KR101137799B1 - Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses thereof - Google Patents

Abstract

The present invention relates to a specific primer set for determining a number of strains of the Pleurotus cultivar and its use, and more particularly, a primer for determining the number of strains of the Pleurotus cultivars consisting of oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 A set, a kit for determining a number of strains of Pleurotus varieties comprising the primer set, and a method for determining the number of strains of Pleurotus varieties using the primer set. Primer set of the present invention and its use is a technology that can test the uniqueness of the variety itself without being influenced by the environment, it is highly applicable to be able to supplement the phenotypic characteristics when distinguishing varieties.

Description

Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses approximately}

The present invention relates to a sequence characterized amplified region (SCAR) primer set and its use for determining a number of strains of oyster mushroom varieties, and more specifically, to the oyster mushroom consisting of oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 SCAR primer set for determining the 'hanhan' strain, a kit for determining the 'hanhan' strain of the oyster mushroom including the primer set, and a method for determining the oyster mushroom 'suhan' strain using the primer set.

RAPD (Ramdom Amplified Polymorphic DNA) method of DNA polymorphism analysis has been most commonly used because it is easy and simple to analyze, but it is difficult to expect accurate experimental results because results may vary depending on reaction conditions (Cutler et. al . 2006 Scientia horticulturae 107: 264-270). Therefore, as a solution to this problem, SCAR markers were developed to clone specific bands generated from the results of RAPD analysis and to generate new sequenced characterized amplified region (SCAR) primers to amplify specific DNA fragments reproducibly through cloning and sequencing. It became.

The conversion of RAPD markers to SCAR markers was first developed as a downy mildew resistant marker in lettuce (Paran et. al . 1993 Theor Appl Genet 85: 985 ~ 993), Bang et al. (2004 Korean J Medicinal Crop Sci 12: 53 ~ 59) used to determine the medicinal herbs for distribution by using to determine the plant origin of baekchul. Koveza and Gostimsky (2005 Russian J of Genetics 41: 1254-1261) also developed SCAR markers to identify various pea varieties and varieties, and Lee et al. (2006 Biol Pharm Bull 29: 629-633) from other homologous plants. Specific markers have been developed to selectively differentiate Artemisia Herbs.

Lee et al. (2004 Theor Appl Genet 108: 1487 ~ 1491) use the 18S rDNA, RAPD, SCAR markers ( Pyrus pyrifolia ) and pear ( P. communis ) has been studied to identify the varieties, and these markers are reported to be effective in distinguishing Pyrus species. Hongyan et al. (2008 World J Microbiol Biotechnol 24: 1223 ~ 1226) are also medicinal mushrooms ( Ganoderma lucidum ) was developed by converting a lineage-specific SCAR marker that can be clearly distinguished into an ISSR marker. SCAR markers have also been used efficiently in areas such as disease-resistant genes and temperature-sensitive genes (Dedryver et. al . 1996 Genome 39: 830-835; Lang et al . 1999 Heredity 131: 121-127).

Although RAPD has limitations in practical use due to the nature of dominant gene expression and the sensitivity of experiments, the conversion of dominant RAPD markers to co-dominant SCAR markers is useful for analysis of F ₂ populations, which is useful for mapping genes. (Paran and Michelmore, 1993 Theor Appl Genet 85: 985-993). That is, SCAR analyzes the nucleotide sequences of selected RAPD bands to improve the instability of RAPD markers, prepares primers from the nucleotide sequence information of species and intraspecific species, and then performs PCR at high annealing temperature. As a method of selecting a factor, it appears as a single band and can be converted into a co-dominant marker by changing the primer design, which is advantageous for genetic analysis and has the advantage of analysis of heterozygotes (Negi et. al . 2000 Theor Appl Genet 101: 146-152).

Since 2000, oyster mushroom has been designated as a crop protection target, but as of 2009, 121 varieties were reported to be produced and imported by the National Species Resource. It becomes the circulation only by sending it. These varieties do not have basic data on the development process, so the distinction of varieties is ambiguous. In the current system of registration of varieties and registration of import and export reports, the varieties popular with consumers can be reproduced and distributed under different names. However, it is difficult to distinguish the breed from the shape of the fruiting body.

Pleurotus cultivated in Korea uses spawn as the name of production and sale declaration, and because the identity and characteristics of the variety are not known clearly, it causes confusion among farmers. It is pointed out as a problem. In addition, the domestic breeding conditions or the operation of the Seed Industry Act have similar parts of distribution varieties, and the distribution system order is confused.

The present invention is not affected by the environment in order to determine the number of strains of Pleurotus cultivar, develop a technology that can test the uniqueness of the variety itself can solve the complaints to check the number of strains of distribution varieties, phenotypic We will develop molecular markers that can supplement the characteristics.

In order to solve the above problems, the present invention provides a set of SCAR primers for determining the Pleurotus erythematosus strains, including the oligonucleotide primers of SEQ ID NO: 1 and 2.

In another aspect, the present invention provides a kit for determining the Pleurotus erythematosus strain containing the primer set.

In addition, the present invention provides a method for determining the 'severe' strains of Pleurotus eryngii containing the primer set.

According to the present invention, the present invention is a DNA polymorphism assay method for determining a number of strains of oyster mushroom varieties, which is not affected by the environment, and can be used to test the uniqueness of the varieties themselves. It can be said that it can be supplemented and its utilization is high.

Since DNA is not influenced by the cultivation environment, developmental stage, or tissue, varieties using molecular biological markers can maintain objectivity and provide high reliability. In addition, the analysis based on such molecular biology methods can be used not only for direct breeding and discrimination, but also for examining the degree and relationship between species and intra-species variation, and also for basic research on genetic breeding.

1 shows PCR condition assays for S-Op-1 markers on 1.5% agarose gel. N: No amplification product.
Figure 2 shows the SCAR-PCR product of Pleurotus species DNA amplified using S-Op-1 primers.
3 shows SCAR markers for a number of similar lines amplified with S-Op-1 (forward) and S-Op-1 (reverse) primers. 590 bp fragments were amplified in several similar lines. M: 1 kb plus DNA ladder (TaKaRa); I, Weonhyeong-like strains; II, Wangheukpyeong-like line; III, several similar strains; IV, Chunchu-2 pseudo lineage.

In order to achieve the object of the present invention, the present invention provides at least 15 oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. Provided is a Sequence Characterized Amplified Region (SCAR) primer set for determining a Pleurotus erythematosus strain comprising one or more oligonucleotides selected from the group consisting of oligonucleotides consisting of segments of consecutive nucleotides.

The oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO: 1. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO: 2.

The oligonucleotide primer set according to one embodiment of the present invention is an oligonucleotide primer set for determining the Pleurotus erythematosus, which includes the oligonucleotide primer sets of SEQ ID NOs: 1 and 2.

The primer set of the present invention is used as a marker for determining the Pleurotus erythematosus strain. To develop the marker, RAPD analysis was first performed on 81 cultivars including 8 Pleurotus species, to find a band of about 600 bp specific to a variety of strains, and cloned the specific band. ) And sequencing. Based on the nucleotide sequence information, 10 to 12 bp of base was added to the RAPD random primer sequence to prepare SCAR primers, using the prepared SCAR primers. PCR was carried out on the spring and -2 strains, and a primer set of SEQ ID NOs: 1 and 2 showing specific bands in several similar strains was selected.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primers will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

Oligonucleotide primer sets according to the present invention; And a kit for determining the Pleurotus erythematosus strain, including a reagent for performing an amplification reaction. In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers and the like. In addition, the kit of the present invention may further include a user manual describing the conditions for performing the optimal reaction.

In order to achieve another object of the present invention, the present invention

Separating genomic DNA from oyster mushrooms;

Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using an oligonucleotide primer set according to the present invention; And

Provided is a method for determining a number of Pleurotus eryngii, including detecting the amplification product.

The method of the present invention comprises the step of separating genomic DNA from the oyster mushroom sample. As a method for separating genomic DNA from the sample, a method known in the art may be used. For example, the CTAB method may be used, or a wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using an oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, annealing (annealing) the primer of the amplification reaction is carried out at 60 ℃ ~ 68 ℃ for 25 seconds to 35 seconds, preferably at 65 ℃ 30 seconds. The cycle of the amplification reaction may be performed 28 to 33 times, preferably 30 times.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example 1. SCAR Primer Preparation

As a result of PCR using RAPD primers, specific bands of several lineage varieties were found around 600 bp, and cloning and sequencing were performed on the specific bands. Based on the base sequence information, a base of 10 to 12 bp was added to a base including a random primer sequence to prepare a SCAR primer (S-Op-1, 22 mer forward and 20 mer reverse).

SCAR primers used for the analysis of Pleurotus erythema SCAR primer

3')Nucleotide Sequence (5 '

3 ') SEQ ID NO: GC (%) T _m (℃) S-Op-1 (Forward direction) CAGCACCCACATAGAAACAATC One 45.45 59.50 S-Op-1 (Reverse) TACGCTGCCGGGTTAGTATC 2 55.00 54.10

Example 2. PCR Amplification of S-Op-1 Markers

PCR amplification of the S-Op-1 marker was performed using ABI PCR SYSTEM 9700. For the first time DNA denaturation was performed once at 94 ° C for 5 minutes, denaturation at 94 ° C for 1 minute, annealing at 65 ° C for 30 seconds, and extension at 72 ° C for 2 minutes. When the best band was formed, the above conditions were presented as a discrimination condition of several lineage varieties (FIG. 1). Since the PCR conditions may not meet the non-specific band, the experiment was carried out by increasing the annealing temperature, and because the binding site of the primer acts only on several strains, no band appeared in other strains.

Example 3. Specific Detection of Several Lineages Using the Primer Set of the Present Invention

When PCR was carried out using S-Op-1 primers on 81 cultivars including 8 Pleurotus cultivars, all of the varieties identified as susceptible strains showed the same bands, and a single band appeared at 590 bp. It was easy to distinguish, and unlike the use of random primers, the band was highly reproducible and thick and clear bands were seen (FIGS. 2 and 3).

Attach an electronic file to a sequence list

Claims (7)

A set of Sequence Characterized Amplified Region (SCAR) primers to determine the Pleurotus erythematosus lineage comprising the oligonucleotide primers of SEQ ID NOs: 1 and 2. delete An oligonucleotide primer set according to claim 1; And a reagent for carrying out the amplification reaction. The kit of claim 3, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. Separating genomic DNA from oyster mushrooms;
Using the isolated genomic DNA as a template, amplifying a target sequence by performing an amplification reaction using the oligonucleotide primer set according to claim 1, wherein the annealing of the primer of the amplification reaction is performed at 60 ° C to 68 ° C. At 25 ° C. for 25 seconds to 35 seconds, and the cycle of the amplification reaction is 28 to 33 times; And
Detecting the amplified product, the method for determining the oak mushroom strain. The method of claim 5, wherein the detection of the amplification product is carried out through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. delete

Images