KR20150145771A - Primer set for multiple detection lily viruses and method for detecting said viruses using the same - Google Patents

Primer set for multiple detection lily viruses and method for detecting said viruses using the same Download PDF

Info

Publication number
KR20150145771A
KR20150145771A KR1020140074861A KR20140074861A KR20150145771A KR 20150145771 A KR20150145771 A KR 20150145771A KR 1020140074861 A KR1020140074861 A KR 1020140074861A KR 20140074861 A KR20140074861 A KR 20140074861A KR 20150145771 A KR20150145771 A KR 20150145771A
Authority
KR
South Korea
Prior art keywords
virus
seq
primer
lsv
cmv
Prior art date
Application number
KR1020140074861A
Other languages
Korean (ko)
Other versions
KR101642771B1 (en
Inventor
최홍수
김미경
곽해련
신준철
서장균
이준성
Original Assignee
대한민국(농촌진흥청장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(농촌진흥청장) filed Critical 대한민국(농촌진흥청장)
Priority to KR1020140074861A priority Critical patent/KR101642771B1/en
Publication of KR20150145771A publication Critical patent/KR20150145771A/en
Application granted granted Critical
Publication of KR101642771B1 publication Critical patent/KR101642771B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a primer set for multiplex diagnosis of lily viruses including Cucumber mosaic virus (CMV), Lily mottle virus (LMoV), Plantago asiatica mosaic virus (PlAMV), and Lily symptomless virus (LSV), and a virus multiplex diagnosing method using the same, wherein the primer set includes a primer pair represented by sequence number 1 and sequence number 2, a primer pair represented by sequence number 3 and sequence number 4, a primer pair represented by sequence number 5 and sequence number 6, and a primer pair represented by sequence number 7 and sequence number 8. The primer set according to the present invention may simultaneously diagnose four kinds of lily infection viruses at once, so time and costs spent in diagnosing viruses may be reduced. Accordingly, economical feasibility is ensured and contribution may be made to the production of virus vigorous bulbs seedlings.

Description

나리 바이러스 다중 진단용 프라이머 세트 및 이를 이용한 진단 방법{Primer set for multiple detection lily viruses and method for detecting said viruses using the same}TECHNICAL FIELD The present invention relates to a primer set for multiple diagnosis of laryngeal virus and a diagnostic method using the primer set.

본 발명은 나리에 발생하는 바이러스의 다중 진단을 위한 프라이머 세트 및 이를 이용한 진단 방법에 관한 것으로, 더욱 상세하게는 나리에 발생하는 4종의 바이러스를 동시에 진단할 수 있는 프라이머 세트 및 이를 이용한 진단 방법에 관한 것이다.More particularly, the present invention relates to a primer set capable of simultaneously diagnosing four types of viruses occurring in a host, and a diagnostic method using the primer set. .

일반적으로 국내에서 경제적으로 심각한 피해를 일으키는 나리 바이러스병은 오이 모자이크 바이러스 (Cucumber mosaic virus, CMV), 나리 얼룩무늬 바이러스 (Lily mottle virus, LMoV), 나리 무병징 바이러스 (Lily symptomless virus , LSV)의 바이러스들이 단독 또는 복합 감염되어 큰 피해를 주고 있으며 병징은 주로 잎에 모자이크 증상이 나타난다. 그 외에도 엽맥 황화, 백색괴사 반점, 꽃잎의 위축, 잎 말림, 식물체의 위축, 황화줄무늬 등의 증상이 나타난다. 또한, 바이러스에 감염되면 꽃의 품질 저하, 구근 생산량에도 큰 영향을 끼쳐 LSV에 감염되면 1-20%의 구근 생산량이 감소된다. 따라서 나리 구근 수입 의존도가 큰 우리나라는= 2013년 신규로 발생된 질경이 모자이크 포텍스바이러스(Plantago asiatica mosaic virus , PlAMV) 등을 포함한 나리 바이러스를 신속하고 정확하게 진단하는 기술 개발이 필요하다.Generally, the Nari viral disease that causes serious economic damage in the country's cucumber mosaic virus (Cucumber mosaic virus, CMV), Canary tabby virus (Lily mottle virus, LMoV), Canary virus disease free ranging (Lily symptomless virus , LSV) viruses are infected alone or in combination and cause great damage, and the symptom is mainly mosaic symptoms on leaves. In addition, symptoms such as vein sagging, white necrotic spots, petal atrophy, leaf curl, plant atrophy, and sulphated streaks appear. In addition, infection with viruses has a significant impact on flower quality and bulb production, and LSV infection can reduce 1-20% bulb production. Thus, Korea, which has a high dependency on Larie bulb importation = 2013 newly produced Plantain mosaic phytate virus ( Plantago asiatica mosaic virus , and PlAMV), it is necessary to develop a technology to rapidly and accurately diagnose viruses.

나리 바이러스는 전 세계적으로 약 20여 종이 알려져 있으며 특히 LSV, CMV, LMoV, Lily virus X (LVX) 등이 흔히 발견된다. (Asjes, C.J., 2000; Chen, J. 등, 2005; Choi, S.A. 등, 2003; Huang, C.H. 등, 2005), 이중에서 나리에 문제가 되고 있으며, 명확하게 구명된 바이러스는 표 1과 같이 정리를 하였다. 히기 표 1은 나리에 발생하는 주요 바이러스를 나타낸 것이다. About 20 viruses are known worldwide, especially LSV, CMV, LMoV, Lily virus X (LVX) are frequently found. (Asjes, CJ, 2000; Chen, J. et al., 2005; Choi, SA et al., 2003; Huang, CH et al., 2005) Respectively. Table 1 shows the major viruses that occur in the larvae.

NoNo .. 바이러스명Virus name 약어Abbreviation 그룹group 전염infection 1One LilyLily symptomlesssymptomless virusvirus LSVLSV BetaflexiviridaeBetaflexiviridae ( ( CarlavirusCarlavirus )) 진딧물
(비영속)aphid
(Non-permanent) 22 LilyLily mottlemottle virusvirus LMoVLMoV PotyviridaePotyviridae ( ( PotyvirusPotyvirus )) 진딧물
(비영속)aphid
(Non-permanent) 33 TulipTulip breakingbreaking virusvirus TBVTBV PotyviridaePotyviridae ( ( PotyvirusPotyvirus )) 진딧물
(비영속)aphid
(Non-permanent) 44 CucumberCucumber mosaicmosaic virusvirus CMVCMV BromoviridaeBromoviridae ( ( CucumovirusCucumovirus )) 진딧물
(비영속)aphid
(Non-permanent) 55 ArabisArabis mosaicmosaic virusvirus ArMVArMV SecoviridaeSecoviridae ( ( FabavirusFabavirus )) 선충
(반영속)eelworm
(Reflection) 66 BroadBroad beanbean wiltwilt virusvirus BBWVBBWV SecoviridaeSecoviridae ( ( FabavirusFabavirus )) 진딧물
(비영속)aphid
(Non-permanent) 77 CitrusCitrus tattertatter leafleaf virusvirus CTLVCTLV BetaflexiviridaeBetaflexiviridae ( ( CapillovirusCapillovirus )) 접목grafting 88 LilyLily virusvirus X X LVXLVX AlphaflexiviridaeAlphaflexiviridae ( ( PotexvirusPotexvirus )) 즙액전염만 가능Juice spread only 99 StrawberryStrawberry latentlatent ringspotringspot virusvirus SLRVSLRV Secoviridae (Unassigned) Secoviridae (Unassigned) 선충
(반영속)eelworm
(Reflection) 1010 TobaccoTobacco rattlerattle virusvirus TRVTRV VirgaviridaeVirgaviridae ( ( TobravirusTobravirus )) 선충
(반영속)eelworm
(Reflection) 1111 TomatoTomato ringspotringspot virusvirus ToRSVToRSV ComovirinaeComovirinae ( ( NepovirusNepovirus )) 선충
(반영속)eelworm
(Reflection) 1212 PlantagoPlantago asiaticaasiatica mosaicmosaic virusvirus PlAMVPlAMV AlphaflexiviridaeAlphaflexiviridae ( ( PotexvirusPotexvirus )) 즙액전염만 가능Juice spread only

국내에서의 나리 바이러스병은 현재까지 CMV, LMoV, BBWV, ToRSV, CarMV및 LSV 등 6종이 보고되어 있다 (Jung, H.J. 등, 2000; Jung, B.N. 등, 2002; Lee 등, 1996; Kim, J.S. 등 1990; Park, J.H. 등, 2003; Jung, Y.H. 등, 1996). 이후 추가로 1종의 바이러스, PlAMV 가 새로 검정이 되었다. 2013년에 지역별로 수집된 나리 시료 215점에 대해 주요 나리 바이러스 4종에 대해 검정한 결과, 표 2와 같은 분포를 보여주었다. In Korea, there have been 6 cases of CMV, LMoV, BBWV, ToRSV, CarMV and LSV (Jung, HJ et al., 2000; Jung, BN et al. Park, JH et al., 2003; Jung, YH et al., 1996). Thereafter, one additional virus, PlAMV, was newly tested. Table 2 shows the distribution of the 215 species of lily samples collected by region in 2013 as a result of the test for four major viruses.

하기 표 2는 국내 나리 바이러스 발생 상황을 보여준다.Table 2 below shows the occurrence of domestic laryngeal virus.

13 지역별 나리 검정
13 Area test
감염종수Number of infections 바이러스 virus 검정주수Black stem 검정률(%)Test rate (%) 1종1 species CMVCMV 00 00 LMoVLMoV 6666 30.7030.70 PlAMVPlAMV 22 0.930.93 LSVLSV 1One 0.470.47 2종2 species CMV+LMoVCMV + LMoV 1313 6.056.05 CMV+PlAMVCMV + PlAMV 00 00 CMV+LSVCMV + LSV 00 00 LMoV+PlAMVLMoV + PlAMV 1515 6.986.98 LMoV+LSVLMoV + LSV 1212 5.585.58 PlAMV+LSVPlAMV + LSV 55 2.332.33 3종3 species CMV+LMoV+PlAMVCMV + LMoV + PlAMV 22 0.930.93 CMV+LMoV+LSVCMV + LMoV + LSV 1One 0.470.47 CMV+PlAMV+LSVCMV + PlAMV + LSV 00 00 LMoV+PlAMV+LSVLMoV + PlAMV + LSV 2121 9.779.77 4종4 species CMV+LMoV+PlAMV+LSVCMV + LMoV + PlAMV + LSV 1One 0.470.47 TotalTotal 215215 100100

CMV는 Bromoviridae 과 Cucumovirus 속에 속하는 바이러스로, Bromoviridae 과, Cucumovirus 속이며 3개의 single stranded plus-sense RNA로 구성되어 있다. RNA 1과 2는 1a, 2a 단백질을 만들며 replicase complex를 이루는데 관여한다. RNA 3는 3a 단백질을 만들며 viral movement protein (MP)으로 알려져 있다. (Chen, Y.K. 등, 2001; Choi, S.K. 등, 2003). CMV는 약 80종의 진딧물에 의해 비영속 전염을 한다. 1916년 오이에서 처음 발견했지만 현재 온대 및 열대 등 모든 기후에서 전세계적으로 발생하는 것으로 알려져 있다. 그리고 약 1200종의 작물에 큰 경제적 손실을 일으킬 수 있다. 나리에서는 품종에 따라 다양한 병징을 일으키며 생육 불량을 가져와 피해를 주고 있다.CMV is Bromoviridae And Cucumovirus The virus belongs to the genus Bromoviridae , Cucumovirus And consists of three single stranded plus-sense RNAs. RNA 1 and 2 are involved in the formation of the 1a and 2a proteins and the formation of a replicase complex. RNA 3 produces the 3a protein and is known as the viral movement protein (MP). (Chen, YK et al., 2001; Choi, SK et al., 2003). CMV is infected by about 80 aphids. It was first discovered in 1916 in cucumber, but is now known to occur worldwide in all climates, including temperate and tropical. And it can cause great economic loss to about 1200 kinds of crops. Laryngeal disease causes various symptoms depending on the breed, causing injury and damage.

LMoV는 Potyviridae 과 Potyvirus 속에 속하는 바이러스로, single stranded plus-sense RNA 로 구성되어 있다. 길이가 700 nm이며 게놈은 10 kb이다 (Zheng, H.Y. 등, 2003). 진딧물에 의해 비영속 전염을 하며, 나리에서 처음 발견되었다 (Brierley 등, 1944). 나리에서 CMV와 마찬가지로 품종에 따라 다양한 병징을 일으키며 생육 불량을 가져와 전세계적으로 나리재배에 큰 피해를 주고 있다.LMoV is a potyviridae And Potyvirus It is composed of single stranded plus-sense RNA. The length is 700 nm and the genome is 10 kb (Zheng, HY et al., 2003). Non-persistent infections by aphids were first detected in Lari (Brierley et al., 1944). As in CMV, it induces various symptoms depending on the breed, causing poor growth and causing great damage to cultivation all over the world.

PlAMV는 Alphaflexiviridae 과 Potexvirus 속에 속하며, 입자 모양은 사상형이고, 길이는 490-530nm이며, 게놈은 6.1kb이다. 질경이에서 처음 발견되었으며 (Kostin 등, 1976), 매개충은 알려져 있지 않고 즙액전염으로 전파되는 것으로 알려져 있다. 러시아에서 처음 발견하여 현재 중앙아시아지역에 주로 발생하는 것으로 보고되어 있다. 온실 내 나리에 괴사 증상을 일으키고 꽃의 상품성을 떨어트리고 80%의 손실을 가져온 것으로 보고되어 있다. 반면, 아직까지 노지에서는 작물에 손실을 일으키는 것은 알려져 있지 않다. (Plant Protection Service of the Netherlands, 2010) PlAMV is Alphaflexiviridae And Potexvirus , The particle shape is mapped, length is 490-530nm, and genome is 6.1kb. It was first found in plantain (Kostin et al., 1976), and the insect is unknown and is known to spread by juice transmission. It was first discovered in Russia and is reported to occur mainly in Central Asia. It has been reported that it causes necrotic symptoms in the greenhouse, lowers the commerciality of flowers and causes 80% loss. On the other hand, it is not known that crops are damaged in the past. (Plant Protection Service of the Netherlands, 2010)

LSV는 Betaflexiviridae과 Carlavirus속에 속하는 바이러스로, Carlavirus 속이며 길이가 610~690 nm, 지름이 12~15 nm이다. 게놈은 7.4~8.5 kb, single stranded plus-sense RNA로 구성되어 있다 (Ahn, H.I. 등, 1999; Choi, S.A. 등, 2003). 진딧물에 의해 비영속 전염을 하며, 나리에서 처음 발견되었다 (Brierley 등, 1944). 나리에서 뚜렷한 병징이 나타나진 않지만 감염으로 인해 구근 퇴화가 일어나 품질 저하를 일으킨다. 육안으로 LSV를 발견하기 어려워 포장에서 바이러스 감염 여부를 판단하기 어렵다. 다른 바이러스와 복합으로 감염될 경우 증상이 심각하게 나타나 잠재적인 피해를 야기한다.LSV is a virus belonging to Betaflexiviridae and Carlavirus , and Carlavirus It has a length of 610 to 690 nm and a diameter of 12 to 15 nm. The genome consists of 7.4 to 8.5 kb of single stranded plus-sense RNA (Ahn, HI et al., 1999; Choi, SA et al., 2003). Non-persistent infections by aphids were first detected in Lari (Brierley et al., 1944). Although there are no obvious symptoms in the larynx, infection causes bulb degeneration which causes quality deterioration. LSV is difficult to detect visually, so it is difficult to judge whether or not the virus is infected in the package. If you are infected with other viruses, symptoms can be serious and cause potential harm.

본 발명은 상기와 같은 기술적 과제를 해결하기 위하여, 국내 나리(Liliaceae)에 발생하는 바이러스 4종, 오이 모자이크 바이러스 (Cucumber mosaic virus, CMV), 나리 얼룩무늬 바이러스 (Lily mottle virus, LMoV), 질경이 모자이크 포텍스바이러스 (Plantago asiatica mosaic virus, PlAMV), 및 나리 무병징 바이러스 (Lily symptomless virus, LSV)를 특이적으로 검출할 수 있는 프라이머 쌍을 설계하고, 상기 프라이머로 역전사-중합효소연쇄반응(RT-PCR)을 거쳐 상기 바이러스에 대해서 민감도가 우수한 프라이머 세트를 선별하여 제공하고자 한다. The present invention to solve the technical problems as described above, domestic canary virus 4 species occurs (Liliaceae), cucumber mosaic virus (Cucumber mosaic virus, CMV), canary speckles virus (Lily mottle virus, LMoV), plantain mosaic A pair of primers capable of specifically detecting Plantago asiatica mosaic virus ( PlAMV) and Lily symptomless virus ( LSV) were designed, and RT- PCR) to select and provide a primer set that is highly sensitive to the virus.

본 발명은 또한 상기 프라이머 세트를 포함하는 프라이머 조성물을 이용하여 상기 바이러스들을 각각 또는 동시에 검출할 수 있는 바이러스 진단 방법 및 진단 키트를 제공하고자 한다. The present invention also provides a virus diagnostic method and a diagnostic kit capable of detecting the viruses individually or simultaneously using a primer composition comprising the primer set.

상기 기술적 과제를 달성하기 위하여, 본 발명은 서열번호 1 및 서열번호 2로 표시되는 프라이머 쌍, 서열번호 3 및 서열번호 4로 표시되는 프라이머 쌍, 서열번호 5 및 서열번호 6으로 표시되는 프라이머 쌍 및 서열번호 7 및 서열번호 8로 표시되는 프라이머 쌍을 포함하는 오이 모자이크 바이러스 (Cucumber mosaic virus, CMV), 나리 얼룩무늬 바이러스 (Lily mottle virus, LMoV), 질경이 모자이크 포텍스바이러스 (Plantago asiatica mosaic virus , PlAMV) 및 나리 무병징 바이러스 (Lily symptomless virus , LSV)의 나리 바이러스 다중 진단용 프라이머 세트를 제공한다. In order to achieve the above object, the present invention provides a primer pair comprising a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: cucumber comprising a pair of primers represented by SEQ ID NO: 7 and 8 mosaic virus (cucumber mosaic virus, CMV), canary speckles virus (lily mottle virus, LMoV), plantain mosaic virus-Tex fabric (Plantago asiatica mosaic virus , PlAMV) and Lily symptomless virus , and LSV).

본 발명의 발명자들은 상기 4종 바이러스 내에서 지금까지 알려진 염기서열을 수집하여 종의 모든 계통과 분리주가 가지고 있는 공통 염기서열을 탐색한 후 이 공통 염기서열 중에서 유연관계가 있는 다른 바이러스가 가지고 있는 염기서열을 프라이머 설계 대상에서 제외시킴으로써 종 특이적 서열을 선발한 다음 이러한 종 특이적 염기서열로부터 프라이머로 최적의 조건을 가지는 서열을 종 특이적 프라이머로 설계하고 이 프라이머들을 조합별로 실제적인 역전사-중합효소연쇄반응(RT-PCR)을 거쳐 대상 바이러스 이외의 핵산과는 비특이적 반응이 없고, 대상 바이러스에 대해서는 민감도가 우수한 조합을 최종 선발하여 본 발명을 완성하게 되었다.The inventors of the present invention collect known nucleotide sequences in the above-mentioned four species viruses and search common sequences possessed by all strains and isolates of the species. Then, Specific sequences were selected by excluding the sequences from the primer design, and then sequences having optimal conditions as primers from these species-specific base sequences were designed as species-specific primers, and these primers were designed as combinations of actual reverse transcription-polymerase The present invention has been accomplished based on the final selection of a combination which is free of nonspecific reaction with a nucleic acid other than a target virus through a chain reaction (RT-PCR), and which is excellent in sensitivity to a target virus.

본 발명의 프라이머는 상기 바이러스에 대해서 종 특이적으로 RT-PCR 산물이 합성되도록 하기 위하여 개발되었다. 본 발명에서 종 특이적이라는 의미는 해당 프라이머가 진단대상이 되는 바이러스의 유전체 서열로부터 특이적인 RT-PCR 산물을 합성할 수 있음을 의미하며, 진단대상이 되는 바이러스 종 내의 모든 계통에 대해서 공통적으로 작용해야 하고, 다른 유사 종 또는 식물체 유래의 핵산과의 비특이적 반응은 일어나지 않아야 한다. 일반적으로 사용하는 프라이머의 경우는 바이러스의 특정 유전자를 증폭하기 위하여 설계되어 종 특이적이지 못한 경우가 많으며, 식물체 또는 다른 바이러스의 핵산에 의한 비특이적 산물을 생산하는 경우가 있기 때문에 진단용으로 사용하기에는 부적합하다.The primers of the present invention were developed to allow RT-PCR products to be synthesized species-specifically for the virus. In the present invention, the term "species-specific" means that the primer can synthesize a specific RT-PCR product from the genomic sequence of the virus to be diagnosed, and it is common for all the strains in the virus species to be diagnosed And nonspecific reactions with nucleic acids derived from other similar species or plants should not occur. Generally used primers are designed to amplify specific genes of viruses and are not species specific, and are sometimes unsuitable for diagnostic use because they may produce nonspecific products by the nucleic acid of plants or other viruses .

구체적으로 본 발명의 프라이머는 다음과 같은 방법으로 디자인 되었다. (a) 대상 바이러스의 유전자 중 대상이 되는 게놈을 선정;(b) 현재까지 알려진 대상 바이러스의 계통 및 분리주의 게놈서열에서 공통 염기서열을 탐색;(C) 유사 바이러스의 게놈과 동일 또는 유사한 서열을 배제;(d) 프라이머로 기능이 가능한 염기서열만을 선정하는 방법에 의해 프라이머를 디자인 했다. 디자인된 프라이머 중 RT-PCR에 의해 종 특이적인 증폭이 수행될 수 있으며, 비특이적 반응이 일어나지 않는 프라이머 쌍을 선정하였다.Specifically, the primer of the present invention was designed in the following manner. (a) selecting the target genome of the gene of the target virus; (b) searching for the common nucleotide sequence in the genome sequence of the target virus and the isolate genome; (C) (D) a primer was designed by selecting only a base sequence capable of functioning as a primer. A pair of primers that can be subjected to species-specific amplification by RT-PCR among the designed primers and which does not cause nonspecific reaction was selected.

본 발명에서 '프라이머'는 짧은 자유 3 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 핵산의 주형 (template)과 염기쌍(base pair)을 형성할 수 있고 핵산 주형의 가닥 복사를 위한 시작 지점으로 기능하는 짧은 핵산 서열을 의미한다. 상기 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다.In the present invention, a 'primer' is a nucleic acid sequence having a short free 3 'hydroxyl group and can form base pairs with a template of a complementary nucleic acid. Quot; means a short nucleic acid sequence which functions as a starting point. The primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

상기 4개의 바이러스를 RT-PCR 전기영동 결과로 구별하기 위해서는 크기 구별이 또렷해야 하므로, 증폭되는 산물의 크기를 고려하여, 각 바이러스를 검출하는 프라이머 쌍을 선발하였다. In order to distinguish the four viruses from each other by RT-PCR electrophoresis, it was necessary to distinguish the sizes of the viruses. Therefore, considering the size of amplified product, a pair of primers for detecting each virus was selected.

본 발명의 프라이머 세트는 CMV 검출용으로 서열번호 1과 2로 표시되는 프라이머 쌍, LMoV 검출용으로는 서열번호 3과 4로 표시되는 프라이머 쌍, PlAMV 검출용으로는 서열번호 5와 6으로 표시되는 프라이머 쌍, LSV 검출용으로는 서열번호 7과 8로 표시되는 프라이머 쌍을 이용한다. The primer set of the present invention comprises a pair of primers represented by SEQ ID NOS: 1 and 2 for CMV detection, a pair of primers represented by SEQ ID NOS: 3 and 4 for detection of LMoV, and a pair of primers represented by SEQ ID NOS: 5 and 6 for PlAMV detection Primer pairs and primer pairs shown in SEQ ID NOS: 7 and 8 are used for LSV detection.

본 발명의 CMV의 효율적인 유전자 증폭을 위한 프라이머로는 CMV 염기서열 2647~2671에 상보적인 서열번호 1에 기재된 올리고뉴클레오타이드를 전방향 프라이머(Forward primer)로, CMV 염기서열 3284~3259에 상보적인 서열번호 2에 기재된 올리고뉴클레오타이드를 역방향 프라이머(Reverse primer)로 제작한다. As the primers for efficient gene amplification of CMV of the present invention, oligonucleotides complementary to CMV nucleotide sequences 2647 to 2671 were used as forward primers and CMV nucleotide sequences 3284 to 3259, complementary to CMV nucleotide sequences 3284 to 3259, The oligonucleotide described in 2 is prepared with a reverse primer.

상기와 같이 CMV 염기서열 2647~2671을 선택한 이유는, 이 부위의 염기서열은 LMoV, PlAMV, 및 LSV와 공유하는 염기서열이 아니며, CMV 계통간에 차이가 없는 안정된 염기서열로서, CMV 에 특징적인 염기서열이기 때문이다. The reason for selecting CMV nucleotide sequences 2647 to 2671 as described above is that the nucleotide sequence of this site is not a nucleotide sequence shared with LMoV, PlAMV, and LSV, and is a stable nucleotide sequence having no difference between CMV lines, It is because it is sequence.

한편 CMV 염기서열 3284~3259을 선택한 이유는, 이 부위의 염기서열이 LMoV, PlAMV, 및 LSV와 공유하지 않는 특징적인 염기서열을 가지고 있으며, 상기 2647~2671 염기서열의 전방향 프라이머와 짝으로 하여 역전사 중합효소 연쇄반응을 실시할 경우에 CMV에 특이적인 염기서열 핵산인 462 bp 크기의 증폭된 유전자를 얻을 수 있기 때문이다. On the other hand, CMV nucleotide sequences 3284 to 3259 were selected because the nucleotide sequences of the CMV nucleotides 3284 to 3259 were not shared with LMoV, PlAMV, and LSV, and were paired with the forward primers of the 2647 to 2671 base sequences This is because when the reverse transcription polymerase chain reaction is performed, an amplified gene having a size of 462 bp, which is a nucleotide sequence specific for CMV, can be obtained.

상기 서열번호 1 및 2를 이용하여 증폭된 CMV에 특징적인 462 bp 크기의 증폭된 유전자는 진단에 적용할 때 국내외 나리에 발생하는 CMV 및 CMV 변이체를 오차없이 진단할 수 있다.The 462 bp amplified gene characteristic of CMV amplified using the above SEQ ID NOS: 1 and 2 can diagnose CMV and CMV variants occurring at home and abroad in an error-free manner when applied to diagnosis.

본 발명의 LMoV의 효율적인 유전자 증폭을 위한 프라이머로는 LMoV 염기서열 8616~8638에 상보적인 서열번호 3에 기재된 올리고뉴클레오타이드를 전방향 프라이머(Forward primer)로, LMoV 염기서열 9105~9088에 상보적인 서열번호 4에 기재된 올리고뉴클레오타이드를 역방향 프라이머(Reverse primer)로 제작한다. As the primers for efficient gene amplification of LMoV of the present invention, oligonucleotides of SEQ ID NO: 3 complementary to LMoV nucleotide sequences 8616 to 8638 are referred to as forward primers and sequences complementary to LMoV nucleotide sequences 9105 to 9088 The oligonucleotide described in 4 is prepared with a reverse primer.

상기와 같이 LMoV 염기서열 8616~8638을 선택한 이유는, 이 부위의 염기서열은 CMV, PlAMV, 및 LSV와 공유하는 염기서열이 아니며, LMoV 계통간에 차이가 없는 안정된 염기서열로서, LMoV 에 특징적인 염기서열이기 때문이다. As described above, LMoV nucleotide sequences 8616 to 8638 were selected because the nucleotide sequence of this site is not a nucleotide sequence shared with CMV, PlAMV, and LSV, and is a stable nucleotide sequence having no difference between LMoV lines, It is because it is sequence.

한편 LMoV 염기서열 9105~9088을 선택한 이유는, 이 부위의 염기서열이 CMV, PlAMV, 및 LSV와 공유하지 않는 특징적인 염기서열을 가지고 있으며, 상기 8616~8638 염기서열의 전방향 프라이머와 짝으로 하여 역전사 중합효소 연쇄반응을 실시할 경우에 LMoV에 특이적인 염기서열 핵산인 490 bp 크기의 증폭된 유전자를 얻을 수 있기 때문이다. On the other hand, the reason why LMoV nucleotide sequences 9105 to 9088 were selected is that the nucleotide sequence of this site has a characteristic base sequence that is not shared with CMV, PlAMV, and LSV, and is paired with an omnidirectional primer of the nucleotide sequence of 8616 to 8638 This is because when the reverse transcription polymerase chain reaction is performed, an amplified gene having a size of 490 bp, which is a nucleotide sequence specific to LMoV, can be obtained.

상기 서열번호 3 및 4를 이용하여 증폭된 LMoV에 특징적인 490 bp 크기의 증폭된 유전자는 진단에 적용할 때 국내외 나리에 발생하는 LMoV 및 LMoV 변이체를 오차없이 진단할 수 있다.The 490 bp amplified gene, which is characteristic of LMoV amplified using SEQ ID NOS: 3 and 4, can be used to diagnose LMoV and LMoV mutants occurring at home and abroad when diagnosed.

본 발명의 PlAMV의 효율적인 유전자 증폭을 위한 프라이머로는 PlAMV 염기서열 5372~5391에 상보적인 서열번호 5에 기재된 올리고뉴클레오타이드를 전방향 프라이머(Forward primer)로, PlAMV 염기서열 5710~5729에 상보적인 서열번호 6에 기재된 올리고뉴클레오타이드를 역방향 프라이머(Reverse primer)로 제작한다. As the primers for efficient gene amplification of PlAMV of the present invention, oligonucleotides of SEQ ID NO: 5 complementary to PlAMV nucleotide sequences 5372 to 5391 were used as forward primers and primers of SEQ ID NOs: 5 to 519 complementary to PlAMV nucleotide sequences 5710 to 5729 The oligonucleotide described in SEQ ID NO: 6 is prepared as a reverse primer.

상기와 같이 PlAMV 염기서열 5372~5391을 선택한 이유는, 이 부위의 염기서열은 CMV, LMoV, 및 LSV와 공유하는 염기서열이 아니며, PlAMV 계통간에 차이가 없는 안정된 염기서열로서, PlAMV 에 특징적인 염기서열이기 때문이다. The reason for selecting PlAMV nucleotide sequences 5372 to 5391 as described above is that the nucleotide sequence at this site is not a nucleotide sequence shared with CMV, LMoV, and LSV, and is a stable nucleotide sequence having no difference between PlAMV strains, It is because it is sequence.

한편 PlAMV 염기서열 5710~5729을 선택한 이유는, 이 부위의 염기서열이 CMV, LMoV, 및 LSV와 공유하지 않는 특징적인 염기서열을 가지고 있으며, 상기 5372~5391 염기서열의 전방향 프라이머와 짝으로 하여 역전사 중합효소 연쇄반응을 실시할 경우에 PlAMV에 특이적인 염기서열 핵산인 339 bp 크기의 증폭된 유전자를 얻을 수 있기 때문이다. On the other hand, the reason for selecting PlAMV nucleotide sequences 5710 to 5729 is that the nucleotide sequence of this site has a characteristic base sequence that is not shared with CMV, LMoV, and LSV, and is paired with the forward primer of the 5372 to 5391 base sequence This is because when the reverse transcription polymerase chain reaction is performed, an amplified gene having a size of 339 bp, which is a nucleotide sequence specific to PlAMV, can be obtained.

상기 서열번호 5 및 6을 이용하여 증폭된 PlAMV에 특징적인 339 bp 크기의 증폭된 유전자는 진단에 적용할 때 국내외 나리에 발생하는 PlAMV 및 PlAMV 변이체를 오차없이 진단할 수 있다.The 339 bp amplified gene characteristic of PlAMV amplified using SEQ ID NOS: 5 and 6 can be used to diagnose PlAMV and PlAMV mutants occurring at home and abroad when diagnosed.

본 발명의 LSV의 효율적인 유전자 증폭을 위한 프라이머로는 LSV 염기서열 7479~7501에 상보적인 서열번호 7에 기재된 올리고뉴클레오타이드를 전방향 프라이머(Forward primer)로, LSV 염기서열 7696~7677에 상보적인 서열번호 8에 기재된 올리고뉴클레오타이드를 역방향 프라이머(Reverse primer)로 제작한다. As the primers for efficient gene amplification of the LSV of the present invention, oligonucleotides of SEQ ID NO: 7 complementary to LSV nucleotide sequences 7479 to 7501 were used as forward primers and oligonucleotides complementary to LSV nucleotide sequences 7696 to 7677 The oligonucleotide described in SEQ ID NO: 8 is prepared with a reverse primer.

상기와 같이 LSV 염기서열 7479~7501을 선택한 이유는, 이 부위의 염기서열은 CMV, LMoV, 및 PlAMV와 공유하는 염기서열이 아니며, LSV 계통에 차이가 없는 안정된 염기서열로서, LSV 에 특징적인 염기서열이기 때문이다. The reason for selecting LSV nucleotide sequence 7479 to 7501 as described above is that the nucleotide sequence at this site is not a base sequence shared with CMV, LMoV, and PlAMV, and is a stable base sequence having no difference in LSV system, It is because it is sequence.

한편 LSV 염기서열 7696~7677을 선택한 이유는, 이 부위의 염기서열이 CMV, LMoV, 및 PlAMV와 공유하지 않는 특징적인 염기서열을 가지고 있으며, 상기 7479~7501 염기서열의 전방향 프라이머와 짝으로 하여 역전사 중합효소 연쇄반응을 실시할 경우에 PlAMV에 특이적인 염기서열 핵산인 218 bp 크기의 증폭된 유전자를 얻을 수 있기 때문이다. On the other hand, the reason why LSV nucleotide sequence 7696 to 7677 was selected is that the nucleotide sequence of this region has a characteristic base sequence which is not shared with CMV, LMoV, and PlAMV, and is paired with the forward primer of the above 7479 to 7501 base sequence This is because when the reverse transcription polymerase chain reaction is performed, an amplified gene having a size of 218 bp, which is a nucleotide sequence specific to PlAMV, can be obtained.

상기 서열번호 7 및 8을 이용하여 증폭된 LSV에 특징적인 218 bp 크기의 증폭된 유전자는 진단에 적용할 때 국내외 나리에 발생하는 LSV 및 LSV 변이체를 오차없이 진단할 수 있다.The 218 bp amplified gene, which is characteristic of LSV amplified using SEQ ID NOS: 7 and 8, can diagnose LSV and LSV mutants occurring at home and abroad when diagnosed.

본 발명의 나리 바이러스 다중 진단용 프라이머 세트는 CMV, LMoV, PlAMV 및 LSV 단독감염, 2종, 3종 및 4종 복합감염시킨 시료를 RT-PCR 실행하여, 그 산물을 전기영동 한 결과, 상기 4가지 바이러스들을 크기별로 뚜렷하게 구별할 수 있었다. 그러므로 상기 프라이머 쌍을 상기 4가지 바이러스들을 동시에 또는 각각 진단하는데 유용하게 쓸 수 있음을 알 수 있다.The primer sets for multiple diagnosis of larynx viruses of the present invention were obtained by performing RT-PCR on CMV, LMoV, PlAMV and LSV single infectious, two, three, and four types of infected samples, and the products were electrophoresed. As a result, Viruses could be distinguished by size. Therefore, it can be seen that the above primer pair can be useful for diagnosing the four viruses simultaneously or individually.

본 발명의 나리 바이러스 다중 진단을 위한 프라이머 세트는 나리에 발생하는 바이러스 중에서 특이적으로 CMV, LMoV, PlAMV 및 LSV을 검출할 수 있다. The primer set for multiple diagnosis of Larynx virus according to the present invention can detect CMV, LMoV, PlAMV and LSV specifically among the viruses generated in Larynx.

또한, 다중 진단을 위한 multiplex PCR에서는 프라이머 간의 간섭현상으로 mono PCR에 비해 감도가 낮아지게 되는데, 본 발명의 프라이머 세트를 이용한 바이러스 진단 방법은 서로간의 간섭 현상이 감소되고, 민감도도 향상될 수 있다. In multiplex PCR for multiplex diagnosis, the sensitivity is lower than that of mono PCR due to interference between primers. In the virus diagnosis method using the primer set of the present invention, the interference phenomenon between the primers can be reduced and the sensitivity can be improved.

본 발명의 다른 실시 예에 따르면, 본 발명은 상기 프라이머 쌍을 포함하는 CMV, LMoV, PlAMV 및 LSV을 동시에 진단할 수 있는 다중 진단용 키트를 제공한다.According to another embodiment of the present invention, the present invention provides a multiple diagnosis kit capable of simultaneously diagnosing CMV, LMoV, PlAMV and LSV including the primer pair.

또한 본 발명은 상기 프라이머 쌍을 포함하는 CMV, LMoV, PlAMV 및 LSV 다중 진단용 조성물 및 이를 포함하는 키트를 제공한다.In addition, the present invention provides a composition for multiplex diagnosis of CMV, LMoV, PlAMV and LSV comprising the primer pair and a kit comprising the primer pair.

상기 조성물은 RT-PCR 증폭 반응을 수행하기에 필요한 시약, 열 안정성 DNA 폴리머라아제, dNTP 및 2가 금속 양이온을 함유하는 용액을 의미한다.The composition means a reagent, a thermostable DNA polymerase, a dNTP and a solution containing a divalent metal cation necessary for performing an RT-PCR amplification reaction.

상기 키트는 RT-PCR 용 키트로서, 서열번호 1과 2로 표시되는 프라이머 쌍, 서열번호 3과 4로 표시되는 프라이머 쌍, 및 서열번호 5와 6으로 표시되는 프라이머 쌍 및 서열번호 7과 8로 표시되는 프라이머 쌍으로 이루어진 군에서 선택되는 하나 이상의 프라이머 쌍 및 역전사 반응과 증폭 반응을 수행하기 위한 시약을 포함한다. 상기 키트에서 증폭반응을 수행하기 위한 시약은 역전사효소, DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한 RT-PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성성분들이 본 발명의 키트에 추가로 포함될 수 있다. 나아가 필요한 경우 RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수도 있다.The kit includes a primer pair shown in SEQ ID NO: 1 and 2, a primer pair shown in SEQ ID NO: 3 and 4, a primer pair shown in SEQ ID NO: 5 and 6, and a primer pair shown in SEQ ID NO: 7 and 8 One or more primer pairs selected from the group consisting of primer pairs to be displayed, and a reagent for performing the reverse reaction and the amplification reaction. The reagent for carrying out the amplification reaction in the kit may include reverse transcriptase, DNA polymerase, dNTPs, buffer, and the like. In addition, components necessary for conducting electrophoresis to confirm whether the RT-PCR product is amplified can be further included in the kit of the present invention. Further, it may contain an RNase inhibitor, DEPC-water, sterilized water and the like if necessary.

본 발명에서 'RT-PCR 키트'는 상기 RT-PCR 조성물을 동결 건조된 형태로 플라스틱 튜브에 담아 제조될 수 있으며, 상기 키트는 RT-PCR 조성물 외에, 분석에 사용되는 적절한 시약 및 도구를 더 포함할 수 있으며, 이러한 시약 및 도구로는 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지, 용해제, 세정제 등이 포함될 수 있다.In the present invention, 'RT-PCR kit' can be prepared by putting the RT-PCR composition into a plastic tube in a lyophilized form, and the kit further includes appropriate reagents and tools used for analysis in addition to the RT-PCR composition Such reagents and tools may include suitable carriers, labels capable of generating detectable signals, solubilizers, detergents, and the like.

상기 적합한 담체로는, 이에 한정되지는 않으나, 가용성 담체, 예를 들어 당 분야에 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS, 불용성 담체, 예를 들어 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로스 및 이들의 조합일 수 있다.Such suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffers known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester , Polyacrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

본 발명의 또 다른 실시예들에 따르면, (a) 시료로부터 바이러스 RNA를 분리하는 단계; (b) 상기 (a) 단계의 RNA를 주형으로, 서열번호 1 및 서열번호 2로 표시되는 프라이머 쌍, 서열번호 3 및 서열번호 4로 표시되는 프라이머 쌍, 서열번호 5 및 서열번호 6으로 표시되는 프라이머 쌍 및 서열번호 7 및 서열번호 8로 표시되는 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및 (c) 상기 (b) 단계의 RT-PCR 산물을 크기별로 분리하는 단계를 포함하는 CMV, LMoV, PlAMV 및 LSV을 동시에 진단할 수 있는 나리 바이러스 다중 진단 방법을 제공한다. According to still other embodiments of the present invention, there is provided a method of detecting viral RNA, comprising: (a) separating viral RNA from a sample; (b) a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4, a pair of SEQ ID NO: 5 and SEQ ID NO: 6, Performing the RT-PCR using the primer pair and the primer pair shown in SEQ ID NO: 7 and SEQ ID NO: 8; And (c) isolating the RT-PCR products of step (b) by size. The present invention also provides a method for diagnosing laryngeal viruses capable of simultaneously diagnosing CMV, LMoV, PlAMV and LSV.

바람직하게, 본 발명은 (a) 시료로부터 바이러스 RNA를 분리하는 단계; (b) 상기 (a) 단계의 RNA를 주형으로, 서열번호 1의 및 서열번호 2로 표시되는 프라이머 쌍, 서열번호 3 및 서열번호 4로 표시되는 프라이머 쌍, 서열번호 5 및 서열번호 6으로 표시되는 프라이머 쌍 및 서열번호 7 및 서열번호 8로 표시되는 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및 (c) 상기 (b) 단계의 RT-PCR 산물을 크기별로 분리하는 단계를 포함하는 CMV, LMoV, PlAMV 및 LSV를 다중 진단하는 방법을 제공한다. Preferably, the present invention provides a method of detecting a virus, comprising: (a) separating viral RNA from a sample; (b) a primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair shown in SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 And a primer pair shown in SEQ ID NO: 7 and SEQ ID NO: 8; And (c) isolating the RT-PCR products of step (b) by size. The present invention also provides a method for multiplex diagnosis of CMV, LMoV, PlAMV and LSV.

상기 (a) 단계에서 RNA 추출은 당업계에서 통상적으로 사용되는 방법에 따라 수행될 수 있으며, 상업적으로 판매되는 RNA 추출용 키트를 이용하여 수행할 수 있다.The RNA extraction in the step (a) may be performed according to a method commonly used in the art, and may be carried out using a commercially available RNA extraction kit.

또한 상기 (b) 단계에서 RT-PCR에서 분리된 RNA를 주형으로 하고, 본 발명의 프라이머 쌍 중 역방향 프라이머를 프라이머로 하여, 역전사 효소를 이용한 역전사 반응을 통해 cDNA 가닥을 합성한 다음, PCR 반응 혼합액을 이용하여 수행할 수 있다. PCR 반응은 PCR 반응에 필요한 당업계에 공지된 여러 가지 성분을 포함하는 PCR 반응 혼합액을 이용하여 수행될 수 있다. 상기 PCR 반응 혼합액에는 역전사 반응에 의해 합성된 cDNA와 본 발명에서 제공되는 프라이머 쌍 이외에 적당량의 DNA 중합효소, dNTP, PCR 완충용액 및 물을 포함한다. 상기 PCR 완충용액은 Tris-HCl, MgCl2 , KCl 등을 포함할 수 있다. 이 때 MgCl2 농도는 증폭의 특이성과 수량에 크게 영향을 주며, 일반적으로 Mg2 +가 과량인 경우는 비특이적인 PCR 증폭산물이 증가하고, Mg2 +가 부족한 경우 PCR 산물의 산출율이 감소한다. 상기 PCR 완충용액에는 적당량의 트리톤 X-100(Triton X-100)이 추가로 포함될 수도 있다. 또한 PCR은 94-95℃에서 주형 DNA를 전변성시킨 후, 변성(denaturation); 결합(annealing); 및 증폭(extension)의 사이클을 거친 후, 최종적으로 72℃에서 연장(elongation)시키는 일반적인 PCR 반응 조건에서 수행될 수 있다. 상기에서 변성 및 증폭은 94-95℃ 및 72℃에서 각각 수행될 수 있으며, 결합시의 온도는 프라이머의 종류에 따라 달라질 수 있으나, 바람직하게는 50-57℃이며, 보다 바람직하게는 55℃이다. 각 단계의 시간과 싸이클 수는 당업계에 일반적으로 행해지는 조건에 따라 정해질 수 있다.In addition, cDNA strands were synthesized by reverse transcription using reverse transcriptase using the RNA isolated in RT-PCR as a template and the reverse primer of the primer pair of the present invention as a primer in the step (b) . ≪ / RTI > The PCR reaction may be performed using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. The PCR reaction mixture may contain a suitable amount of DNA polymerase, dNTP, PCR buffer solution and water in addition to the cDNA synthesized by the reverse transcription reaction and the primer pair provided in the present invention. The PCR buffer solution may include Tris-HCl, MgCl 2 , KCl, and the like. In this case, MgCl 2 concentration greatly affects the specificity and yield of amplification. In general, when Mg 2 + is excessive, nonspecific PCR amplification product is increased, and when Mg 2 + is insufficient, the yield of PCR product is decreased . The PCR buffer solution may further contain an appropriate amount of Triton X-100 (Triton X-100). Also, PCR was performed by denaturing the template DNA at 94-95 ° C, followed by denaturation; Annealing; Followed by a cycle of amplification and extension followed by final elongation at 72 ° C. Modification and amplification may be performed at 94-95 ° C and 72 ° C, respectively, and the temperature at the time of binding may vary depending on the type of the primer, but is preferably 50-57 ° C, more preferably 55 ° C . The time and number of cycles in each step can be determined according to the conditions commonly practiced in the art.

상기 (c) 단계에서는 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기별로 분리할 수 있다. 바람직하게는 아가로스 겔(agarose gel) 또는 폴리아크릴아미드 겔(polyacrylamide gel) 전기영동 또는 형광분석장치(ABI prism 3100 genetic analyzer-electropherogram)에 의해 확인할 수 있다. 이 때, 형광분석장치를 이용하기 위해서는 당업계에 공지된 형광 다이(dye)를 붙인 프라이머쌍을 이용하여 상기 (b)단계에서 PCR을 수행한다.In the step (c), the DNA of the PCR product can be isolated by size according to a method well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or an ABI prism 3100 genetic analyzer-electropherogram. In this case, in order to use the fluorescence analyzer, PCR is performed in step (b) using a pair of primers having a fluorescent dye well known in the art.

PCR 증폭 결과는 바람직하게는 아가로스 겔 전기영동에 의해 확인할 수 있다. 전기영동 후 에디듐 브로마이드(ethidium bromide) 염색으로 전기영동 결과를 분석할 수 있다. 일반적인 역전사 반응, PCR 수행 및 그 결과 분석 방법에 대해서는 당업계에 잘 알려져 있다.The PCR amplification result can preferably be confirmed by agarose gel electrophoresis. After electrophoresis, electrophoresis results can be analyzed by ethidium bromide staining. Methods for performing general reverse transcription, PCR and analysis of the results are well known in the art.

본 발명에 따른 나리 바이러스 진단용 프라이머 세트는 CMV, LMoV, PlAMV 및 LSV를 각각 진단할 수 있을 뿐만 아니라, 한번에 4종의 바이러스를 동시에 진단할 수 있다. The primer set for larynx virus diagnosis according to the present invention can diagnose CMV, LMoV, PlAMV and LSV as well as simultaneously diagnose four kinds of viruses at a time.

상기 프라이머 세트를 통하여 나리 바이러스 감염 여부를 조기에 진단할 수 있어 감염으로 인한 농가의 경제적 손실을 방지할 수 있다. Through the primer set, it is possible to diagnose early infection of Laryngeal virus, thereby preventing the economic loss of the farm due to the infection.

본 발명에 따른 프라이머 세트를 이용하여 정확하고 특이적으로 바이러스를 진단할 수 있다. The virus can be accurately and specifically diagnosed using the primer set according to the present invention.

또한 프라이머 간의 간섭현상이 적어 높은 민감도로 나리 바이러스 4종의 감염여부를 동시에 진단할 수 있다. In addition, since there is little interference between primers, four types of Lari virus can be diagnosed simultaneously with high sensitivity.

본 발명의 다중 진단방법을 통하여 바이러스 진단에 소요되는 비용과 시간을 줄일 수 있어 경제적이며, 나리 바이러스 무병주 생산 개발에 효과적으로 사용할 수 있다. The multi-diagnosis method of the present invention can reduce the cost and time required for the diagnosis of the virus, which is economical and can be effectively used for development of disease-free production of Larynx virus.

도 1은 나리 바이러스의 주요 병징을 보여주는 그림이다.
도 2는 CMV 진단용 프라이머 조합의 RT-PCR 검정 결과를 나타낸다.
도 3은 LMoV 진단용 프라이머 조합의 RT-PCR 검정 결과를 나타낸다.
도 4는 PlAMV 진단용 프라이머 조합의 RT-PCR 검정 결과를 나타낸다.
도 5는 LSV 진단용 프라이머 조합의 RT-PCR 검정 결과를 나타낸다.
도 6은 최종 선발된 프라이머 세트를 이용하여 나리 바이러스 Multiplex RT-PCR 전기영동 결과를 나타낸 사진이다.Figure 1 is a diagram showing the main symptoms of the naryaviruses.
Figure 2 shows the results of RT-PCR assays of the CMV diagnostic primer combination.
Figure 3 shows the results of RT-PCR assays of primer combinations for LMoV diagnosis.
Figure 4 shows the results of RT-PCR assays of primer combinations for PlAMV diagnosis.
Figure 5 shows the results of RT-PCR assays of primer combinations for LSV diagnosis.
FIG. 6 is a photograph showing the results of a Multivlex RT-PCR electrophoresis using a finally selected primer set.

이하, 본 발명의 이해를 돕기 위하여 실시예 등을 들어 상세하게 설명하기로 한다. 그러나, 본 발명에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며, 본 발명의 범위가 하기 실시예들에 한정되는 것으로 해석되어서는 안 된다. 본 발명의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

실시예 1. 나리 바이러스 검정 체계 확립을 위한 4종 바이러스 진단용 프라이머 선발 Example 1. Selection of 4 kinds of virus-detecting primers for establishment of the nary virus screening system

국내 나리에 발생하는 주요 바이러스인 CMV, LMoV, PlAMV 및 LSV의 진단용 프라이머는 기존에 NCBI에 등록된 염기서열을 참조하여 설계를 하였으며, 합성된 프라이머는 대상바이러스에 특이적으로 반응하는 프라이머 만을 선발하였다.The diagnostic primers for CMV, LMoV, PlAMV, and LSV, which are the major viruses occurring in domestic ruminants, were designed with reference to the nucleotide sequences registered in NCBI, and only the primers that specifically reacted with the target virus were selected .

하기 표 3 내지 표 10에 1차 선발된 CMV, LMoV, PlAMV 및 LSV 특이적 프라이머를 나타내었다. CMV, LMoV, PlAMV and LSV specific primers were selected first in Tables 3 to 10 below.

하기 샘플은 나리 잎을 이용하였다.
The following samples used lily leaves.

1) CMV 진단용 프라이머 선발 1) Selection of CMV diagnostic primer

CMV 진단용 프라이머는 RNA-dependent RNA polymerase (RdRp) 및 replicase 대상으로 크기가 528bp, 462bp, 628bp인 3쌍을 설계하여 (표 3), CMV 진단용 특이 프라이머로 선발하였다 (표 4).CMV diagnostic primers were selected as specific primers for CMV diagnosis (Table 3) by designing three pairs of size 528 bp, 462 bp and 628 bp for RNA-dependent RNA polymerase (RdRp) and replicase (Table 4).

CMV 진단용 프라이머 설계 CMV diagnostic primer design

Primer namePrimer name locuslocus sequence(5'→3')sequence (5 '- > 3') expected sizeexpected size CMV 1-2 uCMV 1-2 u 623-639623-639 CAAGCCCACTTTGCTAT  CAAGCCCACTTTGCTAT 528bp528bp CMV 1-2 dCMV 1-2 d 1303-12841303-1284 ATAACAATGGTAGATGATTT  ATAACAATGGTAGATGATTT CMV 1-5 uCMV 1-5 u 2647-26712647-2671 TTGTGCGTTTRATGGCTACGAAGGC  TTGTGCGTTTRATGGCTACGAAGGC 462bp462bp CMV 1-5 dCMV 1-5 d 3284-32593284-3259 CACGGACCGAAGTCCTTCCGAAGAAACACGGACCGAAGTCCTTCCGAAGAAA CMV 2-2 uCMV 2-2 u 680-701680-701 ACATGATCATGTACCAGTGCCC  ACATGATCATGTACCAGTGCCC 628bp628bp CMV 2-2 dCMV 2-2 d 1238-12161238-1216 ATGAARAARCTCTCAGCCACAGCATGAARAARCTCTCAGCCACAGC

CMV 진단용 프라이머 선발 결과 CMV diagnostic primer selection results

LaneLane SampleSample NoNo .. usedused primersprimers 1One 1One CMV 1-2 uCMV 1-2 u CMV 1-2 dCMV 1-2 d 22 22 33 33 44 44 55 55 77 1One CMV 1-5 uCMV 1-5 u CMV 1-5 dCMV 1-5 d 88 22 99 33 1010 44 1111 55 1212 1One CMV 2-2 uCMV 2-2 u CMV 2-2 dCMV 2-2 d 1313 22 1414 33 1515 44 1616 55

상기 표 3의 설계된 CMV 프라이머 세트 중에서 특이성이 높은 CMV 진단을 위한 프라이머 세트를 선발하였으며, PCR 결과를 도 2에 나타냈다.
A primer set for CMV diagnosis with high specificity was selected from among the set of CMV primers designed in Table 3, and PCR results are shown in FIG.

2) 2) LMoVLMoV 진단용  For diagnostic purposes 프라이머primer 선발  Selection

LMoV 진단용 프라이머는 Coat protein (CP) 지역을 대상으로 크기가 490bp인 1쌍을 설계하였다 (표 5). LMoV에 단독 감염된 시료를 대상으로 RT-PCR 검정 결과, LMoV 진단용 특이 프라이머로 선발하였다 (표 6).
The LMoV diagnostic primer designed a pair of size 490 bp for the Coat protein (CP) region (Table 5). As a result of RT-PCR, LMoV was selected as a specific primer for LMoV diagnosis (Table 6).

LMoV 진단용 프라이머 설계LMoV diagnostic primer design

PrimerPrimer namename locuslocus sequencesequence (5'→3')(5 '- > 3') expectedexpected sizeyou LMoV-KF1LMoV-KF1 8616-86388616-8638 GCAAATGAGACACTCAATRCTGG  GCAAATGAGACACTCAATRCTGG 490bp490 bp LMoV-KR1LMoV-KR1 9105-90889105-9088 ATTTGGCGCAGCGTCGGT  ATTTGGCGCAGCGTCGGT

LMoV 진단용 프라이머 선발 결과 Results of LMoV diagnostic primer selection

LaneLane samplesample NoNo .. usedused primersprimers 1One 1One LMoV-KF1LMoV-KF1 LMoV-KR1LMoV-KR1 22 22

상기 표 5의 설계된 LMoV 프라이머 세트 중에서 특이성이 높은 LMoV 진단을 위한 프라이머 세트를 선발하였으며, PCR 결과를 도 3에 나타냈다.
Among the designed LMoV primer sets shown in Table 5, primer sets for high specificity LMoV diagnosis were selected and PCR results are shown in FIG.

3) 3) PlAMVPlAMV 진단용  For diagnostic purposes 프라이머primer 선발 Selection

PlAMV 진단용 프라이머는 13K triple gene block protein 와 CP 지역을 대상으로 크기가 339bp인 1쌍을 설계하였다 (표 7). PlAMV에 단독 감염된 시료를 대상으로 RT-PCR 검정 결과, PlAMV 진단용 특이 프라이머로 선발하였다 (표 8).
PlAMV diagnostic primers were designed for a 13K triple gene block protein and a pair of size 339 bp in the CP region (Table 7). As a result of RT-PCR, PlAMV was selected as a specific primer for diagnosis of PlAMV (Table 8).

PlAMV 진단용 프라이머 설계 PlAMV diagnostic primer design

PrimerPrimer namename locuslocus sequencesequence (5'→3')(5 '- > 3') expectedexpected sizeyou PlAMV Li 2FPlAMV Li 2F 5372-53915372-5391 AACTCTCCACCATGGCACT  AACTCTCCACCATGGCACT 339bp339 bp PlAMV Li 2RPlAMV Li 2R 5710-57295710-5729 AGAGTCTTGCGTTCCAGATG  AGAGTCTTGCGTTCCAGATG

PlAMV 진단용 프라이머 선발 결과 PlAMV diagnostic primer selection results

LaneLane samplesample NoNo .. usedused primersprimers 1One 1One PlAMV Li 2FPlAMV Li 2F PlAMV Li 2RPlAMV Li 2R 22 22

상기 표 5의 설계된 PlAMV 프라이머 세트 중에서 특이성이 높은 PlAMV 진단을 위한 프라이머 세트를 선발하였으며, PCR 결과를 도 4에 나타냈다.
Among the designed PlAMV primer sets shown in Table 5, a primer set for high-specific PlAMV diagnosis was selected, and PCR results are shown in FIG.

4) 4) LSVLSV 진단용  For diagnostic purposes 프라이머primer 선발 Selection

LSV 진단용 프라이머는 CP 지역을 대상으로 크기가 209~276bp인 4쌍을 설계하였다 (표 9). LSV이 복합 감염된 시료 대상으로 RT-PCR 검정 결과, 4쌍 모두 LSV 진단용 특이 프라이머로 선발하였다 (표 10).
LSV diagnostic primers were designed for four pairs of 209 to 276 bp in size in the CP region (Table 9). As a result of RT-PCR, LSV-positive specimens were selected as LSV-specific primers (Table 10).

LSV 진단용 프라이머 설계 LSV diagnostic primer design

PrimerPrimer namename locuslocus sequencesequence (5'→3')(5 '- > 3') expectedexpected sizeyou LSV-KF1LSV-KF1 7179-71967179-7196 GAGACCCCTGCACGTGGCGAGACCCCTGCACGTGGC 209bp209 bp LSV-KR1LSV-KR1 7387-73697387-7369 TTCCTTCGCATGGCACTCGTTCCTTCGCATGGCACTCG LSV-KF2LSV-KF2 7707-77287707-7728 GTGTGGAACAGCATGCTTGTGCGTGTGGAACAGCATGCTTGTGC 276bp276 bp LSV-KR3LSV-KR3 7983-79627983-7962 CGATTTCAGCTCCTTGTACCCCCGATTTCAGCTCCTTGTACCCC LSV-K4FLSV-K4F 7144-71657144-7165 AATCAAGACCAGCWCARGAATCAATCAAGACCAGCWCARGAATC 221bp221bp LSV-K4RLSV-K4R 7364-73477364-7347 TTCCAGYGAGGGCCTCCCTTCCAGYGAGGGCCTCCC LSV-K5FLSV-K5F 7479-75017479-7501 ATGGCYAAGATWGCGTCWGACATATGGCYAAGATWGCGTCWGACAT 218bp218 bp LSV-K5RLSV-K5R 7696-76777696-7677 TAGAGCCGGCAGACTTTCCGTAGAGCCGGCAGACTTTCCG

LSV 진단용 프라이머 선발 결과LSV diagnostic primer selection results

LaneLane samplesample NoNo .. usedused primersprimers 1One 1One LSV-KF1LSV-KF1 LSV-KR1LSV-KR1 22 LSV-KF2LSV-KF2 LSV-KR3LSV-KR3 33 LSV-K4FLSV-K4F LSV-K4RLSV-K4R 44 LSV-K5FLSV-K5F LSV-K5RLSV-K5R

상기 표 5의 설계된 PlAMV 프라이머 세트 중에서 특이성이 높은 PlAMV 진단을 위한 프라이머 세트를 선발하였으며, PCR 결과를 도 5에 나타냈다.
A primer set for PlAMV diagnosis with high specificity was selected from among the designed PlAMV primer sets shown in Table 5, and PCR results are shown in FIG.

실시예Example 2. 나리 바이러스 4종 동시 진단을 위한  2. For the simultaneous diagnosis of four species of Lari virus 프라이머primer 선정 selection

상기 1차로 선발된 4종 프라이머 테스트를 바탕으로 최종 프라이머 조합을 선발하여 표 11에 나타냈다..Based on the four primary primer tests selected above, the final primer combinations were selected and shown in Table 11.

3종 다중 진단을 위한 후보 프라이머 세트Candidate primer set for three kinds of multiple diagnosis

VirusVirus Primer namePrimer name Seq.No.Seq.No. sequence(5'→3')sequence (5 '- > 3') locuslocus expected sizeexpected size Conc.Conc. CMVCMV CMV 1-5 uCMV 1-5 u 1One CTTGTGCGTTTRATGGCTACGAAGGCCTTGTGCGTTTRATGGCTACGAAGGC 2646-32832646-3283 638bp638bp 32pmol32 pmol CMV 1-5 dCMV 1-5 d 22 CACGGACCGAAGTCCTTCCGAAGAAACACGGACCGAAGTCCTTCCGAAGAAA 3284-32593284-3259 LMoVLMoV LMoV-KF1LMoV-KF1 33 GCAAATGAGACACTCAATRCTGGGCAAATGAGACACTCAATRCTGG 8616-86388616-8638 490bp490 bp 32pmol32 pmol LMoV-KR1LMoV-KR1 44 ATTTGGCGCAGCGTCGGTATTTGGCGCAGCGTCGGT 9105-90889105-9088 PlAMVPlAMV PlAMV Li 2FPlAMV Li 2F 55 AACTCTCCACCATGGCACTAACTCTCCACCATGGCACT 5372-53915372-5391 339bp339 bp 48pmol48 pmol PlAMV Li 2RPlAMV Li 2R 66 AGAGTCTTGCGTTCCAGATGAGAGTCTTGCGTTCCAGATG 5710-57295710-5729 LSVLSV LSV-K5FLSV-K5F 77 ATGGCYAAGATWGCGTCWGACATATGGCYAAGATWGCGTCWGACAT 7479-75017479-7501 218bp218 bp 32pmol32 pmol LSV-K5RLSV-K5R 88 TAGAGCCGGCAGACTTTCCGTAGAGCCGGCAGACTTTCCG 7696-76777696-7677

CMV, LMoV, PlAMV 및 LSV 동시 진단에 가장 적합한 프라이머 세트의 조합으로 상기 서열번호 1 내지 8로 이루어진 프라이머 세트를 선정하였다. 1 to 8 were selected as a combination of primer sets most suitable for simultaneous diagnosis of CMV, LMoV, PlAMV and LSV.

상기 조합의 프라이머 세트를 이용하여 RT-PCR 을 실시한 결과, 상기 프라이머 세트는 프라이머 간에 간섭작용이 적어 다중 진단에 적합하였으며, 바이러스에 대한 민감도가 우수할 뿐만 아니라 특이적으로 바이러스를 검출할 수 있음을 확인하였다. As a result of performing the RT-PCR using the primer set of the above combination, the primer set was suitable for multiple diagnosis due to low interference between primers, and was excellent in sensitivity to viruses as well as capable of specifically detecting viruses Respectively.

하기 표 12는 다중 진단용 프라이머를 이용한 증폭산물의 염기서열 분석 결과를 나타내었다.Table 12 below shows the results of base sequence analysis of amplification products using multiple diagnostic primers.

다중 진단용 프라이머를 이용한 증폭산물의 염기서열 분석 결과Sequence analysis of amplification products using multiple diagnostic primers

대상
바이러스object
virus 프라이머primer 산물크기Product size 염기서열(5'→3')The base sequence (5 '- > 3') 비교대상/상동성Comparable / homologous CMVCMV CMV 1-5u
/CMV 1-5d
CMV 1-5u
/ CMV 1-5d
638bp
638bp
GGCTACGAAGGCCCTTCCGAAAGGAACTCATTCGAAATACACTAAATGGGTTTCTCAATCTAAAGTGAAGAGATCTGTCACATCTCGTTCTATTGCTAGTGTGACACTGGTTGACCTAGATTCCTCCAGGTTTTACATCACGATGACTCAAGCTGATAAGGCTTCACTGATTTCAAGGGCGAAAGAGATGAACTTACCAAAGACTTTCTGGAATGAAAGAATTAAAACCGTGCATGAATCTCAAGGCATTTCTGAAGATCATGTTACCTTGGTAAGATTGAAGAGCACAAAGTGTGACCTGTTTAAACAGTTTTCTTATTGTCTTGTTGCCTTGACTAGACACAAGGTCACTTTCCGCTACGAGTATTGTGGTATATTGAACGGCGATTTGATCGCCGAATGTATTGCTCGTGCTTAGCGGTTTCCCTCCTTCGGGCGGGATCTGGGTTGGCGGTAGTCCATAAACCGTCTGAGGTCACTAAACGTTAACGGTTTCGTTTACGGTGAACGGGTTGTCCATCCAGCTTACGGCTAAAATGGTCAGTCGTGGAGAAATCCACGCCAGTAGACTTACAAGTCTCTGAGGCACCTTTGAAACCATCTCCTAGGTTTCTTCGGAAGGGCTACGAAGGCCCTTCCGAAAGGAACTCATTCGAAATACACTAAATGGGTTTCTCAATCTAAAGTGAAGAGATCTGTCACATCTCGTTCTATTGCTAGTGTGACACTGGTTGACCTAGATTCCTCCAGGTTTTACATCACGATGACTCAAGCTGATAAGGCTTCACTGATTTCAAGGGCGAAAGAGATGAACTTACCAAAGACTTTCTGGAATGAAAGAATTAAAACCGTGCATGAATCTCAAGGCATTTCTGAAGATCATGTTACCTTGGTAAGATTGAAGAGCACAAAGTGTGACCTGTTTAAACAGTTTTCTTATTGTCTTGTTGCCTTGACTAGACACAAGGTCACTTTCCGCTACGAGTATTGTGGTATATTGAACGGCGATTTGATCGCCGAATGTATTGCTCGTGCTTAGCGGTTTCCCTCCTTCGGGCGGGATCTGGGTTGGCGGTAGTCCATAAACCGTCTGAGGTCACTAAACGTTAACGGTTTCGTTTACGGTGAACGGGTTGTCCATCCAGCTTACGGCTAAAATGGTCAGTCGTGGAGAAATCCACGCCAGTAGACTTACAAGTCTCTGAGGCACCTTTGAAACCATCTCCTAGGTTTCTTCGGAAG JN180309/96%JN180309 / 96% LMoVLMoV LMoV-KF1
/LMoV-KR1
LMoV-KF1
/ LMoV-KR1
490bp
490 bp
TCAATGCTGGAGCTTCCAGTTCCACACAAGCGAGCCGATCGACTCGACCTGAGGCTGCAATTGATGTGGCACCGCAACAGAGTTCTGAGGCTAGAGTGCGTGATCGTGATGTTGATGCCGGCACCGTGGGAACATACCAAATCCCACGACTGAAGGCACTAGCAACAAAGATCAACGTACCCAAGGTCAAGGGGCGAATGATAGTGAACACTGGGCACCTTGTGAATTACAACCCAGACCAAACAGATATTTCAAATACAAGGTCAACCCAGAAGCAGTTTGAGGCTTGGTACAACGCAGTGAAAGACGAGTATGGTCTCAACGACGAGAGTATGGCTCTCGCAATGAATGGTCTGATGGTTTGGTGCATAGAGAATGGCACCTCACCAAATGTAAATGGCGTGTGGCTCATGATGGACGGAGATCAGCAAGTTGAATTTCCTTTACGTCCTATACTTGAACACGCAAAACCGACGTCAATGCTGGAGCTTCCAGTTCCACACAAGCGAGCCGATCGACTCGACCTGAGGCTGCAATTGATGTGGCACCGCAACAGAGTTCTGAGGCTAGAGTGCGTGATCGTGATGTTGATGCCGGCACCGTGGGAACATACCAAATCCCACGACTGAAGGCACTAGCAACAAAGATCAACGTACCCAAGGTCAAGGGGCGAATGATAGTGAACACTGGGCACCTTGTGAATTACAACCCAGACCAAACAGATATTTCAAATACAAGGTCAACCCAGAAGCAGTTTGAGGCTTGGTACAACGCAGTGAAAGACGAGTATGGTCTCAACGACGAGAGTATGGCTCTCGCAATGAATGGTCTGATGGTTTGGTGCATAGAGAATGGCACCTCACCAAATGTAAATGGCGTGTGGCTCATGATGGACGGAGATCAGCAAGTTGAATTTCCTTTACGTCCTATACTTGAACACGCAAAACCGACG JX908883/99%JX908883 / 99% PlAMVPlAMV PlAMV Li 2F
/PlAMV Li 2R
PlAMV Li 2F
/ PlAMV Li 2R
339bp
339 bp
CCACCATGGCACTCAACCAAGCCCCCTCTCCTGACGCGCTCGACGCGATGACTTTTGCCGTCTCATCCCCGTCCGTGCCCACCGCCGCGGAGCTGGACACGATCACACGAGGCTTAACAACCCTCGGCGTCCCAGCAGAAGCTCTGCTCAGCCACGCCCTCTCGGTCGTCAACGCGTGCTTCGACGCTGGCTCTTCCGCCTTCGTCACCCTCAGCGGCCCCAGCCCCACAGCCACCATCTCTCTGGCCCAAATCGCCGGGGTTGTGAAAGTCACCACCACCCTGCGGAAGTTCTGCCGCTTCTACGCCAAAATCATCTGGAACGCCCACCATGGCACTCAACCAAGCCCCCTCTCCTGACGCGCTCGACGCGATGACTTTTGCCGTCTCATCCCCGTCCGTGCCCACCGCCGCGGAGCTGGACACGATCACACGAGGCTTAACAACCCTCGGCGTCCCAGCAGAAGCTCTGCTCAGCCACGCCCTCTCGGTCGTCAACGCGTGCTTCGACGCTGGCTCTTCCGCCTTCGTCACCCTCAGCGGCCCCAGCCCCACAGCCACCATCTCTCTGGCCCAAATCGCCGGGGTTGTGAAAGTCACCACCACCCTGCGGAAGTTCTGCCGCTTCTACGCCAAAATCATCTGGAACGC KF471012/99%KF471012 / 99% LSVLSV LSV-K5F
/ LSV-K5R
LSV-K5F
/ LSV-K5R
218bp
218 bp
TGGCTAAGANTGCGTCTGACATTGCAGGGCTTGGGGTACCAACGGAGCACGTCGCATCAGTAATATTGCAAATGGTCATCATGTGTGCTTGCGTGAGCAGTTCGGCGTTCCTTGACCCTGAGGGCAGCATTGAGTTTGAGAATGGAGCGGTGCCCGTCGACTCCATCGCTGCGATCATGAAGAAGCACGCTGGACTGCGGAAAGTCTGCCGGCTCTATGGCTAAGANTGCGTCTGACATTGCAGGGCTTGGGGTACCAACGGAGCACGTCGCATCAGTAATATTGCAAATGGTCATCATGTGTGCTTGCGTGAGCAGTTCGGCGTTCCTTGACCCTGAGGGCAGCATTGAGTTTGAGAATGGAGCGGTGCCCGTCGACTCCATCGCTGCGATCATGAAGAAGCACGCTGGACTGCGGAAAGTCTGCCGGCTCTA JX962776/98%JX962776 / 98%

실시예Example 3. 나리 발생 4종 바이러스에 대한 다중 진단법 개발 3. Development of Multiple Diagnosis Method for Four Laryngeal Viruses

본 발명의 나리 바이러스 다중 바이러스 진단을 위한 RT-PCR 과정은 하기와 같다. The RT-PCR procedure for the diagnosis of Larynx virus multiplex virus of the present invention is as follows.

국내에 분포된 나리 바이러스 CMV, LMoV, PlAMV, 및 LSV에 대해 디자인된 특이 진단용 프라이머들 중 선발하여 한번의 RT-PCR로 4종의 바이러스를 동시에 진단할 수 있는 multiplex RT-PCR 방법을 개발하였다A multiplex RT-PCR method was developed to select four specific diagnostic primers designed for domestic viruses CMV, LMoV, PlAMV, and LSV, and simultaneously diagnose four viruses by one RT-PCR

CMV, LMoV, PlAMV 및 LSV는 표 11의 프라이머 조합을 이용하였다. CMV, LMoV, PlAMV and LSV used the primer combinations in Table 11.

나리 시료는 병징이 있는 잎 또는 구근을 액체질소로 마쇄한 뒤, 바이러스 게놈 추출 키트 (Total RNA extraction kit, Intron Co.)를 이용하여 전체 게놈을 추출하였다. 추출된 게놈을 주형으로 다음과 같은 방법으로 One-step RT-PCR 하였다Laryngeal samples were obtained by crushing diseased leaves or bulbs with liquid nitrogen and then extracting whole genomes using a total RNA extraction kit (Intron Co.). The extracted genome was subjected to one-step RT-PCR as a template in the following manner

역전사(RT)과정으로, 게놈 주형 1 ul, 3'-프라이머 각각 32 pmol 혼합물 0.5 ul, 2.5mM dNTPs 0.5 ul, 10mg/ml BSA 0.1 ul, 40U/ul RNase inhibitor 0.2 ul, 5x RT buffer, AMV 역전사 효소를 넣어 최종 5 ul 반응액으로 42 ℃에서 30분 반응한다. 이 과정에서 만들어진 cDNA를 이용하여, 5'-프라이머 각각 32 pmol 혼합액 0.5 ul, 10mg/ml BSA 0.1 ul, 2.5 mM dNTPs 1.5 ul, 25mM MgCl2 2.5ul, 5X PCR buffer, Taq polymerase를 넣어 최종 20 ul 반응액을 만들어 PCR를 수행하였다. (RT), 0.5 μl of a 32 pmol mixture of each of the 3'-primers, 0.5 μl of 2.5 mM dNTPs, 0.1 μl of 10 mg / ml BSA, 0.2 μl of 40 U / μl RNase inhibitor, 5 × RT buffer, AMV reverse transcriptase The enzyme is added and reacted with the final 5 μl reaction solution at 42 ° C for 30 minutes. Using the cDNA prepared in this procedure, 0.5 μl of 32 pmol each of 5'-primer, 0.1 μl of 10 mg / ml BSA, 1.5 μl of 2.5 mM dNTPs, 2.5 μl of 25 mM MgCl 2 , 5 × PCR buffer and Taq polymerase were added to the final 20 μl PCR was carried out by making a reaction solution.

DNA 초기 변성 과정으로 94 ℃ 3분, [DNA 변성을 위해 94 ℃ 20초, 프라이머 바인딩(annealing)을 위해 55 ℃ 30초, DNA 사슬 신장을 위해 72 ℃ 1분]을 35회 반복한 후, 최종적으로 DNA 사슬 신장을 위해 72 ℃ 10분의 PCR 반응 조건으로 하여 CMV, LMoV, PlAMV 및 LSV 서열을 증폭한 산물을 1.2% 아가로스겔, 100mV, 1시간 30분 전기영동하여 확인하였다.DNA was subjected to initial denaturation at 94 ° C for 3 min, followed by 35 cycles of 94 ° C for 20 sec for denaturation of DNA, 30 sec for 55 ° C for primer annealing and 1 min at 72 ° C for DNA chain extension, The PCR products were amplified with CMV, LMoV, PlAMV and LSV sequences at 72 ° C for 10 min for DNA chain extension. The product was confirmed by electrophoresis on 1.2% agarose gel, 100mV for 1 hour 30 minutes.

그 결과는 도 6에 나타냈다. 단독감염 및 복합 감염 모두에서 정확한 반응을 나타냈다. 따라서, 본 발명의 프라이머 세트를 이용하여 나리에 발생하는 바이러스 4종을 동시에 정확히 진단할 수 있음을 알게되었다. The results are shown in Fig. Both single infection and complex infection showed the correct response. Therefore, it has been found that four kinds of viruses occurring in the larynx can be accurately diagnosed simultaneously using the primer set of the present invention.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for multiple detection lily viruses and method for detecting said viruses using the same <130> P14-050 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CMV 1-5 u <400> 1 cttgtgcgtt tratggctac gaaggc 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CMV 1-5 d <400> 2 cacggaccga agtccttccg aagaaa 26 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LMoV-KF1 <400> 3 gcaaatgaga cactcaatrc tgg 23 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LMoV-KR1 <400> 4 atttggcgca gcgtcggt 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PlAMV Li 2F <400> 5 aactctccac catggcact 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlAMV Li 2R <400> 6 agagtcttgc gttccagatg 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LSV-K5F <400> 7 atggcyaaga twgcgtcwga cat 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LSV-K5R <400> 8 tagagccggc agactttccg 20 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for multiple detection lily viruses and method for          detecting the viruses using the same <130> P14-050 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CMV 1-5 u <400> 1 cttgtgcgtt tratggctac gaaggc 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CMV 1-5 d <400> 2 cacggaccga agtccttccg aagaaa 26 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LMoV-KF1 <400> 3 gcaaatgaga cactcaatrc tgg 23 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LMoV-KR1 <400> 4 atttggcgca gcgtcggt 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PlAMV Li 2F <400> 5 aactctccac catggcact 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PlAMV Li 2R <400> 6 agagtcttgc gttccagatg 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LSV-K5F <400> 7 atggcyaaga twgcgtcwga cat 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LSV-K5R <400> 8 tagagccggc agactttccg 20

Claims (6)

서열번호 1 및 서열번호 2로 표시되는 프라이머 쌍, 서열번호 3 및 서열번호 4로 표시되는 프라이머 쌍, 서열번호 5 및 서열번호 6으로 표시되는 프라이머 쌍 및 서열번호 7 및 서열번호 8로 표시되는 프라이머 쌍을 포함하는
오이 모자이크 바이러스 (Cucumber mosaic virus, CMV), 나리 얼룩무늬 바이러스 (Lily mottle virus, LMoV), 질경이 모자이크 포텍스바이러스 (Plantago asiatica mosaic virus, PlAMV), 및 나리 무병징 바이러스 (Lily symptomless virus, LSV) 의 나리 바이러스 다중 진단용 프라이머 세트.A primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, and a primer pair represented by SEQ ID NO: Containing a pair
Of cucumber mosaic virus (Cucumber mosaic virus, CMV), canary speckles virus (Lily mottle virus, LMoV), plantain mosaic Four text virus (Plantago asiatica mosaic virus, PlAMV) , and canary disease free ranging virus (Lily symptomless virus, LSV) A set of primers for multiple diagnosis of laryngeal viruses. 제1항에 있어서, 상기 서열번호 1은 상기 오이 모자이크 바이러스의 염기서열 3284~3259에 상보적인 전방향 프라이머이고, 상기 서열번호 2는 오이모자이크 바이러스의 염기서열 2647~2671에 상보적인 역방향 프라이머인 것을 특징하며,
상기 서열번호 3은 상기 나리 얼룩무늬 바이러스의 염기서열 8616~8638에 상보적인 전방향 프라이머이고, 상기 서열번호 4는 나리 얼룩무늬 바이러스의 염기서열 9105~9088에 상보적인 역방향 프라이머인 것을 특징으로 하며,
상기 서열번호 5는 상기 질경이 모자이크 포텍스바이러스의 염기서열 5372~5391에 상보적인 전방향 프라이머이고, 상기 서열번호 6은 질경이 모자이크 포텍스바이러스의 염기서열 5710~5729에 상보적인 역방향 프라이머인 것을 특징으로 하며,
상기 서열번호 7은 상기 나리 무병징 바이러스의 염기서열 7479~7501에 상보적인 전방향 프라이머이고, 상기 서열번호 8은 상기 나리 무병징 바이러스의 염기서열 7696~7677에 상보적인 역방향 프라이머인 것을 특징으로 하는 나리 바이러스 다중 진단용 프라이머 세트.2. The cucumber mosaic virus according to claim 1, wherein the sequence number 1 is an omni-directional primer complementary to the nucleotide sequence 3284 to 3259 of the cucumber mosaic virus, and the SEQ ID NO: 2 is a reverse primer complementary to the nucleotide sequence 2647 to 2671 Features:
Wherein SEQ ID NO: 3 is an omnidirectional primer complementary to nucleotide sequences 8616 to 8638 of the Larix spark virus and SEQ ID NO: 4 is a reverse primer complementary to nucleotide sequences 9105 to 9088 of Larix spp.
5 is a forward primer complementary to base sequences 5372 to 5391 of the plantain mosaic phytate virus and SEQ ID NO: 6 is a reverse primer complementary to base sequences 5710 to 5729 of plantain mosaic virus In addition,
SEQ ID NO: 7 is an omnidirectional primer complementary to the nucleotide sequence 7479 to 7501 of the nili-diseased virus and SEQ ID NO: 8 is a reverse primer complementary to the nucleotide sequence 7696 to 7677 of the nili- A set of primers for multiple diagnosis of laryngeal viruses. 제1항의 프라이머 쌍을 포함하는 CMV, LMoV, PlAMV 및 LSV의 다중 진단을 위한 나리 바이러스 다중 진단용 키트.A kit for multiple diagnosis of Larynx virus for multiplex diagnosis of CMV, LMoV, PlAMV and LSV comprising the primer pair of claim 1. 서열번호 1 내지 8의 염기서열로 표시되는 프라이머를 포함하는 오이 모자이크 바이러스 (Cucumber mosaic virus , CMV), 나리 얼룩무늬 바이러스 (Lily mottle virus , LMoV), 질경이 모자이크 포텍스바이러스 (Plantago asiatica mosaic virus , PlAMV), 및 나리 무병징 바이러스 (Lily symptomless virus , LSV)의 다중 진단용 조성물.A cucumber mosaic virus containing a primer represented by the nucleotide sequence of SEQ ID NOS: 1 to 8 ( Cucumber mosaic virus , CMV), Lily mottle virus , LMoV), plantain mosaic formate virus ( Plantago asiatica mosaic virus , PlAMV), and Lily disease virus ( Lily symptomless virus , LSV). 제4항의 조성물을 포함하는 키트. A kit comprising the composition of claim 4. (a) 시료로부터 바이러스 RNA를 분리하는 단계;
(b) 상기 (a) 단계의 RNA를 주형으로,
서열번호 1의 및 서열번호 2로 표시되는 프라이머 쌍, 서열번호 3 및 서열번호 4로 표시되는 프라이머 쌍, 서열번호 5 및 서열번호 6 및 서열번호 7 및 서열번호 8로 표시되는 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및
(c) 상기 (b) 단계의 RT-PCR 산물을 크기별로 분리하는 단계를 포함하는 TYLCV, ToCV, 및 TLCV을 다중 진단하는 진단 방법.(a) separating the viral RNA from the sample;
(b) using the RNA of step (a) as a template,
A primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: Performing RT-PCR; And
(c) isolating the RT-PCR products of step (b) by size.
KR1020140074861A 2014-06-19 2014-06-19 Primer set for multiple detection lily viruses and method for detecting said viruses using the same KR101642771B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140074861A KR101642771B1 (en) 2014-06-19 2014-06-19 Primer set for multiple detection lily viruses and method for detecting said viruses using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140074861A KR101642771B1 (en) 2014-06-19 2014-06-19 Primer set for multiple detection lily viruses and method for detecting said viruses using the same

Publications (2)

Publication Number Publication Date
KR20150145771A true KR20150145771A (en) 2015-12-31
KR101642771B1 KR101642771B1 (en) 2016-08-10

Family

ID=55128563

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140074861A KR101642771B1 (en) 2014-06-19 2014-06-19 Primer set for multiple detection lily viruses and method for detecting said viruses using the same

Country Status (1)

Country Link
KR (1) KR101642771B1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105713994A (en) * 2016-04-07 2016-06-29 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting LSV (lily symptomless viruse) and LMoV (lily mottle viruse) with immuno-capture double RT-PCR (reverse transcription-polymerase chain reaction) techniques
CN105803113A (en) * 2016-04-07 2016-07-27 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting LSV (lily symptomless virus) and LMoV (lilymottle virus)
CN107164560A (en) * 2017-06-06 2017-09-15 青岛农业大学 The special primer and method of tomato chlorisis virus in one-step method real-time fluorescent RT PCR detection single head Bemisia tabaci bodies
CN109913588A (en) * 2019-04-03 2019-06-21 淮安市洪泽区农业干部学校 Kit that is a kind of while detecting plantago mosaic virus and Lily virus X
CN112458214A (en) * 2020-12-28 2021-03-09 甘肃省农业科学院生物技术研究所 Multiplex PCR (polymerase chain reaction) primer for detecting lily virus and application of multiplex PCR primer in RNA (ribonucleic acid) -extraction-free quick detection method of lily virus
CN113667776A (en) * 2021-09-16 2021-11-19 中国农业科学院蔬菜花卉研究所 Real-time fluorescent quantitative PCR (polymerase chain reaction) method for detecting plantain mosaic virus in lily
CN116479185A (en) * 2023-05-16 2023-07-25 南昌师范学院 Method for detecting lily asymptomatic virus by RT-qPCR

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101985654B1 (en) * 2016-11-15 2019-06-04 대한민국 Primer set for multiple detection 4 kinds of virus infecting Passiflora edulis and method for detecting said viruses using the same
KR102054126B1 (en) * 2017-11-10 2019-12-10 대한민국 Primers for multiple detection of the virus in Rehmannia glutinosa and detection method by using the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130054495A (en) * 2011-11-11 2013-05-27 한국생명공학연구원 Probe set for diagnosing or detecting cowpea chlorotic mottle virus and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130054495A (en) * 2011-11-11 2013-05-27 한국생명공학연구원 Probe set for diagnosing or detecting cowpea chlorotic mottle virus and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF VIROLOGICAL METHODS. 2008, Vol.153, pp. 241-244. *
KOREAN JOURNAL OF MICROBIOLOGY. 2009, Vol. 45, No. 3, pp. 251-256. *
Scientia Horticulturae. 2003, Vol. 97, pp. 57-63. *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105713994A (en) * 2016-04-07 2016-06-29 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting LSV (lily symptomless viruse) and LMoV (lily mottle viruse) with immuno-capture double RT-PCR (reverse transcription-polymerase chain reaction) techniques
CN105803113A (en) * 2016-04-07 2016-07-27 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting LSV (lily symptomless virus) and LMoV (lilymottle virus)
CN105803113B (en) * 2016-04-07 2020-02-18 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting lily latent virus and lily mottle virus by double composite immunocapture RT-PCR reaction
CN105713994B (en) * 2016-04-07 2020-02-18 中国科学院寒区旱区环境与工程研究所 Method for synchronously detecting lily latent virus and lily mottle virus by using double composite immunocapture RT-PCR (reverse transcription-polymerase chain reaction)
CN107164560A (en) * 2017-06-06 2017-09-15 青岛农业大学 The special primer and method of tomato chlorisis virus in one-step method real-time fluorescent RT PCR detection single head Bemisia tabaci bodies
CN109913588A (en) * 2019-04-03 2019-06-21 淮安市洪泽区农业干部学校 Kit that is a kind of while detecting plantago mosaic virus and Lily virus X
CN112458214A (en) * 2020-12-28 2021-03-09 甘肃省农业科学院生物技术研究所 Multiplex PCR (polymerase chain reaction) primer for detecting lily virus and application of multiplex PCR primer in RNA (ribonucleic acid) -extraction-free quick detection method of lily virus
CN112458214B (en) * 2020-12-28 2024-04-12 甘肃省农业科学院生物技术研究所 Multiplex PCR primer for detecting lily virus and application of multiplex PCR primer in RNA extraction-free lily virus rapid detection method
CN113667776A (en) * 2021-09-16 2021-11-19 中国农业科学院蔬菜花卉研究所 Real-time fluorescent quantitative PCR (polymerase chain reaction) method for detecting plantain mosaic virus in lily
CN116479185A (en) * 2023-05-16 2023-07-25 南昌师范学院 Method for detecting lily asymptomatic virus by RT-qPCR

Also Published As

Publication number Publication date
KR101642771B1 (en) 2016-08-10

Similar Documents

Publication Publication Date Title
KR101642771B1 (en) Primer set for multiple detection lily viruses and method for detecting said viruses using the same
KR101985654B1 (en) Primer set for multiple detection 4 kinds of virus infecting Passiflora edulis and method for detecting said viruses using the same
JP2008136389A (en) Method for detecting apple mosaic virus, primer set for detection and kit for detection thereof
Kwon et al. Reverse transcription polymerase chain reaction-based system for simultaneous detection of multiple lily-infecting viruses
KR101546758B1 (en) Primer set for multiple detection tomato viruses that transmitted by whiteflies, and method for detecting said viruses using the same
KR101459616B1 (en) Primer set for detecting viruses in sweet potato and method for detecting simultaneously said viruses using the same
JP6895168B2 (en) Virus diagnostic method
KR101928445B1 (en) PCR Primers For Detecting Viruses Occurring on Solanaceae and Method for Detceting Solanaceae Viruses
KR101314168B1 (en) Method for developing gene specific molecular markers for discriminatinig soybean cultivars
JP5315519B2 (en) Koi herpesvirus (KHV) detection method
Ma et al. Detection of three pear viruses by multiplex RT-PCR assays with co-amplification of an internal control
KR20080013414A (en) Specific primers for detection of tomato black ring virus
KR101750837B1 (en) Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same
KR102226176B1 (en) Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same
KR102157815B1 (en) Gene of a novel virus derived from lily
KR101557045B1 (en) Primer set for multiple detection SPV2, SPVC, SPSMV-1, and SPCFV and method for detecting said viruses using the same
KR101928444B1 (en) PCR primers for detecting viruses occurring on cucurbitaceae and method for detceting cucurbitaceae viruses
KR102054126B1 (en) Primers for multiple detection of the virus in Rehmannia glutinosa and detection method by using the same
KR101174815B1 (en) Primer combination for diagnosing Tobacco rattle virus and uses thereof
KR20130032922A (en) Genetic markers for detecting quarantine plant viruses and methods for detecting by using thereof
KR102516117B1 (en) Specific primer set for multiple detection of 4 types of cactus infectious virus and detection method using the same
KR100840736B1 (en) Specific primers for detection of potato spindle turber viroil
KR101018631B1 (en) PCR detection system for Potato spindle tuber viroid
KR20160126116A (en) DETECTING METHOD of POTATO VIRUS Y FROM AN APHID BY USING PCR
JP2021094016A (en) Primer set for detection of sweet potato pathogen virus and method for detection of sweet potato pathogen virus

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant