KR20130080968A - Pcr primers for detecting viruses occurring on cucurbitaceae and method for detceting cucurbitaceae viruses - Google Patents

Abstract

PURPOSE: PCR primers for detecting cucurbit viruses is provided to accurately and quickly detect 6 kind virus which causes disease on cucurbit by performing one polymerase chain reaction (PCR), thereby conveniently detecting infection by the virus. CONSTITUTION: A primer set for detecting 6 kind virus generated in cucurbit comprises; a primer pair represented by sequence number 1 and 2; a primer pair represented by sequence number 3 and 4; a primer pair represented by sequence number 5 and 6; a primer pair represented by sequence number 7 and 8, which are combination of primers capable of concurrently detecting 6 kind virus of ZYMV (zucchini yellow mosaic virus) -Sq and CMV (cucumber mosaic virus) -P1, CMV (cucumber mosaic virus)-II, CGMMV (cucumber green mottle mosaic virus), KGMMV (kyuri green mottle virus), ZYMV (zucchini yellow mosaic virus) -A. The method of concurrently detecting 6 kind virus of CMV-P1, CMV-II, CGMMV, KGMMV, ZYMV-A and ZYMV-Sq generated in cucurbit includes a step of performing PCR by using the primer set.

Description

PCR primers for detecting viruses occurring on cucurbitaceae and method for detceting cucurbitaceae viruses}

The present invention provides a primer set for PCR capable of specifically detecting six major viruses causing diseases in gourds and crops, namely CMV-CI, CMV II, CGMMV, KGMMV, ZYMV-A and ZYMV-Sq, and using the same The present invention relates to a method for detecting a viral infection of watermelon and crops.

Plant viral diseases dramatically reduce the yield and quality of infected crops, resulting in economic losses such as reduced production. In recent years, the late-season infection of eggs has been discovered lately by private companies, which has caused major problems, such as limiting the five-year cultivation in areas where the seed collection and infection are concerned. Nevertheless, the quarantine of Korea's import and export goods ranges from 3,500 to 4,200 thousand a year, and the viral disease has a very wide host range, and is capable of secondary infection through various routes such as contact, mediation or the use of infected species. Since there are few drugs, it is difficult to diagnose or control them. Therefore, having early diagnosis and contaminant removal system for plant virus disease is the most effective control method, and its importance is increasing.

In Korea, studies on the isolation and identification of viruses that cause plant infections have been conducted since the 1960s, mainly on plant virus gene banks (www.virusbank.org) and old agricultural test sites. Representative damages caused by viral diseases include leaf curling disease by PLAV and mosaic disease (mild mosaic and rugose mosaic) by PVX and PVY. And in 1977, there was a case of potato spindle tuber viroid (PSTVd), which was discarded entirely and imported from Japan. The damage caused by these viruses resulted in about 20-50% reduction in production, depending on the type of virus. As a result of the virus infection, at least five years are required to repair the abnormality of the production system. Therefore, the early diagnosis system of the virus is urgently needed for the production of good seed and the seed industry.

On the other hand, in general, pharmaceutical control methods that directly affect plant diseases caused by viruses have not been developed so far. Therefore, in order to manage plant diseases caused by viruses, whether a virus has occurred in a plant or not, It should be diagnosed precisely and quickly whether it occurred. However, since the virus is a pathogen smaller than 1 µm in size, the reality cannot be observed even under an optical microscope, and an electron microscope is required. Therefore, it is difficult to diagnose the virus occurring in the plant with the naked eye. Accordingly, various methods for diagnosing viruses have been developed and used.

So far, serological diagnostic methods such as ELISA have been used to diagnose viruses. However, the serological diagnostic method was not overwhelming when a large number of samples were used to diagnose at a general precision, but when a virus having a serologically flexible relationship with the virus to be diagnosed existed, a virus generated in a plant was misidentified or a virus was detected. As the host-derived substance is changed according to the type of plant infected with the virus, a nonspecific reaction with the substance causes a problem of incorrectly diagnosing the virus. In addition, when two or more viruses are combined, there is a problem in that multiple diagnosis using different kinds of antibodies is required to diagnose them.

Recently, reverse transcription-polymerase chain reaction (RT-PCR) has been used to precisely diagnose viruses occurring in plants. In the RT-PCR method, the primer used determines the specificity and precision of the diagnosis. The primer used in the RT-PCR method is generally not designed to be species specific because it is designed for gene cloning of the virus. Therefore, if species-specific detection primers for plant-causing viruses are developed, it will be possible to detect whether plant viruses are infected very easily and quickly.

On the other hand, the fruits and vegetables contain major economic crops such as cucumbers, melons, melons, and watermelons, and since most of them are produced by plant cultivation, it is important to prevent damage by early diagnosis of viral diseases. There are five species: CMV (cucumber mosaic virus), CGMMV (cucumber green mottle mosaic virus), KGMMV (kyuri green mottle virus), WMV2 (watermelon mosaic virus2) and ZYMV (zucchini yellow mosaic virus). However, these economical gourds and crops also suffer a great deal of economic loss if they are infected by these viruses.

Thus, as a method for early diagnosis of the infection of gourds and crops by the virus, Korean Patent Publication No. 2009-0038732 describes the technology for oligonucleotides for detecting gourd and plant infectious virus, but such a technology There is a shortage of technology that can distinguish silver foil and major viruses from each other.

Therefore, there is a need for the development of a method that can specifically detect the viruses causing the infection of gourds and crops.

Accordingly, an object of the present invention is to provide a primer set capable of detecting six kinds of gourd and crop viruses by one PCR method for each species.

Still another object of the present invention is to provide a method for diagnosing viral infection of gourd and crop using the primer set.

In addition, another object of the present invention is to provide a kit for diagnosing viral diseases of gourds and crops comprising the primer set.

In order to achieve the above object, the present invention is a cucumber mosaic virus (CMV) -P1, cucumber mosaic virus (CMV) -II, cucumber green mottle mosaic virus (CGMMV), kyuri green mottle virus (KGMMV), zucchini yellow (ZYMV) As a primer combination capable of simultaneously diagnosing six viruses of mosaic virus) -A and zucchini yellow mosaic virus (ZYMV) -Sq, SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; And it provides a set of primers for detecting the six kinds of viruses occurring in gourd and crops comprising the primer pair of SEQ ID NO: 7 and 8.

In one embodiment of the present invention, the primer pairs of SEQ ID NOS: 1 and 2 specifically detect cucumber mosaic virus (CMV) -P1 and cucumber mosaic virus (CMV) -II, The primer pair specifically detects cucumber green mottle mosaic virus (CGMMV), and the primer pairs of SEQ ID NOs: 5 and 6 specifically detect kyuri green mottle virus (KGMMV), and the primers of SEQ ID NOs: 7 and 8 The pair can specifically detect zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic virus (ZYMV) -Sq.

In one embodiment of the present invention, the gourd and crop may be cucumber, melon, melon or watermelon.

In addition, the present invention provides a kit for detecting six kinds of viruses that occur in gourds and crops comprising the primer set according to the present invention.

In addition, the present invention, including the step of performing PCR using the primer set according to the present invention, CMV (cucumber mosaic virus)-CM1 (cucumber mosaic virus)-CMV (cucumber mosaic virus)-six kinds of viruses occurring in the crops II, a method for simultaneously detecting cucumber green mottle mosaic virus (CGMMV), kyuri green mottle virus (KGMMV), zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic virus (ZYMV) -Sq.

In one embodiment of the present invention, the PCR is a denaturation reaction of the unknown viral genome as a template, 3 to 5 minutes at 94 ℃, 30 seconds to 50 seconds at 94 ℃, 30 seconds to 50 seconds at 55 ℃ CMV, which is 6 kinds of viruses that occur in gourds and crops by one PCR reaction that repeats 30 to 35 cycles with one cycle of 45 seconds to 50 seconds at 72 ° C., and then extends the reaction for 7 minutes at 72 ° C. (cucumber mosaic virus) -P1, cucumber mosaic virus (CMV) -II, cucumber green mottle mosaic virus (CGMMV), kyuri green mottle virus (KGMMV), zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic virus (ZYMV) ) -Sq can be detected simultaneously.

The primer set of the present invention performs a single PCR reaction to specifically and quickly and accurately detects six viruses of CMV P1, CMVII, CGMMV, KGMMV, ZYMV-A and ZYMV-Sq, which are the main viruses that cause diseases in gourds and crops. Can be detected, there is an effect that can easily diagnose the infection by the virus of gourds and crops.

1 is a PCR result (above) and a BLASTN result (bottom) using a CMV-C1 specific marker.
FIG. 2 shows PCR results (top), and BLASTN results (bottom) using CMV II specific markers.
3 shows PCR results (left) and CLASTN results (right) using CGMMV-C specific markers.
Fig. 4 shows PCR results (left) and BLASTN results (right) using KGMMV-C1 specific markers.
5 shows PCR results using ZYMV-A and ZYMV-Sq specific markers.
6 is a result of multiplex PCR analysis using the primer set of the present invention.
7 is a diagnostic result of the virus infection in cucumber crops using the primer set of the present invention.

The present invention relates to a primer set for PCR that can specifically detect a variety of viruses causing diseases in gourds and crops, and more specifically, CMV-PI, CMV, which are the main viruses of infecting gourds and crops. SEQ ID NOs: 1 and 2, which are primer combinations capable of detecting six viruses of II, CGMMV, KGMMV, ZYMV-A, and ZYMV-Sq by one PCR; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; And a primer set consisting of primer pairs of SEQ ID NOs: 7 and 8.

In particular, the present inventors have designed a primer that can specifically detect them based on the sequence information on the database of the six kinds of viruses that cause diseases in gourds and crops through one embodiment of the present invention, designed primers As a result of performing virus detection on virus-infected crops using candidate primers capable of specifically detecting six viruses, the SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; And when using a primer set consisting of primer pairs of SEQ ID NO: 7 and 8, it was confirmed that six virus-specific genes can be detected at different sizes at the same time, each virus can be detected by a single PCR reaction .

In addition, among the primer pairs included in the primer set for detecting six kinds of viruses occurring in the gourd and crop provided by the present invention, the primer pairs of SEQ ID NOs: 1 and 2 are CMV (cucumber mosaic virus) -P1 and CMV (cucumber). mosaic virus) -II can be specifically detected, primer pairs of SEQ ID NOs: 3 and 4 can specifically detect cucumber green mottle mosaic virus (CGMMV), and primer pairs of SEQ ID NOs: 5 and 6 are KGMMV (kyuri green mottle virus) specifically detects, and primer pairs of SEQ ID NOs: 7 and 8 are capable of specifically detecting ZYMV (zucchini yellow mosaic virus) -A and ZYMV (zucchini yellow mosaic virus) -Sq There is this.

Therefore, the primer set provided in the present invention can be used very easily to detect the six kinds of viruses that occur in gourds and crops, and the present invention also occurs in gourds and crops comprising the primer set of the present invention. Six kinds of virus detection kits can be provided.

The term primer, as used herein, herein refers to a single that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers. -Refers to stranded oligonucleotides. The appropriate length of the primer may vary depending on various factors, such as temperature and use of the primer. In addition, the sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer of the present invention does not need to have a perfectly complementary sequence to the nucleotide sequence of the gene that is the template, and it is sufficient that the primer has sufficient complementarity within the range capable of hybridizing with the gene sequence to perform the primer action. In addition, it is preferable that the primer according to the present invention can be used for gene amplification reaction.

In addition, the amplification reaction refers to a reaction for amplifying a nucleic acid molecule, and the amplification reactions of such genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR). , Ligase chain reaction (LCR), electron mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like.

Furthermore, if the six kinds of virus detection kits generated in the gourd and crop provided by the present invention are applied to a PCR amplification process, the kit of the present invention may optionally include reagents required for PCR amplification, such as buffers and DNA polymerases. (Eg, thermally stable DNA polymerases obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs In the case where the diagnostic kit of the present invention is applied to an immunoassay, the kit of the present invention may optionally include a substrate of a secondary antibody and a label.

Furthermore, the kit according to the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above, and the kit of the present invention may be a diagnostic kit including essential elements necessary for carrying out a DNA chip. have. The DNA chip kit may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

In addition, the present invention includes PCR, which comprises the steps of performing PCR using the primer set according to the present invention, CMV (cucumber mosaic virus) -P1, CMV (cucumber mosaic virus)- II, CGMMV (cucumber green mottle mosaic virus), KGMMV (kyuri green mottle virus), ZYMV (zucchini yellow mosaic virus) -A and ZYMV (zucchini yellow mosaic virus)-can provide a method for detecting at the same time, in particular In the detection method provided by the present invention, after denaturation of an unknown viral genome as a template for 3 to 5 minutes at 94 ° C, 30 seconds to 50 seconds at 94 ° C, 30 seconds to 50 seconds and 72 ° C at 55 ° C In one cycle of 45 seconds to 50 seconds, 30 cycles to 35 cycles were repeated, and one PCR reaction was performed at 72 ° C. for 7 minutes to detect 6 kinds of viruses occurring at night. have.

In general, the PCR reaction is optimized according to the time and temperature conditions of the PCR reaction according to the type and number of nucleotide sequences of the template DNA and primers used in the present invention. With a single PCR reaction, you can diagnose the infection.

In addition, in the present invention, the viruses and crops that can infect the virus may be, but are not limited to, cucumbers, melons, melons or watermelons.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

Checking for Inoculation and Infection of Viruses in Parks and Crops

After inoculating each host plant with viruses that cause disease of the fruit, it was checked for infection. Viruses used were those obtained by the inventors of the strain and plant virus gene bank, that is, CMV-PI, CMV II, CGMMV, KGMMV, ZYMV-A, and ZYMV-Sq. For inoculation of the virus to plants, first mix 0.01 g of the plant to be inoculated using a mortar with 4 μl of 0.01MK ₂ HPO ₄ (dipotassium phosphate), and then crush it. Was inoculated. In addition, after inoculation of the virus to the first leaf of the host plant for the development of plant diseases caused by the virus inoculation, the temperature was maintained at 22 ℃, humidity of 80% or more, after the third leaf of the leaves not inoculated Visually confirmed, the onset was confirmed using ELISA and antibody filter paper diagnostic kit (kisan bio). In addition, when the assay kit is difficult to assay, PCR products (sequence) after sequencing (sequencing) and performed BLASTN to test the significance of the infection for each virus (see FIGS. 1 to 5).

< Example  2>

For virus detection Primer  design

<2-1> Viral Sequence In Silico  analysis

In order to secure the nucleotide sequence of the virus inoculated into the host plant, the virus sequence registered in the NCBI database is searched for the six kinds of gourds and viruses, and the above sequence is classified according to the morphological characteristics of each virus. It was arranged by. After confirming the virus structure by using the virus website (http://tree.bio.ed.ac.uk/rnavirusdb), the CLC Sequence viewer program is used to align the arranged sequences and phylogenetic tree (phylogenetic). The sequence was grouped by constructing a tree).

<2-2> specific primer  Combination design

Based on the sequence information grouped in each plant virus, using the program (Primer 3) was designed a candidate primer combination that can specifically detect each virus as shown in Table 1 below.

<Example 3>

Virus disease diagnosis using PCR reaction

<3-1> Viral RNA Extraction (Trizol method)

In the above embodiment, liquid nitrogen was added to 100 mg of the leaves of the host plant infected with the virus, and the leaves were crushed using beads, and then 1,000 μl of Trizol reagent was added and vortexed. After 5 minutes, the mixture was allowed to stand at room temperature for 5 minutes, and 200 μl of chloroform was added to each tube and vortexed for 15 seconds, and then allowed to stand at room temperature for 15 minutes. After centrifugation at 12,000 rpm for 10 minutes at 4 ° C., 500 μl of the supernatant was transferred to a new tube and inverted by adding 400 μl of isopropanol. After centrifugation at 12,000 rpm for 10 minutes at 4 ° C, the supernatant was discarded and washed with 1 ml of 70% ethanol. After centrifugation for 2 minutes at 12,000rpm at a temperature of 4 ℃, discard the supernatant, and dried at room temperature for 5 minutes, 40 μl of DEPC was added, incubated at 65 ℃ for 10 minutes (mixed well) and stored at -70 ℃ .

<3-2> Virus cDNA Synthesis (SuperScript, invitrogen)

RT-PCR was performed on the RNA of each virus obtained in Example <3-1> for the synthesis of cDNA. As a reaction composition, 10 ng of extracted RNA, 1 μl of Oligo DT, 1 μl of dNTPs, and 1 μl of DEPC were used. After mixing and adjusting the total volume to 11 μl, the reaction was carried out at 65 ° C. for 5 minutes and at 4 ° C. for 1 minute. Thereafter, 2 µl of 10X RT, 4 µl of 25mM Mgcl2, 2 µl of 0.1M DTT, and 1 µl of RNase Out were adjusted, and the total volume was adjusted to 20 µl and reacted at 42 ° C. for 2 minutes. Thereafter, after adding 1 μl of SSII, the total volume was adjusted to 21 μl, reacted at 42 ° C. for 50 minutes and at 70 ° C. for 15 minutes. 1 μl of RNase H was added and treated at 37 ° C. for 20 minutes and stored at −20 ° C.

<3-3> PCR analysis using primers of the present invention for viral cDNA

After obtaining the cDNA of each virus through the experiment of Example <3-2>, each of the six viruses are detected in each of the primers listed in Table 1 above as primers expected to detect these viruses. After selecting each primer pair to make each combination, PCR reaction was performed to find primer combinations that can detect six viruses. First, the PCR reaction composition for the virus cDNA 10ng, 10 × buffer (containing 1.0mM MgCl ₂ ), dNTPs 200 μM, taq polymerase 0.1 Unit, Primer 0.25 uM, adjusted to a total volume of 25 μl, and then denatured at 94 ° C. for 5 minutes, 45 seconds at 94 ° C., 55 ° C. After a total of 35 repetitions of 45 seconds at 45 ℃, 45 seconds at one cycle (cycle), the reaction was carried out at 72 ℃ for 7 minutes.

As a result, it was confirmed that the primer sets shown in Table 2 below can be used as specific primer combinations capable of detecting six viruses at once. In addition, two viruses of CMV-PI and CMV II can be detected with a pair of primers, and two viruses of ZYMV-A and ZYMV-Sq can be detected with a pair of primers ( 6).

Combination of primers for each virus that constitute optimal conditions Virus name Primer name Primer sequence (5 '→ 3') Product length SEQ ID NO: CMV-PI & CMV II FPCMVR2A-F YWCVACTCTGCCYACNCAYRD 240 One FPCMVR2A-R AGCTCWGGRACRTCRGCRTTW 2 CGMMV FPCGMMV_7-F TCCTAGCAATCCGACGACTG 214 3 FPCGMMV_7-R ACCACCGTCAGAAGACCCTC 4 KGMMV FPKGMMV_6-F CCAACGCTGCGACAAATAAT 106 5 FPKGMMV_6-R ACCATTTTGCGTTTGCAGAG 6 ZYMV-A & ZYMV-Sq FPZYMV_6F CCAACGCTGCGACAAATAAT 276 7 FPZYMV_6R GTCTTCGCTAGTGGTGGCAA 8

< Example  4>

Park and virus detection using primer pairs of the present invention

Furthermore, the inventors of the present invention used the virus-specific primer combinations capable of detecting six kinds of watermelons and viruses through Example 3 to identify whether the virus infected with the actual watermelons and crops could be detected. Sixteen were selected and diagnosed as disease by PCR analysis. To this end, all of the primer combinations shown in Table 2 were used. Six sets of the primers were used in Speed Vac. Concentrate using the instrument for 30 minutes, then mix it with commercially available Premixture, and then denature for 5 minutes at 94 ° C, 30 seconds at 94 ° C, 30 seconds at 55 ° C, 50 seconds at 72 ° C as a PCR reaction. After repeating a total of 35 cycles in a cycle, it was synthesized by reacting for 7 minutes at 72 ℃.

As a result, as shown in Figure 7, using the primer combination identified in the present invention it can be seen that it is possible to quickly and accurately detect the infection of six kinds of gourds and viruses through a single PCR method.

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> FNP, inc. <120> PCR primers for detecting viruses occurring on cucurbitaceae and          method for detceting cucurbitaceae viruses <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FPCMVR2A-F primer <400> 1 ywcvactctg ccyacncayr d 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FPCMVR2A-R primer <400> 2 agctcwggra crtcrgcrtt w 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPCGMMV_7-F primer <400> 3 tcctagcaat ccgacgactg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPCGMMV_7-R primer <400> 4 accaccgtca gaagaccctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPKGMMV_6-F primer <400> 5 ccaacgctgc gacaaataat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPKGMMV_6-R primer <400> 6 accattttgc gtttgcagag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPZYMV_6F primer <400> 7 ccaacgctgc gacaaataat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FPZYMV_6R primer <400> 8 gtcttcgcta gtggtggcaa 20

Claims (6)

Cucumber mosaic virus (CMV) -P1, cucumber mosaic virus (CMV) -II, cucumber green mottle mosaic virus (CGMMV), kyuri green mottle virus (KGMMV), zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic (ZYMV) As a primer combination that can simultaneously diagnose six viruses of virus) -Sq, SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; And a primer set for detecting six kinds of viruses occurring in a gourd and a crop comprising primer pairs of SEQ ID NOs: 7 and 8. The method of claim 1,
The primer pairs of SEQ ID NOs: 1 and 2 specifically detect cucumber mosaic virus (CMV) -P1 and cucumber mosaic virus (CMV) -II,
The primer pairs of SEQ ID NOs: 3 and 4 specifically detect CGMMV (cucumber green mottle mosaic virus),
The primer pairs of SEQ ID NO: 5 and 6 specifically detects KMMV (kyuri green mottle virus),
The primer pairs of SEQ ID NOs: 7 and 8 are for detecting six viruses occurring in gourds and crops, characterized by specifically detecting ZYMV (zucchini yellow mosaic virus) -A and ZYMV (zucchini yellow mosaic virus) -Sq. Primer set. The method of claim 1,
The gourd crop is a primer set for detecting 6 kinds of viruses occurring in the gourd crop, characterized in that cucumber, melon, melon or watermelon. Six kinds of virus detection kits that occur in gourd and crops comprising the primer set of claim 1. 6 kinds of viruses that occur in gourd and crops, including the step of performing PCR using the primer set of claim 1, CMV (cucumber mosaic virus) -P1, CMV (cucumber mosaic virus) -II, CGMMV (cucumber green mottle) mosaic virus), kyuri green mottle virus (KGMMV), zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic virus (ZYMV) -Sq. The method of claim 5,
The PCR is based on an unknown viral genome as a template, after denaturation at 94 ° C. for 3 to 5 minutes, 30 seconds to 50 seconds at 94 ° C., 30 seconds to 50 seconds at 55 ° C., and 45 seconds to 50 seconds at 72 ° C. After repeated cycles of 30 to 35 cycles in one cycle, CMV (cucumber mosaic virus) -P1, CMV, six kinds of viruses that occur in gourds and crops in one PCR reaction for 7 minutes extension reaction at 72 ° C. (cucumber mosaic virus) -II, cucumber green mottle mosaic virus (CGMMV), kyuri green mottle virus (KGMMV), zucchini yellow mosaic virus (ZYMV) -A and zucchini yellow mosaic virus (ZYMV) -Sq.

Images