KR101144988B1 - SCAR markers for discrimination of apple cultivars and use thereof - Google Patents

SCAR markers for discrimination of apple cultivars and use thereof Download PDF

Info

Publication number
KR101144988B1
KR101144988B1 KR1020090131107A KR20090131107A KR101144988B1 KR 101144988 B1 KR101144988 B1 KR 101144988B1 KR 1020090131107 A KR1020090131107 A KR 1020090131107A KR 20090131107 A KR20090131107 A KR 20090131107A KR 101144988 B1 KR101144988 B1 KR 101144988B1
Authority
KR
South Korea
Prior art keywords
seq
nos
oligonucleotide primer
primer sets
scar
Prior art date
Application number
KR1020090131107A
Other languages
Korean (ko)
Other versions
KR20110074204A (en
Inventor
조강희
허성
김현란
김정희
신일섭
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020090131107A priority Critical patent/KR101144988B1/en
Publication of KR20110074204A publication Critical patent/KR20110074204A/en
Application granted granted Critical
Publication of KR101144988B1 publication Critical patent/KR101144988B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 사과의 품종 판별용 SCAR(Sequence Chracterized Amplified Region) 마커 및 이의 용도에 관한 것으로서, 보다 상세하게는 사과의 품종 판별용 SCAR 마커, 상기 SCAR 마커 증폭용 SCAR 프라이머 세트, 상기 SCAR 프라이머 세트를 포함하는 사과의 품종을 판별하기 위한 키트, 및 상기 SCAR 프라이머 세트를 이용한 사과의 품종을 판별하는 방법에 관한 것이다. The present invention relates to a SCAR (Sequence Chracterized Amplified Region) marker for identifying a variety of apples and its use, and more particularly, to a SCAR marker for identifying a variety of apples, a SCAR primer set for amplifying the SCAR marker, and a SCAR primer set. The present invention relates to a kit for discriminating a variety of apples, and a method for discriminating a variety of apples using the SCAR primer set.

사과, 품종 판별, SCAR 표지, 프라이머 Apple, Breed Identification, SCAR Mark, Primer

Description

사과의 품종 판별용 SCAR 표지 및 이의 용도{SCAR markers for discrimination of apple cultivars and use thereof}SCAR markers for discrimination of apple cultivars and use according to apple varieties

본 발명은 사과의 품종 판별용 SCAR 마커 및 이의 용도에 관한 것으로서, 보다 상세하게는 사과의 품종 판별용 SCAR 마커, 상기 SCAR 마커 증폭용 SCAR 프라이머 세트, 상기 SCAR 프라이머 세트를 포함하는 사과의 품종을 판별하기 위한 키트, 및 상기 SCAR 프라이머 세트를 이용한 사과의 품종을 판별하는 방법에 관한 것이다. The present invention relates to an SCAR marker for identifying a variety of apples and uses thereof, and more particularly, to determine a variety of apples including an SCAR marker for identifying a variety of apples, a SCAR primer set for amplifying the SCAR marker, and a SCAR primer set. Kit for to, and a method for determining the variety of apples using the SCAR primer set.

사과는 다른 과수와 마찬가지로 영년생 작물로서 종자로부터 개화 결실되는 시기까지 장기간이 소요되는 유년성이며, 유전자 조성이 잡박할 뿐만 아니라 자가불화합성인 특징이 있다. 또한 수면 면적도 상대적으로 커서 육종기간이 매우 길고 노력 및 비용이 많이 든다. 우리나라의 사과 품종 육성은 국립원예특작과학원에서 1988년 '홍로' 품종을 시작으로 현재까지 18 종의 다양한 품종이 개발되었다. Apples, like other fruit trees, are young crops that take a long time to grow from seed to flowering and are characterized by poor genetic composition and self-incompatibility. In addition, the surface area is relatively large, the breeding period is very long, and the labor and cost are high. Starting with the 'Hongro' variety in 1988, 18 varieties of varieties have been developed.

분자 표지에 의한 품종 판별은 나무의 수체 또는 잎이나 과실과 같은 형태적 형질의 조사 없이 추출한 DNA를 이용하여 쉽고 정확하게 품종을 구분할 수 있기 때문에 유통 묘목 시 품종 혼입을 예방하고 육종가의 권리를 보호하기 위해서도 신속 하고 정확하게 품종을 확인할 수 있는 분자표기 기술을 확립할 필요가 있다. 또한 DNA 표지 기술은 품종의 유전적 특성을 본질적으로 반영하므로 환경의 영향을 받지 않아 표현형의 특성을 대체 보완하는데 활용성이 높다.Variety discrimination by molecular labeling can be easily and accurately distinguished by using DNA extracted without investigating the tree's water or morphological traits such as leaves or fruits, so as to prevent the incorporation of varieties in distribution seedlings and to protect breeders' rights. There is a need to establish molecular labeling techniques that can identify varieties quickly and accurately. In addition, DNA labeling technology reflects the genetic characteristics of varieties inherently, so it is not influenced by the environment, so it is highly applicable to complement the characteristics of the phenotype.

일반적으로 과수 국내육성 품종들은 국내 내수용과 해외 수출용 모두 묘목상태로 공급되고 있어 형태적으로 품종 판별이 불가능하다. 또한 신 육성 품종들은 유전적으로 기존 품종들과 매우 밀접하게 연관되어 있어, 형태적 형질만으로 품종 구별이 쉽지 않다. 따라서 본 발명에서는 신속하고 정확한 품종 판별에 대한 기술체계를 확립하는데 필요한 분자 표지를 제공하는데 그 목적이 있다.In general, domestically grown fruit orchards are supplied as seedlings for both domestic and overseas exports. Also, breeding varieties are genetically closely related to existing varieties, so it is not easy to distinguish varieties by morphological traits alone. Accordingly, an object of the present invention is to provide a molecular label required for establishing a technical system for rapid and accurate breed identification.

상기 과제를 해결하기 위해, 본 발명은 사과의 품종 판별용 SCAR 마커를 제공한다.In order to solve the above problems, the present invention provides an SCAR marker for discriminating apple varieties.

또한, 본 발명은 사과의 품종 판별용 SCAR 마커 증폭용 SCAR 프라이머 세트를 제공한다.In addition, the present invention provides a set of SCAR primer for amplifying SCAR marker for apple variety determination.

또한, 본 발명은 사과의 품종 판별용 SCAR 마커 증폭용 SCAR 프라이머 세트를 포함하는 사과의 품종 판별용 키트를 제공한다.In addition, the present invention provides a kit for discriminating the variety of apples, including a set of SCAR primers for amplifying the SCAR marker amplification for apple variety.

또한, 본 발명은 사과의 품종 판별용 SCAR 마커 증폭용 SCAR 프라이머 세트를 이용한 사과의 품종을 판별하는 방법을 제공한다. In addition, the present invention provides a method for determining the variety of apples using the SCAR primer set for amplifying SCAR marker amplification for apple variety.

본 발명에 따르면, 본 발명에 따른 사과의 품종 판별용 SCAR 마커는 사과 국내육성 품종의 품종권 보호 강화와 육성 품종의 수출 시뿐만 아니라 국내 묘목 유통 시 품종인증 기술로 활용 가능하다. According to the present invention, the SCAR marker for discriminating apple varieties according to the present invention can be utilized as a variety certification technology for domestically distributing seedlings as well as for strengthening protection of varieties of apple domestically grown varieties.

국내 과수 묘목 생산업체의 영세성으로 품질 보증이 미흡한 묘목의 유통으로 바이러스, 바이로이드 감염 및 품종 혼입에 따른 민원이 다수 발생하고 있다. 또한 과수 묘목 연간 수요량인 약 9백만 주(2004)의 약 40% 만이 합법 묘목업체에서 공급하고 있는 것으로 추정되고 있다. 따라서 본 발명에서 얻어진 품종 판별 표지는 관련기관에 기술 이전하여 앞으로 신속하고 정확한 품종 인증에 활용될 수 있다.Due to the small size of domestic fruit tree seedling producers, the distribution of seedlings with poor quality assurance has caused a lot of complaints about viruses, viroid infections, and the mixing of varieties. It is estimated that only 40% of the annual demand for fruit tree seedlings (about 9 million shares (2004)) is supplied by legal seedling companies. Therefore, the breed discrimination label obtained in the present invention can be used for rapid and accurate breed certification in the future by transferring the technology to related organizations.

본 발명의 목적을 달성하기 위하여, 본 발명은 사과의 품종 판별용 SCAR(Sequence Chracterized Amplified Region) 마커를 제공한다. 바람직하게는, 상기 사과의 품종 판별용 SCAR 마커는 사과의 국내육성 품종 16 종 및 기존 품종 15 종을 대상으로 한 RAPD(Random Amplified Polymorphic DNA) 분석으로부터 얻을 수 있다. In order to achieve the object of the present invention, the present invention provides a Sequence Chracterized Amplified Region (SCAR) marker for discriminating apple varieties. Preferably, the SCAR marker for identifying the variety of apples can be obtained from RAPD (Random Amplified Polymorphic DNA) analysis of 16 domestically grown varieties of apples and 15 existing varieties.

더욱 바람직하게는, 상기 사과의 품종 판별용 SCAR 마커는 표 1에 기재된 AL1_343 (서열번호 35), AW15_368 (서열번호 36), A330_424 (서열번호 37), AL1_427 (서열번호 38), AN11_433 (서열번호 39), AT6_453 (서열번호 40), AG14_502 (서열번호 41), AN8_566 (서열번호 42), AK17_574 (서열번호 43), AK14_575 (서열번호 44), A408_592 (서열번호 45), AK17_653 (서열번호 46), AM16_708 (서열번호 47), AO4_711 (서열번호 48), AO4_779 (서열번호 49), AT14_789 (서열번호 50) 및 AL1_851 (서열번호 51)로 이루어진 군으로부터 선택된 하나 이상일 수 있다. More preferably, the SCAR marker for discriminating the apple variety is AL1_343 (SEQ ID NO: 35), AW15_368 (SEQ ID NO: 36), A330_424 (SEQ ID NO: 37), AL1_427 (SEQ ID NO: 38), AN11_433 (SEQ ID NO: 36). 39), AT6_453 (SEQ ID NO: 40), AG14_502 (SEQ ID NO: 41), AN8_566 (SEQ ID NO: 42), AK17_574 (SEQ ID NO: 43), AK14_575 (SEQ ID NO: 44), A408_592 (SEQ ID NO: 45), AK17_653 (SEQ ID NO: 46 ), AM16_708 (SEQ ID NO: 47), AO4_711 (SEQ ID NO: 48), AO4_779 (SEQ ID NO: 49), AT14_789 (SEQ ID NO: 50), and AL1_851 (SEQ ID NO: 51).

본 발명에서 빈번히 사용된 용어 “마커(marker)”는 유전적으로 불특정 연 관된 유전자좌를 동정할 때 참고 점으로 사용되는 염기서열을 말한다. 이 용어는 또한 마커 서열을 증폭할 수 있는 프라이머 세트으로 사용되는 핵산과 같은 마커 서열에 상보적인 핵산 서열에도 적용된다. 분자마커(molecular marker)의 유전자지도상의 위치는 유전자좌(genetic locus)로 일컬어진다. The term "marker" frequently used in the present invention refers to a nucleotide sequence used as a reference point when identifying a genetically unspecified genetic locus. The term also applies to nucleic acid sequences that are complementary to marker sequences, such as nucleic acids used as primer sets capable of amplifying marker sequences. The location of the molecular markers on the genetic map is called the genetic locus.

상기 사과 품종은 홍로, 서광, 추광, 새나라, 감홍, 화홍, 선홍, 서홍, 썸머드림, 홍금, 만복, 홍소, 홍안, 여홍, 그린볼, 피크닉, 쓰가루, 산사, 조나골드, 골든델리셔스, 레드델리셔스, 후지, 핑크레이디, 갈라, 모리스델리셔스, 천추, 조나단, 홍월, 국광, 양광, 또는 스퍼어얼리블레이즈일 수 있으나, 이에 제한되지 않는다. The apple varieties are Hongro, Seogwang, Chuseok, Saenara, Gamhong, Huahong, Shenhong, Seohong, Summer Dream, Hongum, Manbok, Hongso, Hong'an, Yeohong, Greenball, Picnic, Tsugaru, Sansa, Jona Gold, Golden Delis, Red Delis , Fuji, Pink Lady, Gala, Mauritius, Schuchu, Jonathan, Hongwol, glow, daylight, or spurly blaze, but is not limited thereto.

