KR101137803B1 - Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof - Google Patents

Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof Download PDF

Info

Publication number
KR101137803B1
KR101137803B1 KR1020100005898A KR20100005898A KR101137803B1 KR 101137803 B1 KR101137803 B1 KR 101137803B1 KR 1020100005898 A KR1020100005898 A KR 1020100005898A KR 20100005898 A KR20100005898 A KR 20100005898A KR 101137803 B1 KR101137803 B1 KR 101137803B1
Authority
KR
South Korea
Prior art keywords
varieties
primer
present
lineage
primers
Prior art date
Application number
KR1020100005898A
Other languages
Korean (ko)
Other versions
KR20110086265A (en
Inventor
유영복
공원식
전창성
권재건
장갑열
서경인
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020100005898A priority Critical patent/KR101137803B1/en
Publication of KR20110086265A publication Critical patent/KR20110086265A/en
Application granted granted Critical
Publication of KR101137803B1 publication Critical patent/KR101137803B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 느타리 품종 중 원형 계통을 판별하기 위한 특이 프라이머 세트 및 이의 용도에 관한 것으로, 더욱 상세하게는 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트로 이루어진 느타리 품종 중 원형 계통을 판별하기 위한 프라이머 세트, 상기 프라이머 세트를 포함하는 느타리 품종 중 원형 계통을 판별하기 위한 키트, 및 상기 프라이머 세트를 이용하여 느타리 품종 중 원형 계통을 판별하는 방법에 관한 것이다. 본 발명의 프라이머 세트 및 이의 용도는 환경의 영향을 받지 않고, 품종 자체의 고유성을 검정할 수 있는 기술로서, 품종 구별 시 표현형적 특성을 대체 보완할 수 있는 것으로 활용도가 높다. The present invention relates to a specific primer set for determining a circular lineage among oyster varieties and uses thereof, and more particularly, a primer for determining a circular lineage among oyster cultivars consisting of oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 A set, a kit for determining a circular lineage among oyster varieties comprising the primer set, and a method for determining a circular lineage among oyster varieties using the primer set. Primer set of the present invention and its use is a technology that can test the uniqueness of the variety itself without being influenced by the environment, it is highly applicable to be able to supplement the phenotypic characteristics when distinguishing varieties.

Description

느타리버섯 원형 계통 판별용 특이 프라이머 및 이의 용도{Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof} Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses approximately}

본 발명은 느타리버섯 품종 중 원형 계통을 판별하기 위한 SCAR (Sequence Characterized Amplified Region) 프라이머 세트 및 이의 용도에 관한 것으로, 더욱 상세하게는 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트로 이루어진 느타리버섯 '원형' 계통을 판별하기 위한 SCAR 프라이머 세트, 상기 프라이머 세트를 포함하는 느타리버섯 '원형' 계통을 판별하기 위한 키트, 및 상기 프라이머 세트를 이용하여 느타리버섯 '원형' 계통을 판별하는 방법에 관한 것이다.The present invention relates to a sequence characterized amplified region (SCAR) primer set and its use for discriminating a circular strain among oyster mushroom varieties, and more particularly, to the oyster mushroom ' SCAR primer set for determining the original 'family, a kit for determining the' round 'lineage mushroom containing the primer set, and a method for determining the' round 'lineage using the primer set.

DNA 다형성 분석법 중 RAPD (Ramdom Amplified Polymorphic DNA) 방법은 분석이 쉽고, 간편하기 때문에 가장 보편적으로 이용되어 왔으나, 반응조건에 따라서 결과가 달라질 수 있기 때문에 정확한 실험결과를 기대하기가 어려웠다 (Cutler et al. 2006 Scientia horticulturae 107: 264~270). 따라서 이러한 문제의 해결책으로 RAPD 분석결과에서 생성된 특이 밴드들을 클로닝(cloning) 및 염기서열분석 과정을 거쳐 새로운 SCAR (Sequenced Characterized Amplified Region) 프라이머를 제작하여 특정 DNA 단편을 재현성 있게 증폭하는 SCAR 마커가 개발되었다.RAPD (Ramdom Amplified Polymorphic DNA) method of DNA polymorphism analysis has been most commonly used because it is easy and simple to analyze, but it is difficult to expect accurate experimental results because results may vary depending on reaction conditions (Cutler et al. 2006 Scientia horticulturae 107: 264-270). Therefore, as a solution to this problem, SCAR markers were developed to clone specific bands generated from the results of RAPD analysis and to generate new sequenced characterized amplified region (SCAR) primers to amplify specific DNA fragments reproducibly through cloning and sequencing. It became.

RAPD 마커의 SCAR 마커로의 전환은 상추에서 노균병(downy mildew) 저항성 마커로 처음 개발되었으며 (Paran et al. 1993 Theor Appl Genet 85: 985~993), Bang 등 (2004 Korean J Medicinal Crop Sci 12: 53~59)은 백출의 기원식물 판별에 이용하여 유통 건재약재를 판별하였다. 또한 Koveza와 Gostimsky (2005 Russian J of Genetics 41: 1254~1261)는 다양한 완두 품종과 변종들을 식별하기 위한 SCAR 마커를 개발하였고, Lee 등 (2006 Biol Pharm Bull 29: 629~633)은 다른 동속 식물로부터 애엽 (Artemisia Herb)을 선택적으로 감별하기 위해 특이 마커를 개발한 바 있다.The conversion of RAPD markers to SCAR markers was first developed as a downy mildew resistant marker in lettuce (Paran et al. 1993 Theor Appl Genet 85: 985-993), Bang et al. (2004 Korean J Medicinal Crop Sci 12: 53 ~ 59) was used to determine the plant origin of baekchul to determine the distribution of herbal medicine. Koveza and Gostimsky (2005 Russian J of Genetics 41: 1254-1261) also developed SCAR markers to identify various pea varieties and varieties, and Lee et al. (2006 Biol Pharm Bull 29: 629-633) from other homologous plants. Specific markers have been developed to selectively differentiate Artemisia Herbs.

Lee 등 (2004 Theor Appl Genet 108: 1487~1491)은 18S rDNA, RAPD, SCAR 마커를 이용하여 돌배 (Pyrus pyrifolia)와 서양배 (P. communis)의 품종을 구분하는 연구를 하였는데, 이들 마커가 배나무 (Pyrus) 종을 구분하는데 효율적이라고 보고하였다. Hongyan 등 (2008 World J Microbiol Biotechnol 24: 1223~1226)도 약용버섯인 영지 (Ganoderma lucidum)를 확실히 구분할 수 있는 계통 특이적 SCAR 마커를 ISSR 마커로 전환하여 개발하였다. 또한 SCAR 마커는 병 저항성 유전자나 온도 민감성 유전자의 탐색과 같은 분야에서도 효율적으로 이용되고 있다 (Dedryver et al. 1996 Genome 39: 830~835; Lang et al . 1999 Heredity 131: 121~127).Lee et al. (2004 Theor Appl Genet 108: 1487 ~ 1491) use the 18S rDNA, RAPD, SCAR markers ( Pyrus pyrifolia ) and pear ( P. communis ) has been studied to identify the varieties, and these markers are reported to be effective in distinguishing Pyrus species. Hongyan et al. (2008 World J Microbiol Biotechnol 24: 1223 ~ 1226) are also medicinal mushrooms (GAnoderma lucidum ) was developed by converting a lineage-specific SCAR marker that can be clearly distinguished into an ISSR marker. SCAR markers have also been used efficiently in areas such as disease-resistant genes and temperature-sensitive genes (Dedryver et al. 1996 Genome 39: 830-835; Lang et al . 1999 Heredity 131: 121-127).

RAPD는 우성유전자가 발현된다는 성질과 실험의 민감성 때문에 실용화 문제에 제한이 있으나, 우성인 RAPD 마커의 공우성 SCAR 마커로의 전환은 F2 집단에 대한 분석에 많은 도움을 주어 유전자연관지도 작성 등에 유용하게 이용될 수 있다 (Paran 및 Michelmore, 1993 Theor Appl Genet 85: 985~993). 즉, SCAR는 RAPD 표지인자의 불안정성을 개선하기 위해 선발된 RAPD 밴드의 염기서열을 분석하여 종간, 종내 특이 밴드의 염기서열 정보로부터 프라이머를 제작한 후 높은 어닐링(annealing) 온도에서 PCR을 수행하여 표지인자를 선발하는 방법으로서 단일 밴드로 나타나며 프라이머 설계를 바꾸어 공우성 마커(co-dominant marker)로 전환할 수 있기 때문에 유전분석에 유리하고 이형접합체의 분석이 가능한 장점이 있다 (Negi et al . 2000 Theor Appl Genet 101: 146~152). Although RAPD has limitations in practical use due to the nature of dominant gene expression and the sensitivity of experiments, the conversion of dominant RAPD markers to co-dominant SCAR markers is useful for analysis of F 2 populations, which is useful for mapping genes. (Paran and Michelmore, 1993 Theor Appl Genet 85: 985-993). That is, SCAR analyzes the nucleotide sequences of selected RAPD bands to improve the instability of RAPD markers, prepares primers from the nucleotide sequence information of species and intraspecific species, and then performs PCR at high annealing temperature. As a method of selecting a factor, it appears as a single band and can be converted into a co-dominant marker by changing the primer design, which is advantageous for genetic analysis and has the advantage of analysis of heterozygotes (Negi et. al . 2000 Theor Appl Genet 101: 146-152).

느타리버섯은 2000년부터 품종보호대상 작목으로 지정되었으나 2009년 현재 국립종자원에 121 품종이 생산수입판매신고되어 있고 이 중 품종보호등록된 품종 수는 27개에 불과하여 아직 대다수의 품종은 생산판매신고만으로 유통이 되고 있다. 이들 품종은 육성경위에 대한 기초자료도 없어 품종의 구별성이 모호한 실정이다. 현재의 품종보호등록과 생산수입판매신고의 이원화된 체제에서는 소비자에게 인기 있는 품종을 중심으로 복제하여 다른 이름으로 유통될 수 있다. 하지만 자실체의 모양으로는 복제된 품종을 구분하기 어려운 실정이다. Since 2000, oyster mushroom has been designated as a crop protection target, but as of 2009, 121 varieties were reported to be produced and imported by the National Species Resource. It becomes the circulation only by sending it. These varieties do not have basic data on the development process, so the distinction of varieties is ambiguous. In the current system of registration of varieties and registration of import and export reports, the varieties popular with consumers can be reproduced and distributed under different names. However, it is difficult to distinguish the breed from the shape of the fruiting body.

국내에서 재배되고 있는 느타리 품종은 생산ㆍ판매 신고된 명칭으로 종균을 사용하고 있으며, 품종의 정체성과 특성이 명확하게 알려져 있지 않아 재배농가에 혼선을 가져오며, 동일 품종이 다른 이름으로 재배되는 경우도 있어 문제점으로 지적되고 있다. 또한 국내의 육종 여건 또는 종자산업법 운영상 유통품종의 상당 부분이 유사하고 그만큼 유통체계 질서가 혼란스러운 경우가 있다. Pleurotus cultivated in Korea uses spawn as the name of production and sale declaration, and because the identity and characteristics of the variety are not clearly known, it causes confusion among farmers, and the same varieties may be cultivated under different names. It is pointed out as a problem. In addition, the domestic breeding conditions or the operation of the Seed Industry Act have similar parts of distribution varieties, and the distribution system order is confused.

본 발명은 느타리버섯 품종 중 원형 계통을 판별하기 위하여 환경의 영향을 받지 않으며, 품종 자체의 고유성을 검정할 수 있는 기술을 개발하여 유통품종 중 원형 계통 품종을 확인해 달라는 민원을 해결할 수 있으며, 표현형적 특성을 대체 보완할 수 있는 분자표지를 개발하고자 한다.The present invention is not affected by the environment in order to determine the circular strain among the oyster mushroom varieties, develop a technology that can test the uniqueness of the varieties themselves can solve the complaints to check the circular strain varieties of distribution varieties, phenotypic We will develop molecular markers that can supplement the characteristics.

상기 과제를 해결하기 위해, 본 발명은 서열번호 1 및 2의 올리고뉴클레오티드 프라이머를 포함하는 느타리버섯 '원형' 계통을 판별하기 위한 SCAR 프라이머 세트를 제공한다. In order to solve the above problems, the present invention provides a set of SCAR primers for determining the 'round' lineage of the Pleurotus erythritis comprising the oligonucleotide primers of SEQ ID NO: 1 and 2.

또한, 본 발명은 상기 프라이머 세트를 포함하는 느타리버섯 '원형' 계통을 판별하기 위한 키트를 제공한다. In addition, the present invention provides a kit for determining the 'round' lineage mushroom containing the primer set.

또한, 본 발명은 상기 프라이머 세트를 포함하는 느타리버섯 '원형' 계통을 판별하는 방법을 제공한다.In addition, the present invention provides a method for determining the 'round' lineage mushroom containing the primer set.

본 발명에 따르면, 본 발명은 느타리버섯 품종 중 원형 계통을 판별할 수 있는 DNA 다형성 검정방법으로서 환경의 영향을 받지 않고, 품종 자체의 고유성을 검정할 수 있는 기술로서 품종 구별 시 표현형적 특성을 대체 보완할 수 있어 활용도가 높다고 할 수 있다. According to the present invention, the present invention is a DNA polymorphism assay method for discriminating a circular strain among oyster mushroom varieties, which is not affected by the environment, and is capable of verifying the uniqueness of the cultivar itself. It can be said that it can be supplemented and its utilization is high.

DNA는 재배환경이나 발육단계, 조직에 따른 영향을 받지 않으므로 분자생물학적 마커를 이용한 품종 구분은 객관성을 유지할 수 있어 높은 신뢰성을 줄 수 있다. 또한 이와 같은 분자생물학적 방법에 기초를 둔 해석은 직접적인 품종육성 및 품종의 판별뿐 아니라, 종간 또는 종내 변이 정도 및 근연관계를 구명하는 방법인 동시에 유전육종관련 기초연구에 활용할 수 있다.Since DNA is not influenced by the cultivation environment, developmental stage, or tissue, varieties using molecular biological markers can maintain objectivity and provide high reliability. In addition, the analysis based on such molecular biology methods can be used not only for direct breeding and discrimination, but also for examining the degree and relationship between species and intra-species variation, and also for basic research on genetic breeding.

도 1은 S-Op-05 프라이머를 사용하여 증폭된 느타리속 (Pleurotus species) DNA의 SCAR-PCR 산물을 보여준다. 1436 bp의 SCAR 마커가 ASI 2180, 2183, 2240, 2595, 2725에서 검출되었다. 화살표는 특이 SCAR 마커를 나타낸다.
도 2는 S-Op-05 프라이머를 사용하여 증폭 시 동일한 밴드를 나타내는 2 가지 느타리속 (Pleurotus) 균주 그룹의 자실체를 보여준다.
1 shows the SCAR-PCR product of Pleurotus species DNA amplified using S-Op-05 primers. SCAR markers of 1436 bp were detected at ASI 2180, 2183, 2240, 2595, 2725. Arrows indicate specific SCAR markers.
Figure 2 shows the fruiting bodies of two Pleurotus strain groups exhibiting the same bands when amplified using S-Op-05 primers.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1의 서열 내의 15개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드들로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 및 서열번호 2의 서열 내의 15개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드들로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드를 포함하는, 느타리버섯 '원형' 계통을 판별하기 위한 SCAR (Sequence Characterized Amplified Region) 프라이머 세트를 제공한다.In order to achieve the object of the present invention, the present invention provides at least 15 oligonucleotides selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. Provided is a Sequence Characterized Amplified Region (SCAR) primer set for determining a Pleurotus 'circular' lineage comprising one or more oligonucleotides selected from the group consisting of oligonucleotides consisting of segments of consecutive nucleotides.

상기 올리고뉴클레오티드는 바람직하게는 서열번호 1의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다. 또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 2의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.The oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20 consecutive nucleotides in the sequence of SEQ ID NO: 1. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19 consecutive nucleotides in the sequence of SEQ ID NO: 2.

본 발명의 일 구현예에 따른 올리고뉴클레오티드 프라이머 세트는 바람직하게는 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트를 포함하는 느타리버섯 '원형' 계통을 판별하기 위한 올리고뉴클레오티드 프라이머 세트이다.The oligonucleotide primer set according to one embodiment of the present invention is preferably an oligonucleotide primer set for determining the Pleurotus mushroom 'circular' lineage including the oligonucleotide primer sets of SEQ ID NOs: 1 and 2.

본 발명의 프라이머 세트는 느타리버섯 '원형' 계통을 판별하기 위한 마커로 이용된다. 상기 마커를 개발하기 위해, 먼저 느타리속 8 종을 포함한 81 개 품종을 대상으로 RAPD 분석을 실시하여, 원형 계통 품종에 특이적인 밴드를 찾아, 상기 특이 밴드를 대상으로 클로닝(cloning)과 염기서열분석을 수행하였다. 상기 염기서열정보를 바탕으로 RAPD 랜덤(random) 프라이머 서열에 10~11 bp의 염기를 추가하여 SCAR 프라이머들을 제작하여, 상기 제작된 SCAR 프라이머들을 이용하여 원형 유사 계통, 왕흑평 유사 계통, 원형 유사 계통, 및 춘추-2 유사 계통을 대상으로 PCR을 수행한 결과 원형 유사 계통에서 특이적인 밴드를 보이는 서열번호 1 및 2의 프라이머 세트를 선발하였다.The primer set of the present invention is used as a marker for discriminating the oyster mushroom 'round' lineage. To develop the marker, RAPD analysis was first performed on 81 cultivars, including eight Pleurotus species, to find a band specific to a circular strain, and to clone and sequence the specific band. Was performed. Based on the nucleotide sequence information, 10-10 bp of base was added to the RAPD random primer sequence to prepare SCAR primers, and the circular-like strain, Wang-pyeong-like strain, and circular-like strain using the prepared SCAR primers. PCR was performed on, and Spring-2 strains to select a primer set of SEQ ID NOS: 1 and 2 showing a specific band in a circular like strain.

본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primers will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은In order to achieve another object of the present invention, the present invention

본 발명에 따른 올리고뉴클레오티드 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 느타리버섯 원형 계통을 판별하기 위한 키트를 제공한다. 본 발명의 키트에서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 설명서를 추가로 포함할 수 있다.Oligonucleotide primer sets according to the present invention; And a kit for determining the Pleurotus erythematosus lineage, comprising a reagent for conducting an amplification reaction. In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers and the like. In addition, the kit of the present invention may further include a user manual describing the conditions for performing the optimal reaction.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은In order to achieve another object of the present invention, the present invention

느타리버섯에서 게놈 DNA를 분리하는 단계;Separating genomic DNA from oyster mushrooms;

상기 분리된 게놈 DNA를 주형으로 하고, 본 발명에 따른 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using an oligonucleotide primer set according to the present invention; And

상기 증폭 산물을 검출하는 단계를 포함하는, 느타리버섯 원형 계통을 판별하는 방법을 제공한다.It provides a method for determining the Pleurotus eryngii strain, comprising detecting the amplification product.

본 발명의 방법은 느타리버섯 시료에서 게놈 DNA를 분리하는 단계를 포함한다. 상기 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, wizard prep 키트(Promega 사)를 이용할 수도 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 올리고뉴클레오티드 프라이머 세트를 프라이머로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.The method of the present invention comprises the step of separating genomic DNA from the oyster mushroom sample. As a method for separating genomic DNA from the sample, a method known in the art may be used. For example, the CTAB method may be used, or a wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, an amplification reaction may be performed using an oligonucleotide primer set according to an embodiment of the present invention as a primer to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

본 발명의 방법에 있어서, 상기 증폭 반응의 프라이머의 어닐링(annealing)은 50℃~60℃에서 60초~90초간 수행하며, 바람직하게는 55℃에서 60초간 수행할 수 있다. 상기 증폭 반응의 사이클은 30~40회, 바람직하게는 35회 수행할 수 있다. In the method of the present invention, annealing (annealing) of the primer of the amplification reaction is carried out for 60 seconds to 90 seconds at 50 ℃ ~ 60 ℃, preferably at 55 ℃ 60 seconds. The cycle of the amplification reaction can be carried out 30 to 40 times, preferably 35 times.

본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트는 상기에 기재된 바와 같다.In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as 32 P or 35 S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.

본 발명의 방법은 상기 증폭 산물을 검출하는 단계를 포함한다. 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as 32 P or 35 S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

실시예Example 1.  One. SCARSCAR 프라이머primer 제작 making

RAPD 프라이머를 이용한 PCR 결과, 약 1,400 bp 크기의 원형 계통 품종에 대한 특이 밴드를 찾아, 상기 특이 밴드를 대상으로 클로닝(cloning)과 염기서열분석을 수행하였다. 상기 염기서열정보를 바탕으로 RAPD 랜덤(random) 프라이머 서열을 포함한 염기에 10~11 bp의 염기를 추가하여 SCAR 프라이머 (S-Op-05, 정방향 21 mer, 역방향 20 mer)를 제작하였다. As a result of PCR using the RAPD primer, a specific band for a circular strain of about 1,400 bp was found, and cloning and sequencing were performed on the specific band. Based on the base sequence information, 10 to 11 bp of base was added to the base including the RAPD random primer sequence to prepare a SCAR primer (S-Op-05, forward 21 mer, reverse 20 mer).

느타리버섯 '원형'의 분석에 사용된 SCAR 프라이머SCAR primers used for the analysis of 'round' mushrooms SCAR 프라이머SCAR primer 뉴클레오티드 서열 (5'

Figure 112010004386163-pat00001
3')Nucleotide Sequence (5 '
Figure 112010004386163-pat00001
3 ') 서열번호SEQ ID NO: GC (%)GC (%) T m (℃) T m (℃) S-Op-05 (정방향)S-Op-05 (Forward direction) CCAGTCACTGCTTGACTACTGCCAGTCACTGCTTGACTACTG 1One 54.5554.55 59.9759.97 S-Op-05 (역방향)S-Op-05 (Reverse) GGAATTCGATTCCCAGTCACGGAATTCGATTCCCAGTCAC 22 50.0050.00 59.3459.34

실시예Example 2. S- 2. S- OpOp -05 -05 마커의Marker PCRPCR 증폭 Amplification

Bioneer PCR Premix (Bioneer, 한국)에 게놈 DNA 100 ng, 프라이머 10 pmole, 및 DDW를 첨가하여 전체 20 ㎕의 혼합액을 제조하였다. PCR 증폭반응은 ABI PCR SYSTEM 9700 (Applied Biosystems, Germany)을 이용하여 처음 DNA의 열변성을 위하여 94℃에서 5분간 1 회, 그리고 94℃에서 1분, 55℃에서 1분, 72℃에서 2분간으로 총 35 회 실시하였으며, 최종 DNA의 합성은 72℃에서 10분으로 하였다.
To the Bioneer PCR Premix (Bioneer, Korea), 100 ng of genomic DNA, 10 pmole of primer, and DDW were added to prepare a total of 20 μl of the mixed solution. PCR amplification reaction was performed once using ABI PCR SYSTEM 9700 (Applied Biosystems, Germany) once for 5 minutes at 94 ° C, 1 minute at 94 ° C, 1 minute at 55 ° C, and 2 minutes at 72 ° C for initial denaturation of DNA. Total 35 times, the final DNA synthesis was 10 minutes at 72 ℃.

실시예Example 3. 본 발명의  3. of the present invention 프라이머primer 세트를 이용한 원형 계통의 특이적 검출 Specific Detection of Prototype Lines Using Sets

본 발명의 S-Op-O5 마커로 원형 계통 느타리 품종에서 1,436 bp 크기의 단일 PCR 밴드가 생성되었다. 원형계통인 2180, 2183, 2240, 2595, 및 2725 품종에서는 1,436 bp의 단일 밴드가 나타난 반면, 2072 및 2016 품종에서는 1,428 bp 및 1,800 bp의 두 개의 PCR 밴드가 나타났다 (도 1). 도 2에 보이는 바와 같이 원형계통은 모두 갓 색깔이 밝은 회색이면서 갓 형태가 반구형으로 둥근 모양인 반면, 이중 밴드가 나타난 2,072 및 2,016 품종은 갓 색깔은 원형계통과 유사하나 갓의 모양은 깔때기형으로 원형계통과는 다른 특성이 있다. 상기 두 품종은 원형계통의 모본으로 사용되었던 품종들이므로, 상기 1,428 bp 및 1,800 bp의 밴드는 교배 모본과 계보가 유사한 품종에서 나타나는 밴드인 것으로 분석된다. 즉, 원형계통 판별용 프라이머 'S-Op-O5'로 증폭된 2016 품종의 이중 밴드는 염색체상의 유사한 염기서열이 다른 대립인자에 위치하기 때문에 나타난 것으로, 2016이 원형계통의 모균주이므로 생성된 증폭산물로 추정된다. 실제로, 2016 품종의 PCR 산물에서 원형 품종과 같은 위치에서 나타난 밴드의 DNA 염기서열을 분석한 결과 99%의 상동성을 보였다. The S-Op-O5 marker of the present invention produced a single PCR band of 1,436 bp size in the circular lineage cultivars. A single band of 1,436 bp appeared in the prototype 2180, 2183, 2240, 2595, and 2725 varieties, whereas two PCR bands of 1,428 bp and 1,800 bp appeared in the 2072 and 2016 varieties (FIG. 1). As shown in FIG. 2, the circular system is all shades of bright gray and the shape of the lampshade is hemispherical in round shape, while the 2,072 and 2,016 varieties in which double bands appear are similar to the circular system but the shape of the lampshade is funnel type. It is different from the circular system. Since the two varieties were used as the parent of the prototype system, the bands of 1,428 bp and 1,800 bp are analyzed to be the bands appearing in the breed with similar breeding lineages. In other words, the double band of the 2016 variety amplified with the primer for discriminating the circular strain 'S-Op-O5' was shown because similar sequences on the chromosome are located in different alleles, and since 2016 is the parent strain of the circular strain, the amplification generated is Presumed to be a product. In fact, the DNA sequences of the bands appearing in the same positions as the prototype varieties in the PCR products of 2016 varieties showed 99% homology.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (7)

서열번호 1 및 2의 올리고뉴클레오티드 프라이머를 포함하는 느타리버섯 '원형' 계통을 판별하기 위한 SCAR (Sequence Characterized Amplified Region) 프라이머 세트.A set of Sequence Characterized Amplified Region (SCAR) primers for determining the Pleurotus erythematosus 'prototype' lineage comprising the oligonucleotide primers of SEQ ID NOs: 1 and 2. 삭제delete 제1항에 따른 올리고뉴클레오티드 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 느타리버섯 원형 계통을 판별하기 위한 키트.An oligonucleotide primer set according to claim 1; And a reagent for carrying out an amplification reaction. 제3항에 있어서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs 및 버퍼를 포함하는 것인 키트.The kit of claim 3, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs, and a buffer. 느타리버섯에서 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제1항에 따른 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
상기 증폭 산물을 검출하는 단계를 포함하는, 느타리버섯 원형 계통을 판별하는 방법.
Separating genomic DNA from oyster mushrooms;
Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set according to claim 1; And
And detecting the amplified product.
제5항에 있어서, 상기 증폭 산물의 검출은 모세관 전기영동, DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것인 방법.The method of claim 5, wherein the detection of the amplification product is carried out through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement. 제5항에 있어서, 상기 증폭 반응의 프라이머의 어닐링(annealing)은 50℃~60℃에서 30초~90초간 수행하며, 상기 증폭 반응의 사이클은 30~40회인 것을 특징으로 하는 방법.The method of claim 5, wherein the annealing of the primers of the amplification reaction is performed at 50 ° C. to 60 ° C. for 30 seconds to 90 seconds, and the cycle of the amplification reaction is 30 to 40 times.
KR1020100005898A 2010-01-22 2010-01-22 Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof KR101137803B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100005898A KR101137803B1 (en) 2010-01-22 2010-01-22 Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100005898A KR101137803B1 (en) 2010-01-22 2010-01-22 Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof

Publications (2)

Publication Number Publication Date
KR20110086265A KR20110086265A (en) 2011-07-28
KR101137803B1 true KR101137803B1 (en) 2012-06-27

Family

ID=44922696

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100005898A KR101137803B1 (en) 2010-01-22 2010-01-22 Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof

Country Status (1)

Country Link
KR (1) KR101137803B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160115871A (en) 2016-08-11 2016-10-06 경상남도 Pcr primers for determination of cultivars of pleurotus ostreatus, suhan-1ho, whasung-2ho and gimje-9ho

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Applied and Environmental Microbiology, Vol. 58, No. 4, pp. 1121-1127 (1992) *
J. Virological Methods, Vol. 148, pp. 120-124 (2008) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160115871A (en) 2016-08-11 2016-10-06 경상남도 Pcr primers for determination of cultivars of pleurotus ostreatus, suhan-1ho, whasung-2ho and gimje-9ho

Also Published As

Publication number Publication date
KR20110086265A (en) 2011-07-28

Similar Documents

Publication Publication Date Title
KR101912192B1 (en) Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof
KR101331740B1 (en) SSR primer derived from Paeonia lactiflora and use thereof
KR102029016B1 (en) SSR primer set for discriminating Agaricus bisporus strain and uses thereof
KR101516190B1 (en) SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR101954673B1 (en) Molecular marker for discriminating Codonopsis lanceolata cultivars and uses thereof
KR20170051866A (en) SSR molecular markers for discriminating of Codonopsis lanceolata cultivars and uses thereof
KR101976974B1 (en) SSR molecular markers for discriminating grape cultivars and uses thereof
CN101654709B (en) Method for using sts primer to identify ginseng species
KR102010279B1 (en) Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof
KR20160082292A (en) Molecular Markers for Selecting radish genetic resources and use thereof
KR102163233B1 (en) SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof
KR101166781B1 (en) Specific primer for strain discrimination of Pleurotus spp. by analysis of mitochondria DNA polymorphism and uses thereof
KR101137799B1 (en) Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses thereof
KR101426466B1 (en) Complete sequencing of Chloroplast genomes of Panax ginseng-derived Maker, DNA primer sets and Kits for discrimination of Panax ginseng cultivars and Panax species and uses thereof
KR101137803B1 (en) Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR102174274B1 (en) Molecular marker for discriminating Zizyphus jujuba 'Boeun' and 'Chuseok' cultivar and uses thereof
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR101736670B1 (en) Primer sets for identification of Phalaenopsis and composition of marker comprising the same
KR101357497B1 (en) EST-SSR primer derived from Ophiopogon japonicus and use thereof
KR101795937B1 (en) Primer set KSLG-CP001 for identification of Phalaenopsis and composition of marker comprising the same
KR20100051981A (en) Molecular marker linked to the major resistant gene to pepper anthracnose (colletotrichum acutatum) and its use
KR101236316B1 (en) SSR primer and kits derived from Acanthopanax senticosus, and use of there
KR102686449B1 (en) InDel molecular marker for discriminating sex of Actinidia arguta and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant