KR102226176B1 - Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same - Google Patents
Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same Download PDFInfo
- Publication number
- KR102226176B1 KR102226176B1 KR1020190073135A KR20190073135A KR102226176B1 KR 102226176 B1 KR102226176 B1 KR 102226176B1 KR 1020190073135 A KR1020190073135 A KR 1020190073135A KR 20190073135 A KR20190073135 A KR 20190073135A KR 102226176 B1 KR102226176 B1 KR 102226176B1
- Authority
- KR
- South Korea
- Prior art keywords
- virus
- cynmv
- bbwv2
- jymv
- hemp
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus) 3종의 마(Diascorea spp.) 바이러스를 동시에 검출하기 위한 프라이머 세트가 개시된다. A primer set for simultaneous detection of three Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus) is disclosed.
Description
본 발명은 3종의 마 바이러스 동시검출용 프라이머 세트 및 이를 이용한 검출 방법에 관한 것으로, 구체적으로 국내 마에서 발생한 3가지 바이러스인 잠두위조바이러스2(Broad bean wilt virus 2, BBWV2), 마괴저모자이크바이러스(Chinese yam necrotic mosaic virus, CYNMV), 마모자이크바이러스(Japanese yam mosaic virus, JYMV)를 각각 또는 동시에 검출할 수 있는 프라이머 세트 및 이를 이용한 검출 방법에 관한 것이다.The present invention relates to a primer set for simultaneous detection of three types of hemp viruses and a detection method using the same, and specifically, broad bean wilt virus 2 (BBWV2), three viruses generated in domestic hemp, and hemp mosaic virus A primer set capable of detecting (Chinese yam necrotic mosaic virus, CYNMV), or Japanese yam mosaic virus (JYMV) respectively or simultaneously, and a detection method using the same.
마는 마목 마과에 속하는 다년생 덩굴성 식물로 동북아시아가 원산이며 한국, 중국, 일본, 베트남 등에서 주로 재배되고 있다. 주요 이용 부위는 덩이뿌리로 주로 산약(마 뿌리를 말린 것)이라 불리는 약용작물로 주로 이용되며 최근에는 건강식품으로 생마를 식용으로도 널리 이용하고 있다. 마는 폐와 비장에 유익하고 면역기능 향상 및 당뇨병 개선효과와 항산화 작용이 있는 것으로 알려져 있어 최근 국내에서 건강기능성 약용작물로 재배가 증가하고 있다. 마는 덩의 뿌리의 모양에 따라 장마, 단마, 둥근마 등으로 구별된다. 마는 괴경(tuber)이나 영여자(aerial bulbil)를 종근으로 하여 영양번식체로 재배 되는데, 바이러스에 감염된 종근을 사용하면 다음 세대에 바이러스 감염률을 높이고 품질과 수량을 저하시킬 수 있어 주의가 요구된다.Hemp is a perennial vine plant belonging to the hemp family. It is native to Northeast Asia and is cultivated mainly in Korea, China, Japan, and Vietnam. The main site of use is tuber root, which is mainly used as a medicinal crop called sanyak (dried hemp root), and recently raw horse is widely used for food as a health food. Hemp is known to be beneficial to the lungs and spleen, and has the effect of improving immune function and diabetes, as well as antioxidant activity. Hemp is classified into rainy season, sweet season, and round season depending on the shape of the root of the dung. Hemp is cultivated as vegetative propagation with tubers or aerial bulbils as stalk roots, and caution is required as the use of viral-infected stalks can increase viral infection rates and lower quality and yield in the next generation.
마에 감염하는 바이러스는 전 세계적으로 약 10종이 알려져 있으며 이 중에서 3종이 국내에서 발생하는 것으로 조사되었다(Eni et al., 2008, 2010; Kenyon et al., 2001; Kwon et al., 2016a, 2016b; Lan et al., 2014; Lee et al., 2016). 국내에서 마에 감염하는 것으로 알려진 3종 바이러스는 잠두위조바이러스2(Broad bean wilt virus 2, BBWV2), 마괴저모자이크바이러스(Chinese yam necrotic mosaic virus, CYNMV), 마모자이크바이러스(Japanese yam mosaic virus, JYMV)으로 이들 바이러스들은 단독 또는 복합 감염의 형태로 피해를 주고 있다. 병징은 주로 잎에서는 괴저반점, 모자이크, 괴사반점, 윤문무늬, 엽맥황화, 엽맥퇴록 등 다양한 증상을 보이며, 상엽은 위축되는 증상이 나타나기도 한다.About 10 types of hemp-infecting viruses are known worldwide, and three of them are found to occur in Korea (Eni et al., 2008, 2010; Kenyon et al., 2001; Kwon et al., 2016a, 2016b; Lan et al., 2014; Lee et al., 2016). Three viruses known to infect hemp in Korea are broad bean wilt virus 2 (BBWV2), Chinese yam necrotic mosaic virus (CYNMV), and Japanese yam mosaic virus (JYMV). As such, these viruses are damaging in the form of single or multiple infections. Symptoms mainly show a variety of symptoms such as necrotic spots, mosaic, necrotic spots, limbal pattern, leaf vein yellowing, leaf vein decay, and the upper leaf atrophy.
