KR102226176B1 - Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same - Google Patents

Abstract

A primer set for simultaneous detection of three Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus) is disclosed.

Description

Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same}

The present invention relates to a primer set for simultaneous detection of three types of hemp viruses and a detection method using the same, and specifically, broad bean wilt virus 2 (BBWV2), three viruses generated in domestic hemp, and hemp mosaic virus A primer set capable of detecting (Chinese yam necrotic mosaic virus, CYNMV), or Japanese yam mosaic virus (JYMV) respectively or simultaneously, and a detection method using the same.

Hemp is a perennial vine plant belonging to the hemp family. It is native to Northeast Asia and is cultivated mainly in Korea, China, Japan, and Vietnam. The main site of use is tuber root, which is mainly used as a medicinal crop called sanyak (dried hemp root), and recently raw horse is widely used for food as a health food. Hemp is known to be beneficial to the lungs and spleen, and has the effect of improving immune function and diabetes, as well as antioxidant activity. Hemp is classified into rainy season, sweet season, and round season depending on the shape of the root of the dung. Hemp is cultivated as vegetative propagation with tubers or aerial bulbils as stalk roots, and caution is required as the use of viral-infected stalks can increase viral infection rates and lower quality and yield in the next generation.

About 10 types of hemp-infecting viruses are known worldwide, and three of them are found to occur in Korea (Eni et al., 2008, 2010; Kenyon et al., 2001; Kwon et al., 2016a, 2016b; Lan et al., 2014; Lee et al., 2016). Three viruses known to infect hemp in Korea are broad bean wilt virus 2 (BBWV2), Chinese yam necrotic mosaic virus (CYNMV), and Japanese yam mosaic virus (JYMV). As such, these viruses are damaging in the form of single or multiple infections. Symptoms mainly show a variety of symptoms such as necrotic spots, mosaic, necrotic spots, limbal pattern, leaf vein yellowing, leaf vein decay, and the upper leaf atrophy.

BBWV2 is a spherical virus of about 25 nm in diameter, belonging to the genus Secoviridae and Fabavirus, and is non-persistently mediated by juice and aphids. BBWV2 has two fragmented RNAs as genomes, and the size of the genomes of RNA1 and RNA2 is about 6 kb and about 3.6 kb, respectively. BBWV2 is a virus with a very wide host range. Major naturally occurring hosts include red pepper, soybean, spinach, peas, and plantain. Recently, infections have been reported in medicinal crops such as rhubarb, motherwort, and hyssop in Korea (Kwon et al. al., 2016c, 2019a, 2019b). Representative symptoms include stains, mosaics, spots, and forgery, and it was observed that the hemp had a lumbar pattern and gangrene symptoms (Kondo et al., 2005; Kwon et al., 2016a).

CYNMV belongs to the genus Potyviridae family Macluravirus and has a filamentous particle shape with a length of 660 nm (Kondo et. al., 2003; Kondo and Fujita, 2012). Until now, it has been reported only in hemp (Dioscorea spp.) and is known to be non-persistently mediated by aphids (Kondo, 2001). CYNMV was first reported in Japan in 1978, and genomes of domestic isolates have been analyzed in 2016 since it was first reported in 2003 in Korea (Kang et al., 2003; Fukumoto and Tochihara, 1978; Kwon et al. ., 2016b). The domestic CYNMV isolate, consisting of a long single-stranded RNA genome of about 8.2 kb, showed more than 97% homology with Japanese isolates as a result of homology analysis with isolates previously reported in Japan and China, while 78% homology with Chinese isolates. As a result, it was confirmed that the domestic separatists had a very close relationship with the Japanese separatists (Kwon et al., 2016b). The main symptoms of CYNMV infection include gangrene and mosaic symptoms on the leaves, and it has been reported that the yield of hemp infected with CYNMV is reduced by 30-45% (Tochihara, 1993).

JYMV belongs to the genus Potyviridae family Potyvirus, and the particles are filamentous with a length of about 785 nm (Fuji and Nakamae, 1999). The genome size is about 9.7kb, and 9 proteins are expressed in one large polyprotein (Fuji and Nakamae, 1999). In Japan, it was first reported in Ma in 1974, and thereafter, the outbreaks were reported in China and domestically. The homology between Japan and China and domestic separatists was found to be 79-86% (Lee et al., 2016). The host of JYMV is also confined to hemp (Dioscorea spp.) like CYNMV, and is known to be non-persistent transmission by aphids. The infection rate in Korea has been reported to be about 40% (Lee et al., 2016). Representative symptoms of JYMV infection include mosaic and gangrene symptoms, and leaf deformation and leaf vein rust symptoms appear.

For healthy hemp cultivation, it is first necessary to use healthy stamens that are not infected with viruses. For this purpose, it is very important to determine whether or not virus is infected and the type of infectious virus during cultivation, and to use seed roots from healthy hemp. As can be seen from the symptoms reviewed above and the symptoms disclosed in FIG. 1, it is difficult to know exactly which virus was infected with the symptoms of the horse. Therefore, in order to quickly and accurately confirm infection, a primer that can simultaneously detect the three major domestic viruses is required. However, primers capable of simultaneously detecting the three major hemp viruses BBWV2, CYNMV, and JYMV in Korea are unknown.

Republic of Korea Public Publication No. 10-2017-0001071 (2017.01.04)

One embodiment provides a primer set capable of simultaneously detecting BBWV2, CYNMV, and JYMV.

One aspect is a primer set for detecting three kinds of Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus), the first It provides a primer set for simultaneous detection of hemp virus including a primer pair, a second primer pair, and a third primer pair.

The first primer pair is for detecting BBWV2, and may be selected from the group consisting of a primer pair consisting of a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and a primer pair consisting of a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 .

The second primer pair is for detecting CYNMV, a primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, a primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8, and SEQ ID NO: 9 and SEQ ID NO: It may be selected from the group consisting of a primer pair consisting of a base sequence of 10.

The third primer pair is for detecting JYMV, and may be selected from the group consisting of a primer pair consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14. .

BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus) three kinds of Ma (Diascorea spp.) viruses are known to those of ordinary skill in the art, and also in Table 1 below. Information is listed.

number Virus name Abbreviation Group (general, genus) Transmission route One Broad bean wilt virus 2 BBWV2 Secoviridae (Fabavirus) Juice, aphid 2 Chinese yam necrotic mosaic virus CYNMV Potyviridae (Macluravirus) aphid 3 Japanese yam mosaic virus JYMV Potyviridae (Potyvirus) aphid

The first primer pair, the second primer pair, and the third primer pair have excellent specificity and sensitivity for each detection target virus, and hybridization between the primer pairs or non-specific amplification other than the detection target virus, even when used in combination Therefore, it is useful to simultaneously detect BBWV2, CYNMV, and JYMV viruses.

The simultaneous detection is to amplify several types of detection targets in one detection process.For example, a sample is introduced into one tube and amplified by mixing all of the first primer pair, the second primer pair, and the third primer pair. It may be to carry out the reaction.

In one embodiment, the simultaneous detection may be detection by multiplex reverse transcription polymerase chain reaction (RT-PCR). The multiple reverse transcription polymerase chain reaction may be performed by a method generally known to a person skilled in the art. In the multiple reverse transcription polymerase chain reaction, a sample containing a virus, a mixture of the first primer pair, the second primer pair, and the third primer pair, a solvent, and a polymerase required for RT-PCR are mixed, and the amplification process is 30 It may be performed including repeating at least 35 cycles or at least 35 cycles. The amplification process may be performed in a cycle of about 30 seconds at 94°C, about 30 seconds at 56°C, and about 1 minute at 72°C.

Another aspect provides a composition for diagnosis of multiple Ma virus comprising a primer set for simultaneous detection of Ma virus. The composition may further include conventional reagents necessary for viral diagnosis, such as amplification of viral RNA. For example, in the case of amplifying viral RNA using the RT-PCR method, reagents required to perform RT-PCR, polymerase, and dNTP may be included, and divalent metal cations may be further included. It is not limited thereto.

The composition may be capable of simultaneously diagnosing one or more in the group consisting of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus), for example, three It could be diagnosing all at the same time.

Another aspect provides a kit for diagnosis of multiple horses virus, including the composition for diagnosis of multiple horses virus. The kit may be prepared by placing a composition for diagnosis of multiple hemp virus in a plastic tube in a freeze-dried form, and may further include appropriate reagents and tools used for detecting the hemp virus. The reagents and tools include, but are not limited to, a carrier, a label capable of generating a detectable signal, a solubilizing agent, a detergent, and the like.

Another aspect provides a method for multi-diagnosing Ma virus using the primer set for simultaneous Ma virus detection.

According to one embodiment, the method for diagnosing multiple virus viruses includes a sample containing a virus, a mixture of the first primer pair, the second primer pair, and the third primer pair, a solvent, and a polymerase required for RT-PCR. And repeating the amplification process at least 30 cycles or at least 35 cycles. The amplification process may be performed in a cycle of about 30 seconds at 94°C, about 30 seconds at 56°C, and about 1 minute at 72°C. The hemp virus may be broad bean wilt virus 2 (BBWV2), Chinese yam necrotic mosaic virus (CYNMV), and Japanese yam mosaic virus (JYMV).

By using the primer set according to one embodiment, it is possible to reduce the cost and time required for diagnosing the hemp virus by simultaneously detecting BBWV2, CYNMV, and JYMV viruses, which are major domestic hemp viruses.

Using the primer set according to an embodiment, it is possible to improve the quality and yield of the hemp by simultaneously detecting the major domestic hemp viruses, BBWV2, CYNMV, and JYMV viruses, and selecting uninfected stem roots.

Figure 1 shows the symptoms expressed in the leaves of the hemp by the hemp virus.
Figure 2 shows the BBWV2 virus detection results using a primer pair according to an embodiment.
3 shows the CYNMV virus detection results using a primer pair according to an embodiment.
Figure 4 shows the JYMV virus detection results using a primer pair according to an embodiment.
Figure 5 shows the virus detection and simultaneous detection results using a primer pair or primer set according to an embodiment.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1: Design of primers for detection of BBWV2

For the primers for detection of BBWV2, RNA-dependent RNA polymerase (RdRp) of RNA1 (accession No. KT246495) and small coat protein (S) of RNA2 (accession No. KT246496) by referring to the entire nucleotide sequence of the BBWV2-DO isolate reported in Ma -CP), the size of the PCR amplification product was 318 bp and 382 bp, respectively, and two pairs of primers were designed. The base sequence of each primer is disclosed in Table 2 below. Primers were prepared, and the specificity of each primer was assayed to be selected as a primer for detecting BBWV2 (see FIG. 2). According to FIG. 2, it was found that both pairs of primers have specificity for detection of BBWV2, and in particular, it was confirmed that the band of the primer pair composed of BBWV2-R2-2960 and BBWV2-R2-3342 was larger and clearer, and thus the sensitivity was excellent.

Sequence list Primer name Locus Sequence(5' →3') Expected size One BBWV2-R1-5336
(Forward) 5336-5358 ATGGAGTGAGTGATTTCTTGTCG 318 bp 2 BBWV2-R1-5653
(Reverse) 5653-5630 CTTGCCTAAACTTCTTCTGTATCG 3 BBWV2-R2-2960
(Forward) 2960-2981 ACGGATCCAAGAGCAGTGAGAA 383 bp 4 BBWV2-R2-3342
(Reverse) 3342-3321 ATCCGARCCAAATTGCCCATAC

Example 2: Design of primers for CYNMV detection

The primers for CYNMV detection are nuclear inclusion b protein (NIb), coat protein (CP) and CP and 3'untranslated region (UTR) region by referring to the entire base sequence of CYNMV-AD isolate (accession No. KX352243) reported in He. The size of the PCR amplification products for targeting was 697bp, 636bp, and 610bp, three pairs were designed. The sequence of each primer is disclosed in Table 3 below. Primers were prepared, and the specificity of each primer was assayed to select primers for CYNMV detection (see FIG. 3). According to FIG. 3, it was found that all three pairs of primers have specificity for CYNMV detection, and CYNMV-3'UTR-F and CYNMV- are the most uniformly detected primer sets in terms of specificity and private map even with differences in virus concentration in the sample. It was confirmed that 3'UTR-R showed the best result, and it was selected.

Sequence list Primer name locus sequence(5'→3') expected size 5 CYNMV-NIb-F
(Forward) 5310-5333 TCATAAACACAAACGATAAGAAGG 697 bp 6 CYNMV-NIb-R
(Reverse) 5986-6006 TGAGTACGGCAATGAATAGCA 7 CYNMV-CP-F
(Forward) 7257-7280 AACCAAACAATAATCCAGACACAG 636 bp 8 CYNMV-CP-R
(Reverse) 7872-7892 TCCCATCAAGAAGCATTACCC 9 CYNMV-3UTR-F
(Forward) 7534-7557 GTGTGCTAACAATGGTACATCATC 610 bp 10 CYNMV-3UTR-R
(Reverse) 8143-8123 GTGCGTTGAGGGTTGCTGAGC

Example 3: JYMV detection primer design

For JYMV detection primers, two pairs of 368bp and 501bp PCR amplification products for CP and 3'UTR regions were designed with reference to the JYMV (accession No. NC000947) total nucleotide sequence reported in Ma. The base sequence of each primer is disclosed in Table 4 below. Primers were prepared, and the specificity of each primer was assayed to select primers for JYMV detection (see FIG. 4). According to FIG. 4, each primer pair had specificity for JYMV detection, and in particular, the primers composed of JYMV-F-9148 and JYMV-R-9648 were most suitable for use as a multiprimer for multi-diagnosis with a band size (selected The size of BBWV2 and CYNMV primers and sizes that are easy to compare) were selected.

Sequence list Primer name locus sequence(5'→3') expected size 11 JYMV-CP-F
(Forward) 8986-9005 TTGGCTAACACAAGGGCTAC 368 bp 12 JYMV-CP-R
(Reverse) 9353-9334 AAATCAAACGCATAGCGAGC 13 JYMV-F-9148
(Forward) 9148-9166 ATGATGGAYGGAGAAGAGC 501 bp 14 JYMV-R-9648
(Reverse) 9648-9626 CCACCCTCATCTCATTCATTCTT

Example 4: Multiple detection of three viruses

Development of a multiplex RT-PCR method capable of simultaneously detecting three viruses with a single RT-PCR by selecting a primer to be used for multiple detection among the primers prepared in Examples 1 to 3 above. Did

The primers for detecting BBWV2, CYNMV, and JYMV to be used in multiple RT-PCR were selected in consideration of the specificity and sensitivity of the previously selected primers and the size of the amplification product (see Table 5 below).

Virus Primer name sequence(5'→3') locus expected size Conc. BBWV2 BBWV2-R2-2960 ACGGATCCAAGAGCAGTGAGAA
(SEQ ID NO: 3) 2960-2981 383bp 10pmol BBWV2-R2-3342 ATCCGARCCAAATTGCCCATAC
(SEQ ID NO: 4) 3342-3321 CYNMV CYNMV-3UTR-F GTGTGCTAACAATGGTACATCATC
(SEQ ID NO: 9) 7543-7557 610bp 10pmol CYNMV-3UTR-R GTGCGTTGAGGGTTGCTGAGC
(SEQ ID NO: 10) 8143-8123 JYMV JYMV-F-9148 ATGATGGAYGGAGAAGAGC
(SEQ ID NO: 13) 9148-9166 501bp 10pmol JYMV-R-9648 CCACCCTCATCTCATTCATTCTT
(SEQ ID NO: 14) 9648-9626

For the hemp sample, after the leaf with symptoms was ground with liquid nitrogen, nucleic acids were extracted using an RNA virus genome extraction kit (Plant RNA Prep kit, Biocube). Virus assay was performed using the extracted genome as a template using the One-step RT-PCR Premix kit (SuprimeScript RT-PCR kit, Genetbio). As primers, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648 were used. RT-PCR conditions for simultaneous detection are disclosed in Table 6 below.

The RT-PCR product was confirmed by electrophoresis with 1.5% agarose gel, 100 mV, and 1 hour. Referring to Lanes 1 to 3 of FIG. 5, when BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648 are used respectively Since the band was clearly identified, it was found that each virus could be specifically detected. Referring to Lanes 4 to 6 of FIG. 5, two primers from BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, JYMV-F-9148/JYMV-R-9648 It was found that even when the pairs were arbitrarily mixed and used, each virus could be specifically detected. Referring to Lane 7 of Figure 5, BBWV2-R2-2960/BBWV2-R2-3342, CYNMV-3UTR-F/CYNMV-3UTR-R, and JYMV-F-9148/JYMV-R-9648 three primer pairs. It was found that even when all of them were mixed and used, each virus could be specifically detected. In addition, even when the three primer pairs were mixed and used, there was little difference in the size of the band, so it was confirmed that there was little hybridization between primers and non-specific binding between viruses, which are factors that reduce multiple detection.

Referring to Table 7 below, as a result of nucleotide sequence analysis of the RT-PCR product, it showed 96-99% homology with the nucleotide sequence registered in NCBI, so it can be seen that it is virus-specific and can be usefully used for multiple detection. there was.

object
virus primer product
size Base sequence (5'→3') comparison target
/Homology BBWV2 BBWV2-R2-2960 /BBWV2-R2-3342
383bp
ACGGATCCAAGAGCAGTGAGAATTTTGAGATTATACATTCTCCTTTCGTGCGCCTACTACAAACTTGTGCATGGATGAGAGGTACTTTGAGGTTTTATGTTGTGGCCCGTGCTAGCTCTGATTACATGAGTTACAGAAGAACATCTCAATTGATGGTTTCAGCTCACGAGAATAGTCTTAGTTCAAATCAATTCTACAGTGGAGCTTTGATGAGTCCAAGTGGTGAGTTGAGCTTTTCCAGAGAAGTGGTTGGCCCAGTGGATGGTTTTGCCTCCATAGGTTGGAATGTGCGTGGGAGCAAGAAGTTTTACAAAGTCCATGTGGAGATGGGGAATGTTCATGAGTACGATACTGTGGTGTTGTATGGGCAATTTGGCTCGGAT KX234810
/99% CYNMV CYNMV-3UTR-F
/CYNMV-3UTR-R
610bp
GTGTGCTAACAATGGTACATCATCTGAGTTAGACGCATCACAATTTATGGAGGTCCATGCAAACGGACAGATAATGGGGATTCCAATTCAAATTTTCGTTGAACCCGCAATTCAGCACGGAGGATTGCGTAAAGTGATGAGACATTTCAGCGGGATCACGAGCAAAATGTTGTCTGAAGGGGGAAAAATGACAGCATGGGGCAGGAAAAGGGGTTTCACTCAAAGATCAATGATACCATATGCCTTTGATTTCTTCGTTCCAACTGATACGACGCCAAAAACAATCAGGGAGCAGTTGAGTCAAAGCAAGGCTGCAGCTATTGGGCGTGGTGTTCAAAGGGTAATGCTTCTTGATGGGAAAGTTCACGGGAGCCGCACAAGTTATGAGAGACACACGGATAACGACCAGGATGAGTACGAACATGGAGGGGCGGAAGATCAGCGCCCAGCTTTATATTAGTAAGGTTTGTTTTGCAACAACTATTACTACTAGTATTAGAAGAATTAAATTTAATCTCTTTCATGATCTTCACTTTTAACTTTTGCGTTTATGAGTTAAATGGGAGTTTTTGTGGGTTTTTCTTCCAATGCTCAGCAACCCTCAACGCAC AB098350 /99% JYMV JYMV-F-9148
/JYMV-R-9648
501bp
ATGATGGACGGAGAAGAGCAAATTGAATATCCGATAAAACCATTAATAGATCACGCCAAACCCACATTTCGACAGATAATGGCTCATTTCAGTTATGTCGCTGAAGCATATATTGAAAAGAGAAATCAGGAAAAAGCGTACATGCCACGCTATGGACTTCAGAGGAACCTGACAGACATGAGCCTCGCTCGCTATGCGTTTGATTTTTACGAAGTAACATCAAAAACACCAGCGAGAGCGCGCGAAGCTCATATCCAAATGAAAGCAGCAGCCCTTAGAGGTGTGCAAAACAAGTTGTTTGGATTGGACGGAAATGTCAGCACAATGGAAGAAAACACGGAGAGACACACAGCTGAAGATGTGAACCGCAATATGCACAGCCTTCTCGGCGTGAGGGGTGTGTAAGCTATGTGTAGGTAATGATATTATTATGTAGTATCCTACCCGTTTAGAGTTATTCCATATGGTCTTTACTTTTAAGAATGAATGAGATGAGGGTGG AB016500 /96%

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same <130> RDA-P190019 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5336 <400> 1 atggagtgag tgatttcttg tcg 23 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R1-5653 <400> 2 cttgcctaaa cttcttctgt atcg 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-2960 <400> 3 acggatccaa gagcagtgag aa 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BBWV2-R2-3342 <400> 4 atccgarcca aattgcccat ac 22 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-F <400> 5 tcataaacac aaacgataag aagg 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-NIb-R <400> 6 tgagtacggc aatgaatagc a 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-F <400> 7 aaccaaacaa taatccagac acag 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-CP-R <400> 8 tcccatcaag aagcattacc c 21 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-F <400> 9 gtgtgctaac aatggtacat catc 24 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYNMV-3UTR-R <400> 10 gtgcgttgag ggttgctgag c 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-F <400> 11 ttggctaaca caagggctac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JYMV-CP-R <400> 12 aaatcaaacg catagcgagc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> JYMV-F-9148 <400> 13 atgatggayg gagaagagc 19 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> JYMV-R-9648 <400> 14 ccaccctcat ctcattcatt ctt 23

Claims (7)

As a primer set for detecting three types of Diascorea spp. viruses of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
For detecting BBWV2, a first primer pair consisting of the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4;
For detecting CYNMV, a second primer pair consisting of the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10; And
It is for detecting JYMV, and includes a third primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14,
The annealing temperature of the first primer pair, the second primer pair, and the third primer pair is 56°C,
A primer set for simultaneous detection of e. The method of claim 1,
The simultaneous detection is to be detected by a multiplex reverse transcription polymerase chain reaction (RT-PCR),
A set of primers for detection of hemp virus. Comprising the primer set of claim 1,
Composition for multiple diagnosis of e. The method of claim 3,
The composition for multi-diagnosis of hemp virus is one that can simultaneously diagnose one or more in the group consisting of BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
Composition for multiple diagnosis of e. Comprising the composition for multiple diagnosis of the Ma virus of claim 3
Hemp virus multi-diagnosis kit. Using the primer set for simultaneous detection of hemp virus of claim 1, multiple diagnosis of hemp virus,
Do virus multiple diagnostic methods. The method of claim 6,
The hemp virus is BBWV2 (Broad bean wilt virus 2), CYNMV (Chinese yam necrotic mosaic virus), and JYMV (Japanese yam mosaic virus),
Do virus multiple diagnostic methods.

Images