KR102121954B1 - Primer set for determining cucumber mosaic virus infection of Capsicum annuum - Google Patents

Primer set for determining cucumber mosaic virus infection of Capsicum annuum Download PDF

Info

Publication number
KR102121954B1
KR102121954B1 KR1020180044399A KR20180044399A KR102121954B1 KR 102121954 B1 KR102121954 B1 KR 102121954B1 KR 1020180044399 A KR1020180044399 A KR 1020180044399A KR 20180044399 A KR20180044399 A KR 20180044399A KR 102121954 B1 KR102121954 B1 KR 102121954B1
Authority
KR
South Korea
Prior art keywords
seq
oligonucleotide primer
primer represented
cmv
infection
Prior art date
Application number
KR1020180044399A
Other languages
Korean (ko)
Other versions
KR20190120978A (en
Inventor
윤주연
최국선
조인숙
권선정
최승국
정봉남
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020180044399A priority Critical patent/KR102121954B1/en
Publication of KR20190120978A publication Critical patent/KR20190120978A/en
Application granted granted Critical
Publication of KR102121954B1 publication Critical patent/KR102121954B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트에 관한 것으로, 구체적으로 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하는 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트, 키트 및 이를 이용한 고추의 오이모자이크바이러스 감염 판별방법에 관한 것이다.
본 발명의 프라이머 세트를 사용하여 RT-PCR을 수행하면 고추의 오이모자이크바이러스 감염여부를 판별할 수 있을 뿐만 아니라 고병원형과 저병원형 또한 신속하고 정확하게 판별할 수 있다. 이에 따라 고병원성 오이모자이크바이러스의 감염을 조기진단하고 피해 확산을 방지하는데 크게 기여할 수 있으며, 또한 고병원성 오이모자이크바이러스에 대한 저항성 품종을 개발하는데에도 큰 도움이 될 것으로 기대된다.
The present invention relates to a set of primers for discriminating cucumber mosquitovirus infection of red pepper, specifically, an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3 and a sequence It relates to a primer set, a kit for determining the cucumber mosquito virus infection of pepper containing the oligonucleotide primer represented by the number 4, and a method for determining the cucumber mosquito virus infection of pepper using the same.
When RT-PCR is performed using the primer set of the present invention, it is possible not only to determine whether the cucumber is infected with cucumber mosaic virus, but also to quickly and accurately determine the high and low pathogen types. Accordingly, it can greatly contribute to the early diagnosis of infection of highly pathogenic cucumber mosaic virus and to prevent the spread of damage, and is also expected to be of great help in developing resistant varieties against highly pathogenic cucumber mosaic virus.

Description

고추의 오이모자이크바이러스 감염 판별용 프라이머 세트{Primer set for determining cucumber mosaic virus infection of Capsicum annuum}Primer set for determining cucumber mosaic virus infection of Capsicum annuum

본 발명은 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트에 관한 것으로, 구체적으로 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하는 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트, 키트 및 이를 이용한 고추의 오이모자이크바이러스 감염 판별방법에 관한 것이다.The present invention relates to a set of primers for the determination of infection of red pepper cucumber mosaic virus, specifically, an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3 and a sequence It relates to a primer set, kit, and a method for discriminating cucumber mosquitovirus infection of peppers using the oligonucleotide primer represented by the number 4, and a kit for determining infection of cucumber mosquito virus infection of peppers.

오이모자이크바이러스(Cucumber mosaic virus; CMV)(이하, 'CMV'로 약기)는 1975년 고추에서 첫 발견된 이후 최근까지 고추의 재배에서 가장 고질적으로 문제를 일으키는 바이러스로, 주로 다른 바이러스와 복합감염이 되어 심한 병징을 유발시킨다.Cucumber mosaic virus (CMV) (hereinafter abbreviated as'CMV') is the most chronically troubled virus in pepper cultivation until it was first discovered in pepper in 1975. Causing severe illness.

다양한 연구를 통해 병 저항성 고추 품종이 육종되고 있으나, 기존의 CMV에 비해 고병원성 특성을 보이는 CMV들이 출현하여 고추 농가에 심각한 피해를 주고 있다. 기존의 CMV는 P0 타입으로 최근 이 계통인 CMV-Fny의 저항성 고추 재배지에서 이를 극복하는 고병원성 P1 타입의 CMV-CaP1 및 GTN 분리주가 발견되었다(Lee et al., 2006; Choi et al., 2015)(도 1 참조).Although disease-resistant pepper varieties have been bred through various studies, CMVs that show higher pathogenicity than conventional CMVs have appeared, which are seriously damaging pepper farms. The existing CMV is a P0 type, and recently, a highly pathogenic P1 type CMV-CaP1 and GTN isolate has been found that overcomes this strain in a CMV-Fny resistant pepper plantation (Lee et al., 2006; Choi et al., 2015). (See Figure 1).

이에 따라 기존 P0 타입의 CMV 감염과 P1 타입의 CMV 감염 여부를 신속하게 판별하여 고병원성 CMV 감염을 조기진단하고 피해 확산을 방지하는 것이 매우 중요해졌다.Accordingly, it has become very important to quickly determine whether a conventional P0 type CMV infection and a P1 type CMV infection are rapidly diagnosed with high pathogenic CMV infection and prevent damage spread.

전 세계적으로 CMV의 분리주는 염기서열에 따라 subgroup IA, IB 및 II로 구분된다(Palukaitis et al., 1992; Palukaitis and Garcia-Arenal, 2003). 국내 고추에서 저항성 평가를 위해 사용되는 CMV 분리주 중 P0 타입의 CMV-Fny는 Subgroup IA에 속하며 P1 타입의 CMV-CaP1 및 GTN의 경우 Subgroup IB에 속한다(도 2 참조). 하지만 이들 CMV 분리주들의 염기서열간 상동성이 약 92.8~96.3%로 매우 높기 때문에 기존의 CMV 특이적인 진단 프라이머를 이용하여 진단할 경우 단순 RT-PCR 진단만으로는 구분이 어려우며 추가적으로 RT-PCR 증폭산물의 염기서열 분석을 통해 병원형 구분을 해야 하는 번거로움이 있다.Globally, CMV isolates are divided into subgroups IA, IB and II according to their base sequence (Palukaitis et al., 1992; Palukaitis and Garcia-Arenal, 2003). Among the CMV isolates used for resistance evaluation in domestic pepper, P0 type CMV-Fny belongs to Subgroup IA and P1 type CMV-CaP1 and GTN belong to Subgroup IB (see FIG. 2). However, since the homology between the base sequences of these CMV isolates is very high, about 92.8~96.3%, it is difficult to distinguish only by simple RT-PCR diagnosis when using existing CMV-specific diagnostic primers, and additionally, the base of RT-PCR amplification products There is a hassle to distinguish the hospital type through sequencing.

이에 본 발명자들은 고추에서 고병원성의 CMV 감염 여부를 신속하고 정확하게 판별할 수 있는 방법을 개발하고자 하였다.Accordingly, the present inventors tried to develop a method for quickly and accurately discriminating whether or not highly pathogenic CMV is infected in red pepper.

Res in Plant Dis. 21(2): 99-102.Res in Plant Dis. 21(2): 99-102. Plant Pathol. J. 22(3): 265-270.Plant Pathol. J. 22(3): 265-270. Adv. Virus Res. 62: 214-323.Adv. Virus Res. 62: 214-323. Adv. Virus. Res. 41: 281-348.Adv. Virus. Res. 41: 281-348.

따라서 본 발명의 주된 목적은 고병원성의 CMV 감염 여부를 신속하고 정확하게 판별할 수 있는 방법을 제공하는데 있다.Therefore, the main object of the present invention is to provide a method for quickly and accurately discriminating whether or not highly pathogenic CMV infection.

본 발명의 다른 목적은 상기 방법에 필요한 프라이머 세트를 제공하는데 있다.Another object of the present invention is to provide a primer set required for the above method.

본 발명의 또 다른 목적은 상기 방법을 효율적으로 수행할 수 있는 키트를 제공하는데 있다.Another object of the present invention is to provide a kit capable of efficiently performing the above method.

본 발명의 한 양태에 따르면, 본 발명은 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하는 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트를 제공한다.According to one aspect of the present invention, the present invention is an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3 and an oligonucleotide primer represented by SEQ ID NO: 4 It provides a primer set for determining the cucumber mosaic virus infection of red pepper containing.

본 발명의 프라이머 세트에 있어서, 서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 포함하는 것이 바람직하다.In the primer set of the present invention, it is preferable to further include an oligonucleotide primer represented by SEQ ID NO: 5 and an oligonucleotide primer represented by SEQ ID NO: 6.

본 발명의 다른 양태에 따르면, 본 발명은 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하는 고추의 오이모자이크바이러스 감염 판별용 키트를 제공한다.According to another aspect of the invention, the present invention is an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3 and an oligonucleotide primer represented by SEQ ID NO: 4 It provides a kit for the determination of cucumber mosaic virus infection of pepper containing.

본 발명의 키트에 있어서, 서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 포함하는 것이 바람직하다.In the kit of the present invention, it is preferable to further include an oligonucleotide primer represented by SEQ ID NO: 5 and an oligonucleotide primer represented by SEQ ID NO: 6.

본 발명의 또 다른 양태에 따르면, 본 발명은 고추 시료로부터 RNA를 수득하는 단계; 상기 RNA를 주형으로 하고, 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머로 역전사중합효소연쇄반응을 수행하는 단계; 및 상기 역전사중합효소연쇄반응으로 생성되는 증폭산물을 검출하는 단계;를 포함하는 고추의 오이모자이크바이러스 감염 판별방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of obtaining RNA from a pepper sample; Using the RNA as a template, a reverse transcriptase with an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3 and an oligonucleotide primer represented by SEQ ID NO: 4 Performing a chain reaction; And detecting an amplification product generated by the reverse transcriptase chain reaction.

본 발명의 판별방법에 있어서, 서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 사용하여 역전사중합효소연쇄반응을 수행하는 것이 바람직하다.In the discrimination method of the present invention, it is preferable to perform a reverse transcriptase chain reaction by further using an oligonucleotide primer represented by SEQ ID NO: 5 and an oligonucleotide primer represented by SEQ ID NO: 6.

본 발명의 프라이머 세트를 사용하여 RT-PCR을 수행하면 고추의 오이모자이크바이러스 감염여부를 판별할 수 있을 뿐만 아니라 고병원형과 저병원형 또한 신속하고 정확하게 판별할 수 있다. 이에 따라 고병원성 오이모자이크바이러스의 감염을 조기진단하고 피해 확산을 방지하는데 크게 기여할 수 있으며, 또한 고병원성 오이모자이크바이러스에 대한 저항성 품종을 개발하는데에도 큰 도움이 될 것으로 기대된다.When RT-PCR is performed using the primer set of the present invention, it is possible not only to determine whether the cucumber is infected with cucumber mosaic virus, but also to quickly and accurately determine the high and low pathogen types. Accordingly, it can greatly contribute to the early diagnosis of infection of highly pathogenic cucumber mosaic virus and to prevent the spread of damage, and is also expected to be of great help in developing resistant varieties against highly pathogenic cucumber mosaic virus.

도 1은 고추(청양품종)에 P0 타입의 오이모자이크바이러스(이하, 'CMV'로 약기)(CMV-Fny) 또는 P1 타입의 CMV(CMV-CaP1 및 CMV-GTN)가 감염된 상태를 나타낸 것이다.
도 2는 CMV 분리주들 사이의 염기서열에 따른 계통분석도를 나타낸 것이다.
도 3은 타입별 CMV에 감염된 고추 시료를 대상으로 본 발명의 일실시예에 따른 프라이머 세트로 RT-PCR한 결과를 나타낸 것이다. A: 기존 CMV 진단 프라이머를 사용한 RT-PCR 결과, B: 본 발명의 CMVP0 프라이머(서열번호 1 및 서열번호 2)를 사용한 RT-PCR 결과, C: 본 발명의 CMVP1 프라이머(서열번호 3 및 서열번호 4)를 사용한 RT-PCR 결과, D: 본 발명의 CaEF1a 프라이머(서열번호 5 및 서열번호 6)를 사용한 RT-PCR 결과, Fny: CMV-Fny에 감염된 고추 시료, CaP1: CMV-CaP1에 감염된 고추 시료, GTN: CMV-GTN에 감염된 고추 시료, Hel: CMV에 감염되지 않은 정상 고추 시료.
도 4는 고추 재배 농가 및 시험포장에서 CMV 감염이 의심되는 고추 시료를 대상으로 본 발명의 일실시예에 따른 프라이머 세트로 RT-PCR한 결과를 나타낸 것이다. CMV-P0: 본 발명의 CMVP0 프라이머(서열번호 1 및 서열번호 2)를 사용한 RT-PCR 결과, CMV-P1: 본 발명의 CMVP1 프라이머(서열번호 3 및 서열번호 4)를 사용한 RT-PCR 결과, EF1a: 본 발명의 CaEF1a 프라이머(서열번호 5 및 서열번호 6)를 사용한 RT-PCR 결과, M: 분자마커, 1 ~ 9: 각 시료 번호.
FIG. 1 shows a state in which P0 type cucumber mosaic virus (hereinafter abbreviated as'CMV') (CMV-Fny) or P1 type CMV (CMV-CaP1 and CMV-GTN) is infected with red pepper (Chungyang variety).
Figure 2 shows the phylogenetic analysis according to the base sequence between CMV isolates.
Figure 3 shows the results of RT-PCR with a primer set according to an embodiment of the present invention targeting pepper samples infected with CMV by type. A: RT-PCR results using conventional CMV diagnostic primers, B: RT-PCR results using CMVP0 primers (SEQ ID NO: 1 and SEQ ID NO: 2) of the present invention, C: CMVP1 primers (SEQ ID NO: 3 and SEQ ID NO: SEQ ID NO: RT-PCR results using 4), D: RT-PCR results using the CaEF1a primers (SEQ ID NO: 5 and SEQ ID NO: 6) of the present invention, Fny: pepper samples infected with CMV-Fny, CaP1: peppers infected with CMV-CaP1 Sample, GTN: pepper sample infected with CMV-GTN, Hel: normal pepper sample not infected with CMV.
Figure 4 shows the results of RT-PCR with a primer set according to an embodiment of the present invention targeting pepper samples suspected of CMV infection in pepper cultivation farms and test packaging. CMV-P0: RT-PCR results using the CMVP0 primers (SEQ ID NO: 1 and SEQ ID NO: 2) of the present invention, CMV-P1: RT-PCR results using the CMVP1 primers (SEQ ID NO: 3 and SEQ ID NO: 4) of the present invention, EF1a: RT-PCR results using the CaEF1a primers of the present invention (SEQ ID NO: 5 and SEQ ID NO: 6), M: molecular marker, 1 to 9: each sample number.

본 발명의 프라이머 세트는 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머, 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하는 것을 특징으로 한다.The primer set of the present invention comprises an oligonucleotide primer represented by SEQ ID NO: 1, an oligonucleotide primer represented by SEQ ID NO: 2, an oligonucleotide primer represented by SEQ ID NO: 3, and an oligonucleotide primer represented by SEQ ID NO: 4 Is done.

상기 각 프라이머는 오이모자이크바이러스(이하, 'CMV'로 약기)의 cDNA로부터 특정 서열을 증폭할 수 있는 프라이머로, 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머와 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머는 하나의 세트로 작용하여 Fny strain(CMV-Fny)과 같은 P0 타입의 CMV의 cDNA로부터 PCR을 통해 778bp 크기의 증폭산물을 생성할 수 있으며, CaP1 strain(CMV-CaP1) 또는 GTN strain(CMV-GTN)과 같은 P1 타입의 CMV의 cDNA로부터는 증폭산물을 생성하지 않는다. 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머는 또 다른 하나의 세트로 작용하여 CaP1 strain 또는 GTN strain과 같은 P1 타입의 CMV의 cDNA로부터 PCR을 통해 1028bp 크기의 증폭산물을 생성할 수 있으며, Fny strain과 같은 P0 타입의 CMV의 cDNA로부터는 증폭산물을 생성하지 않는다. 또한 상기 프라이머들은 모두 고추의 cDNA로부터도 증폭산물을 생성하지 않는다.Each of the primers is a primer capable of amplifying a specific sequence from cDNA of the cucumber mosaic virus (hereinafter abbreviated as'CMV'), and one oligonucleotide primer represented by SEQ ID NO: 1 and an oligonucleotide primer represented by SEQ ID NO: 2 By acting as a set of Fny strain (CMV-Fny) can generate amplification products of size 778bp through PCR from cDNA of P0 type CMV, CaP1 strain (CMV-CaP1) or GTN strain (CMV-GTN) Amplification products are not produced from cDNA of P1 type CMV. The oligonucleotide primer represented by SEQ ID NO: 3 and the oligonucleotide primer represented by SEQ ID NO: 4 act as another set to amplify products of 1028 bp in size through PCR from cDNA of P1 type CMV such as CaP1 strain or GTN strain. It can generate, and does not generate amplification products from cDNA of P0 type CMV such as Fny strain. In addition, all of the primers do not produce amplification products even from cDNA of red pepper.

이러한 특이성으로 인해 상기 프라이머 세트를 사용하여 고추 시료를 대상으로 RT-PCR을 수행하면 증폭산물의 생성유무를 바탕으로 CMV의 감염여부를 판별할 수 있는 동시에 CMV의 병원성도 판별할 수 있는 것이다.Due to this specificity, when RT-PCR is performed on a red pepper sample using the primer set, it is possible to determine whether CMV is infected or not, and also to determine the pathogenicity of CMV, based on the presence or absence of amplification products.

본 발명의 프라이머 세트는 상기 프라이머 이외에 RT-PCR이 정상적으로 수행되었는지의 여부를 판별하기 위한 RT-PCR 검정용 프라이머를 더 포함하는 것이 바람직하다. 이 프라이머는 고추의 cDNA로부터 증폭산물을 생성할 수 있는 프라이머인 것이 바람직하며, 보다 바람직하게는 고추의 EF1α 유전자의 RNA에 대한 cDNA를 증폭할 수 있는 프라이머, 보다 바람직하게는 서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및 서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머인 것이 좋다.It is preferable that the primer set of the present invention further includes a primer for RT-PCR assay for determining whether RT-PCR is normally performed in addition to the primer. The primer is preferably a primer capable of generating an amplification product from cDNA of pepper, more preferably a primer capable of amplifying cDNA for RNA of the EF1α gene of pepper, more preferably represented by SEQ ID NO: 5 It is preferable that it is an oligonucleotide primer and an oligonucleotide primer represented by SEQ ID NO: 6.

본 발명의 프라이머 세트는 상기 프라이머 이외에 시료에 자주 포함되는 다른 유사 바이러스 혹은 미생물과의 감별을 위한 프라이머를 더 포함할 수 있다.The primer set of the present invention may further include primers for differentiation from other similar viruses or microorganisms that are frequently included in a sample in addition to the primers.

본 발명의 프라이머 세트에는 증폭산물 검출의 편의성을 높이기 위해, 검출용 표지를 추가 구성할 수 있다. 이때 검출용 표지는 올리고뉴클레오티드에 연결, 결합, 또는 부착시켜 통상적인 방식으로 증폭산물의 크기, 밀도, 농도, 양 등을 확인할 수 있는 화합물, 생체 분자 또는 생체 분자 유사체 등일 수 있으며, FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 및 NED 등이 사용될 수 있을 것으로 판단된다.In order to increase the convenience of detecting amplification products, the primer set of the present invention may further comprise a label for detection. In this case, the label for detection may be a compound, a biomolecule or a biomolecule analog, or the like, capable of confirming the size, density, concentration, amount, etc. of the amplified product in a conventional manner by linking, binding, or attaching to an oligonucleotide. It is believed that TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED can be used.

본 발명의 고추의 오이모자이크바이러스 감염 판별용 키트는 상기와 같은 프라이머를 포함하는 것을 특징으로 한다. 본 발명의 키트에는 이들 프라이머 이외에 RT-PCR을 위한 역전사효소(reverse transcriptase), cDNA 합성용 프라이머, DNA중합효소(DNA polymerase), dNTP 혼합물(dATP, dCTP, dGTP, dTTP) 또는 반응완충용액이 포함될 수 있으며, 이외에도 RT-PCR을 수행하는데 부수적으로 필요한 도구나 시약 등이 더 포함될 수 있다. 또한, 증폭산물의 검출 편의성을 높이기 위해, 검출용 표지 화합물이 더 함유될 수 있다. 이때 검출용 표지 화합물은 증폭과정에서 증폭산물에 포함되거나 증폭산물에 물리적으로 삽입되어 통상적인 방식으로 증폭산물의 크기, 밀도, 농도, 양 등을 확인할 수 있는 화합물을 사용할 수 있다.The kit for discriminating cucumber mosquitovirus infection of red pepper of the present invention is characterized by including the above primers. In addition to these primers, the kit of the present invention includes a reverse transcriptase for RT-PCR, a primer for synthesizing cDNA, a DNA polymerase, a dNTP mixture (dATP, dCTP, dGTP, dTTP) or a reaction buffer solution. In addition, additional tools or reagents necessary for performing RT-PCR may be further included. In addition, in order to increase the detection convenience of the amplification product, a labeling compound for detection may be further contained. At this time, the labeling compound for detection may be used as a compound that can be included in the amplification product during the amplification process or physically inserted into the amplification product to confirm the size, density, concentration, amount, etc. of the amplification product in a conventional manner.

본 발명의 고추의 오이모자이크바이러스 감염 판별방법은 고추 시료로부터 RNA를 수득하는 단계; 상기 RNA를 주형으로 하고, 상기와 같은 프라이머로 RT-PCR을 수행하는 단계; 및 상기 RT-PCR로 생성되는 증폭산물을 검출하는 단계;를 포함하는 것을 특징으로 한다.Method for determining the cucumber mosaic virus infection of the pepper of the present invention comprises the steps of obtaining RNA from the pepper sample; Using the RNA as a template, and performing RT-PCR with the primers described above; And detecting the amplification product generated by the RT-PCR.

이때 시료는 판별대상 식물로부터 유래된 세포, 조직 등일 수 있으며, 식물체에서 RNA를 분리하는데 사용되는 통상의 방법을 통해 상기 시료로부터 RNA를 수득할 수 있다.At this time, the sample may be cells, tissues, etc. derived from plants to be discriminated, and RNA may be obtained from the sample through a conventional method used to isolate RNA from plants.

상기 RT-PCR은 역전사효소 및 DNA 중합효소를 사용하는 통상적인 RT-PCR 방법을 이용할 수 있으며, 여기에 시료로부터 분리된 RNA와 상기 본 발명의 프라이머를 적용하는 방법으로 수행할 수 있다.The RT-PCR can use a conventional RT-PCR method using reverse transcriptase and DNA polymerase, and can be performed by applying RNA isolated from a sample to the primer of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것이므로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.Hereinafter, the present invention will be described in more detail through examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

[실시예][Example]

1. 프라이머1. Primer

다음 표 1과 같이, P0 타입의 오이모자이크바이러스를 표적으로 하는 정방향 및 역방향 프라이머(CMVP0-F 및 CMVP0-R), P1 타입의 오이모자이크바이러스를 표적으로 하는 정방향 및 역방향 프라이머(CMVP1-F 및 CMVP1-R) 및 고추의 EF1α를 표적으로 하는 정방향 및 역방향 프라이머(CaEF1a-F 및 CaEF1a-R)를 제작하였다.As shown in Table 1, forward and reverse primers (CMVP0-F and CMVP0-R) targeting the P0 type cucumber mosaic virus and forward and reverse primers (CMVP1-F and CMVP1 targeting the P1 type cucumber mosaic virus). -R) and forward and reverse primers (CaEF1a-F and CaEF1a-R) targeting EF1α of pepper were prepared.

프라이머명Primer name 표적Target 프라이머 서열(5’ → 3’)Primer sequence (5' → 3') 증폭크기(bp)Amplification size (bp) CMVP0-FCMVP0-F CMV-P0CMV-P0 GAGTGAACGCTGTAGACCTGGGGAGTGAACGCTGTAGACCTGGG 778778 CMVP0-RCMVP0-R TGGTCTCCTTTTGGAGGCCCCCACGAAAGTGTGGTCTCCTTTTGGAGGCCCCCACGAAAGTG CMVP1-FCMVP1-F CMV-P1CMV-P1 TCGTCTACTAGATCAAGGAGTGTCGTCTACTAGATCAAGGAGTG 10281028 CMVP1-RCMVP1-R TGGTCTCCTTTTGGAGACCCCATTTGGTCTCCTTTTGGAGACCCCATT CaEF1a-FCaEF1a-F EF1αEF1α TCCTGGACAGATTGGAAATGGTCCTGGACAGATTGGAAATGG 232232 CaEF1a-RCaEF1a-R CACAGCAAAACGACCCAATGCACAGCAAAACGACCCAATG

2. RT-PCR2. RT-PCR

P0 타입의 오이모자이크바이러스(CMV-Fny) 및/또는 P1 타입의 오이모자이크바이러스(CMV-CaP1 또는 CMV-GTN)가 감염되었거나 또는 감염되지 않은 고추(청양품종의 고추, Capsicum annuum cv. 'Chung-Yang')의 잎을 시료로 이용하였다.P0 type cucumber mosaic virus (CMV-Fny) and/or P1 type cucumber mosaic virus (CMV-CaP1 or CMV-GTN) infected or uninfected peppers (Chepyang pepper, Capsicum annuum cv.'Chung- Yang') leaves were used as samples.

Plant RNeasy mini kit(Quiagen, Germany)를 사용하여 각 고추 잎 시료 100㎎으로부터 총 RNA를 추출하고, Maxime RT-PCR premix kit(iNtron, Korea)를 이용하여 RT-PCR을 수행하였다.Total RNA was extracted from 100 mg of each pepper leaf sample using a Plant RNeasy mini kit (Quiagen, Germany), and RT-PCR was performed using a Maxime RT-PCR premix kit (iNtron, Korea).

RT-PCR의 구체적인 조건은 다음 표 2에 따랐다.The specific conditions of RT-PCR were in accordance with Table 2 below.

PCR 조성물PCR composition 최종농도Final concentration RT-PCR 조건RT-PCR conditions 반복횟수Repeat count 주형 RNATemplate RNA 100ng100ng 45℃ 30분
94℃ 5분
45 30 minutes
94 5 minutes
1One
정방향 프라이머Forward primer 0.4μM0.4μM 94℃ 30초
55℃ 30초
72℃ 60초
94℃ 30 seconds
55℃ 30 seconds
72℃ 60 seconds
3535
역방향 프라이머Reverse primer 0.4μM0.4μM 멸균 3차 증류수Sterilized tertiary distilled water 총 20㎕가 되도록 첨가Totally added to 20 µl gun 20㎕20 μl 72℃ 5분72 5 minutes 1One

상기 표 1의 프라이머와 비교를 위한 기존 CMV 진단 프라이머(표 3 참조)를 사용하여 RT-PCR을 수행한 결과, CMV-P0 프라이머를 사용한 경우 P0 타입의 CMV에 감염된 이병 식물체에서만 778bp 크기의 특이적 증폭산물이 나타난 반면 다른 병원형의 CMV에 감염된 식물체에서는 증폭산물이 나타나지 않았고(도 3의 B 참조), CMV-P1 프라이머를 사용한 경우 P1 타입의 CMV에 감염된 이병 식물체에서만 1,028bp 크기의 특이적 증폭산물이 나타난 반면 다른 병원형의 CMV에 감염된 식물체에서는 증폭산물이 나타나지 않았다(도 3의 C 참조). CMV에 감염되지 않은 건강한 식물체에서는 CMV-P0 프라이머 및 CMV-P1 프라이머를 사용하여 RT-PCR을 수행하였을 때 어떠한 특이적 증폭산물도 검출되지 않았으며(도 3의 B 및 C 참조), CaEF1a 프라이머를 사용하였을 때에는 모두 232bp 크기의 증폭산물이 확인되어 비특이적인 반응없이 정상적인 RT-PCR이 이루어진 것으로 확인되었다(도 3의 D 참조). 반면, CMVCP 프라이머를 사용하여 RT-PCR을 수행하였을 때에는 P0 타입의 CMV에 감염된 식물체와 P1 타입의 CMV에 감염된 식물체에서 모두 657bp 크기의 증폭산물이 나타났다(도 3의 A 참조).As a result of performing RT-PCR using the existing CMV diagnostic primers for comparison with the primers in Table 1 (see Table 3), when using the CMV-P0 primers, the specific size of 778 bp only in diseased plants infected with P0 type CMV While amplification products appeared, amplification products did not appear in plants infected with CMV of other hospital types (see FIG. 3B ), and when CMV-P1 primers were used, specific amplification of 1,028 bp in size only in diseased plants infected with P1 type CMV While the product appeared, no amplified product appeared in plants infected with other pathogenic CMV (see FIG. 3C ). In a healthy plant not infected with CMV, no specific amplification products were detected when RT-PCR was performed using the CMV-P0 primer and CMV-P1 primer (see B and C in FIG. 3), and the CaEF1a primer was used. When used, all of the amplification products of 232 bp in size were confirmed, and it was confirmed that normal RT-PCR was achieved without a non-specific reaction (see D in FIG. 3). On the other hand, when RT-PCR was performed using the CMVCP primer, amplification products with a size of 657 bp appeared in plants infected with P0 type CMV and plants infected with P1 type CMV (see FIG. 3A ).

프라이머명Primer name 프라이머 서열(5' → 3')Primer sequence (5' → 3') 증폭크기(bp)Amplification size (bp) CMVCP-FCMVCP-F ATGGACAAATCTGAATCAACCAGATGGACAAATCTGAATCAACCAG 657657 CMVCP-RCMVCP-R TCAGACTGGGAGCACTCCAGACTCAGACTGGGAGCACTCCAGAC

이러한 결과는 기존의 프라이머를 사용한 RT-PCR은 CMV의 감염은 판별할 수 있으나, P0 타입과 P1 타입의 CMV 감염을 구분할 수 없는 반면, 본 발명의 프라이머를 사용한 RT-PCR은 CMV의 감염을 판별할 수 있음은 물론 P0 타입과 P1 타입의 CMV 감염을 정확하게 구분할 수 있다는 것을 의미한다.As a result of this, RT-PCR using a conventional primer can discriminate infection of CMV, but cannot distinguish between P0 type and P1 type CMV infection, whereas RT-PCR using the primer of the present invention determines infection of CMV. Not only does it mean that it can accurately distinguish between P0 type and P1 type CMV infection.

3. 효율성 검정3. Efficiency test

본 발명 프라이머 세트의 효율성을 검정하기 위하여, 전북지역의 고추 재배 농가 및 국립원예특작과학원 시험포장에서 바이러스 감염 증상을 보이는 고추 시료들을 채집하여 상기 표 1의 프라이머 세트를 사용하여 RT-PCR을 수행하였다.To test the efficiency of the primer set of the present invention, pepper samples showing virus infection symptoms were collected from the pepper cultivation farms in the Jeollabuk-do region and the National Horticultural Science Research Center, and RT-PCR was performed using the primer set of Table 1 above. .

총 9개의 고추 시료(청양, 수퍼마니따, PR스마트 등의 품종)를 대상으로 RT-PCR을 수행한 결과, 총 6개의 시료가 CMV에 감염된 것으로 판별되었고, 그중 3개의 시료는 P0 타입의 CMV, 2개의 시료는 P1 타입의 CMV, 1개의 시료(8번 시료)는 P0 타입의 CMV 및 P1 타입의 CMV에 감염(복합감염)된 것으로 판별되었다(표 4 및 도 4 참조). 또한 각 고추 시료를 대상으로 기존의 CMV 감염 판별방법에 따라 RT-PCR 및 증폭산물의 서열분석을 실시한 결과, 상기 판별과 같은 결과가 도출되었다.As a result of performing RT-PCR on a total of 9 pepper samples (Chungyang, Supermanita, PR Smart, etc.), a total of 6 samples were determined to be infected with CMV, and 3 of them were P0 type CMV , It was determined that two samples were infected (complex infection) with P1 type CMV, and one sample (No. 8 sample) with P0 type CMV and P1 type CMV (see Table 4 and FIG. 4). In addition, as a result of sequencing RT-PCR and amplified products according to the conventional CMV infection discrimination method for each pepper sample, the same results as the discrimination were derived.

이러한 결과는 본 발명의 프라이머 세트가 실제 농가에서 재배되고 있는 고추의 CMV 감염 여부를 P0 타입 및 P1 타입을 구분하여 정확하게 판별할 수 있어, 효율성이 우수하다는 것을 의미한다.These results indicate that the primer set of the present invention can accurately discriminate whether or not CMV infection of peppers grown in a real farmhouse by classifying the P0 type and the P1 type, and thus the efficiency is excellent.

1One 22 33 44 55 66 77 88 99 CMV-P0CMV-P0 -- -- ++ -- -- ++ -- ++ ++ CMV-P1CMV-P1 -- -- -- ++ ++ -- -- ++ -- 결과result 음성voice 음성voice P0P0 P1P1 P1P1 P0P0 음성voice P0+P1P0+P1 P0P0

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for determining cucumber mosaic virus infection of Capsicum annuum <130> PA-D18023 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CMV-P0 <400> 1 gagtgaacgc tgtagacctg gg 22 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CMV-P0 <400> 2 tggtctcctt ttggaggccc ccacgaaagt g 31 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CMV-P1 <400> 3 tcgtctacta gatcaaggag tg 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CMV-P1 <400> 4 tggtctcctt ttggagaccc catt 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for EF1a <400> 5 tcctggacag attggaaatg g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for EF1a <400> 6 cacagcaaaa cgacccaatg 20 <110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for determining cucumber mosaic virus infection of Capsicum annuum <130> PA-D18023 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CMV-P0 <400> 1 gagtgaacgc tgtagacctg gg 22 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CMV-P0 <400> 2 tggtctcctt ttggaggccc ccacgaaagt g 31 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CMV-P1 <400> 3 tcgtctacta gatcaaggag tg 22 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CMV-P1 <400> 4 tggtctcctt ttggagaccc catt 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for EF1a <400> 5 tcctggacag attggaaatg g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for EF1a <400> 6 cacagcaaaa cgacccaatg 20

Claims (6)

고추의 오이모자이크바이러스(CMV) 감염 판별용 프라이머 세트에 있어서,
서열번호 1로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 2로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하고,
상기 판별은 P0 타입 CMV 및 P1 타입 CMV의 판별이고,
상기 P0 타입 CMV는 Fny strain에 의해 발생하는 것이고,
상기 P1 타입 CMV는 CaP1 strain 또는 GTN strain에 의해 발생하는 것이고,
상기 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머는 P0 타입 CMV에 특이적으로 778bp 크기의 증폭산물을 생성하고,
상기 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머는 P1 타입 CMV에 특이적으로 1028bp 크기의 증폭산물을 생성하는 것인
고추의 오이모자이크바이러스 감염 판별용 프라이머 세트.
In the primer set for determining the cucumber mosaic virus (CMV) infection of pepper,
Oligonucleotide primer represented by SEQ ID NO: 1,
Oligonucleotide primer represented by SEQ ID NO: 2,
Oligonucleotide primer represented by SEQ ID NO: 3 and
It comprises an oligonucleotide primer represented by SEQ ID NO: 4,
The discrimination is the discrimination of P0 type CMV and P1 type CMV,
The P0 type CMV is generated by Fny strain,
The P1 type CMV is caused by CaP1 strain or GTN strain,
The oligonucleotide primer represented by SEQ ID NO: 1 and the oligonucleotide primer represented by SEQ ID NO: 2 generate an amplification product having a size of 778 bp specifically for P0 type CMV,
The oligonucleotide primer represented by SEQ ID NO: 3 and the oligonucleotide primer represented by SEQ ID NO: 4 specifically generate amplification products having a size of 1028 bp for P1 type CMV.
A set of primers for determining the pepper's cucumber mosaic virus infection.
제 1항에 있어서,
서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 포함하는 것을 특징으로 하는 고추의 오이모자이크바이러스 감염 판별용 프라이머 세트.
According to claim 1,
Oligonucleotide primer represented by SEQ ID NO: 5 and
Primer set for determining the cucumber mosquito virus infection of red pepper, characterized in that it further comprises an oligonucleotide primer represented by SEQ ID NO: 6.
고추의 오이모자이크바이러스(CMV) 감염 판별용 키트에 있어서,
서열번호 1로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 2로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 4로 표시되는 올리고뉴클레오티드 프라이머를 포함하고,
상기 판별은 P0 타입 CMV 및 P1 타입 CMV의 판별이고,
상기 P0 타입 CMV는 Fny strain에 의해 발생하는 것이고,
상기 P1 타입 CMV는 CaP1 strain 또는 GTN strain에 의해 발생하는 것 이고,
상기 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머는 P0 타입 CMV에 특이적으로 778bp 크기의 증폭산물을 생성하고,
상기 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머는 P1 타입 CMV에 특이적으로 1028bp 크기의 증폭산물을 생성하는 것인
고추의 오이모자이크바이러스 감염 판별용 키트.
In the kit for determining the cucumber mosaic virus (CMV) infection of pepper,
Oligonucleotide primer represented by SEQ ID NO: 1,
Oligonucleotide primer represented by SEQ ID NO: 2,
Oligonucleotide primer represented by SEQ ID NO: 3 and
It comprises an oligonucleotide primer represented by SEQ ID NO: 4,
The discrimination is the discrimination of P0 type CMV and P1 type CMV,
The P0 type CMV is generated by Fny strain,
The P1 type CMV is caused by CaP1 strain or GTN strain,
The oligonucleotide primer represented by SEQ ID NO: 1 and the oligonucleotide primer represented by SEQ ID NO: 2 generate an amplification product having a size of 778 bp specifically for P0 type CMV,
The oligonucleotide primer represented by SEQ ID NO: 3 and the oligonucleotide primer represented by SEQ ID NO: 4 specifically generate amplification products having a size of 1028 bp for P1 type CMV.
A kit for determining the infection of peppers with cucumber mosaic virus.
제 3항에 있어서,
서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 포함하는 것을 특징으로 하는 고추의 오이모자이크바이러스 감염 판별용 키트.
According to claim 3,
Oligonucleotide primer represented by SEQ ID NO: 5 and
A kit for discriminating cucumber mosquitovirus infection of red pepper, further comprising an oligonucleotide primer represented by SEQ ID NO: 6.
고추의 오이모자이크바이러스(CMV) 감염 판별방법에 있어서,
고추 시료로부터 RNA를 수득하는 단계;
상기 RNA를 주형으로 하고,
서열번호 1로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 2로 표시되는 올리고뉴클레오티드 프라이머,
서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 4로 표시되는 올리고뉴클레오티드 프라이머로 역전사중합효소연쇄반응을 수행하는 단계; 및
상기 역전사중합효소연쇄반응으로 생성되는 증폭산물을 검출하는 단계;를 포함하고,
상기 판별은 P0 타입 CMV 및 P1 타입 CMV의 판별이고,
상기 P0 타입 CMV는 Fny strain에 의해 발생하는 것이고,
상기 P1 타입 CMV는 CaP1 strain 또는 GTN strain에 의해 발생하는 것이고,
상기 서열번호 1로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 2로 표시되는 올리고뉴클레오티드 프라이머는 P0 타입 CMV에 특이적으로 778bp 크기의 증폭산물을 생성하고,
상기 서열번호 3으로 표시되는 올리고뉴클레오티드 프라이머 및 상기 서열번호 4로 표시되는 올리고뉴클레오티드 프라이머는 P1 타입 CMV에 특이적으로 1028bp 크기의 증폭산물을 생성하는 것인
고추의 오이모자이크바이러스 감염 판별방법.
In the method for determining the cucumber mosaic virus (CMV) infection of pepper,
Obtaining RNA from the pepper sample;
The RNA as a template,
Oligonucleotide primer represented by SEQ ID NO: 1,
Oligonucleotide primer represented by SEQ ID NO: 2,
Oligonucleotide primer represented by SEQ ID NO: 3 and
Performing a reverse transcriptase chain reaction with an oligonucleotide primer represented by SEQ ID NO: 4; And
Including the step of detecting the amplification product generated by the reverse transcriptase chain reaction;
The discrimination is the discrimination of P0 type CMV and P1 type CMV,
The P0 type CMV is generated by Fny strain,
The P1 type CMV is caused by CaP1 strain or GTN strain,
The oligonucleotide primer represented by SEQ ID NO: 1 and the oligonucleotide primer represented by SEQ ID NO: 2 generate an amplification product having a size of 778 bp specifically for P0 type CMV,
The oligonucleotide primer represented by SEQ ID NO: 3 and the oligonucleotide primer represented by SEQ ID NO: 4 specifically generate amplification products having a size of 1028 bp for P1 type CMV.
Method for determining the cucumber mosaic virus infection of red pepper.
제 5항에 있어서,
서열번호 5로 표시되는 올리고뉴클레오티드 프라이머 및
서열번호 6으로 표시되는 올리고뉴클레오티드 프라이머를 더 사용하여 역전사중합효소연쇄반응을 수행하는 것을 특징으로 하는 고추의 오이모자이크바이러스 감염 판별방법.
The method of claim 5,
Oligonucleotide primer represented by SEQ ID NO: 5 and
A method of discriminating a cucumber mosaic virus infection of red pepper, characterized in that a reverse transcriptase chain reaction is further performed using the oligonucleotide primer represented by SEQ ID NO: 6.
KR1020180044399A 2018-04-17 2018-04-17 Primer set for determining cucumber mosaic virus infection of Capsicum annuum KR102121954B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180044399A KR102121954B1 (en) 2018-04-17 2018-04-17 Primer set for determining cucumber mosaic virus infection of Capsicum annuum

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180044399A KR102121954B1 (en) 2018-04-17 2018-04-17 Primer set for determining cucumber mosaic virus infection of Capsicum annuum

Publications (2)

Publication Number Publication Date
KR20190120978A KR20190120978A (en) 2019-10-25
KR102121954B1 true KR102121954B1 (en) 2020-06-11

Family

ID=68420573

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180044399A KR102121954B1 (en) 2018-04-17 2018-04-17 Primer set for determining cucumber mosaic virus infection of Capsicum annuum

Country Status (1)

Country Link
KR (1) KR102121954B1 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140086234A (en) * 2012-12-28 2014-07-08 성균관대학교산학협력단 Primer composition for loop-mediated isothermal amplification reaction for detecting Cucumber Mosaic Virus, and use thereof

Also Published As

Publication number Publication date
KR20190120978A (en) 2019-10-25

Similar Documents

Publication Publication Date Title
van Dam et al. Use of comparative genomics-based markers for discrimination of host specificity in Fusarium oxysporum
Lievens et al. Recent developments in the molecular discrimination of formae speciales of Fusarium oxysporum
CN1079114C (en) Nucleic acid markers for rice blast resistance genes and rice blast resistance genes isolated by the use of these markers
Pérez‐Sierra et al. High vegetative compatibility diversity of Cryphonectria parasitica infecting sweet chestnut (Castanea sativa) in Britain indicates multiple pathogen introductions
Ioos et al. Multiplex real‐time PCR assays for the detection and identification of Heterobasidion species attacking conifers in Europe
Schoebel et al. Development of new polymorphic microsatellite markers for three closely related plant-pathogenic Phytophthora species using 454-pyrosequencing and their potential applications
Martin et al. Evaluation of molecular markers for Phytophthora ramorum detection and identification: testing for specificity using a standardized library of isolates
KR102121954B1 (en) Primer set for determining cucumber mosaic virus infection of Capsicum annuum
KR101166781B1 (en) Specific primer for strain discrimination of Pleurotus spp. by analysis of mitochondria DNA polymorphism and uses thereof
KR102175124B1 (en) Primers for multiple detection of the virus in Cucurbitaceae and detection method by using the same
Gailīte et al. Genetic diversity analysis of Latvian and Estonian Saussurea esthonica populations
KR102226176B1 (en) Primer Set for Simultaneous detection of Three Kinds of Yam Viruses and Detecting Method Using The Same
KR20200043345A (en) Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof
KR101137799B1 (en) Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses thereof
KR102304789B1 (en) PCR primer set for environmental DNA detection of Culter brevicauda and method using the same
KR101750837B1 (en) Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same
KR101651815B1 (en) Primer set for diagnosing White clover mosaic virus and uses thereof
KR102248546B1 (en) Primer set for simultaneous diagnosis of tomato spotted wilt virus, chrysanthemum stem necrosis virus, and Verticillium dahlia, and diagnostic method using the same
KR101137803B1 (en) Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof
KR102487657B1 (en) Primer set for detecting Mythimna loreyi and detection method using the same
KR102667128B1 (en) Primer sets for diagnosing of novel garlic virus and diagnostic methods using thereof
KR101834923B1 (en) Marker composition for discriminating of species of Colletotrichum spp. and uses thereof
CN107881221B (en) Molecular identification method for partial cryptosporidium species based on Lectin gene
KR20240086950A (en) Primer sets for detecting Begomovirus and use thereof
KR101931612B1 (en) Marker and kit for genetic diversity of Cylindrocarpon destructans

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
X701 Decision to grant (after re-examination)