BBWV2는 Secoviridae 과 Fabavirus 속에 속하는 직경이 약 25 nm인 구형바이러스로 즙액 및 진딧물에 의해 비영속적으로 매개된다. BBWV2는 분절된 2개의 RNA를 게놈으로 가지며 RNA1과 RNA2의 게놈의 크기는 각각 약 6 kb, 약 3.6 kb 이다. BBWV2는 기주 범위가 매우 넓은 바이러스로 주요 자연 발생 기주로는 고추, 콩, 시금치, 완두, 질경이 등이 있으며 최근에 국내에서 지황이나 익모초, 우슬 등과 같은 약용작물에서도 감염이 보고된바 있다(Kwon et al., 2016c, 2019a, 2019b). 대표적인 병징으로는 얼룩, 모자이크, 반점, 위조 등을 나타내며 마에서는 윤문무늬 및 괴저 증상 등이 나타나는 것으로 관찰되었다(Kondo et al., 2005; Kwon et al., 2016a). BBWV2 is a spherical virus of about 25 nm in diameter, belonging to the genus Secoviridae and Fabavirus, and is non-persistently mediated by juice and aphids. BBWV2 has two fragmented RNAs as genomes, and the size of the genomes of RNA1 and RNA2 is about 6 kb and about 3.6 kb, respectively. BBWV2 is a virus with a very wide host range. Major naturally occurring hosts include red pepper, soybean, spinach, peas, and plantain. Recently, infections have been reported in medicinal crops such as rhubarb, motherwort, and hyssop in Korea (Kwon et al. al., 2016c, 2019a, 2019b). Representative symptoms include stains, mosaics, spots, and forgery, and it was observed that the hemp had a lumbar pattern and gangrene symptoms (Kondo et al., 2005; Kwon et al., 2016a).
CYNMV는 Potyviridae 과 Macluravirus 속에 속하며, 길이가 660 nm인 사상형의 입자 모양을 가지는 바이러스이다(Kondo et. al., 2003; Kondo and Fujita, 2012). 현재까지 발생기주로는 마(Dioscorea spp.)에서만 보고가 되어있고 진딧물에 의해서 비영속적으로 매개된다고 알려져 있다(Kondo, 2001). CYNMV는 1978년에 일본에서 최초로 보고 되었으며 국내에서는 2003년에 처음으로 보고된 이래 2016년에 국내 분리주에 대한 게놈이 분석된바 있다(Kang et al., 2003; Fukumoto and Tochihara, 1978; Kwon et al., 2016b). 약 8.2 kb의 긴 외가닥 RNA 게놈으로 구성된 국내 CYNMV 분리주는 기존에 일본과 중국에서 보고된 분리주들과의 상동성 분석 결과 일본 분리주들과는 97% 이상의 상동성을 보인 반면, 중국 분리주들과는 78%의 상동성을 나타내어 국내 분리주는 일본 분리주들과 매우 가까운 근연관계를 가지고 있음을 확인하였다(Kwon et al., 2016b). CYNMV의 감염 주요 병징으로는 잎에 괴저 증상 및 모자이크 증상이 나타나며 CYNMV가 감염된 마는 수확량이 30-45% 감소되는 것으로 보고된 바 있다(Tochihara, 1993). CYNMV belongs to the genus Potyviridae family Macluravirus and has a filamentous particle shape with a length of 660 nm (Kondo et. al., 2003; Kondo and Fujita, 2012). Until now, it has been reported only in hemp (Dioscorea spp.) and is known to be non-persistently mediated by aphids (Kondo, 2001). CYNMV was first reported in Japan in 1978, and genomes of domestic isolates have been analyzed in 2016 since it was first reported in 2003 in Korea (Kang et al., 2003; Fukumoto and Tochihara, 1978; Kwon et al. ., 2016b). The domestic CYNMV isolate, consisting of a long single-stranded RNA genome of about 8.2 kb, showed more than 97% homology with Japanese isolates as a result of homology analysis with isolates previously reported in Japan and China, while 78% homology with Chinese isolates. As a result, it was confirmed that the domestic separatists had a very close relationship with the Japanese separatists (Kwon et al., 2016b). The main symptoms of CYNMV infection include gangrene and mosaic symptoms on the leaves, and it has been reported that the yield of hemp infected with CYNMV is reduced by 30-45% (Tochihara, 1993).
JYMV는 Potyviridae 과 Potyvirus속에 속하며, 입자는 약 785nm 길이의 사상형이다(Fuji and Nakamae, 1999). 게놈 크기는 약 9.7kb로 하나의 커다란 다단백질(polyprotein)에서 9개의 단백질을 발현한다(Fuji and Nakamae, 1999). 일본에서 1974년에서 마에서 최초로 보고되었으며 그 후 중국과 국내에서 발생이 보고되었는데 일본과 중국 및 국내 분리주들과의 상동성은 79~86%로 조사되었다(Lee et al., 2016). JYMV의 발생 기주 역시 CYNMV처럼 마(Dioscorea spp.)에 국한되어있으며 진딧물에 의해 비영속전염하는 것으로 알려져 있다. 국내에서의 감염율은 약 40% 정도로 보고된바 있다(Lee et al., 2016). 대표적인 JYMV 감염 증상으로는 모자이크와 괴저병징이 있으며 잎에 변형과 엽맥녹대 증상이 나타난다. JYMV belongs to the genus Potyviridae family Potyvirus, and the particles are filamentous with a length of about 785 nm (Fuji and Nakamae, 1999). The genome size is about 9.7kb, and 9 proteins are expressed in one large polyprotein (Fuji and Nakamae, 1999). In Japan, it was first reported in Ma in 1974, and thereafter, the outbreaks were reported in China and domestically. The homology between Japan and China and domestic separatists was found to be 79-86% (Lee et al., 2016). The host of JYMV is also confined to hemp (Dioscorea spp.) like CYNMV, and is known to be non-persistent transmission by aphids. The infection rate in Korea has been reported to be about 40% (Lee et al., 2016). Representative symptoms of JYMV infection include mosaic and gangrene symptoms, and leaf deformation and leaf vein rust symptoms appear.
건전한 마 재배를 위해서는 우선적으로 바이러스에 감염되지 않는 건전한 종근을 사용해야 한다. 이를 위해 재배 시 바이러스 감염여부와 감염 바이러스의 종류를 파악하여 건전한 마에서 채종한 종근을 사용하는 것이 매우 중요하다. 앞서 검토한 병징 및 도 1에 개시된 병징에서 알 수 있는 바와 같이, 마의 병징으로는 어떤 바이러스에 감염되었는지를 정확히 알기 어렵다. 따라서 신속하면서 정확한 감염 확인을 위해 국내 발생 주요 3종 바이러스를 동시에 검출할 수 있는 프라이머가 필요하다. 그러나 국내에서 주요한 3가지 마 바이러스인 BBWV2, CYNMV, 및 JYMV를 동시에 검출할 수 있는 프라이머는 알려지지 않았다. For healthy hemp cultivation, it is first necessary to use healthy stamens that are not infected with viruses. For this purpose, it is very important to determine whether or not virus is infected and the type of infectious virus during cultivation, and to use seed roots from healthy hemp. As can be seen from the symptoms reviewed above and the symptoms disclosed in FIG. 1, it is difficult to know exactly which virus was infected with the symptoms of the horse. Therefore, in order to quickly and accurately confirm infection, a primer that can simultaneously detect the three major domestic viruses is required. However, primers capable of simultaneously detecting the three major hemp viruses BBWV2, CYNMV, and JYMV in Korea are unknown.
일 구체예는 BBWV2, CYNMV, 및 JYMV를 동시에 검출할 수 있는 프라이머 세트를 제공한다.One embodiment provides a primer set capable of simultaneously detecting BBWV2, CYNMV, and JYMV.
일 양상은, BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus) 3종의 마(Diascorea spp.) 바이러스를 검출하기 위한 프라이머 세트로서, 제 1 프라이머쌍, 제 2 프라이머쌍, 및 제 3 프라이머쌍을 포함하는 마 바이러스 동시 검출용 프라이머 세트를 제공한다. One aspect is a primer set for detecting three kinds of Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus), the first It provides a primer set for simultaneous detection of hemp virus including a primer pair, a second primer pair, and a third primer pair.
상기 제 1 프라이머쌍은 BBWV2를 검출하기 위한 것이고, 서열번호 1 및 서열번호 2의 염기서열로 구성된 프라이머쌍 및 서열번호 3 및 서열번호 4의 염기서열로 구성된 프라이머쌍으로 이루어진 군에서 선택된 것일 수 있다. The first primer pair is for detecting BBWV2, and may be selected from the group consisting of a primer pair consisting of a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and a primer pair consisting of a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 .
상기 제 2 프라이머쌍은 CYNMV를 검출하기 위한 것이고, 서열번호 5 및 서열번호 6의 염기서열로 구성된 프라이머쌍, 서열번호 7 및 서열번호 8의 염기서열로 구성된 프라이머쌍, 및 서열번호 9 및 서열번호 10의 염기서열로 구성된 프라이머쌍으로 이루어진 군에서 선택된 것일 수 있다. The second primer pair is for detecting CYNMV, a primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, a primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8, and SEQ ID NO: 9 and SEQ ID NO: It may be selected from the group consisting of a primer pair consisting of a base sequence of 10.
상기 제 3 프라이머쌍은 JYMV를 검출하기 위한 것이고, 서열번호 11 및 서열번호 12의 염기서열로 구성된 프라이머쌍 및 서열번호 13 및 서열번호 14의 염기서열로 구성된 프라이머쌍으로 이루어진 군에서 선택된 것일 수 있다. The third primer pair is for detecting JYMV, and may be selected from the group consisting of a primer pair consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14. .
BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus) 3종의 마(Diascorea spp.) 바이러스에 대한 정보는 통상기술자에게 알려져 있으며, 하기 표 1에도 정보가 기재되어 있다. BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus) three kinds of Ma (Diascorea spp.) viruses are known to those of ordinary skill in the art, and also in Table 1 below. Information is listed.
상기 제 1 프라이머쌍, 제 2 프라이머쌍, 및 제 3 프라이머쌍은 각각의 검출 대상 바이러스에 대한 특이성 및 민감도가 우수하고, 혼합하여 사용하는 경우에도 프라이머쌍 사이의 혼성화 또는 검출대상 바이러스 외의 비특이적 증폭이 없으므로 BBWV2, CYNMV, 및 JYMV 바이러스를 동시에 검출하는데 유용하다. The first primer pair, the second primer pair, and the third primer pair have excellent specificity and sensitivity for each detection target virus, and hybridization between the primer pairs or non-specific amplification other than the detection target virus, even when used in combination Therefore, it is useful to simultaneously detect BBWV2, CYNMV, and JYMV viruses.
상기 동시 검출은 하나의 검출 과정에서 여러 종류의 검출 대상을 증폭하는 것으로, 예를 들면 하나의 튜브에 시료를 투입하고 제 1 프라이머쌍, 제 2 프라이머쌍, 및 제 3 프라이머쌍을 모두 혼합하여 증폭 반응을 수행하는 것일 수 있다. The simultaneous detection is to amplify several types of detection targets in one detection process.For example, a sample is introduced into one tube and amplified by mixing all of the first primer pair, the second primer pair, and the third primer pair. It may be to carry out the reaction.
일 구체예에서, 상기 동시 검출은 다중 역전사 중합효소 연쇄반응(multiplex reverse transcription polymerase chain reaction, RT-PCR)로 검출하는 것일 수 있다. 상기 다중 역전사 중합효소 연쇄반응은 통상기술자에게 일반적으로 알려진 방법으로 수행하는 것일 수 있다. 상기 다중 역전사 중합효소 연쇄반응은 바이러스를 포함하는 시료, 상기 제 1 프라이머쌍, 제 2 프라이머쌍, 및 제 3 프라이머쌍의 혼합물, 용매, 및 RT-PCR에 필요한 중합효소를 혼합하고 증폭과정을 30회(cycle) 이상 또는 35회(cycle) 이상 반복하는 것을 포함하여 수행할 수 있다. 상기 증폭과정은 1회(cycle)가 94℃에서 약 30초, 56℃에서 약 30초, 및 72℃에서 약 1분으로 이루어지는 것일 수 있다.In one embodiment, the simultaneous detection may be detection by multiplex reverse transcription polymerase chain reaction (RT-PCR). The multiple reverse transcription polymerase chain reaction may be performed by a method generally known to a person skilled in the art. In the multiple reverse transcription polymerase chain reaction, a sample containing a virus, a mixture of the first primer pair, the second primer pair, and the third primer pair, a solvent, and a polymerase required for RT-PCR are mixed, and the amplification process is 30 It may be performed including repeating at least 35 cycles or at least 35 cycles. The amplification process may be performed in a cycle of about 30 seconds at 94°C, about 30 seconds at 56°C, and about 1 minute at 72°C.
다른 양상은, 상기 마 바이러스 동시 검출용 프라이머 세트를 포함하는 마 바이러스 다중 진단용 조성물을 제공한다. 상기 조성물은 바이러스 RNA 증폭 등 바이러스 진단에 필요한 통상적인 시약들을 더 포함할 수 있다. 예를 들면 RT-PCR 방법을 이용하여 바이러스 RNA를 증폭시키는 경우, RT-PCR을 수행하는데 필요한 시약, 중합효소(polymerase), 및 dNTP를 포함할 수 있고, 2가 금속 양이온을 더 포함할 수 있으나 이에 한정되는 것은 아니다. Another aspect provides a composition for diagnosis of multiple Ma virus comprising a primer set for simultaneous detection of Ma virus. The composition may further include conventional reagents necessary for viral diagnosis, such as amplification of viral RNA. For example, in the case of amplifying viral RNA using the RT-PCR method, reagents required to perform RT-PCR, polymerase, and dNTP may be included, and divalent metal cations may be further included. It is not limited thereto.
상기 조성물은 BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus)로 이루어진 군에서 하나 이상을 동시 진단할 수 있는 것일 수 있고, 예를 들면 3가지 모두를 동시에 진단하는 것일 수 있다. The composition may be capable of simultaneously diagnosing one or more in the group consisting of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus), for example, three It could be diagnosing all at the same time.
또 다른 양상은, 상기 마 바이러스 다중 진단용 조성물을 포함하는 마 바이러스 다중 진단용 키트를 제공한다. 상기 키트는 마 바이러스 다중 진단용 조성물을 동결 건조한 형태로 플라스틱 튜브에 담아 제조될 수 있으며, 이 외에도 마 바이러스 검출에 사용되는 적절한 시약 및 도구를 더 포함할 수 있다. 상기 시약 및 도구는 담체, 검출 가능한 신호를 생성할 수 있는 표지, 용해제, 세정제 등이 있으나, 이에 한정되는 것은 아니다. Another aspect provides a kit for diagnosis of multiple horses virus, including the composition for diagnosis of multiple horses virus. The kit may be prepared by placing a composition for diagnosis of multiple hemp virus in a plastic tube in a freeze-dried form, and may further include appropriate reagents and tools used for detecting the hemp virus. The reagents and tools include, but are not limited to, a carrier, a label capable of generating a detectable signal, a solubilizing agent, a detergent, and the like.
또 다른 양상은 상기 마 바이러스 동시 검출용 프라이머 세트를 이용하여 마 바이러스를 다중 진단하는 마 바이러스 다중 진단 방법을 제공한다. Another aspect provides a method for multi-diagnosing Ma virus using the primer set for simultaneous Ma virus detection.
일 구체예에 따르면, 상기 마 바이러스 다중 진단 방법은 바이러스를 포함하는 시료, 상기 제 1 프라이머쌍, 제 2 프라이머쌍, 및 제 3 프라이머쌍의 혼합물, 용매, 및 RT-PCR에 필요한 중합효소를 혼합하고 증폭과정을 30회(cycle) 이상 또는 35회(cycle) 이상 반복하는 것을 포함할 수 있다. 상기 증폭과정은 1회(cycle)가 94℃에서 약 30초, 56℃에서 약 30초, 및 72℃에서 약 1분으로 이루어지는 것일 수 있다. 상기 마 바이러스는 BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus)일 수 있다.According to one embodiment, the method for diagnosing multiple virus viruses includes a sample containing a virus, a mixture of the first primer pair, the second primer pair, and the third primer pair, a solvent, and a polymerase required for RT-PCR. And repeating the amplification process at least 30 cycles or at least 35 cycles. The amplification process may be performed in a cycle of about 30 seconds at 94°C, about 30 seconds at 56°C, and about 1 minute at 72°C. The hemp virus may be broad bean wilt virus 2 (BBWV2), Chinese yam necrotic mosaic virus (CYNMV), and Japanese yam mosaic virus (JYMV).
일 구체예에 따른 프라이머 세트를 이용하면, 국내 주요 마 바이러스인 BBWV2, CYNMV, 및 JYMV 바이러스를 동시에 검출함으로서 마 바이러스 진단에 필요한 비용과 시간을 절감할 수 있다. By using the primer set according to one embodiment, it is possible to reduce the cost and time required for diagnosing the hemp virus by simultaneously detecting BBWV2, CYNMV, and JYMV viruses, which are major domestic hemp viruses.
일 구체예에 따른 프라이머 세트를 이용하면, 국내 주요 마 바이러스인 BBWV2, CYNMV, 및 JYMV 바이러스를 동시에 검출하고 감염되지 않은 종근을 선별함으로써 마의 품질 및 수확량을 향상시킬 수 있다.Using the primer set according to an embodiment, it is possible to improve the quality and yield of the hemp by simultaneously detecting the major domestic hemp viruses, BBWV2, CYNMV, and JYMV viruses, and selecting uninfected stem roots.
도 1은 마 바이러스에 의해 마의 잎에서 발현되는 병징을 나타낸 것이다.
도 2는 일 구체예에 따른 프라이머쌍을 이용한 BBWV2 바이러스 검출 결과를 나타낸 것이다.
도 3은 일 구체예에 따른 프라이머쌍을 이용한 CYNMV 바이러스 검출 결과를 나타낸 것이다.
도 4는 일 구체예에 따른 프라이머쌍을 이용한 JYMV 바이러스 검출 결과를 나타낸 것이다.
도 5는 일 구체예에 따른 프라이머쌍 또는 프라이머 세트를 이용한 바이러스 검출 및 동시 검출 결과를 나타낸 것이다. Figure 1 shows the symptoms expressed in the leaves of the hemp by the hemp virus.
Figure 2 shows the BBWV2 virus detection results using a primer pair according to an embodiment.
3 shows the CYNMV virus detection results using a primer pair according to an embodiment.
Figure 4 shows the JYMV virus detection results using a primer pair according to an embodiment.
Figure 5 shows the virus detection and simultaneous detection results using a primer pair or primer set according to an embodiment.
이하 하나 이상의 구체예를 실시예를 통해 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다. Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.
실시예 1: BBWV2 검출용 프라이머 설계Example 1: Design of primers for detection of BBWV2
BBWV2 검출용 프라이머는 마에서 보고된 BBWV2-DO isolate의 전체 염기서열을 참조하여 RNA1 (accession No. KT246495)의 RNA-dependent RNA polymerase (RdRp) 및 RNA2 (accession No. KT246496)의 small coat protein (S-CP)를 대상으로 한 PCR 증폭 산물의 크기가 각 318bp, 382bp인 프라이머 2쌍을 설계하였다. 각 프라이머의 염기 서열은 하기 표 2에 개시되어 있다. 프라이머를 제작하고 각 프라이머의 특이성을 검정하여 BBWV2 검출용 프라이머로 선발하였다(도 2 참조). 도 2에 따르면 프라이머 2 쌍 모두 BBWV2 검출의 특이성이 있는 것으로 나타났으며, 특히 BBWV2-R2-2960 및 BBWV2-R2-3342으로 구성된 프라이머 쌍의 밴드가 더 크고 선명하여 민감도가 우수한 것으로 확인되었다.For the primers for detection of BBWV2, RNA-dependent RNA polymerase (RdRp) of RNA1 (accession No. KT246495) and small coat protein (S) of RNA2 (accession No. KT246496) by referring to the entire nucleotide sequence of the BBWV2-DO isolate reported in Ma -CP), the size of the PCR amplification product was 318 bp and 382 bp, respectively, and two pairs of primers were designed. The base sequence of each primer is disclosed in Table 2 below. Primers were prepared, and the specificity of each primer was assayed to be selected as a primer for detecting BBWV2 (see FIG. 2). According to FIG. 2, it was found that both pairs of primers have specificity for detection of BBWV2, and in particular, it was confirmed that the band of the primer pair composed of BBWV2-R2-2960 and BBWV2-R2-3342 was larger and clearer, and thus the sensitivity was excellent.
(Forward)BBWV2-R1-5336
(Forward)
(Reverse)BBWV2-R1-5653
(Reverse)
(Forward)BBWV2-R2-2960
(Forward)
(Reverse)BBWV2-R2-3342
(Reverse)
실시예 2: CYNMV 검출용 프라이머 설계 Example 2: Design of primers for CYNMV detection
CYNMV 검출용 프라이머는 마에서 보고된 CYNMV-AD isolate (accession No. KX352243)의 전체염기서열을 참조하여 nuclear inclusion b protein (NIb), coat protein (CP) 및 CP와 3' untranslated region (UTR) 지역을 대상으로 한 PCR 증폭산물의 크기가 697bp, 636bp, 610bp인 3쌍을 설계하였다. 각 프라이머의 서열은 하기 표 3에 개시되어 있다. 프라이머를 제작하고 각 프라이머의 특이성을 검정하여 CYNMV 검출용 프라이머로 선발하였다(도 3 참조). 도 3에 따르면 프라이머 3 쌍 모두 CYNMV 검출의 특이성이 있는 것으로 나타났으며, 샘플 내 바이러스 농도의 차이에도 특이성 및 민간도 면에서 가장 균일하게 검출되는 프라이머 세트로 CYNMV-3'UTR-F와 CYNMV-3'UTR-R 가 가장 좋은 결과를 나타내는 것으로 확인하여 이를 선발하였다. The primers for CYNMV detection are nuclear inclusion b protein (NIb), coat protein (CP) and CP and 3'untranslated region (UTR) region by referring to the entire base sequence of CYNMV-AD isolate (accession No. KX352243) reported in He. The size of the PCR amplification products for targeting was 697bp, 636bp, and 610bp, three pairs were designed. The sequence of each primer is disclosed in Table 3 below. Primers were prepared, and the specificity of each primer was assayed to select primers for CYNMV detection (see FIG. 3). According to FIG. 3, it was found that all three pairs of primers have specificity for CYNMV detection, and CYNMV-3'UTR-F and CYNMV- are the most uniformly detected primer sets in terms of specificity and private map even with differences in virus concentration in the sample. It was confirmed that 3'UTR-R showed the best result, and it was selected.
(Forward)CYNMV-NIb-F
(Forward)
(Reverse)CYNMV-NIb-R
(Reverse)
(Forward)CYNMV-CP-F
(Forward)
(Reverse)CYNMV-CP-R
(Reverse)
(Forward)CYNMV-3UTR-F
(Forward)
(Reverse)CYNMV-3UTR-R
(Reverse)
실시예 3: JYMV 검출용 프라이머 설계 Example 3: JYMV detection primer design
JYMV 검출용 프라이머는 마에서 보고된 JYMV (accession No. NC000947) 전체염기서열을 참조하여 CP와 3'UTR 지역을 대상으로 한 PCR 증폭산물의 크기가 368bp, 501bp인 2쌍을 설계하였다. 각 프라이머의 염기서열은 하기 표 4에 개시되어 있다. 프라이머를 제작하고 각 프라이머의 특이성을 검정하여 JYMV 검출용 프라이머로 선발하였다(도 4 참조). 도 4에 따르면 각 프라이머쌍은 모두 JYMV 검출에 대한 특이성이 있었으며, 특히 JYMV-F-9148 및 JYMV-R-9648로 구성된 프라이머가 밴드의 크기가 다중진단용 multiprimer로 사용하기에 가장 적합하며 (선발한 BBWV2와 CYNMV프라이머의 사이즈와 비교가 용이한 크기임) 이를 선발하였다. For JYMV detection primers, two pairs of 368bp and 501bp PCR amplification products for CP and 3'UTR regions were designed with reference to the JYMV (accession No. NC000947) total nucleotide sequence reported in Ma. The base sequence of each primer is disclosed in Table 4 below. Primers were prepared, and the specificity of each primer was assayed to select primers for JYMV detection (see FIG. 4). According to FIG. 4, each primer pair had specificity for JYMV detection, and in particular, the primers composed of JYMV-F-9148 and JYMV-R-9648 were most suitable for use as a multiprimer for multi-diagnosis with a band size (selected The size of BBWV2 and CYNMV primers and sizes that are easy to compare) were selected.
(Forward)JYMV-CP-F
(Forward)
(Reverse)JYMV-CP-R
(Reverse)
(Forward)JYMV-F-9148
(Forward)
(Reverse)JYMV-R-9648
(Reverse)
실시예 4: 3종 바이러스 다중검출 Example 4: Multiple detection of three viruses
상기 실시예 1 내지 3에서 제작한 프라이머들 중에서 다중검출에 사용할 프라이머를 선발하고, 이를 이용하여 한번의 RT-PCR로 3종의 바이러스를 동시에 검출할 수 있는 다중(multiplex) RT-PCR 방법을 개발하였다Development of a multiplex RT-PCR method capable of simultaneously detecting three viruses with a single RT-PCR by selecting a primer to be used for multiple detection among the primers prepared in Examples 1 to 3 above. Did
다중 RT-PCR에 사용될 BBWV2, CYNMV, 및 JYMV 검출용 프라이머는 앞에서 선발된 프라이머의 특이성과 민감도 및 증폭산물의 크기를 고려하여 선발하였다(하기 표 5 참조). The primers for detecting BBWV2, CYNMV, and JYMV to be used in multiple RT-PCR were selected in consideration of the specificity and sensitivity of the previously selected primers and the size of the amplification product (see Table 5 below).
(서열번호 3)ACGGATCCAAGAGCAGTGAGAA
(SEQ ID NO: 3)
(서열번호 4)ATCCGARCCAAATTGCCCATAC
(SEQ ID NO: 4)
(서열번호 9)GTGTGCTAACAATGGTACATCATC
(SEQ ID NO: 9)
(서열번호 10)GTGCGTTGAGGGTTGCTGAGC
(SEQ ID NO: 10)
(서열번호 13)ATGATGGAYGGAGAAGAGC
(SEQ ID NO: 13)
(서열번호 14)CCACCCTCATCTCATTCATTCTT
(SEQ ID NO: 14)
마 시료는 병징이 있는 잎을 액체질소로 마쇄한 뒤, RNA 바이러스 게놈 추출 키트(Plant RNA Prep kit, Biocube)를 이용하여 핵산을 추출하였다. 추출된 게놈을 주형으로 One-step RT-PCR Premix kit (SuprimeScript RT-PCR kit, Genetbio)를 이용하여 바이러스 검정을 실시하였다. 프라이머는 BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648를 사용하였다. 동시 검출을 위한 RT-PCR 조건은 하기 표 6에 개시되어 있다. For the hemp sample, after the leaf with symptoms was ground with liquid nitrogen, nucleic acids were extracted using an RNA virus genome extraction kit (Plant RNA Prep kit, Biocube). Virus assay was performed using the extracted genome as a template using the One-step RT-PCR Premix kit (SuprimeScript RT-PCR kit, Genetbio). As primers, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648 were used. RT-PCR conditions for simultaneous detection are disclosed in Table 6 below.
RT-PCR산물은 1.5% 아가로스겔, 100mV, 1시간 전기영동하여 확인하였다. 도 5의 Lane 1 내지 3을 참조하면, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648를 각각 사용한 경우 밴드가 선명하게 확인되었으므로 각 바이러스를 특이적으로 검출할 수 있음을 알 수 있었다. 도 5의 Lane 4 내지 6을 참조하면, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648 중에서 2가지 프라이머쌍을 임의로 혼합하여 사용하는 경우에도 각 바이러스를 특이적으로 검출할 수 있음을 알 수 있었다. 도 5의 Lane 7을 참조하면, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, 및 JYMV-F-9148/JYMV-R-9648 3가지 프라이머쌍을 모두 혼합하여 사용하는 경우에도 각 바이러스를 특이적으로 검출할 수 있음을 알 수 있었다. 또한 3가지 프라이머쌍을 혼합하여 사용하는 경우에도 밴드의 크기 차이가 거의 없으므로 다중검출의 저하요소인 프라이머끼리의 혼성화 및 바이러스간 비특이적 결합이 거의 없음을 확인할 수 있었다. The RT-PCR product was confirmed by electrophoresis with 1.5% agarose gel, 100 mV, and 1 hour. Referring to
하기 표 7을 참조하면, RT-PCR산물의 염기서열 분석결과, NCBI에 등록된 염기서열과 96~99%의 상동성을 보였으므로, 바이러스 특이적이면서도 다중검출에 유용하게 사용될 수 있음을 알 수 있었다. Referring to Table 7 below, as a result of nucleotide sequence analysis of the RT-PCR product, it showed 96-99% homology with the nucleotide sequence registered in NCBI, so it can be seen that it is virus-specific and can be usefully used for multiple detection. there was.
바이러스object
virus
크기product
size
/상동성comparison target
/Homology
BBWV2-R2-2960 /BBWV2-R2-3342
383bp
/99%KX234810
/99%
/CYNMV-3UTR-R
CYNMV-3UTR-F
/CYNMV-3UTR-R
610bp
/JYMV-R-9648
JYMV-F-9148
/JYMV-R-9648
501bp
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same <130> RDA-P190019 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5336 <400> 1 atggagtgag tgatttcttg tcg 23 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5653 <400> 2 cttgcctaaa cttcttctgt atcg 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-2960 <400> 3 acggatccaa gagcagtgag aa 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-3342 <400> 4 atccgarcca aattgcccat ac 22 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-F <400> 5 tcataaacac aaacgataag aagg 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-R <400> 6 tgagtacggc aatgaatagc a 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-F <400> 7 aaccaaacaa taatccagac acag 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-R <400> 8 tcccatcaag aagcattacc c 21 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-F <400> 9 gtgtgctaac aatggtacat catc 24 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-R <400> 10 gtgcgttgag ggttgctgag c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-F <400> 11 ttggctaaca caagggctac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-R <400> 12 aaatcaaacg catagcgagc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> JYMV-F-9148 <400> 13 atgatggayg gagaagagc 19 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> JYMV-R-9648 <400> 14 ccaccctcat ctcattcatt ctt 23 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same <130> RDA-P190019 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5336 <400> 1 atggagtgag tgatttcttg tcg 23 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5653 <400> 2 cttgcctaaa cttcttctgt atcg 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-2960 <400> 3 acggatccaa gagcagtgag aa 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-3342 <400> 4 atccgarcca aattgcccat ac 22 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-F <400> 5 tcataaacac aaacgataag aagg 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-R <400> 6 tgagtacggc aatgaatagc a 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-F <400> 7 aaccaaacaa taatccagac acag 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-R <400> 8 tcccatcaag aagcattacc c 21 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-F <400> 9 gtgtgctaac aatggtacat catc 24 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-R <400> 10 gtgcgttgag ggttgctgag c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-F <400> 11 ttggctaaca caagggctac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-R <400> 12 aaatcaaacg catagcgagc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> JYMV-F-9148 <400> 13 atgatggayg gagaagagc 19 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> JYMV-R-9648 <400> 14 ccaccctcat ctcattcatt ctt 23
Claims (7)
BBWV2를 검출하기 위한 것이고, 서열번호 3 및 서열번호 4의 염기서열로 구성된 제 1 프라이머쌍;
CYNMV를 검출하기 위한 것이고, 서열번호 9 및 서열번호 10의 염기서열로 구성된 제 2 프라이머쌍; 및
JYMV를 검출하기 위한 것이고, 서열번호 13 및 서열번호 14의 염기서열로 구성된 제 3 프라이머쌍을 포함하고,
상기 제1프라이머쌍, 제2프라이머쌍, 및 제3프라이머쌍의 어닐링 온도는 56℃인,
마 바이러스 동시 검출용 프라이머 세트. As a primer set for detecting three types of Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
For detecting BBWV2, a first primer pair consisting of the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4;
For detecting CYNMV, a second primer pair consisting of the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10; And
It is for detecting JYMV, and includes a third primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14,
The annealing temperature of the first primer pair, the second primer pair, and the third primer pair is 56°C,
A primer set for simultaneous detection of e.
상기 동시 검출은 다중 역전사 중합효소 연쇄반응(multiplex reverse transcription polymerase chain reaction, RT-PCR)로 검출하는 것인,
마 바이러스 검출용 프라이머 세트.The method of claim 1,
The simultaneous detection is to be detected by a multiplex reverse transcription polymerase chain reaction (RT-PCR),
A set of primers for detection of hemp virus.
마 바이러스 다중 진단용 조성물. Comprising the primer set of claim 1,
Composition for multiple diagnosis of e.
상기 마 바이러스 다중 진단용 조성물은 BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus)로 이루어진 군에서 하나 이상을 동시 진단할 수 있는 것인,
마 바이러스 다중 진단용 조성물. The method of claim 3,
The composition for multi-diagnosis of hemp virus is one that can simultaneously diagnose one or more in the group consisting of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
Composition for multiple diagnosis of e.
마 바이러스 다중 진단용 키트.Comprising the composition for multiple diagnosis of the Ma virus of claim 3
Hemp virus multi-diagnosis kit.
마 바이러스 다중 진단 방법.Using the primer set for simultaneous detection of hemp virus of claim 1, multiple diagnosis of hemp virus,
Do virus multiple diagnostic methods.
상기 마 바이러스는 BBWV2(Broad bean wilt virus 2), CYNMV(Chinese yam necrotic mosaic virus), 및 JYMV(Japanese yam mosaic virus)인,
마 바이러스 다중 진단 방법.
The method of claim 6,
The hemp virus is BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
Do virus multiple diagnostic methods.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190073135A KR102226176B1 (en) | 2019-06-19 | 2019-06-19 | Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190073135A KR102226176B1 (en) | 2019-06-19 | 2019-06-19 | Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20200144909A KR20200144909A (en) | 2020-12-30 |
KR102226176B1 true KR102226176B1 (en) | 2021-03-10 |
Family
ID=74088155
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190073135A KR102226176B1 (en) | 2019-06-19 | 2019-06-19 | Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102226176B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114019159B (en) * | 2021-11-09 | 2022-08-12 | 中国科学院西北生态环境资源研究院 | Detection primer composition and kit for Japanese yam mosaic virus and application of detection primer composition and kit |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101771964B1 (en) | 2015-06-25 | 2017-08-29 | 대한민국 | PCR primer for multiplex diagnosing infectious 4 virus to Chinese cabbages and method for detecting virus using the same |
KR101881206B1 (en) * | 2016-07-20 | 2018-07-24 | 경상북도(농업기술원) | Primer set for simultaneous diagnosis of an yam virus and diagnosing method using the same |
-
2019
- 2019-06-19 KR KR1020190073135A patent/KR102226176B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
농촌진흥청 과제 최종보고서, 마 상품성 향상을 위한 씨마 생산 및 재배법 개선 연구, (2018.02.)* |
Also Published As
Publication number | Publication date |
---|---|
KR20200144909A (en) | 2020-12-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Kingsley et al. | Detection of both hepatitis A virus and Norwalk-like virus in imported clams associated with food-borne illness | |
Yang et al. | Sequence diversity of South Pacific isolates of Taro bacilliform virus and the development of a PCR-based diagnostic test | |
KR101642771B1 (en) | Primer set for multiple detection lily viruses and method for detecting said viruses using the same | |
Okuda et al. | RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template | |
KR101985654B1 (en) | Primer set for multiple detection 4 kinds of virus infecting Passiflora edulis and method for detecting said viruses using the same | |
Papayiannis et al. | Differentiation of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus using real-time TaqMan® PCR | |
KR101149422B1 (en) | Primers and its application in multiplex PCR to identify Rinderpest, Peste-des-petits-ruminants virus, Bluetongue virus and Rift Valley fever | |
KR102226176B1 (en) | Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same | |
KR101459616B1 (en) | Primer set for detecting viruses in sweet potato and method for detecting simultaneously said viruses using the same | |
JP2019013169A (en) | Diagnostic methods for virus | |
De Breuil et al. | Groundnut ringspot virus: an emerging Tospovirus inducing disease in peanut crops | |
FR2884259A1 (en) | Detecting potato virus Y responsible for necrosis, comprises extraction of nucleic acids from plant and amplification by reverse transcriptase-polymerase chain reaction from RNA viral region to detect polymorphisms | |
Zhang et al. | Molecular characterisation of canine parvovirus strains circulating in China | |
Minutolo et al. | A polyvalent tool for detecting coguviruses in multiple hosts allowed the identification of a novel seed-transmitted coguvirus infecting Brassicaceae | |
KR102667135B1 (en) | Primer sets for diagnosing of novel soybean geminivirus and diagnostic methods using thereof | |
KR101651815B1 (en) | Primer set for diagnosing White clover mosaic virus and uses thereof | |
KR101750837B1 (en) | Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same | |
Hasiów-Jaroszewska et al. | Genetic diversity of the Cucumber green mottle mosaic virus and the development of RT-LAMP assay for its detection. | |
KR102054126B1 (en) | Primers for multiple detection of the virus in Rehmannia glutinosa and detection method by using the same | |
Luo et al. | A Review of Viruses Infecting Yam (Dioscorea spp.). Viruses 2022, 14, 662 | |
Kundu | Detection, distribution and genetic diversities of Apple stem pitting virus and Apple stem grooving virus in the Czech Republic | |
KR102121954B1 (en) | Primer set for determining cucumber mosaic virus infection of Capsicum annuum | |
KR101983456B1 (en) | Detecting method barley yellow mosaic virus from soil using nested pcr | |
KR20230040631A (en) | Compositions for detecting tomato spotted wilt viruses having a mutation that overcomes resistance caused Tsw gene expression in plants, Kits and Detecting method for the same | |
KR100386135B1 (en) | Detection of Nephrotic Hemorrhagic Fever Virus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |