KR100801558B1 - Primer for detecting Rice black-streaked dwarf virus Rice dwarf virus and Rice stripe virus and method for detecting simultaneously said viruses using the same - Google Patents

Abstract

A diagnosing primer is provided to diagnose respectively or simultaneously rice black-streaked dwarf virus(RBSDV), rice dwarf virus(RDV) and rice stripe virus(RSV) through RT-PCR species-specifically. A primer for diagnosing at least one virus selected from the group consisting of RBSDV, RDV and RSV is characterized in that it comprises a primer pair selected from the group consisting of a primer pair described as SEQ ID : NOs. 4 and 9 and a primer pair described as SEQ ID : NOs. 4 and 7; a primer pair selected from the group consisting of a primer pair described as SEQ ID : NOs. 16 and 24, a primer pair described as SEQ ID : NOs. 17 and 24, a primer pair described as SEQ ID : NOs. 18 and 23, a primer pair described as SEQ ID : NOs. 21 and 33, and a primer pair described as SEQ ID : NOs. 21 and 34; and a primer pair selected from the group consisting of a primer pair described as SEQ ID : NOs. 40 and 46 and a primer pair described as SEQ ID : NOs. 41 and 46. A method for diagnosing the virus comprises a step of subjecting a genome RNA of a virus sample as a template to RT-PCR using the primer.

Description

Primer for detecting Rice black-streaked dwarf virus, Rice dwarf virus and Rice stripe virus and method for detecting simultaneously said viruses using the same}

Figure 1 shows the location of primers for rice atrophy virus (RBSDV).

Figure 2A is a diagram showing the RT-PCR results of the primer combination for rice atrophy virus.

Figure 2B is a picture confirming the non-specific RT-PCR response of the selected primer combination against the rice gill disease virus and rice stripe leaf blight virus.

  Lanes 1 and 4: RBSDV

  2, 5 lanes: RDV

  3, 6 lanes: RSV

FIG. 3 shows the position (A) of the primer for RNA S3 of rice disease virus (RDV) and the position (B) of the primer for RNA 8.

Figure 4A is a diagram showing the RT-PCR results of the primer combination for rice disease.

FIG. 4B is a diagram confirming whether or not non-specific RT-PCR responses to the selected BMD virus and rice stripe leaf blight virus.

  Lanes 1, 20 and 21: Size Markers

  Lanes 2, 5, 8, 11, 14, 17, 22, 25: RDV

  3, 6, 9, 12, 15, 18, 23, 26 Lane: RBSDV

  4, 7, 10, 13, 16, 19, 24, 27 Lane: RSV

FIG. 5 shows the position (A) of the primer for RNA 3 and the position (B) of RNA for RNA 4 of rice stripe leaf virus (RSV).

Figure 6A is a diagram showing the RT-PCR results of the combination for rice stripe leaf blight virus.

Figure 6B is a picture confirming whether the non-specific RT-PCR response to the rice black atrophy virus and rice gill virus of the selected primer combination.

  1, 4 lanes: RSV

  Lanes 2 and 5: RBSDV

  3, 6 lanes: RDV

Figure 7A is a diagram showing the RT-PCR results of the selected primer combinations for the rice forgery atrophy virus, rice gill disease and rice stripe leaf blight virus.

  Lanes 1 and 5: RBSDV

  2, 6 lanes: RSV

  3, 7 lanes: RDV

  4, 8 lanes: RBSDV + RDV + RSV

7B shows RT-PCR results with annealing temperatures of selected primer combinations (combination 7).

  1 lane 48.5 ° C 2 lane 49.9 ° C

  3 lane 51.8 ° C 4 lane 54.5 ° C

  5 lanes 58.1 ° C 6 lanes 62.3 ° C

  7 lanes 65.1 ° C 8 lanes 68.0 ° C

  9 lanes 69.7 ° C 10 lanes 71.6 ° C

Figure 7C is a picture confirming the simultaneous diagnosis of the virus complex infection of the selected primer combination.

  Lane 1: RBSDV Lane 2: RSV

  Lane 3: RDV Lane 4: RBSDV + RSV

  Lane 5: RBSDV + RDV Lane 6: RSV + RDV

  Lane 7: RBSDV + RSV + RDV

The present invention relates to a primer for simultaneous diagnosis of rice black atrophy virus, rice gill disease virus and rice streaky leaf virus, and a diagnostic method using the same. More specifically, the present invention includes rice black atrophy virus, rice gill disease and The present invention relates to a diagnostic primer capable of diagnosing rice stripe leaf blight virus through RT-PCR, or a simultaneous diagnosis method using the same.

Plants and crops, such as rice, corn, and barley, are important food crops that provide food to humans, and these crops are economically affected by diseases such as black atrophy disease (black string organ), ogal disease, and streaked leaf blight caused by viruses. It is doing a lot of damage.

Black Swan Black Swan atrophy disease is contracted rice disease virus (Rice black - streaked dwarf by a virus, RBSDV), rice is ohgalbyeong ohgalbyeong viruses (Rice dwarf virus , RDV), is caused by the rice stripe virus (RSV), which is infected alone or in combination in the field, and the external symptoms of the virus-infected plant are cultivated. It is almost impossible to diagnose the virus accurately with the naked eye because it appears in various and complex ways depending on the variety, type, and environmental factors.

In general, the virus reagent for diagnosing a virus can diagnose only one type of virus, and thus, when a multi-infected sample is to be diagnosed, there is a problem of having to diagnose it several times. On the other hand, the serological diagnostic method is limited in its use when precision is required because the detection ability is very inferior to the molecular biological diagnostic method.

Accordingly, the present inventors have been conducting research to develop a method for diagnosing three kinds of viruses, rice black atrophy virus, rice organ disease and rice stripe leaf blight virus, which are causing enormous damage to Korean food crops including rice. The present invention has been completed by developing respective diagnostic primers capable of species-specific diagnosis of viruses, simultaneous diagnosis primers capable of multiple diagnosis of these viruses, and a diagnostic method using the same.

Accordingly, an object of the present invention is to provide a primer for diagnosing rice black atrophy virus, rice organ disease and rice stripe leaf blight virus through RT-PCR, respectively, or simultaneously, and a method for concurrent diagnosis using the same. will be.

In order to achieve the above object, the present invention provides a diagnostic primer capable of diagnosing rice black atrophy virus, rice gill disease and rice stripe leaf blight virus through RT-PCR.

In order to achieve another object of the present invention, the present invention provides a diagnostic method capable of species-specifically or at the same time to diagnose a rice black atrophy virus, rice gal disease virus and rice stripe leaf blight virus using the primer. .

In order to achieve another object of the present invention, the present invention provides a diagnostic kit capable of species-specifically or simultaneously diagnosing rice black atrophy virus, rice organ disease and rice streaked leaf virus comprising the primer. do.

Hereinafter, the content of the present invention will be described in more detail.

The present invention is a rice black atrophy virus ( Rice) black - streaked dwarf virus , RBSDV), Rice dwarf virus , RDV) and rice streaked leaf virus ( Rice) stripe virus , RSV) diagnostic primer.

Primers of the invention were developed to allow species-specific RT-PCR products to be synthesized for each virus. Species specific in the present invention means that the primer can synthesize a specific RT-PCR product from the genome sequence of the virus to be diagnosed, and is common to all strains in the species of the virus to be diagnosed. It must act and nonspecific reaction with nucleic acids from other similar species or plants should not occur. In general, primers used in general are designed to amplify specific genes of a virus and are not species specific, and are not suitable for diagnostic use because they may produce nonspecific products by nucleic acids of plants or other viruses. .

Specifically, the primer of the present invention was developed (designed) by the following method. i) selecting a genome of interest among genes (genomes) of the target virus, ii) searching for common base sequences in the genome sequences of strains and isolates of the target virus known to date, iii) identical to the genome of similar viruses, and similar sequences Iv) primers were designed by selecting only the nucleotide sequence capable of functioning as a primer, and species-specific amplification can be performed by RT-PCR among the designed primers, and non-specific primers do not occur. Pairs were selected.

The primer of the present invention refers to a primer pair for PCR, and more particularly, refers to a primer pair for RT-PCR for the RNA genome of a virus, but not limited thereto. Primer of the present invention is a primer pair comprising a forward primer and a reverse primer, the primer of the present invention is shown in SEQ ID NO: 4 and 9 for the simultaneous diagnosis of rice black atrophy virus, rice organ disease, rice stripe leaf blight virus A primer pair selected from the group consisting of a primer pair and primer pairs represented by SEQ ID NOs: 4 and 7; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And it may be a primer comprising a primer pair selected from the group consisting of a primer pair represented by SEQ ID NO: 40 and 46 and a primer pair represented by SEQ ID NO: 41 and 46, preferably a primer represented by SEQ ID NO: 4 and 9 A pair of primers selected from the group consisting of a pair and a primer pair represented by SEQ ID NOs: 4 and 7; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 40 and 46 and a primer pair represented by SEQ ID NOs: 41 and 46, more preferably a primer pair represented by SEQ ID NOs: 4 and 9; Primer pairs represented by SEQ ID NOs: 16 and 24; And it may be a primer consisting of a primer pair represented by SEQ ID NO: 40 and 46.

Primers for diagnosing dystrophic atrophy virus may be a primer comprising a primer pair represented by SEQ ID NO: 4 and 9 or a primer pair represented by SEQ ID NO: 4 and 7, preferably represented by SEQ ID NO: 4 and 9 It may be a primer consisting of a primer pair or a primer pair represented by SEQ ID NO: 4 and 7.

As primers for diagnosing rice disease, primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, and represented by SEQ ID NOs: 21 and 33 It may be a primer comprising one selected from the group consisting of a primer pair and a primer pair represented by SEQ ID NO: 21 and 34, preferably a primer pair represented by SEQ ID NO: 16 and 24, primer pair represented by SEQ ID NO: 17 and 24 It may be a primer selected from the group consisting of a primer pair represented by SEQ ID NO: 18 and 23, a primer pair represented by SEQ ID NO: 21 and 33, and a primer pair represented by SEQ ID NO: 21 and 34.

Primers for diagnosing rice leaf leaf blight virus may be a primer comprising a primer pair represented by SEQ ID NO: 40 and 46 or a primer pair represented by SEQ ID NO: 41 and 46, preferably represented by SEQ ID NO: 40 and 46 It may be a primer consisting of a primer pair or a primer pair represented by SEQ ID NO: 41 and 46.

The primers provided in the present invention can be usefully used for diagnosing rice black atrophy virus, rice organ disease, rice stripe leaf blight virus simultaneously or separately. Therefore, the present invention uses the genomic RNA of a virus sample as a template, and simultaneously or individually diagnoses the rice atrophy virus, rice gal disease virus, rice stripe leaf blight virus, characterized in that performing RT-PCR using the primers. Provide a method. In this case, the use of the primer means that the primer is used as a primer for RT-PCR to perform RT-PCR.

The diagnostic method of the present invention is characterized by performing genomic RNA of a viral sample as a template and performing RT-PCR using the primer of the present invention.

RT-PCR can be easily detected through electrophoresis and the like, by producing a DNA template through a reverse transcription reaction to the RNA molecule, and performing the PCR reaction using the template as a template.

Such a PCR product can be used to confirm the presence or absence of a specific virus, i.e., to diagnose a specific virus. In order to use the diagnostic product, a primer for generating a specific PCR product is required. Primers as described may be used.

That is, the primer pair selected from the group consisting of primer pairs represented by SEQ ID NOs: 4 and 9 and primer pairs represented by SEQ ID NOs: 4 and 7 for simultaneous diagnosis of rice black atrophy virus, rice organ disease, rice stripe leaf blight virus ; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 40 and 46 and a primer pair represented by SEQ ID NOs: 41 and 46, and preferably a primer represented by SEQ ID NOs: 4 and 9 A pair of primers selected from the group consisting of a pair and a primer pair represented by SEQ ID NOs: 4 and 7; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 40 and 46 and a primer pair represented by SEQ ID NOs: 41 and 46. More preferably primer pairs represented by SEQ ID NOs: 4 and 9; Primer pairs represented by SEQ ID NOs: 16 and 24; And primer pairs represented by SEQ ID NOs: 40 and 46.

As primers for diagnosing dystrophic atrophy virus, primers including the primer pairs represented by SEQ ID NOs: 4 and 9 or the primer pairs represented by SEQ ID NOs: 4 and 7, may be used. The primer consisting of the primer pair shown or the primer pair shown by sequence numbers 4 and 7 can be used.

As primers for diagnosing rice disease, primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, and represented by SEQ ID NOs: 21 and 33 A primer comprising a primer pair and one selected from the group consisting of primer pairs represented by SEQ ID NOs: 21 and 34 may be used. Preferably, primer pairs represented by SEQ ID NOs: 16 and 24, primers represented by SEQ ID NOs: 17 and 24 A primer selected from the group consisting of a pair, a primer pair represented by SEQ ID NOs: 18 and 23, a primer pair represented by SEQ ID NOs: 21 and 33, and a primer pair represented by SEQ ID NOs: 21 and 34 can be used.

As primers for diagnosing rice stripe leaf blight virus, primers including the primer pairs represented by SEQ ID NOs: 40 and 46 or the primer pairs represented by SEQ ID NOs: 41 and 46 may be used. The primer consisting of the primer pair shown or the primer pair shown by SEQ ID No. 41 and 46 can be used.

Such a diagnostic method of the present invention can be carried out by RT-PCR techniques known in the art, but preferably the diagnostic method of the present invention

(a) isolating genomic RNA of the viral sample;

(b) using the genomic RNA of step (a) as a template and performing RT-PCR using the primer of the present invention; And

(c) the RT-PCR product of step (b) can be carried out by a method comprising the step of separating and analyzing by size.

Each step will be described in detail as follows.

Step (a)  Genome RNA Step to separate

Extraction of genomic RNA in step (a) is a guanidinium / cesium chloride (Guuanidinium / cesium chloride) method, guanidine-HCl (Guanidine HCl) method, guaniidinium thiocyanate ) Or commercially available RNA extraction kits.

Step (b)  : RT - PCR Steps to perform

In step (b), RT-PCR performs a reverse transcription reaction using the genomic RNA of step (a) as a template, and then uses a PCR reaction mixture containing various components known in the art for PCR reaction. It can be performed using.

For the reverse transcription reaction and PCR reaction, a method well known in the art may be used, but is not limited thereto. Among them, the PCR reaction mixture may contain an appropriate amount of DNA polymerization in addition to the DNA template synthesized by the reverse transcription reaction and the primer of the present invention. Enzyme, dNTP, PCR buffer and water (dH 2 O). The PCR buffer solution includes Tris-HCl, MgCl 2, KCl, and the like. At this time, the MgCl 2 concentration greatly affects the specificity and yield of amplification, and may be preferably used in the range of 1.5 to 2.5 mM. In general, when Mg2 + is excessive, nonspecific PCR amplification products increase, and when Mg2 + is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatures the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94 to 95 ° C. and 72 ° C., respectively, and the annealing temperature may vary depending on the type of primer. The temperature at the time of binding is preferably 45 to 57 ° C, and more preferably 50 to 52 ° C for simultaneous diagnosis of rice black atrophy virus, rice gill virus, and rice stripe leaf blight virus. The time and number of cycles in each step can be determined according to the conditions generally made in the art.

Step (c)  : RT - PCR  Steps to analyze the product by size

In the step (c) it can be separated by size RT-PCR products according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by polyacrylamide gel electrophoresis, more preferably modified polyacrylamide gel electrophoresis. Electrophoresis results can be analyzed by silver staining after electrophoresis. General PCR performance and resulting analysis methods are well known in the art.

In addition, the analysis of the separated fragments is carried out by a method of identifying and comparing the size of the fragments of the sample to be a sample. For example, according to the results of Table 15 for the simultaneous diagnosis of rice atrophy virus, rice gallbladder virus, and rice stripe leaf blight virus, the diagnosis of rice agal disease virus according to the result of Table 5 for the diagnosis of rice black atrophy virus At the time of diagnosis according to the results of Table 8, and when the rice stripe leaf blight virus diagnosis can be analyzed by checking whether the RT-PCR product of the corresponding size corresponding to the primer was detected.

Such a diagnostic method may be useful when a rapid and accurate diagnosis of a suspicious sample is required for infection with rice black atrophy virus, rice gal disease virus, rice stripe leaf blight virus.

In addition, the present invention provides a kit for diagnosing rice black atrophy virus, rice organ disease, rice stripe leaf blight virus comprising a primer according to the present invention.

That is, in the simultaneous diagnosis kit of rice black atrophy virus, rice gill disease, rice stripe leaf blight virus, a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 4 and 9 and a primer pair represented by SEQ ID NOs: 4 and 7 ; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And a primer pair including a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 40 and 46, and a primer pair represented by SEQ ID NOs: 41 and 46, and preferably a primer represented by SEQ ID NOs: 4 and 9 A pair of primers selected from the group consisting of a pair and a primer pair represented by SEQ ID NOs: 4 and 7; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And a primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 40 and 46 and a primer pair represented by SEQ ID NOs: 41 and 46. More preferably primer pairs represented by SEQ ID NOs: 4 and 9; Primer pairs represented by SEQ ID NOs: 16 and 24; And it may include a primer for diagnosing a virus, characterized in that consisting of the primer pair represented by SEQ ID NO: 40 and 46.

Primers for diagnosing dystrophic atrophy virus may include a primer comprising a primer pair represented by SEQ ID NOs: 4 and 9 or a primer pair represented by SEQ ID NOs: 4 and 7, preferably, SEQ ID NOs: 4 and 9 A primer consisting of a primer pair represented or a primer pair represented by SEQ ID NOs: 4 and 7 may be included.

As primers for diagnosing rice disease, primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, and represented by SEQ ID NOs: 21 and 33 Primer comprising a primer pair and selected from the group consisting of a primer pair represented by SEQ ID NO: 21 and 34, preferably a primer pair represented by SEQ ID NO: 16 and 24, primer represented by SEQ ID NO: 17 and 24 A primer selected from the group consisting of a pair, a primer pair represented by SEQ ID NOs: 18 and 23, a primer pair represented by SEQ ID NOs: 21 and 33, and a primer pair represented by SEQ ID NOs: 21 and 34 may be included.

Primers for diagnosing rice stripe leaf blight virus may include a primer comprising a primer pair represented by SEQ ID NO: 40 and 46 or a primer pair represented by SEQ ID NO: 41 and 46, preferably SEQ ID NO: 40 and 46 A primer consisting of a primer pair represented or a primer pair represented by SEQ ID NOs: 41 and 46 may be included.

In addition, it may further include reverse transcriptase, DNA polymerase and its buffer solution, and a PCR reaction buffer solution of the above-described composition for easily performing reverse transcription and PCR reactions, and confirm whether amplification of the PCR product is possible. Components or diagnostic reference tables necessary for performing electrophoresis may be further included in the kit of the present invention.

In one embodiment of the present invention, a primer was prepared based on the genome sequence of the rice black atrophy virus, and among them, a primer capable of being specifically diagnosed for the species was selected.

In another embodiment of the present invention, a primer was prepared based on the genome sequence of rice disease, and selected from among them were primers capable of species-specific diagnosis.

In another embodiment of the present invention, the primers were prepared based on the genome sequences of the rice stripe leaf blight virus, and among them, primers capable of being specifically diagnosed for the species were selected.

In another embodiment of the present invention, a combination of primers capable of simultaneously diagnosing rice atrophy virus, rice organ disease, and rice stripe leaf blight virus were selected, and among them, primers capable of being specifically diagnosed were selected.

Accordingly, the present invention provides a primer capable of diagnosing rice black atrophy virus, rice organ disease and rice stripe leaf blight virus, and a diagnostic method using the same.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Rice black atrophy ( RBSDV Diagnostic Species Specific Primer pair  Development

<1-1> Selection of nucleic acid for diagnosis and specificity Of primer  design

RBSDV is a spherical virus with a diameter of 75 to 80 nm, and the nucleic acid is composed of 10 (S1-S10) double-stranded RNA segments. The function of each RNA genome is not yet fully understood, but RNA S10 has the smallest size and is encoded by one protein constituting the envelope protein, and more nucleotide sequences are known than the other RNA fragments. Was selected.

In order to diagnose all known RBSDV strains up to now, as shown in Table 1 below, the base sequences of RNA S10 of 10 known strains were analyzed to search for common base sequences of RBSDV.

RBSDV Isolation Using Common Base Sequence Search Genbank accession no. Segregation Gene size (bp) D00606 RBSDV-pRB C3 1801 AY050488 RBSDV-zhjw 1801 AJ297434 RBSDV-Hebei 1801 AJ297433 RBSDV-Zhejiang 1801 AJ291707 RBSDV-Wuhan 1801 AF459813 RBSDV-zhjs 1801 AF227208 RBSDV-Shx 1801 AF227207 RBSDV-Hn 1801 AF227206 RBSDV-Hbr 1801 AF227205 RBSDV-Hb 1801

Among them, RNA 10 of three viruses of the genus Fijivirus, which is a similar virus among the RBSDV common nucleotide sequences searched above, in order to prevent a virus similar to RBSDV from being mistaken and diagnosed, that is, to have species-specific properties. In comparison with Table 2), only RBSDV-specific sequences were selected.

Fijivirus for Selection of RBSDV Species Specific Sequences Fijivirus Accession no. Gene size (bp) Maize rough dwarf virus L76560 1802 Fiji disease virus AY297694 1819 Oat sterile dwarf virus AB011027 1761

In addition, the general conditions of the primers, such as the size of 20 to 25bp, Tm is in the range of 50 to 65 ℃, primer secondary structure formation, self-complementary sequence among the base sequence to satisfy the above conditions to function as a primer Exclusion, GC content was finally selected the base sequence that satisfies the conditions of about 50%.

Taken together, the design of the primers in the present invention includes i) selecting an RNA genome of interest among RBSDV genes, ii) searching for common base sequences in the genome sequence of RBSDV known to date, and iii) Fijivirus, a similar virus. The design of the primer was performed by excluding the same sequence as the genome and iv) selecting only the nucleotide sequence capable of functioning as a primer.

As a result, five upstream primers and seven downstream primers were selected as shown in Table 3 below. The positions of the primers in the genome of RBSDV are shown in FIG. 1. At this time, the primer position is NCBI accession no. Calculated based on the sequence of D00606.

Designed RBSDV Diagnostic Primer Primer Name division Sequence Length (bp) Tm (℃) Primer position SEQ ID NO: RBSD-S10-N10 Upstream CCTGCTCAAATGGGAATACTTACTG 25 57 604-628 One RBSD-S10-N20 AAGAATTAAGTGTTTTGGATGC 22 50 836-857 2 RBSD-S10-N30 TGATCCCGATGAATACGAATTGACC 25 62 942-966 3 RBSD-S10-N40 CGTCGAAACGAATTAGAAGAGAAAA 25 57 1,087-1,111 4 RBSD-S10-N50 TCAGTAATTATCAGTAGAGCGAACA 25 52 1,552-1,576 5 RBSD-S10-C10 Downstream GAATTTCCCCCTAGCCGTCGTC 22 62 1,770-1,791 6 RBSD-S10-C20 CTCCCAGTGGTCATCTTGCAC 21 57 1,687-1,708 7 RBSD-S10-C30 GAAGAAACGTTGGCGGAAAGT 21 57 1,616-1,637 8 RBSD-S10-C40 AATCAAAACAAGGTACAGCCAAAGA 25 57 1,297-1,321 9 RBSD-S10-C50 ACTAGTGGCACTTTTCTCTTCTA 23 49 1,100-1,122 10 RBSD-S10-C60 TAATTAGTGCGCAACGTGGACAAA 24 60 969-992 11 RBSD-S10-C70 TTATCTGCATCCAAAACACTTA 22 50 842-863 12

<1-2> Of primer  Combination

Referring to the position of each primer in Table 3, 21 combinations were made as shown in Table 4 so that no products were too small or too large.

RBSDV diagnostic primer combinations and expected products Combination Downstream primer Upstream primer Expected product (bp) One RBSD-S10-C70 RBSD-S10-N10 260 2 RBSD-S10-C60 RBSD-S10-N10 389 3 RBSD-S10-C50 RBSD-S10-N10 519 4 RBSD-S10-C50 RBSD-S10-N20 287 5 RBSD-S10-C50 RBSD-S10-N30 181 6 RBSD-S10-C40 RBSD-S10-N10 718 7 RBSD-S10-C40 RBSD-S10-N20 486 8 RBSD-S10-C40 RBSD-S10-N30 380 9 RBSD-S10-C40 RBSD-S10-N40 235 10 RBSD-S10-C30 RBSD-S10-N10 1034 11 RBSD-S10-C30 RBSD-S10-N20 802 12 RBSD-S10-C30 RBSD-S10-N30 696 13 RBSD-S10-C30 RBSD-S10-N40 551 14 RBSD-S10-C20 RBSD-S10-N20 573 15 RBSD-S10-C20 RBSD-S10-N30 767 16 RBSD-S10-C20 RBSD-S10-N40 622 17 RBSD-S10-C20 RBSD-S10-N50 157 18 RBSD-S10-C10 RBSD-S10-N20 956 19 RBSD-S10-C10 RBSD-S10-N30 850 20 RBSD-S10-C10 RBSD-S10-N40 705 21 RBSD-S10-C10 RBSD-S10-N50 240

<1-3> combined Primer pair  Selection

In order to confirm that the primer pairs in Table 4 are amplified well by RT-PCR, and to specifically amplify RBSDV among three viruses of RBSDV, RDV and RSV, -PCR was performed: RNA genomes from RBSDV, RDV, and RSV, respectively, were separated using Trizol (TRIzol, Invitrogen, USA) as follows: 1 ml of Trizol was added to 100 mg of sample tissue, followed by grinding. Leave at 5 ° C. for 5 minutes. The mixture was centrifuged at 12,000 g for 10 minutes at 2 to 8 ° C, 0.2 ml of chloroform was added to the supernatant, shaken vigorously for 15 seconds, and then placed at 15 to 30 ° C for 3 minutes. It was again centrifuged at 12,000 g for 15 minutes at 2-8 ° C. to transfer the water layer to a new tube. 0.5 ml of isopropyl alcohol was added thereto, and the mixture was kept at 15 to 30 ° C for 10 minutes. After centrifugation at 12,000 g for 10 minutes at 2 to 8 ℃, the supernatant was discarded and washed 2-3 times with 75% ethanol. After centrifugation at 7,500 g for 2 minutes at 2 to 8 ° C. for 5 minutes, it was completely dried for 5 to 10 minutes. It was used by dissolving in RNase-free water.

With each RNA genome as a template, the RT-PCR reaction was performed as follows. Reverse transcription was performed by reverse transcription buffer (50 mM) with 0.5 μl total RNA, 12.5 pmole downstream primer, 1.25 U AMV reverse transcriptase (Roche Co., USA), and 5 U RNase inhibitor (Roche Co., USA). 5 µl of Tris-HCl, 50 mM KCl, 10 mM MgCl ₂ , 10 mM DTT, 0.5 mM Spermidine, 2 mM dNTP) was reacted at 42 ° C. for 30 minutes. Polymerase chain reaction (PCR) was carried out by PCR buffer (10 mM Tris-HCl, 50) with 5 μl of reverse transcriptase added upstream primer 12.5 pmole and Faststart Taq DNA polymerase (Roche Co., USA) 1 U. 25 μl of mM KCl) was amplified 40 times at 95 ° C. for 45 seconds, 50 ° C. for 60 seconds, and 72 ° C. for 60 seconds. RT-PCR products were identified on 1% agarose gel using 0.5 × TBE.

As a result, as shown in FIG. 2, the combination of No. 9 and No. 16 among the 21 primer pairs was the best amplification without non-specific amplification (FIG. 2A), and this was preliminarily selected.

As described above, RT-PCR was also performed on RDV and RSV using the combination of Nos. 9 and 16. As shown in FIG. 2B, the primer pairs were specifically amplifiable for RBSDV. By combining these results, two pairs of primers were finally selected as RBSDV diagnostic primer pairs (Table 5).

RBSDV Diagnostic Primer Pair Combination number division primer Standing column SEQ ID NO: Length Product (bp) 9 Downstream RBSD-S10-C40 AATCAAAACAAGGTACAGCCAAAGA 9 25 235 Upstream RBSD-S10-N40 CGTCGAAACGAATTAGAAGAGAAAA 4 25 16 Downstream RBSD-S10-C20 CTCCCAGTGGTCATCTTGCAC 7 21 622 Upstream RBSD-S10-N40 CGTCGAAACGAATTAGAAGAGAAAA 4 25

< Example  2> Rice disease ( RDV Diagnostic species Singular primer  Development

<2-1> Selection and Specificity of Diagnostic Nucleic Acids Of primer  design

RDV is a spherical virus of about 70 nm in diameter and the nucleic acid consists of 12 (S1-S12) double-stranded RNA segments. So far, research has shown that fragments of S1-S12 are encoded with seven structural and at least six nonstructural proteins. Structural proteins are encoded in S1, S2, S3, S5, S7, and S8. Among them, S3 and S8, which encode the core protein (P3), which occupies most of the core of the virus particle, and the outer envelope protein (P8), which is a major component of the outer shell, were selected as the nucleic acid to be diagnosed. It was.

For the design of RDV species specific diagnostic primers, the primer design procedure in Example 1 was applied mutatis mutandis as follows: For S3, three known RDV isolates (D00607, X54620, U72757) were used and for S8. Four common isolates (U36565, D00536, D10219, D13773) were used to search for common base sequences. In addition, the searched species common nucleotide sequence was identified by RGDV ( Rice , a taxonomically similar virus to RDV). gall dwarf virus- specific species were searched for by comparison. At this time, two isolates of RGDV (AY559408, D13774) for the S3 gene and two isolates of RGDV (D13410, AY999077) for the S8 gene were analyzed. Among the RDV species specific nucleotide sequences satisfying these conditions, base sequences satisfying general conditions as primers were designed as diagnostic primers.

RDV diagnostic primers were designed with four upstream and four downstream primers in RNA S3, six upstream primers and nine downstream primers in RNA S8. . The positions and sequences of the primers are shown in FIGS. 3 and 6, respectively. At this time, the primer position is NCBI accession no. Calculated based on D00607 (RNA 3) and D00536 (RNA 8), respectively.

Diagnostic primers for designed RDV RNA S3 and S8 primer division Sequence Length (bp) Tm (℃) Primer position Target genes Sequence number RDR8-N10 Upstream ATACTTTCTCCGGGCTCACAACAGG 25 62 100-124 RNA8 13 RDR8-N20 AGTGCCAATGTCCGATACCGTCAGA 25 64 350-374 RNA8 14 RDR8-N30 GCGGGGCAGACTGGGAACATA 21 63 504-524 RNA8 15 RDR8-N40 CGTCGCCGAAAGAAGGAGAAT 21 60 575-595 RNA8 16 RDR8-N50 GCCGCAGACGCTGCTACTACATTTA 25 62 753-777 RNA8 17 RDR8-N60 GGATCCGCCGGCCATACCTG 20 65 1,103-1,122 RNA8 18 RDR3-N20 CAAGATCTGGGCGAAGTGGTGAGTG 25 65 1,011-1,035 RNA3 19 RDR3-N30 GATATCTGGATTAACGCTTGACTGT 25 55 1,157-1,181 RNA3 20 RDR3-N40 GCAATTGATCAGTGGCAGTCT 21 54 1,365-1,385 RNA3 21 RDR3-N50 GACTCGCGCTCTATCGGCACCAT 23 65 1,541-1,563 RNA3 22 RDR8-C10 Downstream CCAGATTCAGGACCGGGCATTTC 23 64 1,369-1,391 RNA8 23 RDR8-C20 GGGCATTTCCTCCACGGCTACC 22 64 1,356-1,377 RNA8 24 RDR8-C30 TTTCCTCCACGGCTACCCCTATCTG 25 64 1,348-1,372 RNA8 25 RDR8-C35 CCCAGCCTCCGCGGTTACACA 21 66 1,322-1,342 RNA8 26 RDR8-C40 GCCGGCGGATCCATATAGTTCGTGA 25 67 1,090-1,114 RNA8 27 RDR8-C50 TGCCAATATCGTAAACTCGCCTTCA 25 62 899-923 RNA8 28 RDR8-C60 ATCCCGTTTTAGCCACACCCAGTTC 25 64 861-885 RNA8 29 RDR8-C70 GCCCCGCAACAGACCGAAACA 21 66 490-510 RNA8 30 RDR8-C80 GATTGCATTTTGGCGCTCATACA 23 61 418-440 RNA8 31 RDR3-C10 TAATAAGTTCGGCGTAGCATCAAG 24 57 1,812-1,835 RNA3 32 RDR3-C20 GGTTGCGTGACGAAGCCATTTAGAT 25 63 1,735-1,759 RNA3 33 RDR3-C30 GAGCGGTCAGGCAAAGCGAGAT 22 63 1,627-1,648 RNA3 34 RDR3-C40 GGGGGAATGAGGGCTTGAAATAACA 25 64 1,213-1,237 RNA3 35

<2-2> Of primer  Combination

With reference to the position of each primer in Table 6, 46 combinations were made as shown in Table 7 so that no products were too small or too large.

RDV diagnostic primer combinations and expected products Combination Downstream primer Upstream primer Expected product (bp) Combination Downstream primer Upstream primer Expected product (bp) One RDR8-C80 RDR8-N10 440 24 RDR8-C30 RDR8-N40 798 2 RDR8-C70 RDR8-N10 411 25 RDR8-C30 RDR8-N50 620 3 RDR8-C70 RDR8-N20 161 26 RDR8-C30 RDR8-N60 270 4 RDR8-C60 RDR8-N10 786 27 RDR8-C20 RDR8-N30 874 5 RDR8-C60 RDR8-N20 536 28 RDR8-C20 RDR8-N40 803 6 RDR8-C60 RDR8-N30 382 29 RDR8-C20 RDR8-N50 625 7 RDR8-C60 RDR8-N40 311 30 RDR8-C20 RDR8-N60 275 8 RDR8-C50 RDR8-N10 824 31 RDR8-C10 RDR8-N30 888 9 RDR8-C50 RDR8-N20 574 32 RDR8-C10 RDR8-N40 817 10 RDR8-C50 RDR8-N30 420 33 RDR8-C10 RDR8-N50 639 11 RDR8-C50 RDR8-N40 349 34 RDR8-C10 RDR8-N60 289 12 RDR8-C50 RDR8-N50 171 35 RDR3-C40 RDR3-N20 227 13 RDR8-C40 RDR8-N10 1015 36 RDR3-C30 RDR3-N20 638 14 RDR8-C40 RDR8-N20 765 37 RDR3-C30 RDR3-N30 492 15 RDR8-C40 RDR8-N30 611 38 RDR3-C30 RDR3-N40 284 16 RDR8-C40 RDR8-N40 540 39 RDR3-C20 RDR3-N20 740 17 RDR8-C40 RDR8-N50 362 40 RDR3-C20 RDR3-N30 603 18 RDR8-C35 RDR8-N20 993 41 RDR3-C20 RDR3-N40 395 19 RDR8-C35 RDR8-N30 839 42 RDR3-C20 RDR3-N50 219 20 RDR8-C35 RDR8-N40 768 43 RDR3-C10 RDR3-N20 825 21 RDR8-C35 RDR8-N50 590 44 RDR3-C10 RDR3-N30 679 22 RDR8-C35 RDR8-N60 240 45 RDR3-C10 RDR3-N40 471 23 RDR8-C30 RDR8-N30 869 46 RDR3-C10 RDR3-N50 295

<2-3> combined Of primer  Selection

In order to confirm that the primer pairs in Table 7 are amplified well by RT-PCR and to specifically amplify RDV among three viruses of RBSDV, RDV and RSV, RT-PCR was performed in the same manner as in 1-3>.

As a result, as shown in FIG. 4a, a combination of Nos. 2, 11, 17, 28, 29, 34, 38, and 41, which is well amplified without a nonspecific reaction, was selected primarily from 46 primer pairs. .

RT-PCR was also performed for RBSDV and RSV as described above using the combination of Nos. 2, 11, 17, 28, 29, 34, 38 and 41. Likewise, the combination of Nos. 28, 29, 34, 38 and 41 was found to be a primer pair capable of specifically amplifying RDV. In case of No. 2, No. 11 and No. 17, RBSDV and RSV were amplified nonspecifically. By combining these results, 5 pairs of primers were finally selected as RDV diagnostic primer pairs (Table 8).

Finalized RDV Diagnostic Primer Pair Combination number division primer Standing column SEQ ID NO: Length (bp) Product (bp) 28 Downstream RDR8-C20 GGGCATTTCCTCCACGGCTACC 24 22 803 Upstream RDR8-N40 CGTCGCCGAAAGAAGGAGAAT 16 21 29 Downstream RDR8-C20 GGGCATTTCCTCCACGGCTACC 24 22 625 Upstream RDR8-N50 GCCGCAGACGCTGCTACTACATTTA 17 25 34 Downstream RDR8-C10 CCAGATTCAGGACCGGGCATTTC 23 23 289 Upstream RDR8-N60 GGATCCGCCGGCCATACCTG 18 20 38 Downstream RDR3-C30 GAGCGGTCAGGCAAAGCGAGAT 34 22 284 Upstream RDR3-N40 GCAATTGATCAGTGGCAGTCT 21 21 41 Downstream RDR3-C20 GGTTGCGTGACGAAGCCATTTAGAT 33 25 395 Upstream RDR3-N40 GCAATTGATCAGTGGCAGTCT 21 21

< Example  3> Rice stripe ( RSV Diagnostic species Singular primer  Development

<3-1> Selection and specificity of the nucleic acid to be diagnosed Of primer  design

RSV is a thin thread-shaped particle, 500-2000 nm in length and about 8 nm in width. Nucleic acid is composed of four kinds of single stranded RNA (ssRNA). RNAs 1, 2, 3, and 4 have sizes of about 10 kb, 3.4 to 3.6 kb, 2.3 to 2.5 kb, and 2.0 to 2.2 kb, respectively. RNA1 codes for a protein that is thought to be an RNA dependent RNA polymerase, and RNA2 codes for two proteins that have no known function. Envelope proteins are encoded in RNA3, and RNA4 is encoded by non-structural proteins that show high expression levels. The nucleic acid to be diagnosed in the present invention was RNA3 encoded by the envelope protein and RNA4 encoded by the nonstructural protein.

For the design of RDV species-specific diagnostic primers, the primer design procedure in Example 1 was applied mutatis mutandis as follows: Table 9 and Table 10 are now known to diagnose all the RBSDV strains known to date. The base sequences of RNA 3 and RNA 4 of the strains were analyzed to find common base sequences of RBSDV.

RSV Isolation Using the RNA3 Common Base Sequence Genbank accession no. Segregation Gene size (bp) X53563 RSV-T 2504 D01094 RSV 2475 AF508865 RSV-HZ 2509 AF508912 RSV-KM 2497 AF508913 RSV-YL 2489 AF509500 RSV-DW 2480 AJ875057 RSV-FMi04 2496 AJ875058 RSV-FYi04 2472 AJ875059 RSV-LLi04 2489 AJ875060 RSV-YAn04 2488 AJ875061 RSV-BSh04 2472 Y11095 RSV-chinese 2511

RSV Isolation Using the RNA4 Common Base Sequence Genbank accession no. Segregation Gene size (bp) Y11096 RSV-chinese 2235 AF221830 RSV-BS 2157 AF513505 RSV-HZ 2157 AY185499 RSV-KM 2235 AY185500 RSV-YR 2235 AY185501 RSV-CX 2137 AY185502 RSV-DL 2137 D01039 RSV 2137 D10979 RSV-T 2157

The searched species common nucleotide sequence is Maize belonging to Tenuivirus, a taxonomic virus similar to RSV. stripe virus (RNA3: M57426, RNA4:-) , Rice grassy stunt virus (RNA3: AB010377, RNA4: AB010378) , Rice hoja blanca virus (RNA3: L07940, RNA4: L14952) , Echinochloa hoja Through comparison analysis of RNA3 and RNA4 of blanca virus (RNA3: L75930, RNA4: L48441), species-specific sequences of only RSV were searched. Of these RSV species specific sequences, base sequences satisfying general conditions as primers were designed as diagnostic primers.

As RSV diagnostic primers, three upstream primers and four downstream primers were designed in RNA3, and three upstream primers and two downstream primers were designed in RNA4. The positions and sequences of the primers are shown in FIGS. 5 and 11, respectively. At this time, the position of the primer is NCBI accession no. Calculated based on X53563 (RNA 3) and Y11096 (RNA 4), respectively.

Diagnostic primers for RSV RNA 3 and RNA 4 primer division Sequence Length (bp) Tm (℃) Primer position Target genes Sequence number RSR3-N10 Upstream ACAATTTGCCCTTTACCGTTCCTA 24 59 448-471 RNA3 36 RSR3-N20 AGTGCACTAGAACCCTCACCAG 22 55 657-678 RNA3 37 RSR3-N30 TTGGCCAATCCTTAAAATGTGCTA 24 59 898-921 RNA3 38 RSR4-N20 GGGTATCTTCTTTGGCTGCTTCA 23 58 1,366-1,388 RNA4 39 RSR4-N30 CATCACAGTGTCACTGGTCTTCAT 24 55 1,537-1,560 RNA4 40 RSR4-N40 GATCTGAGGGGTTCACATAGGACT 24 56 1,755-1,778 RNA4 41 RSR3-C10 Downstream GATGCGCTGGCTGGTATGTCT 21 59 1,606-1,626 RNA3 42 RSR3-C20 TGTATTGCCATTATTATTGCTCACT 25 54 1,244-1,268 RNA3 43 RSR3-C25 TCCAGTAGAGTCTTTAGTTTG 21 43 1,222-1,242 RNA3 44 RSR3-C30 TAGCACATTTTAAGGATTGG 20 47 902-921 RNA3 45 RSR4-C10 AGTTGATAATAAGAATAGGAAATC 24 45 2,084-2,107 RNA4 46 RSR4-C20 TGAAGGCACATAGGAAGGCAACT 23 59 1,918-1,940 RNA4 47

<3-2> Of primer  Combination

By referring to the position of each primer in Table 11, 17 combinations were made as shown in Table 12 so that no products were too small or too large.

RSV diagnostic primer combinations and expected products Combination Downstream primer Upstream primer Expected product (bp) One RSR3-C30 RSR8-N10 474 2 RSR3-C30 RSR8-N20 265 3 RSR3-C25 RSR8-N10 795 4 RSR3-C25 RSR8-N20 586 5 RSR3-C25 RSR8-N30 345 6 RSR3-C20 RSR8-N10 821 7 RSR3-C20 RSR8-N20 612 8 RSR3-C20 RSR8-N30 371 9 RSR3-C10 RSR8-N10 1179 10 RSR3-C10 RSR8-N20 970 11 RSR3-C10 RSR8-N30 729 12 RSR4-C20 RSR4-N20 575 13 RSR4-C20 RSR4-N30 404 14 RSR4-C20 RSR4-N40 186 15 RSR4-C10 RSR4-N20 742 16 RSR4-C10 RSR4-N30 571 17 RSR4-C10 RSR4-N40 353

<3-3> combined Of primer  Selection

In order to confirm that the primer pairs in Table 12 are well amplified by RT-PCR and to specifically amplify RSV among three viruses of RBSDV, RDV, and RSV, RT-PCR was performed in the same manner as in 1-3>.

As a result, as shown in Fig. 6a, a combination of No. 16 and No. 17, which is well amplified without non-specific reaction, was selected first among 17 primer pairs.

As described above, RT-PCR was also performed on RBSDV and RDV using the 16th and 17th combinations. As shown in FIG. 6B, both 16th and 17th combinations can be specifically amplified for RDV. It was found that the pair. By combining these results, two pairs of primers were finally selected as RDV diagnostic primer pairs (Table 13).

Finalized RSV Diagnostic Primer Pair Combination number division primer Standing column SEQ ID NO: Length (bp) Product (bp) 16 Downstream RSR4-C10 AGTTGATAATAAGAATAGGAAATC 46 24 571 Upstream RSR4-N30 CATCACAGTGTCACTGGTCTTCAT 40 24 17 Downstream RSR4-C10 AGTTGATAATAAGAATAGGAAATC 46 24 353 Upstream RSR4-N40 GATCTGAGGGGTTCACATAGGACT 41 24

< Example  4> 3 types of viruses ( RBSDV , RDV , RSV ) Simultaneous Diagnosis

<4-1> Three kinds of viruses ( RBSDV , RDV , RSV For simultaneous diagnosis Of primer  Selection

In order to simultaneously diagnose RBSDV, RDV, and RSV, three types of viruses occurring in rice, primer pairs for simultaneous diagnosis were designed using the primer pairs selected in Examples 1, 2, and 3. The primer pairs used in the co-diagnosis combination are two pairs of RBSDV diagnostic primers, six pairs of RDV primers, and two pairs of RSV primers. These primer pairs were combined to design 11 combinations for simultaneous diagnosis (Table 14). Each combination was made to easily distinguish the virus to be diagnosed by the size of the RT-PCR product.

Design of primers for simultaneous diagnosis of three viruses Combination Downstream Upstream RT-PCR Product (bp) RBSDV RDV RSV RBSDV RDV RSV RBSV RDV RSV One RBSD-S10-C40 RDS8-C10 RSR4-C10 RBSD-S10-N40 RDS8-N60 RSR4-N40 235 289 353 2 RBSD-S10-C40 RDS8-C70 RSR4-C10 RBSD-S10-N40 RDS8-N10 RSR4-N40 235 411 353 3 RBSD-S10-C40 RDS8-C20 RSR4-C10 RBSD-S10-N40 RDS8-N50 RSR4-N40 235 625 353 4 RBSD-S10-C40 RDS8-C20 RSR4-C10 RBSD-S10-N40 RDS8-N40 RSR4-N40 235 803 353 5 RBSD-S10-C40 RDS3-C20 RSR4-C10 RBSD-S10-N40 RDR3-N40 RSR4-N30 235 395 571 6 RBSD-S10-C40 RDS8-C70 RSR4-C10 RBSD-S10-N40 RDS8-N10 RSR4-N30 235 411 571 7 RBSD-S10-C40 RDS8-C20 RSR4-C10 RBSD-S10-N40 RDS8-N40 RSR4-N30 235 803 571 8 RBSD-S10-C20 RDR3-C30 RSR4-C10 RBSD-S10-N40 RDR3-N40 RSR4-N40 622 284 353 9 RBSD-S10-C20 RDS8-C10 RSR4-C10 RBSD-S10-N40 RDS8-N60 RSR4-N40 622 289 353 10 RBSD-S10-C20 RDS8-C70 RSR4-C10 RBSD-S10-N40 RDS8-N10 RSR4-N40 622 411 353 11 RBSD-S10-C20 RDS8-C20 RSR4-C10 RBSD-S10-N40 RDS8-N40 RSR4-N40 622 803 353

Multiplex RT-PCR was performed using the three virus virus mixtures using the 11 simultaneous diagnostic primer combinations. Combinations 4 and 7 were selected first. RT-PCR using EF-Taq DNA polymerase (Solgent Co.) 0.625 U, except for amplification 40 times at 95 ℃ 45 seconds, 50 ℃ 60 seconds, 72 ℃ 80 seconds 40 and The same was done. RT-PCR was performed again under the conditions of three viruses alone and in combination, and as a result, the primer pairs of the combination 7 were confirmed to be amplified for each virus without a non-specific reaction, and were selected as a pair of simultaneous diagnosis primers (FIG. 7).

<4-2> Establishment of conditions for RT-PCR

In order to establish an optimal RT-PCR condition of the primer pair selected in Example <4-1>, the annealing temperature was changed during PCR reaction, that is, the annealing temperature was respectively 48.5, 49.9, 51.8, 54.5, 58.1, Was carried out in the same manner as in Example <1-3>, except that 62.3, 65.1, 68.0, 69.7 and 71.6 ° C.

As a result of confirming each PCR product by electrophoresis, as shown in FIG. 7B, the optimum annealing temperature was found to be 50 to 52 ° C.

<4-3> Confirmation of three viruses alone or in combination

The RT-PCR method of Example 4-2, wherein the annealing temperature of the three types of viruses generated in rice alone and all possible combination infection conditions using the selected primer pairs, is possible. 50 ° C.).

As a result, as shown in Figure 7c it can be seen that the primer pair of the present invention can accurately diagnose all three viruses, namely RBSDV, RDV and RSV, which occurs in rice alone or in combination.

The results are summarized in Table 15 below.

Summary of Multiple Simultaneous Diagnosis for Three Rice Viruses Target Virus Downstream Primer (SEQ ID NO) Upstream Primer (SEQ ID NO) RT-PCR Product (bp) Primer concentration (pmole / 50μl) Annealing Temperature (℃) RBSDV RBSD-S10-C40 (9) RBSD-S10-N40 (4) 235 25 50 to 52 RDV RDR8-C20 (24) RDR8-N40 (16) 803 25 RSV RSR4-C10 (46) RSR4-N30 (40) 571 25

As described above, the diagnostic primer of the present invention and the diagnostic method using the same are capable of diagnosing three types of viruses (black trophic atrophy, ogal disease, streaked leaf blight) occurring in rice species and individually or simultaneously. Has an effect. Therefore, the diagnostic primer of the present invention and the diagnostic method using the same have the effect of diagnosing three viruses occurring in rice.

Attach sequence list electronic file  

Claims (18)

A primer pair selected from the group consisting of a primer pair represented by SEQ ID NOs: 4 and 9 and a primer pair represented by SEQ ID NOs: 4 and 7; To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer pair selected from the group consisting of primer pairs represented; And SEQ ID NO: 40 and a primer represented by SEQ ID NO: 41 and 46 pairs 46 and atrophy rice tone comprises a pair of primers selected from the group consisting of primer pair represented by the disease virus (Rice black - streaked dwarf virus , RBSDV), Rice dwarf one or more virus diagnostic primers selected from the group consisting of virus , RDV) and Rice stripe virus (RSV). The method of claim 1, wherein the primer pair represented by SEQ ID NO: 4 and 9; Primer pairs represented by SEQ ID NOs: 16 and 24; And primer pairs represented by SEQ ID NOs: 40 and 46. One or more viruses selected from the group consisting of rice atrophy virus, rice gill disease, and rice stripe leaf blight virus, characterized by genomic RNA of a virus sample as a template, and performing RT-PCR using the primer of claim 1. Diagnostic method. The method of claim 3, (a) isolating genomic RNA of the viral sample; (b) using the genomic RNA of step (a) as a template and performing RT-PCR using the primer of claim 1; And (c) separating and analyzing the RT-PCR product of step (b) by size. The virus diagnosis method according to claim 3 or 4, wherein the RT-PCR is performed at an annealing temperature of 50 to 52 ° C. At least one virus diagnostic kit selected from the group consisting of rice atrophy atrophy virus, rice organ disease and rice stripe leaf blight virus, characterized in that it comprises a primer of claim 1. A primer for diagnosing forgery dystrophy virus comprising a primer pair represented by SEQ ID NOs: 4 and 9 or a primer pair represented by SEQ ID NOs: 4 and 7. A genomic RNA of a virus sample as a template and RT-PCR is performed using the primers of claim 7, characterized in that the dystrophy of atrophy of black atrophy disease. The method of claim 8, (a) isolating genomic RNA of the viral sample; (b) using the genomic RNA of step (a) as a template and performing RT-PCR using the primer of claim 7; And (C) a method for diagnosing forgery dystrophy virus, characterized in that the step of separating and analyzing the RT-PCR product of step (b) by size. A rice black atrophy virus diagnostic kit comprising the primer of claim 7. To primer pairs represented by SEQ ID NOs: 16 and 24, primer pairs represented by SEQ ID NOs: 17 and 24, primer pairs represented by SEQ ID NOs: 18 and 23, primer pairs represented by SEQ ID NOs: 21 and 33, and SEQ ID NOs: 21 and 34 A primer for diagnosing rice disease, comprising a selected from the group consisting of primer pairs. A method for diagnosing rice disease, characterized in that the genomic RNA of a virus sample is used as a template and RT-PCR is performed using the primer of claim 11. The method of claim 12, (a) isolating genomic RNA of the viral sample; (b) using the genomic RNA of step (a) as a template and performing RT-PCR using the primer of claim 11; And (c) a method for diagnosing rice disease, characterized in that the step of separating and analyzing the RT-PCR product of step (b) by size. A rice disease diagnosis kit comprising the primer of claim 11. A primer for diagnosing rice stripe leaf virus comprising a primer pair represented by SEQ ID NOs: 40 and 46 or a pair of primers represented by SEQ ID NOs: 41 and 46. A genome RNA of a virus sample as a template and RT-PCR is carried out using the primer of claim 15, characterized in that rice stripe leaf blight virus diagnostic method. The method of claim 16, (a) isolating genomic RNA of the viral sample; (b) using the genomic RNA of step (a) as a template and performing RT-PCR using the primer of claim 15; (C) method for diagnosing rice stripe leaf blight virus, characterized in that the step of separating and analyzing the RT-PCR product of step (b) by size. Rice stripe leaf blight virus diagnostic kit comprising the primer of claim 15.

Images