본 발명은 또한, 사과 품종 판별용 SCAR 마커를 증폭하기 위한 올리고뉴클레오티드 SCAR 프라이머 세트를 제공한다. 본 발명의 일 구현예에 따른 올리고뉴클레오티드 SCAR 프라이머 세트는 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 4의 올리고뉴클레오티드 프라이머 세트; 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 서열번호 9 및 10의 올리고뉴클레오티드 프라이머 세트; 서열번호 11 및 12의 올리고뉴클레오티드 프라이머 세트; 서열번호 13 및 14의 올리고뉴클레오티드 프라이머 세트; 서열번호 15 및 16의 올리고뉴클레오티드 프라이머 세트; 서열번호 17 및 18의 올리고뉴클레오티드 프라이머 세트; 서열번호 19 및 20의 올리고뉴클레오티드 프라이머 세트; 서열번호 21 및 22의 올리고뉴클레오티드 프라이머 세트; 서열번호 23 및 24의 올리고뉴클레오티드 프라이머 세트; 서열번호 25 및 26의 올 리고뉴클레오티드 프라이머 세트; 서열번호 27 및 28의 올리고뉴클레오티드 프라이머 세트; 서열번호 29 및 30의 올리고뉴클레오티드 프라이머 세트; 서열번호 31 및 32의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 33 및 34의 올리고뉴클레오티드 프라이머 세트로 이루어진 군으로부터 선택된 사과의 품종을 판별하기 위한 하나 이상의 올리고뉴클레오티드 프라이머 세트일 수 있다. The present invention also provides an oligonucleotide SCAR primer set for amplifying the SCAR marker for apple variety discrimination. Oligonucleotide SCAR primer set according to an embodiment of the present invention is the oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; Oligonucleotide primer sets of SEQ ID NOs: 23 and 24; Oligonucleotide primer sets of SEQ ID NOs: 25 and 26; Oligonucleotide primer sets of SEQ ID NOs: 27 and 28; Oligonucleotide primer sets of SEQ ID NOs: 29 and 30; Oligonucleotide primer sets of SEQ ID NOs: 31 and 32; And one or more oligonucleotide primer sets for determining a variety of apples selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 33 and 34.

본 발명의 프라이머 세트는 바람직하게는 상기 프라이머 세트로 이루어진 군으로부터 선택되는 2 이상의 프라이머 세트를 포함하며, 더욱 바람직하게는 3 개의 프라이머 세트, 더 더욱 바람직하게는 4 개의 프라이머 세트, 가장 바람직하게는 5 개의 프라이머 세트 즉, 서열번호 9 및 10의 올리고뉴클레오티드 프라이머 세트; 서열번호 21 및 22의 올리고뉴클레오티드 프라이머 세트; 서열번호 23 및 24의 올리고뉴클레오티드 프라이머 세트; 서열번호 27 및 28의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 29 및 30의 올리고뉴클레오티드 프라이머 세트를 포함할 수 있다. 본 발명의 일 구현예에 따라 상기 5 개의 프라이머 세트를 이용하면 16 종의 사과 국내육성 품종 (홍로, 서광, 추광, 새나라, 감홍, 화홍, 선홍, 서홍, 썸머드림, 홍금, 만복, 홍소, 홍안, 여홍, 그린볼, 피크닉)의 판별이 가능하다. The primer set of the present invention preferably comprises two or more primer sets selected from the group consisting of the above primer sets, more preferably three primer sets, even more preferably four primer sets, most preferably 5 Sets of primers, ie oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; Oligonucleotide primer sets of SEQ ID NOs: 23 and 24; Oligonucleotide primer sets of SEQ ID NOs: 27 and 28; And oligonucleotide primer sets of SEQ ID NOs: 29 and 30. According to one embodiment of the present invention, using the five primer sets, 16 kinds of apple domestically grown varieties (Hongro, Seogwang, Chukwang, Saenara, Gamhong, Huahong, Shenhong, Seohong, Summer Dream, Honggeum, Manbok, Hongso, Hongan , Red, greenball, picnic).

본 발명의 일 구현예에 따른 올리고뉴클레오티드 SCAR 프라이머 세트는 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 4의 올리고뉴클레오티드 프라이머 세트; 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 서열번호 9 및 10의 올리고뉴클레오티드 프라이머 세트; 서열번호 11 및 12의 올리고뉴클레오티드 프라이머 세트; 서열번호 13 및 14의 올리고뉴클레오티드 프라이머 세트; 서열번호 15 및 16의 올리고뉴클레오티드 프라이머 세트; 서열번호 17 및 18의 올리고뉴클레오티드 프라이머 세트; 서열번호 19 및 20의 올리고뉴클레오티드 프라이머 세트; 서열번호 21 및 22의 올리고뉴클레오티드 프라이머 세트; 서열번호 23 및 24의 올리고뉴클레오티드 프라이머 세트; 서열번호 25 및 26의 올리고뉴클레오티드 프라이머 세트; 서열번호 27 및 28의 올리고뉴클레오티드 프라이머 세트; 서열번호 29 및 30의 올리고뉴클레오티드 프라이머 세트; 서열번호 31 및 32의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 33 및 34의 올리고뉴클레오티드 프라이머 세트를 포함하는 사과의 품종을 판별하기 위한 올리고뉴클레오티드 SCAR 프라이머 세트일 수 있다. Oligonucleotide SCAR primer set according to an embodiment of the present invention is the oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; Oligonucleotide primer sets of SEQ ID NOs: 23 and 24; Oligonucleotide primer sets of SEQ ID NOs: 25 and 26; Oligonucleotide primer sets of SEQ ID NOs: 27 and 28; Oligonucleotide primer sets of SEQ ID NOs: 29 and 30; Oligonucleotide primer sets of SEQ ID NOs: 31 and 32; And an oligonucleotide SCAR primer set for determining a variety of apples, including the oligonucleotide primer sets of SEQ ID NOs: 33 and 34.

상기 프라이머는 각 프라이머의 서열 길이에 따라, 서열번호 1 내지 서열번호 34의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상, 25개 이상, 26개 이상, 27개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 예를 들면, 서열번호 1의 프라이머는 서열번호 1의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있으며, 서열번호 2의 프라이머는 서열번호 2의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 또한, 상기 프라이머는 서열번호 1 내지 서열번호 34의 염기서열의 부가, 결실 또는 치환된 서열도 포함할 수 있다.The primers may be at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 in the sequence of SEQ ID NOs: 1 to 34, depending on the sequence length of each primer. Oligonucleotides consisting of segments of at least 24, at least 24, at least 25, at least 26, at least 27 consecutive nucleotides. For example, at least 16 primers, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, and at least 24 within the sequence of SEQ ID NO: 1 And oligonucleotides consisting of fragments of consecutive nucleotides, wherein the primers of SEQ ID NO: 2 are at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 in the sequence of SEQ ID NO: 2 Oligonucleotides consisting of segments of at least 22, 23 or more consecutive nucleotides. In addition, the primer may include a sequence of addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 34.

본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primers will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

본 발명은 또한, 본 발명에 따른 올리고뉴클레오티드 SCAR 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 사과 품종을 판별하기 위한 키트를 제공한다. The invention also provides an oligonucleotide SCAR primer set according to the invention; And a kit for determining an apple variety, comprising a reagent for performing an amplification reaction.

본 발명의 키트에서, SCAR 프라이머 세트는 사과 품종 판별용 SCAR 마커 증폭용 프라이머 세트이며, 상기 프라이머 세트는 SCAR 마커를 이용하여 당업자가 용이하게 디자인할 수 있으며, 이와 같이 디자인된 프라이머 세트는 본 발명의 범위 내에 포함된다. 바람직하게는, 상기 사과 품종을 대상으로 RAPD 분석을 실시하고, 품종 특이적인 RAPD 마커를 선발하여, 선발된 RAPD 표지의 염기서열 분석 결과를 토대로 디자인된, 선발 RAPD 프라이머 10개의 염기를 포함하거나 포함하지 않는 20~28 염기 크기의 올리고뉴클레오티드 SCAR 프라이머 세트가 제작될 수 있다. In the kit of the present invention, the SCAR primer set is a primer set for amplifying the SCAR marker for apple variety discrimination, and the primer set can be easily designed by a person skilled in the art using the SCAR marker, and the primer set designed as described above is It is included within the scope. Preferably, the apple varieties are subjected to RAPD analysis, selection of varieties specific RAPD markers, and do not include or include 10 bases of the selected RAPD primer, designed based on the results of sequencing of the selected RAPD label 20-28 base size oligonucleotide SCAR primer sets can be prepared.

상기 증폭 반응을 수행하기 위한 시약은 내열성 DNA 중합효소, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.Reagents for performing the amplification reaction may include heat-resistant DNA polymerase, dNTPs, buffers and the like. In addition, the kits of the present invention may further comprise a user guide describing the optimal reaction performance conditions. The guide is a printed document that explains how to use the kit, such as how to prepare a PCR buffer, and the reaction conditions presented. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

본 발명은 또한,The present invention also provides

사과에서 게놈 DNA를 분리하는 단계;Separating genomic DNA from an apple;

상기 분리된 게놈 DNA를 주형으로 하고, 본 발명에 따른 올리고뉴클레오티드 SCAR 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using an oligonucleotide SCAR primer set according to the present invention; And

상기 증폭 산물을 검출하는 단계를 포함하는, 사과 품종을 판별하는 방법을 제공한다.It provides a method for determining the apple variety, comprising the step of detecting the amplification product.

본 발명의 방법은 사과에서 게놈(genomic) DNA를 분리하는 단계를 포함한다. 상기 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, wizard prep 키트(Promega 사)를 이용할 수도 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 올리고뉴클레오티드 프라이머 세트를 프라이머로 이용하여 증폭 반응을 수행 하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 세트으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.The method includes the step of separating genomic DNA from an apple. As a method for separating genomic DNA from the sample, a method known in the art may be used. For example, the CTAB method may be used, or a wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using an oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출 가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭 시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 가장 바람직하게는, 은염색 키트(Bioneer, Daejeon, Korea)를 사용하여 가시화될 수 있다.In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5′-end of the primer, so that the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as 32 P or 35 S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized, and the amplification product may be radioactively labeled. Most preferably, it may be visualized using a silver dye kit (Bioneer, Daejeon, Korea).

본 발명의 방법은 상기 증폭 산물을 검출하는 단계를 포함한다. 상기 증폭 산물의 검출은 모세관 전기영동, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있다. 증폭 산물을 검출하는 방법 중의 하나로서,모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 가장 바람직하게는, 6% 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.The method of the present invention includes detecting the amplification product. Detection of the amplification product can be carried out through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Most preferably 6% acrylamide gel electrophoresis can be used. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as 32 P or 35 S to the PCR reaction solution to label the amplification product when performing the PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

실시예Example 1. 사과품종의  Apple varieties DNADNA 추출 extraction

본 발명에 이용된 사과 품종은 국내육성 품종인 홍로, 서광, 추광, 새나라, 감홍, 화홍, 선홍, 서홍, 썸머드림, 홍금, 만복, 홍소, 홍안, 여홍, 그린볼, 및 피 크닉과 기존 품종인 쓰가루, 산사, 조나골드, 골든델리셔스, 레드델리셔스, 후지, 핑크레이디, 갈라, 모리스델리셔스, 천추, 조나단, 홍월, 국광, 양광, 및 스퍼어얼리블레이즈로 총 31품종이다. 사과 어린 잎으로부터의 게놈 DNA의 추출을 위해서 DNeasy plant mini kit (Qiagen)를 사용하였다. 추출된 DNA는 0.8%의 아가로즈 겔상에 전기영동하여 확인하였고, DNA 양은 NanoDrop spectrophotometer (Thermo Scientific)로 정량한 후 10ngμL- 1 의 농도로 희석하여 분석에 사용하였다.Apple varieties used in the present invention are domestically grown varieties Hongro, Seogwang, Chukwang, Saenara, Gamhong, Huahong, Shenhong, Seohong, Summer Dream, Hongum, Manbok, Hongso, Hongan, Yeohong, Greenball, and Picnic and existing varieties There are 31 varieties, including Tsugaru, Sansa, Jona Gold, Golden Delhi, Red Delhi, Fuji, Pink Lady, Gala, Mauritius, Schuchu, Jonathan, Hongwol, Guangwang, Sunshine, and Spherical Blaze. DNeasy plant mini kit (Qiagen) was used for the extraction of genomic DNA from apple young leaves. The extracted DNA was confirmed by electrophoresis on 0.8% agarose gel, and the amount of DNA was quantified by a NanoDrop spectrophotometer (Thermo Scientific), and diluted to a concentration of 10 ng μL - 1 for analysis.

실시예Example 2.  2. RAPDRAPD 분석을 이용한 품종간 다형성 탐색 Exploration of Polymorphism Between Varieties Using Analysis

RAPD 표지 선발에는 Operon 및 University of British Columbia (UBC)에서 제조된 10 개의 염기로 구성된 임의의 프라이머를 이용하였다. PCR 반응은 40ng의 게놈 DNA에 1×PCR 완충액, 5 pmol의 random 프라이머, 200μM의 dNTP, 3mM의 MgCl2와 0.4 유닛의 Taq DNA 중합효소 (Genetbio)를 첨가하여, 반응액을 12.5μL로 맞추었다. PCR 반응은 thermocycler (Bio-rad icycler PCR system)를 사용하여 하기와 같은 프로그램으로 수행하였다: 94℃에서 5분간 변성시킨 후; 94℃에서 45초간 변성, 37℃에서 45초간 어닐링(annealing), 및 72℃에서 2분간 연장(extension) 과정을 10 회 반복 수행한 후; 94℃에서 45초간 변성, 42℃에서 45초간 어닐링, 및 72℃에서 2분간 연장 과정을 30 회 반복 수행하고; 마지막으로 72℃에서 5분간 최종 연장반응을 수행하였다. 증폭된 PCR 산물은 1.2% 아가로즈 겔에서 150V로 3시간 동안 전기영동하여 확인하였다.For RAPD label selection, any primer consisting of 10 bases prepared by Operon and the University of British Columbia (UBC) was used. The PCR reaction was performed by adding 1 × PCR buffer, 5 pmol random primer, 200μM dNTP, 3mM MgCl 2 and 0.4 unit of Taq DNA polymerase (Genetbio) to 40ng genomic DNA, to adjust the reaction solution to 12.5μL. . PCR reactions were carried out using a thermocycler (Bio-rad icycler PCR system) with the following program: after 5 min degeneration at 94 ° C .; 10 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 37 ° C. for 45 seconds, and extension at 72 ° C. for 2 minutes; 30 cycles of denaturation at 94 ° C. for 45 seconds, annealing at 42 ° C. for 45 seconds, and extension at 72 ° C. for 2 minutes; Finally, the final extension reaction was performed at 72 ° C. for 5 minutes. The amplified PCR product was confirmed by electrophoresis for 3 hours at 150V on 1.2% agarose gel.

실시예Example 3. 선발된 품종 특이  3. Selected Breeds Specific RAPDRAPD 표지의  Cover 클로닝과Cloning and 염기서열 분석 Sequencing

선발된 품종 특이적 RAPD 표지의 염기서열 분석을 위해 표지 선발에 사용되었던 프라이머로 PCR을 실시한 후, 전기영동하여 특이 표지 DNA 밴드를 잘라내고 QIAquick Gel Extraction Kit (Qiagen)를 이용하여 DNA를 추출하였다. 추출된 DNA를 TOPO-TA cloning system (Invitrogen)을 이용하여 pCR2.1-TOPO 벡터에 넣어 E. coli TOP10에 형질전환시킨 후 DNA가 삽입된 균주를 선발하였다. 상기 선발된 균주로부터 플라스미드 DNA를 분리하였고, 삽입된 DNA 전 염기서열을 automated sequencer (CoreBioSystem)를 이용하여 분석하였다. PCR was performed with primers used for label selection for sequencing of selected varieties specific RAPD labels, followed by electrophoresis to cut out specific labeled DNA bands, and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen). The extracted DNA was transformed into E. coli TOP10 by using the TOPO-TA cloning system (Invitrogen) into the pCR2.1-TOPO vector, and the strain into which DNA was inserted was selected. Plasmid DNA was isolated from the selected strains, and the entire DNA sequence was analyzed using an automated sequencer (CoreBioSystem).

실시예Example 4. 품종 특이적  4. Breed Specific SCARSCAR 표지 개발 Cover development

선발된 RAPD 표지의 염기서열 분석 결과를 토대로 하여 선발 프라이머의 10 개의 염기를 포함하거나 포함하지 않는 24~28 염기 크기의 SCAR 프라이머를 제작하였다. 합성된 SCAR 프라이머를 각 품종에 적용하여 실용성을 검토하였다. PCR은 총 15μL 반응액에 40ng의 게놈 DNA, 200μM의 dNTP, 5pmol의 SCAR 프라이머, 1×PCR 완충액 및 0.5유닛의 Hot-start Taq DNA 중합효소 (Genetbio)를 첨가하여 수행하였다. PCR은 95℃에서 10분간 주형 DNA를 변성시킨 후; 95℃에서 30초간 변성, 63℃에서 30초간 어닐링(annealing), 72℃에서 1분간 연장(extension) 과정을 30 회 반응시킨 후; 72℃에서 5분간 처리한 후 반응을 종료하였다. PCR 분석 결과 17 종의 SCAR 프라이머 쌍에서 RAPD 표지와 동일한 결과를 얻을 수 있어 품종 판별에 이용 할 수 있었다. 이 중 2 종은 '홍로'와 '서광'에서만 나타나는 품종 특이적인 표지였다.Based on the sequencing results of the selected RAPD label, a SCAR primer having a size of 24 to 28 bases with or without 10 bases of the selection primers was prepared. The synthesized SCAR primer was applied to each variety to examine its practicality. PCR was performed by adding 40 ng of genomic DNA, 200 μM of dNTP, 5 pmol of SCAR primer, 1 × PCR buffer, and 0.5 unit of Hot-start Taq DNA polymerase (Genetbio) to a total 15 μL reaction solution. PCR denatures template DNA at 95 ° C. for 10 minutes; 30 seconds of denaturation at 95 ° C., annealing at 63 ° C. for 30 seconds, and extension reaction at 72 ° C. for 1 minute; The reaction was terminated after treatment at 72 ° C. for 5 minutes. As a result of PCR analysis, the same results as RAPD markers were obtained from 17 SCAR primer pairs, which could be used for cultivation. Two of these species were breed-specific markers that appeared only in 'Hongro' and 'Sunlight'.

표 1. 사과 품종 판별용 SCAR 프라이머 염기서열Table 1. SCAR primer sequences for apple variety

SCAR 표지 SCAR cover 프라이머 서열 (5'→3')Primer sequence (5 '→ 3') 서열번호SEQ ID NO: 증폭산물 크기(bp)Amplification Product Size (bp) AL1_343
(서열번호 35)
AL1_343
(SEQ ID NO 35)
F: GGCATGACCTCAAACATGACAATATT F: GGCATGACCTCAAACATGACAATATT 1One 343
343
R: GGCATGACCTAGCCGTCCTAGGTT R: GGCATGACCTAGCCGTCCTAGGTT 22 AW15_368
(서열번호 36)
AW15_368
(SEQ ID NO: 36)
F: GGATATGTACGTGGAAACTTTGGTTTC F: GGATATGTACGTGGAAACTTTGGTTTC 33 368
368
R: ACACCGGAACTATATGTAAACAATCTGA R: ACACCGGAACTATATGTAAACAATCTGA 44 A330_424
(서열번호 37)
A330_424
(SEQ ID NO: 37)
F: GATATTTCCGTGTTTTCGGACTAC F: GATATTTCCGTGTTTTCGGACTAC 55 424
424
R: GGTGGTTTCCTAAGTAGAGCCACA R: GGTGGTTTCCTAAGTAGAGCCACA 66 AL1_427
(서열번호 38)
AL1_427
(SEQ ID NO: 38)
F: ACAACTGGGGAGGCACAAGG F: ACAACTGGGGAGGCACAAGG 77 427
427
R: ACAACTGGGGGTCCTCATCC R: ACAACTGGGGGTCCTCATCC 88 AN11_433
(서열번호 39)
AN11_433
(SEQ ID NO: 39)
F: CGCCGCAAAGGAAGAACAACAAGAAA F: CGCCGCAAAGGAAGAACAACAAGAAA 99 433
433
R: CGCCGCAAAGCCACCTTGCTGATG R: CGCCGCAAAGCCACCTTGCTGATG 1010 AT6_453
(서열번호 40)
AT6_453
(SEQ ID NO 40)
F: CAAGGGCAGACAGACATATATTCATAG F: CAAGGGCAGACAGACATATATTCATAG 1111 453
453
R: CAAGGGCAGAGGTCAGAGGACAGC R: CAAGGGCAGAGGTCAGAGGACAGC 1212 AG14_502
(서열번호 41)
AG14_502
(SEQ ID NO 41)
F: AGTACTTGGATTTAACGGAGGACATGA F: AGTACTTGGATTTAACGGAGGACATGA 1313 502
502
R: CAGATCTTGACTAAGACCCTGGATAAG R: CAGATCTTGACTAAGACCCTGGATAAG 1414 AN8_566
(서열번호 42)
AN8_566
(SEQ ID NO: 42)
F: ACCTCAGCTCTACATGATGCCGAA F: ACCTCAGCTCTACATGATGCCGAA 1515 566
566
R: ACCTCAGCTCGGTCATTGCATATAA R: ACCTCAGCTCGGTCATTGCATATAA 1616 AK17_574
(서열번호 43)
AK17_574
(SEQ ID NO: 43)
F: CCCAGCTGTGTATTTACCTTTTCT F: CCCAGCTGTGTATTTACCTTTTCT 1717 574
574
R: CCCAGCTGTGACCTATTACGAAGC R: CCCAGCTGTGACCTATTACGAAGC 1818 AK14_575
(서열번호 44)
AK14_575
(SEQ ID NO: 44)
F: CCCGCTACACCCATTTTGTGTACGTGT F: CCCGCTACACCCATTTTGTGTACGTGT 1919 575
575
R: TAGCCAAAGGACTCCACTATAAGGAGG R: TAGCCAAAGGACTCCACTATAAGGAGG 2020 A408_592
(서열번호 45)
A408_592
(SEQ ID NO 45)
F: CCGTCTCTTTACTATAACTAACCCTTC F: CCGTCTCTTTACTATAACTAACCCTTC 2121 592
592
R: CCGTCTCTTTCGTTTCAGGAATTTTCC R: CCGTCTCTTTCGTTTCAGGAATTTTCC 2222 AK17_653
(서열번호 46)
AK17_653
(SEQ ID NO 46)
F: CCCAGCTGTGACATAACAAAAAATATC F: CCCAGCTGTGACATAACAAAAAATATC 2323 653
653
R: CCCAGCTGTGAGGGAGTGGCTCGA R: CCCAGCTGTGAGGGAGTGGCTCGA 2424 AM16_708
(서열번호 47)
AM16_708
(SEQ ID NO 47)
F: ATTAAAACACTGGAGCTCAAAACCTCAA F: ATTAAAACACTGGAGCTCAAAACCTCAA 2525 708
708
R: GTAACCAGCCCAATAACCAACCCAACT R: GTAACCAGCCCAATAACCAACCCAACT 2626 AO4_711
(서열번호 48)
AO4_711
(SEQ ID NO 48)
F: AAGTCCGCTCACCAGTAACATAAAA F: AAGTCCGCTCACCAGTAACATAAAA 2727 711
711
R: AAGTCCGCTCCAGATAAAAGGAGT R: AAGTCCGCTCCAGATAAAAGGAGT 2828 AO4_779
(서열번호 49)
AO4_779
(SEQ ID NO 49)
F: AAGTCCGCTCAAATCCACCTCAAG F: AAGTCCGCTCAAATCCACCTCAAG 2929 779
779
R: AAGTCCGCTCTACAGACTGTTCAAT R: AAGTCCGCTCTACAGACTGTTCAAT 3030 AT14_789
(서열번호 50)
AT14_789
(SEQ ID NO 50)
F: AATGCCGCAGCAGATAAGTAATCTCTA F: AATGCCGCAGCAGATAAGTAATCTCTA 3131 789
789
R: AATGCCGCAGTAAGAAACCTTGAAGGA R: AATGCCGCAGTAAGAAACCTTGAAGGA 3232 AL1_851
(서열번호 51)
AL1_851
(SEQ ID NO: 51)
F: CATCAAAGCTTAAAGACTCAAGCAGCTT F: CATCAAAGCTTAAAGACTCAAGCAGCTT 3333 851
851
R: GGCATGACCTGGCTGTTAACTTTG R: GGCATGACCTGGCTGTTAACTTTG 3434

도 1 (a)는 사과 국내육성 품종인 '서광'에서만 특이적으로 나타나는 343bp 크기의 AL1_343 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '서광, '감홍, '만복, '여홍'및 기존품종인 '레드델리셔스', '핑크레이디', '갈라', '조나단', '홍월', '양광' 및 '스퍼어리블레이즈'에서만 나타나는 368bp 크기의 AW15_368 SCAR 표지를 보여준다. (c)는 사과 국내육성 품종인 '홍로', '새나라', '감홍', '홍금', '만복', '홍안', '여홍', '피크닉' 및 기존품종인 '쓰가루, '레드델리셔스', '후지', '핑크레이디', '모리스델리셔스', '천추', '국광'에서만 나타나는 424bp 크기의 A330_424 SCAR 표지를 보여준다. M, 100bp DNA 래더(ladder); 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈.Figure 1 (a) shows an AL1_343 SCAR marker of size 343bp specifically appearing only in 'growing light' apple domestically grown varieties. (b) shows apple breeding varieties such as Seogwang, Gamhong, Manbok, Yeohong, and existing varieties Red Delish, Pink Lady, Gala, Jonathan, Hongwol, and Yanggwang. And a 368 bp sized AW15_368 SCAR marker that only appears in 'Spurri blaze'. (c) The apple domestically grown varieties 'Hongro', 'Saenara', 'gamhong', 'honggeum', 'manbok', 'hongan', 'yuhong', 'picnic' and existing varieties 'Tsugaru,' red Delhi It shows the A330_424 SCAR cover of 424bp size that appears only in ',' Fuji ',' Pink Lady ',' Morris Delhi ',' Spring 'and' Glow '. M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, zona gold; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 2 (a)는 사과 국내육성 품종인 '서광', '새나라', '감홍', '홍안', '여홍' 및 기존 품종인 '조나골드', '레드델리셔스', '후지', '천추', '국광'에서만 나타나는 427bp 크기의 AL1_427 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '홍로', '추광', '새나라', '선홍', '서홍', '그린볼' 및 기존 품종인 '쓰가루', '산사', '조나골드', '골든델리셔스', '갈라', '모리스델리셔스', '천추', '양광', '스퍼어얼리블레이즈'에서만 나타나는 433bp 크기의 AN11_433 SCAR 표지를 보여준다. (c)는 사과 국내육성 품종인 '홍로'에서만 특이적으로 나타나는 453bp 크기의 AT6_453 SCAR 표지를 보여준다. M, 100bp DNA 래더; 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈. Figure 2 (a) is the apple domestically grown varieties 'Swanggwang', 'Saenara', 'gamhong', 'Hongan', 'Yellow' and the existing varieties 'Jona Gold', 'Red Delicious', 'Fuji', 'Cheonchu' ',' Kwanggwang 'shows only 427bp size AL1_427 SCAR marker. (b) the apple domestically grown varieties 'Hongro', 'Cheonwang', 'Saenara', 'Sunhong', 'West Hong', 'Greenball' and the existing varieties 'Tsugaru', 'Sansa', 'Jona Gold', It shows a 433bp AN11_433 SCAR cover that appears only in 'Golden Delhi', 'Gala', 'Morris Delhi', 'Spring', 'Sunshine' and 'Spherical Blaze'. (c) shows an AT6_453 SCAR marker with a size of 453 bp, which is specific only in the apple domestically grown cultivar. M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, zona gold; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 3 (a) 사과 국내육성 품종인 '서광', '추광', '새나라', '감홍', '선홍' 및 기존 품종인 '골든델리셔스', '모리스델리셔스'에서만 나타나는 502bp 크기의 AG14_502 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '홍로', '서광', '추광', '새나라', '화홍', '선홍', '서홍', '홍금', '홍소', '홍안', '그린볼' 및 기존 품종인 '골든델리셔스', '모리스델리셔스', '홍월', '양광', '스퍼어얼리블레이즈'에서만 나타나는 566bp 크기의 AN8_566 SCAR 표지를 보여준다. (c)는 사과 국내육성 품종인 '홍로', '서광', '새나라', '감홍', '화홍', '선홍', '홍금', '홍소', '홍안', '여홍', '그린볼' 및 기존품종인 '쓰가루', '조나골드', '골든델리셔스', '레드델리셔스', '후지', '핑크레이디', '갈라', '모리스델리셔스', '천추', '국광', '양광', '스퍼어얼리블레이즈'에서만 나타나는 574bp 크기의 AK17_574 SCAR 표지를 보여준다. M, 100bp DNA 래더; 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골 드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈.Figure 3 (a) AG14_502 SCAR cover of 502bp size appearing only in the apple domestically grown varieties' Swanggwang ',' Cheonwang ',' Saenara ',' gamhong ',' Sunhong 'and the existing varieties' Golden Delis',' Morris delis Shows. (b) the apple domestically grown varieties' Hongro ',' Swanggwang ',' Cheongwang ',' Saenara ',' Huahong ',' Sunhong ',' Shouhong ',' Hongum ',' Hongso ',' Hongan ',' 'Green Ball' and the existing varieties 'Golden Delis', 'Muri Delis', 'Hongwol', 'Sunshine', and 'Spherical Blaze' show the 566bp AN8_566 SCAR cover. (c) the apple domestically grown varieties' Hongro ',' Swanggwang ',' Saenara ',' Gamhong ',' Huahong ',' Sunhong ',' Hongum ',' Hongso ',' Hongan ',' Yellow ',' Green Ball and existing varieties Tsugaru, Jona Gold, Golden Delhi, Red Delhi, Fuji, Pink Lady, Gala, Mauritius It shows the AK17_574 SCAR cover of 574bp that appears only in ',' light 'and' spherical blaze '. M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, Jonathan; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 4 (a)는 사과 국내육성 품종인 '추광', '화홍', '선홍', '서홍', '만복', '홍안', '여홍', '피크닉' 및 기존품종인 '쓰가루', '산사', '조나골드', '레드델리셔스', '후지', '모리스델리셔스', '천추', '조나단', '홍월', '국광'에서만 나타나는 575bp 크기의 AK14_575 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '홍로', '서광', '새나라', '선홍', '만복', '홍소', '여홍', '피크닉' 및 기존품종인 '산사', '조나단', '홍월', '양광', '스퍼어얼리블레이즈'에서만 나타나는 592bp 크기의 A408_592 SCAR 표지를 보여준다. (c)는 사과 국내육성 품종인 '홍로', '서광', '추광', '선홍', '썸머드림', '만복', '홍소' 및 기존품종인 '핑크레이디', '모리스델리셔스'에서만 나타나는 653bp 크기의 AK17_653 SCAR 표지를 보여준다. M, 100bp DNA 래더; 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈.Figure 4 (a) is the apple domestically grown varieties 'Cheongwang', 'hwahong', 'sunhong', 'seohong', 'manbok', 'hongan', 'yuhong', 'picnic' and the existing varieties 'Tsugaru', It shows the AK14_575 SCAR cover of 575bp size that appears only in 'Sansa', 'Jona Gold', 'Red Delhi', 'Fuji', 'Morris Delhi', 'Cheonchu', 'Jonathan', 'Hongwol' and 'Kwanggwang'. (b) The apple domestically grown varieties 'Hongro', 'Swanggwang', 'Saenara', 'Sunhong', 'Manbok', 'Hongso', 'Je Hong', 'Picnic' and the existing varieties 'Sansa' and 'Jonathan' It shows the A408_592 SCAR cover of 592bp that appears only in 'Hongwol', 'Sunshine' and 'Spherical Blaze'. (c) the apple domestically grown varieties 'Hongro', 'Swanggwang', 'Cheongwang', 'Sunhong', 'Summer Dream', 'Manbok', 'Hongso' and the existing varieties 'Pink Lady' and 'Morris Delhi' Shows a 653bp sized AK17_653 SCAR marker. M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, zona gold; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 5 (a)는 사과 국내육성 품종인 '홍소', '여홍', '그린볼' 및 기존품종인 '쓰가루', '조나단', '양광', '스퍼어얼리블레이즈'에서만 나타나는 708bp 크기의 AM16_708 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '홍로', '감홍', '홍금', '만복', '홍안', '여홍' 및 기존품인 '쓰가루', '조나골드', '레드델리셔스', '후지', '천추', '국광', '양광', '스퍼어얼리블레이즈'에서만 나타나는 711bp 크기의 AO4_711 SCAR 표지를 보여준다. (c)는 사과 국내육성 품종인 '추광', '새나라', '화홍', '선홍', '서홍', '만복', '홍소' '홍안', '피크닉' 및 기존품종인 '레드델리셔스', '후지', '조나단', '홍월', '양광'에서만 나타나는 779bp 크기의 AO4_779 SCAR 표지를 보여준다. M, 100bp DNA 래더; 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈.Figure 5 (a) is 708bp size of the apple domestically grown varieties, 'red', 'red', 'green ball' and the existing varieties 'Tsugaru', 'Jonathan', 'lightning', 'super early blaze' AM16_708 Shows the SCAR cover. (b) the apple domestically grown varieties 'Hongro', 'gamhong', 'honggeum', 'manbok', 'hongan', 'yuhong' and the existing products 'Tsugaru', 'Jona Gold', 'Red Delicious', It shows the AO4_711 SCAR cover of 711bp size that appears only in 'Fuji', 'Spring', 'Kwanggwang', 'Sunlight' and 'Spherical Blaze'. (c) shows the apple domestically grown varieties: 'Cheongwang', 'Saenara', 'Huahong', 'Sunhong', 'West Hong', 'Manbok', 'Hongso' 'Hong', 'Picnic' and the existing varieties' Red Delis It shows the AO4_779 SCAR cover of 779 bp that appears only in ',' Fuji ',' Jonathan ',' Hongwol 'and' Sunshine '. M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, zona gold; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 6 (a)는 사과 국내육성 품종인 '서광', '감홍', '화홍', '서홍', '썸머드림', '홍소' '홍안', '여홍', '그린볼' 및 기존품종인 '쓰가루', '산사', '조나골드', '골든델리셔스', '핑크레이디', '갈라', '모리스델리셔스', '조나단', '홍월', '양광'에서만 나타나는 789bp 크기의 AT14_789 SCAR 표지를 보여준다. (b)는 사과 국내육성 품종인 '홍로', '선홍', '홍소', '피크닉' 및 기존품종인 '산사', '핑크레이디', '갈라'에서만 나타나는 851bp 크기의 AL1_851 SCAR 표지를 보여준다. M, 100bp DNA 래더; 1, 홍로; 2, 서광; 3, 추광; 4, 새나라; 5, 감홍; 6, 화홍; 7, 선홍; 8, 서홍; 9, 썸머드림; 10, 홍금; 11, 만복; 12, 홍소; 13, 홍안; 14, 여홍; 15, 그린볼; 16, 피크닉; 17, 쓰가루; 18, 산사; 19, 조나골드; 20, 골든델리셔스; 21, 레드델리셔스; 22, 후지; 23, 핑크레이디; 24, 갈라; 25, 모리스델리셔스; 26, 천추; 27, 조나단; 28, 홍월; 29, 국광; 30, 양광; 31, 스퍼어얼리블레이즈.Figure 6 (a) is an apple domestically grown varieties of 'seogwang', 'gamhong', 'hwahong', 'seohong', 'summer dream', 'hongso' 'hong', 'red', 'green ball' and existing varieties 789bp size AT14_789 which appears only in 'Tsugaru', 'Sansa', 'Jona Gold', 'Golden Delhi', 'Pink Lady', 'Gala', 'Morris Delhi', 'Jonathan', 'Hongwol' and 'Sunshine' Show SCAR markers. (b) shows the cover of AL1_851 SCAR of 851bp size that appears only in 'Hongro', 'Sunhong', 'Hongso', 'Picnic' and the existing varieties 'Sansa', 'Pink Lady' and 'Gala' . M, 100 bp DNA ladder; 1, egret; 2, west light; 3, autumn; 4, the new country; 5, dark red; 6, Huahong; 7, magenta; 8, west red; 9, summer dream; 10, red gold; 11, fullness; 12, red pepper; 13, red eye; 14, red red; 15, greenball; 16, picnic; 17, tsugaru; 18, hawthorn; 19, zona gold; 20, Golden Delhi; 21, Red Delhi; 22, Fuji; 23, pink lady; 24, gala; 25, Mauritius delis; 26, sacrum; 27, Jonathan; 28, red moon; 29, glow; 30, daylight; 31, spherical blaze.

도 7은 사과 국내육성 품종 판별용 SCAR 표지를 보여준다. Figure 7 shows the SCAR marker for identifying domestically grown apple varieties.

도 8은 사과 기존 품종 품종 판별용 SCAR 표지를 보여준다. Figure 8 shows the SCAR marker for discriminating apples existing varieties varieties.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SCAR markers for discrimination of apple cultivars and use thereof <130> PN09273 <160> 51 <170> KopatentIn 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AL1_343 f primer <400> 1 ggcatgacct caaacatgac aatatt 26 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AL1_343 r primer <400> 2 ggcatgacct agccgtccta ggtt 24 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AW15_368 f primer <400> 3 ggatatgtac gtggaaactt tggtttc 27 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AW15_368 r primer <400> 4 acaccggaac tatatgtaaa caatctga 28 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A330_424 f primer <400> 5 gatatttccg tgttttcgga ctac 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A330_424 r primer <400> 6 ggtggtttcc taagtagagc caca 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AL1_427 f primer <400> 7 acaactgggg aggcacaagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AL1_427 r primer <400> 8 acaactgggg gtcctcatcc 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AN11_433 f primer <400> 9 cgccgcaaag gaagaacaac aagaaa 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AN11_433 r primer <400> 10 cgccgcaaag ccaccttgct gatg 24 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT6_453 f primer <400> 11 caagggcaga cagacatata ttcatag 27 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AT6_453 r primer <400> 12 caagggcaga ggtcagagga cagc 24 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AG14_502 f primer <400> 13 agtacttgga tttaacggag gacatga 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AG14_502 r primer <400> 14 cagatcttga ctaagaccct ggataag 27 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AN8_566 f primer <400> 15 acctcagctc tacatgatgc cgaa 24 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AN8_566 r primer <400> 16 acctcagctc ggtcattgca tataa 25 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_574 f primer <400> 17 cccagctgtg tatttacctt ttct 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_574 r primer <400> 18 cccagctgtg acctattacg aagc 24 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK14_575 f primer <400> 19 cccgctacac ccattttgtg tacgtgt 27 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK14_575 r primer <400> 20 tagccaaagg actccactat aaggagg 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> A408_592 f primer <400> 21 ccgtctcttt actataacta acccttc 27 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> A408_592 r primer <400> 22 ccgtctcttt cgtttcagga attttcc 27 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK17_653 f primer <400> 23 cccagctgtg acataacaaa aaatatc 27 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_653 r primer <400> 24 cccagctgtg agggagtggc tcga 24 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AM16_708 f primer <400> 25 attaaaacac tggagctcaa aacctcaa 28 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AM16_708 r primer <400> 26 gtaaccagcc caataaccaa cccaact 27 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AO4_711 f primer <400> 27 aagtccgctc accagtaaca taaaa 25 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AO4_711 r primer <400> 28 aagtccgctc cagataaaag gagt 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AO4_779 f primer <400> 29 aagtccgctc aaatccacct caag 24 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AO4_779 r primer <400> 30 aagtccgctc tacagactgt tcaat 25 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT14_789 f primer <400> 31 aatgccgcag cagataagta atctcta 27 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT14_789 r primer <400> 32 aatgccgcag taagaaacct tgaagga 27 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AL1_851 f primer <400> 33 catcaaagct taaagactca agcagctt 28 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AL1_851 r primer <400> 34 ggcatgacct ggctgttaac tttg 24 <210> 35 <211> 343 <212> DNA <213> AL1_343 <400> 35 ggcatgacct caaacatgac aatattttat atgttcataa cttctgtccc tgcttaaatt 60 atagctgagt tagcatcagt taaattatta cagttttacc agtcattcaa gtaacccaat 120 aaatataatg tactaaatta ggggtgtgat atccacacac gattttttac ttttctcata 180 ttcttttaaa tttcgatcat tagatcggat gtattgaaaa atatctgttt ggacccaaaa 240 tattagtttg ggccgagtat agaatcattc tcggcccggg aggccttacg acaagggtat 300 catggatcgt gggcctccaa acctaggacg gctaggtcat gcc 343 <210> 36 <211> 428 <212> DNA <213> AW15_368 <400> 36 acaccggaac aagacatttg caggattgtg ctcgacactc ctgttaggta cgcacaagcg 60 gatatgtacg tggaaacttt ggtttcaccg gtgattggcg gcggctagct catacatttg 120 atttgaagca taccaactgg tattatgagc ctttcctttg ctttgctctt tctattaatg 180 taacaatata acgtaattgt catacatatt aagatactgg ctattatcta ttgctattta 240 ctgctttcat gatcatgtac atttgtgtgc ggtgtgtata cttagcccga tcgatgcaaa 300 tccaagctgc gtttatgcat atacatatat aattgtggaa gagaatgaga tctgttagtg 360 tagggaaaaa caaagattga aacatgcatg tttaccttca tcagattgtt tacatatagt 420 tccggtgt 428 <210> 37 <211> 477 <212> DNA <213> A330_424 <400> 37 ggtggtttcc atgtaatttt tatcgatatc gatattatcc cgatatttcc atcgatattt 60 ccgtgttttc ggactaccga tatttccgat attaccgata ttttcttcct tggttccaag 120 ctatcctctc tccctttaga ttttgctgag catgccctac ttggctatta catttcgttt 180 ccgttacata taattcaatg taggacggac ccatgtacga ggaatgttat aggattaaga 240 gcaaacaaaa caactaccac ttatattact ttcgttttaa attacattca agttttttat 300 ataaaacatt cacgcttact aactatatga gtatttaagt gaagacaaat attaatgtga 360 ttaaggataa acagcggtcc agctcctctc tgaaacccaa acaaaccata cccattgttt 420 cacgtacgtc gtcatttggt tcttgaccaa atatgtggct ctacttagga aaccacc 477 <210> 38 <211> 427 <212> DNA <213> AL1_427 <400> 38 acaactgggg aggcacaagg tagtattcag agtccaatag taaccttcta atcatgtgag 60 aaactagggc agcctgtttt atccagtttc tatcgaaagt atgaattgac atgttggaca 120 tcatgaagta aacgttcgag gacatgacgc ctcatataaa agcgacgttt gaaatcctct 180 tcattgtaca tcaagttggg gttgaagtag ttggtcatca gattatgatg tgccatatct 240 ctattttgtg gcttgtaacc acgaccagca atatggtcac cttattgagg ttgttcttca 300 gttgcttcac acgccatgac cccagccatg gctgtcatat atgatgcatt gtgccatgct 360 tcatcttctc gtctcatttt tgcccattta tcttccaatt cggaattgga tgaggacccc 420 cagttgt 427 <210> 39 <211> 433 <212> DNA <213> AN11_433 <400> 39 tcgccgcaaa ggaagaacaa caagaaaatc tactcctctt cagaacaaga gtgttgaatt 60 gtttagaggt tcagaatact ttgattgcta tatattaagg aaattggctg tttaatacgc 120 cagttgactt ggaagttagg agacggaaga cttgtagaaa ctaacaatgt aaaaaagttg 180 cttgatacac gctgtttgat tagttggctt aaagacttcc gtggcctatc agggagtttc 240 cttcccaact tccccaatga ccagcaccag aaagactttg accccttgac tcttcaacca 300 ttttcgtcac gaacaggtcc ttcaaactgt tcctctgagg cggaatcttc tccgatagcg 360 gcatcggaac cggcggctca cggcggcgac tgctgctccg ggtcaggagc atcagcaagg 420 tgggtttgcg gcg 433 <210> 40 <211> 453 <212> DNA <213> AT6_453 <400> 40 caagggcaga cagacatata ttcatagcat taaaatccta tatatgctca ttatatgcat 60 ccatagaaac acataaagaa tttatcaatg acataagtag tgaaacaatt tgcatccttt 120 cataaaagtc attcaaacaa aatatcacaa caaatttacg atcatattcg gggcttcaaa 180 acagcccata actactaaaa atcagttaca cattattctc aaattaaacc aaaagtaaaa 240 catatttgaa aagataaaac taagaaaaga agatctgccg tgcgtccgtg cctctgtgct 300 ctgctgcttc cctcttcctg cgcactgcct tctgtcctca cgtcagctct cctgcctctt 360 ctttctctcc gcacacctcc tctgacctgc gtcagtcctc actgcgcctt ctgctgtgtt 420 ttgcgcactg ctgtcctctg acctctgccc ttg 453 <210> 41 <211> 627 <212> DNA <213> AG14_502 <400> 41 ggatgagacc ctaagaaaag acttgagtac ttggatttaa cggaggacat gacacaaacg 60 agcgcaatag cgttctagga ttcatatagc cgaccccact tagtgggaaa aggctttgtt 120 gttgttgttg ttgtatatga atatatataa ataaaaaata aaaatacaaa ctataaaaga 180 aggttgtcaa ggtcagctag gtcggactgc tggatatctg ctgggtggag cggctgggag 240 ctcaaagatg gctgaggagc aattggtggc atcgggaatt cgaaagccaa agaactgaag 300 ggcgtgtaag atctgactca tcttatcacc caggtcgcaa gctgagcatc ttgggccgta 360 agcttctgat ccaagtcctc aacttcctac atcaaagtgg tgacatgttt cgtgctatct 420 ctggaataag agacagtagt gtcacgatgt ggcgcatccc ctatcttttg gtaaatctta 480 tcaaacctat aatcgagggt cttatccagg gtcttagtca agatctgaag acccgcatat 540 tcatatttaa ttaaaattta tacttttaat gaatgtaaaa tataacagtt acataaattt 600 acatcgagct gctcaatggt ctcatcc 627 <210> 42 <211> 566 <212> DNA <213> AN8_566 <400> 42 acctcagctc tacatgatgc cgaatctact tgagtattta cacactcaag ggggagtgtt 60 ataaacattg tatttaagtg tgattgtgta aaccctagat tagatttgat tctagtttgt 120 tttccatatt aggacttgta ttccttggag gaaaaggatt cttccatccc ttattaatat 180 aaataaagac aatgcgtagg ggaataacgc atcctctaca caaccctaca aacacatctc 240 tctccactct ctctcccatg tcagattaaa ataagccaca acactaagct atttctacac 300 catttcttac atccttttca ccttttcata ctatcttacc ttattttaat gtctaaaata 360 ttaccacatg gataagtttt aaatacttta taaaaactta atttaaaatc atttaaaact 420 aagtttaaaa tgattaaaca aaaaattaaa agctatagaa caaaaacaat taaagttgtt 480 attttcacaa tgaggaagac tcaattcatg caaggagaga aagagccatg ggcaaaggag 540 attatatgca atgaccgagc tgaggt 566 <210> 43 <211> 574 <212> DNA <213> AK17_574 <400> 43 cccagctgtg tatttacctt ttctttattt gtttattcat gttttctgtt gtttttgttt 60 agaaggatgt agaatatgaa ccaaaggatg tttatgggga agtttcaaag actcatcacg 120 ctatacagta agtcatgctg cagctcaact cattttgttg aagttgactc aacattatgt 180 cttatgactc gtcgaaattg cagcacgctg gataaaaaaa tttcaaattt ggagatggaa 240 ttagctgctg caaaggctgc acaggaatct atacttagtg gttcaccgat tgcagaaaat 300 ttaagaattc ccgcgacaag aaataaaaga aagtatttga tggtcgtagg aataaacact 360 gcttttagca gtcgaaagcg cagagattca gttcgtgcta cttggatgcc tcaaggtttt 420 ttatcgacaa cctactttct ttatattttc taattatatg tgaatgcctc tgacaattcc 480 cttatacttt gtctttacta tatagcggat aaaagaaagc agcttgagga aaaaaagggc 540 attgtagttc gcttcgtaat aggtcacagc tggg 574 <210> 44 <211> 575 <212> DNA <213> AK14_575 <400> 44 cccgctacac ccattttgtg tacgtgttga tgtttcaccg cccaacattc tgtgccatac 60 actaattctg tgctcatacc tataggtaac acaccatttt gtgtacgtgt tgatgtttca 120 ccgcccaaca ttctgtgcca taaaaatttt aaattaaatg atgtgtcacc tataggtatg 180 agcacatttg tcgacgctta agtaataatc caataataac aaccacatca ttttatttgc 240 aaattttatt taaaaaaatt tgatcacctt aacattatcc aaacaaaaat cgtgctttca 300 cttatcataa agcgcaaagc ctaatttttg caccaatttt tttttcttac atagttgtag 360 cacttagttt aacaagttca cgtttctcta ttaggttaaa gactaatggc attgtttgat 420 tcgattacat ataaaataaa aagtgaagtc atagtgttga ggaagccagt ctatgcatga 480 ggtcgaaaaa agcttggaag tgtagtgaca tgatgaagga tgattgtgtc gggattccct 540 ccttatagtg gagtcctttg gctatgtgta gcggg 575 <210> 45 <211> 592 <212> DNA <213> A408_592 <400> 45 ccgtctcttt actataacta acccttcttc atcgttgatg tctattgaac actatggttt 60 tttaatttga aagttctaaa ctttctagta gctttgatta aattatggac ctttttattg 120 agattgagaa cttaagaaga accccttgcg aagccccttt tgaatgttac aacatggtgg 180 cctccagtgg aaaaacgatg catggaaagt acatgagcca caaatttatg gaatttttta 240 gtagcattga tgtatgattt cagtggcgga tgtacattgt gattgaaatg gtctcagaat 300 tactcgaggt tcaggaaata tacaggtgaa ggtttttcga ggatcctttg aacgtttagt 360 aaggatcctt tttgtgccca ccaagtattt attgtaatgt ctgctagcat atctcagcaa 420 cactcaacaa gttgcagcgg aagtactcaa caaaatttct caataacact tatcagattg 480 ctttggcata tgtcggtatc tgttgacatg tacgcaatat gagcgacaat aaattaccaa 540 gtgttcgacc aaatactgtg aacacggaaa attcctgaaa cgaaagagac gg 592 <210> 46 <211> 653 <212> DNA <213> AK17_653 <400> 46 cccagctgtg acataacaaa aaatatctaa gagtgaggtg tccctttaga ttcaagtccg 60 tgatactaca agtttgtgaa atgactgacc cataaatgat ttaggttatt ctaacaacat 120 cgaattcttc tgaaacataa acccatgctc gcaagtcaaa atgttgcttc actctagcat 180 cgttgtatac gagctgcgca agggtggtct ttccgatgcc acccattccc acaaccggaa 240 tcacactcaa cttattgcca ttcgcatcat cggatagcaa cagtttcaca atggcctcct 300 tgtcctcatc cctaccgtac acaccgtcct cttccaccaa agaagtggca gataatcttg 360 attgtggtcg ccgattggga acaccctctt tcaaaccaag cacatctttc tcattcacaa 420 taaattctaa cctctcaagc attcctacaa tcttcggttc cattgttttg tcaaattcat 480 caatccaagt ggaactggag atccgtacct gaatttttct gctgctgctg ctgctttctg 540 attcatcgcc ttcgagcttt cgccgcagag cttcagtctt gatcacatcc agcaggtcgt 600 ctgcagcata cagagcatct ttaagttcgt cgagccactc cctcacagct ggg 653 <210> 47 <211> 752 <212> DNA <213> AM16_708 <400> 47 gtaaccagcc agataagtac caaaaccatt tctcaaaaac tcgtattaaa acactggagc 60 tcaaaacctc aaaatatcat ttcataaacc ataataagtc atattcgtaa accatagaat 120 tccatgtata gaaatctcat aattcaactt tagtaaaacg taaattcgag aaaacataat 180 atgcaaatcc ataaaacata ttcaattcat gaaatatgca atgcatgcaa acctaatatt 240 ttataaaaac atgcatgttt agaaggggtc cactcacagg tattccattg ctcgagagcc 300 actcgaacca gcgagaatgg tgtcactttc caccgatgca cctgaccaca attagggatc 360 atttactaaa aatctactaa aacgttagaa tttgggaaaa ctgatggcga atttggaatc 420 tggatgtcaa aactagccta agagacgtcc cggccgaaat ctgaaaatgt caacccaaaa 480 gtcaacattg atcggtcaac agtcaacgaa aagtcaatgg gtctgggctt gggtcggatc 540 cgattattgg gttgggtcta ggctacggtt attgggctaa ggctttgggt tgatttaata 600 ggttggattt taggttggat aacatattgg acttgggccg gggttatttg gtttggactt 660 aggttggaat cggtttgagt tgagtgggtt gggacccata gctaattaaa ttgggccgac 720 ctagcagttg ggttggttat tgggctggtt ac 752 <210> 48 <211> 711 <212> DNA <213> AO4_711 <400> 48 aagtccgctc accagtaaca taaaaaaata gcaatatgtg tgtgattttt ttatctttat 60 tatgtttttg ttgtaaaatc gactgtgggt gcagtggaat aaatgaaaca agacacaaaa 120 tttacgaggt tcctctacag tcagtgtgac tggagtacgt cctcggggca gcagtggtgc 180 tttcattata atttgaaata ataggagtac aaagataact ctctctatta tctcctctta 240 tcttcttcta tcttctctct tcctcttcct tctctctctt cctcttcctt ccttcctctc 300 tttctttccc gtgaaccctt cacatctatc tatccctttg ttgtgtttca taaggcttgt 360 ttttatacaa gtaaatcaca tgctaaatag tggaagggca acttgcccat tatttgagtg 420 gacatccatt tctacaacac tcccccttgg atggccacaa gtcttcgatt gactcgttaa 480 aatcttgatc tgttttgaat gctcccactg atgagtatct ccccctgatt tcaaatcatt 540 taggttgatc gttgatcgtt ctgctttagt ctcttagtaa gaagagttgc tgaaagagtt 600 gctttactta ttgttaactt tccacagcct ttttcttgaa ctgggttgta ggactttctg 660 ctagactagc atcgaagatc ggaatttact ccttttatct ggagcggact t 711 <210> 49 <211> 779 <212> DNA <213> AO4_779 <400> 49 aagtccgctc aaatccacct caagatcaag tccacggccc ttgaagaacg ttcatcctta 60 gatcaagccc aacggccttt tggatcagtc acatatccac aaatacacac cttacggaga 120 tcgaatcaga ggatcaaatt taagagagat tgtaacccaa aatcatcaaa tacaaatatt 180 ttgtttgtgc acgttgttct tgtctctttc gtttcaggaa ttttccatgt tcacagtact 240 gtcccttatt cttaaaattt tgggtattac gtgctaagga tcacacttct ggccatgatg 300 ccaccccttg gcaagtcttg attctaccat atgttgtgaa accaacccta aagtggtgag 360 aagaaagata gattcagact tgggttcaga aggttccaat taaagctagg cgggtttgtt 420 cggtattctc cagtcgaagc tggatgagca gattcggtaa gcgtctgtcg aaacagagac 480 ttttggttgg tacacctctg ccaaagtaga gcatatcatt caatacatct acgctgaagt 540 aggcatgcca ttcattgggc tccaatcaaa aggataattt aatgaacttc cgttctctac 600 gttgctactt caaaagtatg ctagaggcat aaacggacga gaaaaatctt ctctagtcaa 660 aattcaatcg aattctataa acttcaaaat tttatttatt catggatgta aaagttttaa 720 tcatgttttg cttcaagcaa gatcatctct catgattgaa cagtctgtag agcggactt 779 <210> 50 <211> 789 <212> DNA <213> AT14_789 <400> 50 aatgccgcag cagataagta atctctagct tcttttatcc gttgcaaata taaagaaatg 60 aaatcattac cctttttgat attctgaagt tcggatttca attaaaagat actggtatga 120 gtcactgtgg aaaattgctc ttttaggcga ttccagatat cttgagcact tgtactgcca 180 ataacacata gatagcttaa gagataaggt ttagtgtgta aagaatataa gtatgtaatg 240 atctcaacgg taaatgtaat gaaattcttg agttttgaat gactctctct ttcttcttct 300 caaagctatc tttgctcttc tcctcttcat ttcttcttct tcatcatact acagtaaggt 360 ttacatggta tcatcgccgg aattgctaat cgctcggtaa tcaatcttgg ttctattgct 420 tccgctctat atctttcctc tctctctgat cctaattctt ctcttcttga attctttggt 480 tttttttgtg cttcttcagc agtgatcgag caagaactag tttcttgcac accaggtgtt 540 tgttaaaacg tttttgagat attgaaattc aaattgttca acaatggtga catcttttca 600 gctccagatt gtccagtctc cgattacggc tcttatctcc atagtttcta cttctgtgac 660 agccaagctt gatgaatcaa actacctgac ttggaacttt caggttcaat tgatgcttga 720 aggtaatgga attatggggt ttgttgatgg gtcaatgatg tgtccttcaa ggtttcttac 780 tgcggcatt 789 <210> 51 <211> 868 <212> DNA <213> AL1_851 <400> 51 ggcatgacct cccactacat caaagcttaa agactcaagc agcttgacgg gcactacttt 60 acaagtcgat gactatccag ttgttataca gttcctacct tacaactaag ttttcattcg 120 tttcactcat ttttcaatga tgaattcaga agtaatttac aacttggccc tagtgcatgc 180 ttacaacaac tgatcactca tgcacttcaa aataagacca cgcttttctt agggtctcat 240 cccaggaatt gcaccctccg aatgaccaac catgccctcc agtgcgagag ggtaaaccaa 300 ttccccgaca cccgcatgag ttcgctttcc aatgcaggag gataaactct acactctgaa 360 tatccagaag tggctaagtt gcacgatggc ttgcatcgga attcctagaa atagccacaa 420 tggtctttct caaggcttag ctaactaaag gattttgggt ttctttgctt aatttgcgag 480 gaatcggtcc ccaaagactg tacaccctat ggacggctgc cctggaaccc taaagcttct 540 atcgagtgta ttatcgtagc ttatggtttc cagaagactg cctacggttt gccttttgag 600 cagtaagccg cgttaaactt atacaattgc actttttatg aaaggttaaa catgttagcg 660 tgtatatact aagcttcatc cattgccgac atgctacgca atcgatgatc ttcacttctg 720 ccaaaacgca gaatgattta cactaattcc taaagtgttg tgatacttgc tacgcaacac 780 ataaaattgg atacacaaag tatgttgtga tgtaggccac acagctcaaa agattgaaaa 840 aagccaaagt taacagccag gtcatgcc 868 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SCAR markers for discrimination of apple cultivars and use          the <130> PN09273 <160> 51 <170> Kopatentin 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AL1_343 f primer <400> 1 ggcatgacct caaacatgac aatatt 26 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AL1_343 r primer <400> 2 ggcatgacct agccgtccta ggtt 24 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AW15_368 f primer <400> 3 ggatatgtac gtggaaactt tggtttc 27 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AW15_368 r primer <400> 4 acaccggaac tatatgtaaa caatctga 28 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A330_424 f primer <400> 5 gatatttccg tgttttcgga ctac 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A330_424 r primer <400> 6 ggtggtttcc taagtagagc caca 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AL1_427 f primer <400> 7 acaactgggg aggcacaagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AL1_427 r primer <400> 8 acaactgggg gtcctcatcc 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> AN11_433 f primer <400> 9 cgccgcaaag gaagaacaac aagaaa 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AN11_433 r primer <400> 10 cgccgcaaag ccaccttgct gatg 24 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT6_453 f primer <400> 11 caagggcaga cagacatata ttcatag 27 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AT6_453 r primer <400> 12 caagggcaga ggtcagagga cagc 24 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AG14_502 f primer <400> 13 agtacttgga tttaacggag gacatga 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AG14_502 r primer <400> 14 cagatcttga ctaagaccct ggataag 27 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AN8_566 f primer <400> 15 acctcagctc tacatgatgc cgaa 24 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AN8_566 r primer <400> 16 acctcagctc ggtcattgca tataa 25 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_574 f primer <400> 17 cccagctgtg tatttacctt ttct 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_574 r primer <400> 18 cccagctgtg acctattacg aagc 24 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK14_575 f primer <400> 19 cccgctacac ccattttgtg tacgtgt 27 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK14_575 r primer <400> 20 tagccaaagg actccactat aaggagg 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> A408_592 f primer <400> 21 ccgtctcttt actataacta acccttc 27 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> A408_592 r primer <400> 22 ccgtctcttt cgtttcagga attttcc 27 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AK17_653 f primer <400> 23 cccagctgtg acataacaaa aaatatc 27 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AK17_653 r primer <400> 24 cccagctgtg agggagtggc tcga 24 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AM16_708 f primer <400> 25 attaaaacac tggagctcaa aacctcaa 28 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AM16_708 r primer <400> 26 gtaaccagcc caataaccaa cccaact 27 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AO4_711 f primer <400> 27 aagtccgctc accagtaaca taaaa 25 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AO4_711 r primer <400> 28 aagtccgctc cagataaaag gagt 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AO4_779 f primer <400> 29 aagtccgctc aaatccacct caag 24 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> AO4_779 r primer <400> 30 aagtccgctc tacagactgt tcaat 25 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT14_789 f primer <400> 31 aatgccgcag cagataagta atctcta 27 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AT14_789 r primer <400> 32 aatgccgcag taagaaacct tgaagga 27 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AL1_851 f primer <400> 33 catcaaagct taaagactca agcagctt 28 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AL1_851 r primer <400> 34 ggcatgacct ggctgttaac tttg 24 <210> 35 <211> 343 <212> DNA <213> AL1_343 <400> 35 ggcatgacct caaacatgac aatattttat atgttcataa cttctgtccc tgcttaaatt 60 atagctgagt tagcatcagt taaattatta cagttttacc agtcattcaa gtaacccaat 120 aaatataatg tactaaatta ggggtgtgat atccacacac gattttttac ttttctcata 180 ttcttttaaa tttcgatcat tagatcggat gtattgaaaa atatctgttt ggacccaaaa 240 tattagtttg ggccgagtat agaatcattc tcggcccggg aggccttacg acaagggtat 300 catggatcgt gggcctccaa acctaggacg gctaggtcat gcc 343 <210> 36 <211> 428 <212> DNA <213> AW15_368 <400> 36 acaccggaac aagacatttg caggattgtg ctcgacactc ctgttaggta cgcacaagcg 60 gatatgtacg tggaaacttt ggtttcaccg gtgattggcg gcggctagct catacatttg 120 atttgaagca taccaactgg tattatgagc ctttcctttg ctttgctctt tctattaatg 180 taacaatata acgtaattgt catacatatt aagatactgg ctattatcta ttgctattta 240 ctgctttcat gatcatgtac atttgtgtgc ggtgtgtata cttagcccga tcgatgcaaa 300 tccaagctgc gtttatgcat atacatatat aattgtggaa gagaatgaga tctgttagtg 360 tagggaaaaa caaagattga aacatgcatg tttaccttca tcagattgtt tacatatagt 420 tccggtgt 428 <210> 37 <211> 477 <212> DNA <213> A330_424 <400> 37 ggtggtttcc atgtaatttt tatcgatatc gatattatcc cgatatttcc atcgatattt 60 ccgtgttttc ggactaccga tatttccgat attaccgata ttttcttcct tggttccaag 120 ctatcctctc tccctttaga ttttgctgag catgccctac ttggctatta catttcgttt 180 ccgttacata taattcaatg taggacggac ccatgtacga ggaatgttat aggattaaga 240 gcaaacaaaa caactaccac ttatattact ttcgttttaa attacattca agttttttat 300 ataaaacatt cacgcttact aactatatga gtatttaagt gaagacaaat attaatgtga 360 ttaaggataa acagcggtcc agctcctctc tgaaacccaa acaaaccata cccattgttt 420 cacgtacgtc gtcatttggt tcttgaccaa atatgtggct ctacttagga aaccacc 477 <210> 38 <211> 427 <212> DNA <213> AL1_427 <400> 38 acaactgggg aggcacaagg tagtattcag agtccaatag taaccttcta atcatgtgag 60 aaactagggc agcctgtttt atccagtttc tatcgaaagt atgaattgac atgttggaca 120 tcatgaagta aacgttcgag gacatgacgc ctcatataaa agcgacgttt gaaatcctct 180 tcattgtaca tcaagttggg gttgaagtag ttggtcatca gattatgatg tgccatatct 240 ctattttgtg gcttgtaacc acgaccagca atatggtcac cttattgagg ttgttcttca 300 gttgcttcac acgccatgac cccagccatg gctgtcatat atgatgcatt gtgccatgct 360 tcatcttctc gtctcatttt tgcccattta tcttccaatt cggaattgga tgaggacccc 420 cagttgt 427 <210> 39 <211> 433 <212> DNA <213> AN11_433 <400> 39 tcgccgcaaa ggaagaacaa caagaaaatc tactcctctt cagaacaaga gtgttgaatt 60 gtttagaggt tcagaatact ttgattgcta tatattaagg aaattggctg tttaatacgc 120 cagttgactt ggaagttagg agacggaaga cttgtagaaa ctaacaatgt aaaaaagttg 180 cttgatacac gctgtttgat tagttggctt aaagacttcc gtggcctatc agggagtttc 240 cttcccaact tccccaatga ccagcaccag aaagactttg accccttgac tcttcaacca 300 ttttcgtcac gaacaggtcc ttcaaactgt tcctctgagg cggaatcttc tccgatagcg 360 gcatcggaac cggcggctca cggcggcgac tgctgctccg ggtcaggagc atcagcaagg 420 tgggtttgcg gcg 433 <210> 40 <211> 453 <212> DNA <213> AT6_453 <400> 40 caagggcaga cagacatata ttcatagcat taaaatccta tatatgctca ttatatgcat 60 ccatagaaac acataaagaa tttatcaatg acataagtag tgaaacaatt tgcatccttt 120 cataaaagtc attcaaacaa aatatcacaa caaatttacg atcatattcg gggcttcaaa 180 acagcccata actactaaaa atcagttaca cattattctc aaattaaacc aaaagtaaaa 240 catatttgaa aagataaaac taagaaaaga agatctgccg tgcgtccgtg cctctgtgct 300 ctgctgcttc cctcttcctg cgcactgcct tctgtcctca cgtcagctct cctgcctctt 360 ctttctctcc gcacacctcc tctgacctgc gtcagtcctc actgcgcctt ctgctgtgtt 420 ttgcgcactg ctgtcctctg acctctgccc ttg 453 <210> 41 <211> 627 <212> DNA <213> AG14_502 <400> 41 ggatgagacc ctaagaaaag acttgagtac ttggatttaa cggaggacat gacacaaacg 60 agcgcaatag cgttctagga ttcatatagc cgaccccact tagtgggaaa aggctttgtt 120 gttgttgttg ttgtatatga atatatataa ataaaaaata aaaatacaaa ctataaaaga 180 aggttgtcaa ggtcagctag gtcggactgc tggatatctg ctgggtggag cggctgggag 240 ctcaaagatg gctgaggagc aattggtggc atcgggaatt cgaaagccaa agaactgaag 300 ggcgtgtaag atctgactca tcttatcacc caggtcgcaa gctgagcatc ttgggccgta 360 agcttctgat ccaagtcctc aacttcctac atcaaagtgg tgacatgttt cgtgctatct 420 ctggaataag agacagtagt gtcacgatgt ggcgcatccc ctatcttttg gtaaatctta 480 tcaaacctat aatcgagggt cttatccagg gtcttagtca agatctgaag acccgcatat 540 tcatatttaa ttaaaattta tacttttaat gaatgtaaaa tataacagtt acataaattt 600 acatcgagct gctcaatggt ctcatcc 627 <210> 42 <211> 566 <212> DNA <213> AN8_566 <400> 42 acctcagctc tacatgatgc cgaatctact tgagtattta cacactcaag ggggagtgtt 60 ataaacattg tatttaagtg tgattgtgta aaccctagat tagatttgat tctagtttgt 120 tttccatatt aggacttgta ttccttggag gaaaaggatt cttccatccc ttattaatat 180 aaataaagac aatgcgtagg ggaataacgc atcctctaca caaccctaca aacacatctc 240 tctccactct ctctcccatg tcagattaaa ataagccaca acactaagct atttctacac 300 catttcttac atccttttca ccttttcata ctatcttacc ttattttaat gtctaaaata 360 ttaccacatg gataagtttt aaatacttta taaaaactta atttaaaatc atttaaaact 420 aagtttaaaa tgattaaaca aaaaattaaa agctatagaa caaaaacaat taaagttgtt 480 attttcacaa tgaggaagac tcaattcatg caaggagaga aagagccatg ggcaaaggag 540 attatatgca atgaccgagc tgaggt 566 <210> 43 <211> 574 <212> DNA <213> AK17_574 <400> 43 cccagctgtg tatttacctt ttctttattt gtttattcat gttttctgtt gtttttgttt 60 agaaggatgt agaatatgaa ccaaaggatg tttatgggga agtttcaaag actcatcacg 120 ctatacagta agtcatgctg cagctcaact cattttgttg aagttgactc aacattatgt 180 cttatgactc gtcgaaattg cagcacgctg gataaaaaaa tttcaaattt ggagatggaa 240 ttagctgctg caaaggctgc acaggaatct atacttagtg gttcaccgat tgcagaaaat 300 ttaagaattc ccgcgacaag aaataaaaga aagtatttga tggtcgtagg aataaacact 360 gcttttagca gtcgaaagcg cagagattca gttcgtgcta cttggatgcc tcaaggtttt 420 ttatcgacaa cctactttct ttatattttc taattatatg tgaatgcctc tgacaattcc 480 cttatacttt gtctttacta tatagcggat aaaagaaagc agcttgagga aaaaaagggc 540 attgtagttc gcttcgtaat aggtcacagc tggg 574 <210> 44 <211> 575 <212> DNA <213> AK14_575 <400> 44 cccgctacac ccattttgtg tacgtgttga tgtttcaccg cccaacattc tgtgccatac 60 actaattctg tgctcatacc tataggtaac acaccatttt gtgtacgtgt tgatgtttca 120 ccgcccaaca ttctgtgcca taaaaatttt aaattaaatg atgtgtcacc tataggtatg 180 agcacatttg tcgacgctta agtaataatc caataataac aaccacatca ttttatttgc 240 aaattttatt taaaaaaatt tgatcacctt aacattatcc aaacaaaaat cgtgctttca 300 cttatcataa agcgcaaagc ctaatttttg caccaatttt tttttcttac atagttgtag 360 cacttagttt aacaagttca cgtttctcta ttaggttaaa gactaatggc attgtttgat 420 tcgattacat ataaaataaa aagtgaagtc atagtgttga ggaagccagt ctatgcatga 480 ggtcgaaaaa agcttggaag tgtagtgaca tgatgaagga tgattgtgtc gggattccct 540 ccttatagtg gagtcctttg gctatgtgta gcggg 575 <210> 45 <211> 592 <212> DNA <213> A408_592 <400> 45 ccgtctcttt actataacta acccttcttc atcgttgatg tctattgaac actatggttt 60 tttaatttga aagttctaaa ctttctagta gctttgatta aattatggac ctttttattg 120 agattgagaa cttaagaaga accccttgcg aagccccttt tgaatgttac aacatggtgg 180 cctccagtgg aaaaacgatg catggaaagt acatgagcca caaatttatg gaatttttta 240 gtagcattga tgtatgattt cagtggcgga tgtacattgt gattgaaatg gtctcagaat 300 tactcgaggt tcaggaaata tacaggtgaa ggtttttcga ggatcctttg aacgtttagt 360 aaggatcctt tttgtgccca ccaagtattt attgtaatgt ctgctagcat atctcagcaa 420 cactcaacaa gttgcagcgg aagtactcaa caaaatttct caataacact tatcagattg 480 ctttggcata tgtcggtatc tgttgacatg tacgcaatat gagcgacaat aaattaccaa 540 gtgttcgacc aaatactgtg aacacggaaa attcctgaaa cgaaagagac gg 592 <210> 46 <211> 653 <212> DNA <213> AK17_653 <400> 46 cccagctgtg acataacaaa aaatatctaa gagtgaggtg tccctttaga ttcaagtccg 60 tgatactaca agtttgtgaa atgactgacc cataaatgat ttaggttatt ctaacaacat 120 cgaattcttc tgaaacataa acccatgctc gcaagtcaaa atgttgcttc actctagcat 180 cgttgtatac gagctgcgca agggtggtct ttccgatgcc acccattccc acaaccggaa 240 tcacactcaa cttattgcca ttcgcatcat cggatagcaa cagtttcaca atggcctcct 300 tgtcctcatc cctaccgtac acaccgtcct cttccaccaa agaagtggca gataatcttg 360 attgtggtcg ccgattggga acaccctctt tcaaaccaag cacatctttc tcattcacaa 420 taaattctaa cctctcaagc attcctacaa tcttcggttc cattgttttg tcaaattcat 480 caatccaagt ggaactggag atccgtacct gaatttttct gctgctgctg ctgctttctg 540 attcatcgcc ttcgagcttt cgccgcagag cttcagtctt gatcacatcc agcaggtcgt 600 ctgcagcata cagagcatct ttaagttcgt cgagccactc cctcacagct ggg 653 <210> 47 <211> 752 <212> DNA <213> AM16_708 <400> 47 gtaaccagcc agataagtac caaaaccatt tctcaaaaac tcgtattaaa acactggagc 60 tcaaaacctc aaaatatcat ttcataaacc ataataagtc atattcgtaa accatagaat 120 tccatgtata gaaatctcat aattcaactt tagtaaaacg taaattcgag aaaacataat 180 atgcaaatcc ataaaacata ttcaattcat gaaatatgca atgcatgcaa acctaatatt 240 ttataaaaac atgcatgttt agaaggggtc cactcacagg tattccattg ctcgagagcc 300 actcgaacca gcgagaatgg tgtcactttc caccgatgca cctgaccaca attagggatc 360 atttactaaa aatctactaa aacgttagaa tttgggaaaa ctgatggcga atttggaatc 420 tggatgtcaa aactagccta agagacgtcc cggccgaaat ctgaaaatgt caacccaaaa 480 gtcaacattg atcggtcaac agtcaacgaa aagtcaatgg gtctgggctt gggtcggatc 540 cgattattgg gttgggtcta ggctacggtt attgggctaa ggctttgggt tgatttaata 600 ggttggattt taggttggat aacatattgg acttgggccg gggttatttg gtttggactt 660 aggttggaat cggtttgagt tgagtgggtt gggacccata gctaattaaa ttgggccgac 720 ctagcagttg ggttggttat tgggctggtt ac 752 <210> 48 <211> 711 <212> DNA <213> AO4_711 <400> 48 aagtccgctc accagtaaca taaaaaaata gcaatatgtg tgtgattttt ttatctttat 60 tatgtttttg ttgtaaaatc gactgtgggt gcagtggaat aaatgaaaca agacacaaaa 120 tttacgaggt tcctctacag tcagtgtgac tggagtacgt cctcggggca gcagtggtgc 180 tttcattata atttgaaata ataggagtac aaagataact ctctctatta tctcctctta 240 tcttcttcta tcttctctct tcctcttcct tctctctctt cctcttcctt ccttcctctc 300 tttctttccc gtgaaccctt cacatctatc tatccctttg ttgtgtttca taaggcttgt 360 ttttatacaa gtaaatcaca tgctaaatag tggaagggca acttgcccat tatttgagtg 420 gacatccatt tctacaacac tcccccttgg atggccacaa gtcttcgatt gactcgttaa 480 aatcttgatc tgttttgaat gctcccactg atgagtatct ccccctgatt tcaaatcatt 540 taggttgatc gttgatcgtt ctgctttagt ctcttagtaa gaagagttgc tgaaagagtt 600 gctttactta ttgttaactt tccacagcct ttttcttgaa ctgggttgta ggactttctg 660 ctagactagc atcgaagatc ggaatttact ccttttatct ggagcggact t 711 <210> 49 <211> 779 <212> DNA <213> AO4_779 <400> 49 aagtccgctc aaatccacct caagatcaag tccacggccc ttgaagaacg ttcatcctta 60 gatcaagccc aacggccttt tggatcagtc acatatccac aaatacacac cttacggaga 120 tcgaatcaga ggatcaaatt taagagagat tgtaacccaa aatcatcaaa tacaaatatt 180 ttgtttgtgc acgttgttct tgtctctttc gtttcaggaa ttttccatgt tcacagtact 240 gtcccttatt cttaaaattt tgggtattac gtgctaagga tcacacttct ggccatgatg 300 ccaccccttg gcaagtcttg attctaccat atgttgtgaa accaacccta aagtggtgag 360 aagaaagata gattcagact tgggttcaga aggttccaat taaagctagg cgggtttgtt 420 cggtattctc cagtcgaagc tggatgagca gattcggtaa gcgtctgtcg aaacagagac 480 ttttggttgg tacacctctg ccaaagtaga gcatatcatt caatacatct acgctgaagt 540 aggcatgcca ttcattgggc tccaatcaaa aggataattt aatgaacttc cgttctctac 600 gttgctactt caaaagtatg ctagaggcat aaacggacga gaaaaatctt ctctagtcaa 660 aattcaatcg aattctataa acttcaaaat tttatttatt catggatgta aaagttttaa 720 tcatgttttg cttcaagcaa gatcatctct catgattgaa cagtctgtag agcggactt 779 <210> 50 <211> 789 <212> DNA <213> AT14_789 <400> 50 aatgccgcag cagataagta atctctagct tcttttatcc gttgcaaata taaagaaatg 60 aaatcattac cctttttgat attctgaagt tcggatttca attaaaagat actggtatga 120 gtcactgtgg aaaattgctc ttttaggcga ttccagatat cttgagcact tgtactgcca 180 ataacacata gatagcttaa gagataaggt ttagtgtgta aagaatataa gtatgtaatg 240 atctcaacgg taaatgtaat gaaattcttg agttttgaat gactctctct ttcttcttct 300 caaagctatc tttgctcttc tcctcttcat ttcttcttct tcatcatact acagtaaggt 360 ttacatggta tcatcgccgg aattgctaat cgctcggtaa tcaatcttgg ttctattgct 420 tccgctctat atctttcctc tctctctgat cctaattctt ctcttcttga attctttggt 480 tttttttgtg cttcttcagc agtgatcgag caagaactag tttcttgcac accaggtgtt 540 tgttaaaacg tttttgagat attgaaattc aaattgttca acaatggtga catcttttca 600 gctccagatt gtccagtctc cgattacggc tcttatctcc atagtttcta cttctgtgac 660 agccaagctt gatgaatcaa actacctgac ttggaacttt caggttcaat tgatgcttga 720 aggtaatgga attatggggt ttgttgatgg gtcaatgatg tgtccttcaa ggtttcttac 780 tgcggcatt 789 <210> 51 <211> 868 <212> DNA <213> AL1_851 <400> 51 ggcatgacct cccactacat caaagcttaa agactcaagc agcttgacgg gcactacttt 60 acaagtcgat gactatccag ttgttataca gttcctacct tacaactaag ttttcattcg 120 tttcactcat ttttcaatga tgaattcaga agtaatttac aacttggccc tagtgcatgc 180 ttacaacaac tgatcactca tgcacttcaa aataagacca cgcttttctt agggtctcat 240 cccaggaatt gcaccctccg aatgaccaac catgccctcc agtgcgagag ggtaaaccaa 300 ttccccgaca cccgcatgag ttcgctttcc aatgcaggag gataaactct acactctgaa 360 tatccagaag tggctaagtt gcacgatggc ttgcatcgga attcctagaa atagccacaa 420 tggtctttct caaggcttag ctaactaaag gattttgggt ttctttgctt aatttgcgag 480 gaatcggtcc ccaaagactg tacaccctat ggacggctgc cctggaaccc taaagcttct 540 atcgagtgta ttatcgtagc ttatggtttc cagaagactg cctacggttt gccttttgag 600 cagtaagccg cgttaaactt atacaattgc actttttatg aaaggttaaa catgttagcg 660 tgtatatact aagcttcatc cattgccgac atgctacgca atcgatgatc ttcacttctg 720 ccaaaacgca gaatgattta cactaattcc taaagtgttg tgatacttgc tacgcaacac 780 ataaaattgg atacacaaag tatgttgtga tgtaggccac acagctcaaa agattgaaaa 840 aagccaaagt taacagccag gtcatgcc 868  

Claims (9)

표 1에 기재된 AL1_343 (서열번호 35), AW15_368 (서열번호 36), A330_424 (서열번호 37), AL1_427 (서열번호 38), AN11_433 (서열번호 39), AT6_453 (서열번호 40), AG14_502 (서열번호 41), AN8_566 (서열번호 42), AK17_574 (서열번호 43), AK14_575 (서열번호 44), A408_592 (서열번호 45), AK17_653 (서열번호 46), AM16_708 (서열번호 47), AO4_711 (서열번호 48), AO4_779 (서열번호 49), AT14_789 (서열번호 50) 및 AL1_851 (서열번호 51)을 포함하는, 사과의 품종 판별용 SCAR(Sequence Chracterized Amplified Region) 마커.AL1_343 (SEQ ID NO: 35), AW15_368 (SEQ ID NO: 36), A330_424 (SEQ ID NO: 37), AL1_427 (SEQ ID NO: 38), AN11_433 (SEQ ID NO: 39), AT6_453 (SEQ ID NO: 40), AG14_502 (SEQ ID NO: 41), AN8_566 (SEQ ID NO: 42), AK17_574 (SEQ ID NO: 43), AK14_575 (SEQ ID NO: 44), A408_592 (SEQ ID NO: 45), AK17_653 (SEQ ID NO: 46), AM16_708 (SEQ ID NO: 47), AO4_711 (SEQ ID NO: 48) ), Sequence Chracterized Amplified Region (SCAR) marker for apple variety, including AO4_779 (SEQ ID NO: 49), AT14_789 (SEQ ID NO: 50), and AL1_851 (SEQ ID NO: 51). 제1항에 있어서, 상기 SCAR 마커는 사과의 국내육성 품종인 홍로, 서광, 추광, 새나라, 감홍, 화홍, 선홍, 서홍, 썸머드림, 홍금, 만복, 홍소, 홍안, 여홍, 그린볼, 및 피크닉의 16 종 및 기존 품종인 쓰가루, 산사, 조나골드, 골든델리셔스, 레드델리셔스, 후지, 핑크레이디, 갈라, 모리스델리셔스, 천추, 조나단, 홍월, 국광, 양광, 및 스퍼어얼리블레이즈의 15 종을 대상으로 한 RAPD(Random Amplified Polymorphic DNA) 분석으로부터 얻어진 것을 특징으로 하는 SCAR 마커.The method of claim 1, wherein the SCAR marker is a domestically cultivated varieties of apple, Hongro, Seogwang, Chuo, Saenara, Gamhong, Huahong, Shenhong, Seohong, Summer Dream, Hongum, Manbok, Hongso, Hongan, Yeohong, Greenball, and Picnic 16 species and 15 varieties of Tsugaru, Sansa, Jona Gold, Golden Delhi, Red Delhi, Fuji, Pink Lady, Gala, Mauritius, Schuchu, Jonathan, Hongwol, Guangwang, Sunshine, and Spherical Blaze SCAR markers obtained from RAPD (Random Amplified Polymorphic DNA) analysis. 제1항에 있어서, 상기 사과 품종은 홍로, 서광, 추광, 새나라, 감홍, 화홍, 선홍, 서홍, 썸머드림, 홍금, 만복, 홍소, 홍안, 여홍, 그린볼, 피크닉, 쓰가루, 산사, 조나골드, 골든델리셔스, 레드델리셔스, 후지, 핑크레이디, 갈라, 모리스델리셔스, 천추, 조나단, 홍월, 국광, 양광, 및 스퍼어얼리블레이즈로 이루어진 군으로부터 선택되는 2 이상인 것을 특징으로 하는 SCAR 마커.The method of claim 1, wherein the apple varieties are Hongro, Seogwang, Chuseok, Saenara, Gamhong, Huahong, Shenhong, Seohong, Summer Dream, Hongum, Manbok, Hongso, Hongan, Yeonhong, Greenball, Picnic, Tsugaru, Sansa, Jonah Gold SCAR marker, characterized in that at least two selected from the group consisting of, Golden Delhi, Red Delhi, Fuji, Pink Lady, Gala, Mauritius, Schuchu, Jonathan, Hongwol, Guangwang, Sunshine, and Spherical Blaze. 제1항에 따른 사과 품종 판별용 SCAR 마커를 증폭하기 위한 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 4의 올리고뉴클레오티드 프라이머 세트; 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 서열번호 9 및 10의 올리고뉴클레오티드 프라이머 세트; 서열번호 11 및 12의 올리고뉴클레오티드 프라이머 세트; 서열번호 13 및 14의 올리고뉴클레오티드 프라이머 세트; 서열번호 15 및 16의 올리고뉴클레오티드 프라이머 세트; 서열번호 17 및 18의 올리고뉴클레오티드 프라이머 세트; 서열번호 19 및 20의 올리고뉴클레오티드 프라이머 세트; 서열번호 21 및 22의 올리고뉴클레오티드 프라이머 세트; 서열번호 23 및 24의 올리고뉴클레오티드 프라이머 세트; 서열번호 25 및 26의 올리고뉴클레오티드 프라이머 세트; 서열번호 27 및 28의 올리고뉴클레오티드 프라이머 세트; 서열번호 29 및 30의 올리고뉴클레오티드 프라이머 세트; 서열번호 31 및 32의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 33 및 34의 올리고뉴클레오티드 프라이머 세트를 포함하는 올리고뉴클레오티드 SCAR 프라이머 세트.Oligonucleotide primer sets of SEQ ID NOs: 1 and 2 for amplifying the SCAR marker for identifying apple varieties according to claim 1; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; Oligonucleotide primer sets of SEQ ID NOs: 11 and 12; Oligonucleotide primer sets of SEQ ID NOs: 13 and 14; Oligonucleotide primer sets of SEQ ID NOs: 15 and 16; Oligonucleotide primer sets of SEQ ID NOs: 17 and 18; Oligonucleotide primer sets of SEQ ID NOs: 19 and 20; Oligonucleotide primer sets of SEQ ID NOs: 21 and 22; Oligonucleotide primer sets of SEQ ID NOs: 23 and 24; Oligonucleotide primer sets of SEQ ID NOs: 25 and 26; Oligonucleotide primer sets of SEQ ID NOs: 27 and 28; Oligonucleotide primer sets of SEQ ID NOs: 29 and 30; Oligonucleotide primer sets of SEQ ID NOs: 31 and 32; And an oligonucleotide primer set of SEQ ID NOs: 33 and 34. 삭제delete 제4항에 따른 올리고뉴클레오티드 SCAR 프라이머 세트; 및 DNA 폴리머라제, dNTPs 및 버퍼를 포함하는, 사과 품종을 판별하기 위한 키트.An oligonucleotide SCAR primer set according to claim 4; And a kit for determining apple varieties comprising DNA polymerase, dNTPs and buffers. 삭제delete 사과에서 게놈 DNA를 분리하는 단계;Separating genomic DNA from an apple; 상기 분리된 게놈 DNA를 주형으로 하고, 제4항에 따른 올리고뉴클레오티드 SCAR 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide SCAR primer set according to claim 4; And 상기 증폭 산물을 검출하는 단계를 포함하는, 사과 품종을 판별하는 방법.Detecting the amplified product. 제8항에 있어서, 상기 증폭 산물의 검출은 모세관 전기영동, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것인 방법.The method of claim 8, wherein the detection of the amplification product is carried out via capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
KR1020090131107A 2009-12-24 2009-12-24 SCAR markers for discrimination of apple cultivars and use thereof KR101144988B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020090131107A KR101144988B1 (en) 2009-12-24 2009-12-24 SCAR markers for discrimination of apple cultivars and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020090131107A KR101144988B1 (en) 2009-12-24 2009-12-24 SCAR markers for discrimination of apple cultivars and use thereof

Publications (2)

Publication Number Publication Date
KR20110074204A KR20110074204A (en) 2011-06-30
KR101144988B1 true KR101144988B1 (en) 2012-06-27

Family

ID=44404601

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020090131107A KR101144988B1 (en) 2009-12-24 2009-12-24 SCAR markers for discrimination of apple cultivars and use thereof

Country Status (1)

Country Link
KR (1) KR101144988B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101649589B1 (en) * 2014-04-09 2016-08-31 경북대학교 산학협력단 SSR primer derived from apple and use thereof
KR101979218B1 (en) * 2016-10-28 2019-05-15 경북대학교 산학협력단 Composition for determining bud mutation cultivar of Fuji apple
KR102142010B1 (en) * 2019-09-05 2020-08-06 충북대학교 산학협력단 Marker for discriminating Hongro apple and its bud mutation cultivar and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Euphytica. 2005, Vol. 145, Nos. 1-2, pp. 181-188 *
GenBank Accession No. AB270792 (2007.04.25.) *

Also Published As

Publication number Publication date
KR20110074204A (en) 2011-06-30

Similar Documents

Publication Publication Date Title
KR100823692B1 (en) Sequence-based dna markers for evaluation of phylogenetic relationships and cultivar identification in korean watermelon varieties
KR101516190B1 (en) SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR101912192B1 (en) Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof
KR101816573B1 (en) Markers for discrimination of resistance or susceptibility about gummy stem blight disease of watermelon
US20220010325A1 (en) Quantitative trait loci (qtl) associated with shattering-resistant capsules in sesame and uses thereof
KR101976974B1 (en) SSR molecular markers for discriminating grape cultivars and uses thereof
KR20130078111A (en) Scar markers for discrimination of grape cultivars and use thereof
KR20160082292A (en) Molecular Markers for Selecting radish genetic resources and use thereof
KR101822995B1 (en) DNA marker for selecting Jubilee-type stripe pattern of watermelon
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
RU2717017C2 (en) Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof
KR101605530B1 (en) A method for identifying strawberry varieties using microsatellites markers
KR101650986B1 (en) Universal primer set for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR102106214B1 (en) Molecular Markers for Selecting radish genetic resources and use thereof
KR20130102032A (en) Primer sets for discrimination of grape cultivars and use thereof
KR102332689B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Panax ginseng &#39;GeumJin&#39; and &#39;SeonHyang&#39; cultivar and uses thereof
KR102332688B1 (en) Molecular marker based on nuclear genome sequence for discriminating Panax ginseng &#39;SeonHyang&#39; cultivar and uses thereof
KR101822390B1 (en) Maker for cultivar discrimination in Korean breeding wheat and method for determination using the same
KR101766274B1 (en) A method for identifying blueberry varieties using microsatellites markers
KR101714764B1 (en) Molecular marker for discrimination of Alexandre melon F1 cultivars and use thereof
KR101546428B1 (en) SCAR marker for cultivar discrimination in Korean breeding wheat and use thereof
RU2718584C2 (en) Molecular markers of rlm4 gene of brassica napus black stem resistance and methods of using them
KR101695051B1 (en) Universal primer set COS0842 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101736670B1 (en) Primer sets for identification of Phalaenopsis and composition of marker comprising the same
JP2002112773A (en) Method for discriminating sex of papaya using dna marker

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant