul, upstream and downstream primers 1ul, ddH2O7.5 ul, template 3ul, 25ul in total;
3) taking a proper amount of the CO I gene amplified by the polymerase chain reaction in the step 2), carrying out agarose electrophoresis separation, observing by using an ultraviolet lamp, judging a result according to the size of an amplification product, specifically amplifying a band of about 658bp, and sending the band to a biological company for sequencing;
4) according to the sequencing result, the homology with the gene sequence SEQ ID NO.1 is more than 98 percent, and the specimen to be detected can be judged to be the furuncle bat moth.
According to the technical principle of DNA bar codes, a preparation method of insect micro DNA templates is adopted, the CO I gene of the furuncle moth is amplified by a synthesized primer through improved PCR reaction conditions, and the sequence of a PCR product is determined by a professional biological company. The sequencing result is subjected to manual proofreading and sequence splicing, and Blast similarity search in NCBI (national center for Biotechnology information) is carried out to ensure that the obtained sequence is a target sequence. The species identification of the furuncle and the bat moth is realized by morphological identification, thereby ensuring the reliability of results.
The primers were modified according to literature, forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3', reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3'.
The invention can detect the amplification result by an agarose gel electrophoresis detection method.
Compared with the traditional morphological identification method, the gene sequence obtained by the invention can be used for molecular identification of the species of the furuncle and the moth, and can accurately and effectively shorten the identification time.
Drawings
FIG. 1 is a technical flow chart of the present invention.
FIG. 2 is a diagram showing the electrophoretic identification of the CO I gene PCR amplification result of 11 samples (numbered 1-11, including imagoes and pupae) of the furuncle moth in example 1 of the present invention. The numbering is as follows: lanes 1-10 show the CO I gene extracted from adult Ten-headed furuncle swift moth, lane 11 shows the CO I gene extracted from pupa furuncle swift moth (the specific information of each sample is shown in Table 1), and a band with size of 658bp is detected. M is 2000plus DNA marker.
FIG. 3 is a diagram showing the results of the electrophoresis of the CO I gene PCR amplification of 11 samples (numbered 12-22, including eggs, larvae and pupae) of the furuncle moth according to example 2 of the present invention. The numbering is as follows: lane 12 is CO I gene extracted from eggs of the furuncle-bat moth, 13-19 are CO I genes extracted from different tissues of seven-headed larvae of the furuncle-bat moth, 20-22 are CO I genes extracted from different tissues of three-headed pupae of the furuncle-bat moth (the specific information of each sample is shown in Table 1), and a strip with size of 658bp is detected. M is 2000plus DNA marker.
TABLE 1 sampling information Table
Detailed Description
Example 1
1. Collection and preservation of furuncle and bat moth specimen
Collecting pupae in the field, breeding the pupae indoors to adult, and determining the pupae as the furuncle moth by morphological identification. Storing in sealed plastic tube at-20 deg.C, and storing pupa in 75% ethanol.
2. Pretreatment of test samples
11 furuncle bat moth specimens are taken from the preserved furuncle bat moth specimens (the number 1-3 is taken from the city county in Hunan province, the number 4-6 is taken from the country in Ningxiang in Hunan province, the number 7-9 is taken from the entrance county in Hunan province, and the number 10 and 11 are taken from the gurgle city in Hunan province), one chest foot of an adult worm is carefully taken down by using tweezers, the body wall of the worm is taken from the worm, the worm is moved into an EP (environmental protection) tube, one tube is taken from each tube, unique number is carried out, and the DNA is extracted. The remainder was kept for further species identification.
3. DNA template preparation
Extracting sample genome DNA by using a blood tissue cell genome extraction kit (DP 304, Hunan Oracle biomedical Co., Ltd.) and storing at-20 deg.C for later use.
4. Primer synthesis
The primers used in this example 1 were as follows:
forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3'
Reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3'
5. PCR amplification
The PCR reaction system of example 1 is shown in Table 2.
TABLE 2 furuncle moth CO I gene PCR reaction System (25 ul System)
The reaction procedure of this example 1 is shown in Table 3.
TABLE 3 PCR reaction procedure for CO I gene of furuncle moth
The PCR product was stored at 4 ℃ until use.
6. PCR amplification product detection
5ul of PCR amplification product was electrophoresed on 1% agar gel (130V for 10 min). The electrophoresis pattern of the amplification product of sample No. 1-11 detected by the gel imaging system is shown in figure 2 (the lane number corresponds to the sample number). It can be seen that 11 samples of example 1 can specifically amplify the product of about 658 bp.
7. Gene sequence determination
And (3) purifying and sequencing a product obtained by PCR amplification by a biological company (a sequencing primer is the same as a primer used by PCR), and correcting and splicing the obtained gene sequence to obtain the target gene sequence. Judging the identification result: sequencing results show that the homology of 11 samples and the gene sequence SEQ ID NO.1 of the invention is more than 99.2 percent, so that the COI gene can be confirmed to be used for identifying the species of the furuncle and the moth.
Example 2
1. Collection and preservation of furuncle and bat moth specimen
Collecting larvae and pupae from field, breeding in room until imago, storing in 75% alcohol, and storing imago in refrigerator at-20 deg.C; eggs are produced by raised adult furuncle and bat moths and are stored in an artificial climate box at the temperature of 8 ℃.
2. Pretreatment of samples
11 samples (with the number of 12-22) are taken out from the preserved furuncle bat moth specimens in different insect states, a small amount of corresponding tissues (the details of the collection place, the insect state, the test tissues and the collection time are shown in table 1) are carefully taken down by using forceps, the samples are moved into an EP (EP) tube, one tissue is used for each tube, and unique numbering is carried out (the number of 12 is a single-particle ovum, the numbers of 13-19 are respectively the pectoral foot, the gluteal foot and the body wall of seven larvae, and the numbers of 20-22 are the body wall or the body tissue of three pupae) for DNA extraction. The rest of the sample is kept for species identification.
3. DNA template preparation
Extracting sample genome DNA by using a blood tissue cell genome extraction kit (DP 304, Hunan Oracle biomedical Co., Ltd.) and storing at-20 deg.C for later use.
4. Primer synthesis
The primers used in this example 2 were as follows:
forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3'
Reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3'
5. PCR amplification
The PCR reaction system of this example 2 is shown in Table 4.
TABLE 4 furuncle moth CO I gene PCR reaction System (25 ul System)
The reaction procedure of this example 2 is shown in Table 5.
TABLE 5 PCR reaction procedure for CO I gene of furuncle swift moth
The PCR product was stored at 4 ℃ until use.
6. PCR amplification product detection
5ul of PCR amplification product was electrophoresed on 1% agar gel (130V for 10 min). And (3) detecting by a gel imaging system, wherein an electrophoresis pattern is shown in figure 3, and lanes 12-22 are amplification products of DNA extracted from the correspondingly numbered samples respectively. It can be seen that the furuncle and bat moth with different insect states in example 2 can also specifically amplify a product of about 658 bp.
7. Gene sequence determination
And (3) purifying and sequencing a product obtained by PCR amplification by a biological company (a sequencing primer is the same as a primer used by PCR), and correcting and splicing the obtained gene sequence to obtain the target gene sequence. Sequencing results show that the homology of 11 tested samples (numbered 12-22) and the gene sequence SEQ ID NO.1 reaches 98.4 percent, so that the tested egg, larva and pupa specimens can be confirmed to be both furuncle and moth.
Sequence listing
<110> university of Master in Hunan
<120> specific DNA sequence for identifying furuncle and bat moth
<160>3
<170>PatentIn version 3.5
<210>1
<211>658
<212>DNA
<213> DNA of furuncle moth
<400>1
ttttattttt ggtatttgag caggaataat tggaacttcg ttaagattat taattcgaac 60
agaattaggt aatcctggat ctttaattgg agatgatcaa atttataatg taattgtaac 120
agcacatgct tttattataa ttttttttat agttatacct attataattg gtggatttgg 180
taattgatta gtacctttaa tattaggagc tcctgatata gcttttccac gattaaataa 240
tataagattt tgattattac ccccttcatt aatactatta atttctagaa gaattgtaga 300
aaatggagct ggaacaggtt gaacagtcta tcccccatta tctgcaaata ttgcacatgc 360
tggtagatca gtggatttag caattttttc cttacattta gcaggtattt catctatttt 420
aggggcagtc aattttatta caactgtaat taatatacga tcggaaggaa tatcttttga 480
ccgaatacca ttatttgtat gaagagttgc aattactgct ttattacttt tattatcttt 540
acctgtatta gcaggagcta ttactatatt actaacagac cgaaatttaa atacttcatt 600
ttttgaccct gctgggggag gggatcctat tttataccaa catttatttt gatttttt 658
<210>2
<211>25
<212>DNA
<213> Forward primer
<400>2
attcaaccaa tcataaagat attgg 25
<210>3
<211>26
<212>DNA
<213> reverse primer
<400>3
taaacttctg gatgtccaaa aaatca 26
Claims (2)
1. A DNA standard detection gene sequence for identifying furuncle bat moth endoglia nodus is characterized in that the standard detection gene is a CO I gene, and the sequence of the CO I gene is shown as SEQ ID NO. 1:
2. a molecular identification method of furuncle moths comprises the following steps:
1) separating and extracting DNA from the tissue of the furuncle and the moth to be detected;
2) amplifying a CO I gene of the furuncle moth by using the DNA extracted in the step 1) as a template and a pair of primers, namely a forward primer 5'-ATTCAACCAATCATAAAGATATTGG-3' and a reverse primer 5'-TAAACTTCTGGATGTCCAAAAAATCA-3' through a polymerase chain reaction;
3) taking a proper amount of the CO I gene amplified by the polymerase chain reaction in the step 2), carrying out agarose electrophoresis separation, observing by using an ultraviolet lamp, judging a result according to the size of an amplification product, specifically amplifying a band of about 658bp, and sending the band to a biological company for sequencing;
4) according to the sequencing result, when the homology of the sequence obtained in the step 3) and the CO I gene sequence shown in the SEQ ID NO.1 of claim 1 is more than 98%, the tissue to be detected in the step 1) can be obtained to belong to the furuncle bat moth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710023904.XA CN107523577B (en) | 2017-01-13 | 2017-01-13 | Specific DNA sequence for identifying furuncle swift moth |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710023904.XA CN107523577B (en) | 2017-01-13 | 2017-01-13 | Specific DNA sequence for identifying furuncle swift moth |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107523577A CN107523577A (en) | 2017-12-29 |
| CN107523577B true CN107523577B (en) | 2020-05-19 |
Family
ID=60748562
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710023904.XA Active CN107523577B (en) | 2017-01-13 | 2017-01-13 | Specific DNA sequence for identifying furuncle swift moth |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107523577B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735554A (en) * | 2019-02-01 | 2019-05-10 | 中山大学 | It is a kind of for identifying the COI gene and method for identifying molecules of triatoma rubrofasciata |
-
2017
- 2017-01-13 CN CN201710023904.XA patent/CN107523577B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GenBank：KT780172.1;Yang,X.等;《Genbank》;20160402;第1-7页 * |
| GenBank：MG470843.1;Li,G.等;《Genbank》;20171226;第1页 * |
| 疖蝙蛾生物学特性的初步研究;赵锦年 等;《林业科学》;19880229;第24卷(第1期);第101-105页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107523577A (en) | 2017-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105483261B (en) | A kind of specific gene and its method for identifying molecules of indigo plant abdomen Storehouse midge | |
| CN105543249B (en) | A kind of beauty Storehouse midge specific gene and its method for identifying molecules | |
| CN104120189A (en) | Molecular biological method for identifying diptera insects | |
| CN110804664B (en) | Primer pair and kit for identifying bark beetles in Meidiao and application of primer pair and kit | |
| CN104513863A (en) | Insect pest detecting method for tobaccos based on DNA bar codes | |
| CN104232634B (en) | A kind of I primer pair of pine tree bee specificity SS-CO and rapid molecular detection method | |
| Retief et al. | A protocol for molecular detection of Phaeomoniella chlamydospora in grapevine wood: research in action | |
| CN107523577B (en) | Specific DNA sequence for identifying furuncle swift moth | |
| CN108034733B (en) | DNA bar code standard sequence of Culicoides kindred species and molecular identification method thereof | |
| CN108950007A (en) | For identifying the HRM primer and method of river Puffer and other fish products | |
| CN108486121B (en) | Specific DNA sequence of Cuicoides spinuloides and molecular identification method thereof | |
| CN108384791A (en) | A kind of specific gene and its method for identifying molecules of Beijing Storehouse midge | |
| CN104293922B (en) | With the closely linked molecule marker GmSSR18-24 of Soybean Resistance To Rust ospc gene and application | |
| CN106636319A (en) | Molecular biological method for rapidly identifying Hoolock leuconedys and Nomascus leucogenys | |
| CN107988232A (en) | The DNA bar code standard sequence and its method for identifying molecules of a kind of open country Storehouse midge | |
| CN108486122A (en) | A kind of the DNA bar code standard sequence and its method for identifying molecules of South Mountain Storehouse midge | |
| CN108342398A (en) | A kind of specific gene and its method for identifying molecules of open country Storehouse midge | |
| CN107513534B (en) | DNA barcode standard gene sequence of giant furuncle moth and application thereof | |
| Rana et al. | Isolation, identification and characterization of Cytospora chrysosperma associated with canker disease of Salix alba L | |
| CN113025724A (en) | Dual PCR primer, method and kit for identifying small pissodes punctatus | |
| Putty et al. | PCR as a rapid diagnostic tool for detection of dermatophytes | |
| Ishaq et al. | Amanita subjunquillea and its ectomycorrhizal association, reported as new for Pakistan | |
| Halici et al. | First record of a common endolithic lichenized fungus species Catenarina desolata Schting, Sgaard & Elvebakk. from James Ross Island (Antarctic Peninsula) | |
| KR101434832B1 (en) | Primers of polymerase chain reactions for the detection of Phytophthora species broken out on kind of fruit tree or seedling, and detection kits and methods thereof | |
| CN114058731B (en) | Molecular marker for distinguishing rice blast fungus sources and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |