KR102163233B1 - SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof - Google Patents

SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof Download PDF

Info

Publication number
KR102163233B1
KR102163233B1 KR1020190100078A KR20190100078A KR102163233B1 KR 102163233 B1 KR102163233 B1 KR 102163233B1 KR 1020190100078 A KR1020190100078 A KR 1020190100078A KR 20190100078 A KR20190100078 A KR 20190100078A KR 102163233 B1 KR102163233 B1 KR 102163233B1
Authority
KR
South Korea
Prior art keywords
sae
seolgang
primer set
jeong
mushroom
Prior art date
Application number
KR1020190100078A
Other languages
Korean (ko)
Inventor
정종욱
안혜진
이화용
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020190100078A priority Critical patent/KR102163233B1/en
Application granted granted Critical
Publication of KR102163233B1 publication Critical patent/KR102163233B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a set of SSR primers for discriminating varieties of Agaricus bisporus and uses thereof. A molecular marker of the present invention can effectively identify Agaricus bisporus, Sae jeong, Sae-ah, and Seolgang which are novel Agaricus bisporus varieties developed in Korea, thereby being able to be usefully used for protecting varieties and preventing illegal distribution of domestic Agaricus bisporus.

Description

양송이 품종 새정, 새아, 설강 구별을 위한 SSR 프라이머 세트 및 이의 용도{SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof}[SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof]

본 발명은 양송이 품종 새정, 새아, 설강 구별을 위한 SSR 프라이머 세트 및 이의 용도에 관한 것이다.The present invention relates to a set of SSR primers for discriminating between cultivar Saejeong, Saeah, and Seolgang, and uses thereof.

최근 분자생물학의 급속한 발전으로 DNA 수준에서 유전자원의 다양성(bio-diversity) 연구를 가능케 하는 핵산 지문 분석 방법 및 다양한 DNA 마커들이 개발되었다. 이를 통해 유용 형질의 탐색, 생물의 종 판별, 품종 분류·동정 및 집단 개체군의 유연관계 분석 등을 간단하고 신속하게 수행할 수 있게 되었다. 지금까지 개발된 PCR(polymerase chain reaction)을 이용한 지문분석법(fingerprinting)에는 RAPD(randomly amplified polymorphic DNA) 방법, AFLP(amplified fragment length polymorphic DNA) 방법, SSR(simple sequence repeat) 방법 등이 있다. 상기 방법 중 RAPD 방법은 비특이적 PCR 산물이 증폭되므로 재현성이 떨어지는 단점이 있고, AFLP 방법은 높은 DNA 다형성(polymorphism) 검출로 각광을 받고 있지만 재현성이 떨어지는 밴드의 출현과 분석이 복잡하다.Recently, with the rapid development of molecular biology, a nucleic acid fingerprint analysis method and various DNA markers have been developed that enable the study of bio-diversity at the DNA level. Through this, it is possible to perform simple and rapid analysis of useful traits, species identification of organisms, breed classification and identification, and relationship analysis of population populations. Fingerprinting using polymerase chain reaction (PCR) developed so far includes a randomly amplified polymorphic DNA (RAPD) method, amplified fragment length polymorphic DNA (AFLP) method, and a simple sequence repeat (SSR) method. Among the above methods, the RAPD method has a disadvantage of inferior reproducibility because a non-specific PCR product is amplified, and the AFLP method is in the spotlight for detecting high DNA polymorphism, but the appearance and analysis of bands with poor reproducibility are complicated.

이에 반해 SSR(simple sequence repeat) 분석법은 재현성이 매우 뛰어나며, 식물 집단들 내에서 유전자좌(gene locus)마다 많은 대립인자들을 가지고 있고 대립유전자의 특성을 명확하게 나타낼 수 있어 식물의 유전적 다양성, 계통유연관계를 분석하고 지문분석법(fingerprinting)과 분자 맵핑(molecular mapping) 등에 활용되고 있다.On the other hand, the simple sequence repeat (SSR) analysis method has excellent reproducibility, has many alleles for each gene locus within plant populations, and can clearly indicate the characteristics of alleles, so the genetic diversity and phylogenetic linkage of plants. It analyzes the relationship and is used for fingerprinting and molecular mapping.

양송이(Agaricus bisporus)는 전 세계적으로 가장 널리 재배되는 식용버섯으로, 당질, 단백질, 비타민, 무기질 등과 같은 영양소가 골고루 함유되어 있고 독특한 맛과 향을 지니고 있다. 양송이의 성양식은 담자포자(basidiospore)를 형성하여 이루어진다. 양송이의 담자기(basidium)에서 형성되는 담자포자 중 95%는 2개의 담자포자를 형성하고, 4.5%는 3개, 0.5%는 4개를 형성한다. 95%의 2개의 담자포자를 형성하는 개체 중에서 63%는 2개의 이질핵체를 가지고, 32%는 2개의 동질핵체를 가진다. 나머지 5% 중에서 4.5%는 포자의 수가 3개이고 핵을 1개 또는 동질핵체 2개를 가지며, 0.5%만 포자의 수가 4개이고 포자내 핵의 수가 1개인 것으로 알려져 있다. 이처럼 복잡한 양송이 버섯의 성양식은 품종육성에 제한요인이 되고 있으며, 다양한 품종이 육성되어 있는 느타리버섯과 달리 양송이 균사에는 꺽쇠연결(clamp connection)이 존재하지 않기 때문에 교잡 후 균사의 형태에 의한 교잡확인이 쉽지 않아 품종육성속도가 느린편이다.Mushroom ( Agaricus bisporus ) is the most widely cultivated edible mushroom in the world, and it contains evenly nutrients such as sugars, proteins, vitamins and minerals, and has a unique taste and aroma. The cultivation of mushrooms is accomplished by forming basidiospore. Of the basidium formed in the basidium of the mushroom, 95% form 2 basidis, 4.5% form 3, 0.5% form 4. Of the 95% of two basidiospores, 63% have 2 heterologous nuclei and 32% have 2 homologous nuclei. Of the remaining 5%, 4.5% has 3 spores, 1 nucleus or 2 homogenous nuclei, and only 0.5% is known to have 4 spores and 1 nucleus in spores. This complex maturation of mushrooms is a limiting factor for breeding, and unlike oyster mushrooms in which various varieties are grown, there is no clamp connection in the mushroom mycelium. This is not easy and the speed of breeding is slow.

양송이는 느타리, 팽이, 큰느타리(새송이), 표고에 이어 5번째로 많이 재배되고 있고, 국내 버섯 총 생산량의 약 5.3%를 차지한다. 과거에는 미국, 유럽, 호주에 있는 거대 종균회사로부터 종균을 수입하여 국내 농가에서 양송이를 재배하였으나, 농촌진흥청에서 국내 최초로 단포자 교잡방법으로 개발된 새아(Sae-Ah)를 시작으로 새정(Sae Jeong), 새연(Saeyeon), 새도(Saedo), 새한(Saehan)과 같이 우리나라 재배환경에 적합한 국산 양송이 품종을 개발하였고, 특히 새정과 새도 품종은 외국 품종에 비해 품질의 우수함을 인정받고 있다.Mushrooms are the fifth most cultivated after oysters, tops, large oysters and shiitake, and account for about 5.3% of the total domestic mushroom production. In the past, mushrooms were cultivated in domestic farms by importing seeds from giant seed companies in the United States, Europe, and Australia, but Sae Jeong (Sae Jeong) started with Sae-Ah, which was developed by the Rural Development Administration for the first time in Korea as a single spore hybridization method. ), Saeyeon, Saedo, and Saehan have developed domestic mushroom varieties suitable for the cultivation environment in Korea. In particular, Saejeong and Saedo varieties are recognized for their superior quality compared to foreign varieties.

한편, 한국등록특허 제0996968호에는 느타리버섯(Oyster Mushroom)에서 유래한 '버섯에서 유래된 SSR 프라이머 및 이의 용도'가 개시되어 있고, 한국공개특허 제2014-0125912호에는 '새송이 버섯 변이균주 검출용 프라이머 및 이를 이용한 검출 방법'이 개시되어 있으나, 본 발명의 양송이 품종 새정, 새아, 설강 구별을 위한 SSR 프라이머 세트 및 이의 용도에 대해서는 기재된 바가 없다.Meanwhile, Korean Patent No. 0996968 discloses'SSR primers derived from mushrooms and their uses' derived from Oyster Mushroom, and Korean Patent Publication No. 2014-0125912 discloses'For detection of mutant strains of oyster mushrooms. Primers and detection methods using the same are disclosed, but there is no description of the SSR primer set and the use thereof for discriminating between Saejeong, Saeah, and Seolgang varieties of the present invention.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 양송이 신품종 새정(Sae Jeong), 새아(Sae-Ah), 설강(Seolgang)의 게놈 서열을 분석하여 2개의 SSR(simple sequence repeat) 마커를 발굴하고, 상기 SSR 마커를 증폭할 수 있는 프라이머 세트를 제작하여 DNA 시료들을 분석한 결과, 본 발명의 SSR 분자마커가 양송이 품종 새정, 새아 및 설강을 명확하게 구별할 수 있음을 확인함으로써, 본 발명을 완성하였다.The present invention was derived from the above requirements, and the present inventors analyzed the genomic sequence of new varieties of mushrooms, Sae Jeong, Sae-Ah, and Seolgang, and two simple sequence repeat (SSR) markers Was discovered, and as a result of analyzing DNA samples by preparing a primer set capable of amplifying the SSR marker, it was confirmed that the SSR molecular marker of the present invention can clearly distinguish between the cultivar Saejeong, Saeae and Seolgang, this The invention was completed.

상기 과제를 해결하기 위해, 본 발명은 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트를 포함하는 양송이(Agaricus bisporus) 품종 구별용 SSR(simple sequence repeat) 프라이머 세트를 제공한다. In order to solve the above problems, the present invention provides a set of oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom comprising the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 ( Agaricus bisporus ) Provides a simple sequence repeat (SSR) primer set for breeding.

또한, 본 발명은 상기 SSR 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는 양송이 품종 구별용 키트를 제공한다.In addition, the present invention is the SSR primer set; And it provides a kit for identifying the variety of mushrooms comprising a reagent for performing the amplification reaction.

또한, 본 발명은 상기 SSR 프라이머 세트를 이용하여 양송이 품종을 구별하는 방법을 제공한다.In addition, the present invention provides a method of distinguishing a variety of mushrooms using the SSR primer set.

본 발명의 양송이 품종 구별용 SSR 분자마커는 저비용, 고효율로 국내에서 개발된 양송이 신품종 새정, 새아 및 설강을 효과적으로 판별할 수 있을 뿐만 아니라 양송이의 품종 보호 및 분자육종 연구 등에 유용하게 활용될 수 있을 것으로 기대된다.The SSR molecular marker for discriminating mushroom varieties of the present invention can effectively discriminate new varieties of mushrooms developed in Korea with low cost and high efficiency, as well as to be useful for protecting varieties of mushrooms and researching molecular breeding. It is expected.

도 1은 본 발명의 프라이머 세트 AB-gSSR-0238(서열번호 1 및 2)를 이용하여 양송이 품종 새정, 새아 및 설강을 구별한 DNA 단편 분석(fragment analyzer) 결과이다.
도 2는 본 발명의 프라이머 세트 AB-gSSR-1142(서열번호 3 및 4)을 이용하여 양송이 품종 새정, 새아 및 설강을 구별한 DNA 단편 분석 결과이다.
1 is a result of a DNA fragment analysis (fragment analyzer) distinguishing between a mushroom cultivar Saejeong, Saea, and Seolgang using the primer set AB-gSSR-0238 (SEQ ID NO: 1 and 2) of the present invention.
2 is a DNA fragment analysis result of distinguishing between a mushroom cultivar Saejung, Saeah, and Seolgang using the primer set AB-gSSR-1142 (SEQ ID NOs: 3 and 4) of the present invention.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트를 포함하는 양송이(Agaricus bisporus) 품종 구별용 SSR(simple sequence repeat) 프라이머 세트를 제공한다.In order to achieve the object of the present invention, the present invention is a set of oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom comprising the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 ( Agaricus bisporus ) Provides a simple sequence repeat (SSR) primer set for breeding.

본 발명의 프라이머 세트에 있어서, 상기 양송이 품종은 국내에서 개발된 새정(Sae Jeong; 품종 등록번호 5567), 새아(Sae-Ah; 품종 등록번호 4013) 및 설강(Seolgang; 품종 등록번호 4378)일 수 있다.In the primer set of the present invention, the mushroom variety may be Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013) and Seolgang (variety registration number 4378) developed in Korea. have.

본 발명에 따른 상기 2개의 SSR 프라이머 세트를 동시에 이용하면 양송이 품종 새정, 새아 및 설강을 모두 구별할 수 있다.When the two SSR primer sets according to the present invention are used at the same time, it is possible to distinguish all of the mushroom varieties Saejeong, Saeah and Seolgang.

상기 프라이머는 각 프라이머의 서열 길이에 따라 서열번호 1, 2, 3 및 4의 서열 내의 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 예를 들면, 서열번호 1의 프라이머(22개 올리고뉴클레오티드)는 서열번호 1의 서열 내의 18개 이상, 19개 이상, 20개 이상, 21개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 또한, 상기 프라이머는 서열번호 1 내지 4의 염기서열의 부가, 결실 또는 치환된 서열도 포함할 수 있다. 상기 서열번호 중 홀수 번호의 올리고뉴클레오티드는 프라이머는 정방향 프라이머이며, 짝수 번호의 올리고뉴클레오티드 프라이머는 역방향 프라이머이다.The primers are oligonucleotides consisting of segments of 20 or more, 21 or more, 22 or more, 23 or more, 24 or more contiguous nucleotides in the sequence of SEQ ID NOs: 1, 2, 3 and 4 according to the sequence length of each primer. Can include. For example, the primer of SEQ ID NO: 1 (22 oligonucleotides) may include an oligonucleotide consisting of segments of 18 or more, 19 or more, 20 or more, 21 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. . In addition, the primer may include an addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 to 4. In the above sequence numbers, the oligonucleotides with odd numbers are a forward primer, and the oligonucleotide primers with an even number are reverse primers.

본 명세서에 있어서, 용어 "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present specification, the term "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

본 발명에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)을 포함할 수 있다.In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or It may include an intercalating agent.

본 발명은 또한, 본 발명에 따른 SSR 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는 양송이 품종 구별용 키트를 제공한다.The present invention also, the SSR primer set according to the present invention; And it provides a kit for identifying the variety of mushrooms comprising a reagent for performing the amplification reaction.

본 발명의 키트에서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.In the kit of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, buffers, and the like. In addition, the kit of the present invention may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare PCR buffer, suggested reaction conditions, etc. The guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

본 발명의 양송이 품종 구별용 키트에 있어서, 상기 양송이 품종은 바람직하게는 새정(Sae Jeong; 품종 등록번호 5567), 새아(Sae-Ah; 품종 등록번호 4013) 및 설강(Seolgang; 품종 등록번호 4378)일 수 있다.In the kit for distinguishing varieties of mushrooms of the present invention, the varieties of mushrooms are preferably Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013), and Seolgang (Seolgang; variety registration number 4378). Can be

본 발명은 또한, 상기 SSR 프라이머 세트를 이용하여 양송이 품종을 구별하는 방법을 제공한다. 상기 방법은 구체적으로는,The present invention also provides a method for discriminating mushroom varieties using the SSR primer set. The method is specifically,

양송이 시료로부터 게놈 DNA를 분리하는 단계; Separating genomic DNA from the mushroom sample;

상기 분리된 게놈 DNA를 주형으로 하고, 상기 SSR 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및Using the isolated genomic DNA as a template and performing an amplification reaction using the SSR primer set to amplify a target sequence; And

상기 증폭 단계의 산물을 검출하는 단계를 포함할 수 있다.It may include the step of detecting the product of the amplification step.

본 발명에 따른 방법에 있어서, 상기 양송이 품종은 국내에서 개발된 새정(Sae Jeong; 품종 등록번호 5567), 새아(Sae-Ah; 품종 등록번호 4013) 및 설강(Seolgang; 품종 등록번호 4378)일 수 있다.In the method according to the present invention, the mushroom varieties may be Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013) and Seolgang (variety registration number 4378) developed in Korea. have.

또한, 본 발명의 SSR 프라이머 세트 2개를 동시에 이용하면 양송이 품종 새정, 새아 및 설강을 모두 구별할 수 있다.In addition, if two sets of SSR primers of the present invention are used at the same time, it is possible to distinguish all of the mushroom varieties Saejeong, Saeah, and Seolgang.

본 발명의 방법은 양송이 시료로부터 게놈 DNA를 분리하는 단계를 포함한다. 상기 양송이 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, Wizard prep 키트(Promega 사)를 이용할 수도 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 SSR 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다.The method of the present invention comprises the step of isolating genomic DNA from a mushroom sample. The method of separating genomic DNA from the mushroom sample may use a method known in the art, for example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, the target sequence may be amplified by performing an amplification reaction using the SSR primer set according to an embodiment of the present invention.

본 발명의 일 구현 예에 있어서, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 올리고뉴클레오티드 프라이머 조합은 상기에 기재된 바와 같다.In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling material. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer when amplifying the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, for labeling using a radioactive material, when a radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radiolabeled. The oligonucleotide primer combinations used to amplify the target sequence are as described above.

본 발명의 일 구현 예에 있어서, 상기 양송이 품종을 구별하는 방법은 상기 증폭 산물을 검출하는 단계를 포함하며, 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 모세관 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABI Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.In one embodiment of the present invention, the method of distinguishing the varieties of mushrooms includes detecting the amplification product, and the detection of the amplification product includes DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement Alternatively, it may be performed through phosphorescence measurement, but is not limited thereto. As one of the methods of detecting the amplification product, capillary electrophoresis may be performed. For capillary electrophoresis, for example, an ABI Sequencer can be used. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. In addition, when performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the fluorescence measurement method is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as 32 P or 35 S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

재료 및 방법 Materials and methods

1. 양송이 균사체의 DNA 추출1. DNA extraction of mushroom mycelium

퇴비 추출 배지(compost dextrose agar; CDA)의 상면에 셀로판을 깔고 배양한 양송이 품종 새정, 새아 및 설강의 균사체를 수확하여 액체질소에 얼린 후 막자사발로 곱게 갈아 GeneAll® GenEx™ Plant 키트(GeneAll, 한국)로 게놈 DNA를 추출하였다. Mushroom varieties grown by spreading cellophane on the top of compost dextrose agar (CDA) The mycelium was harvested, frozen in liquid nitrogen, and then finely ground in a mortar to extract genomic DNA with GeneAll ® GenEx™ Plant kit (GeneAll, Korea).

우선, 튜브에 옮겨 담은 균사에 PL 버퍼 500 ㎕를 넣어 65℃에서 10분간 가열하여 파이펫으로 섞어주고, 13,000 rpm으로 1분간 원심분리하고 상층액을 분리하여 새 튜브로 옮겨준 후 PP 버퍼를 상층액의 1/3만큼 넣고 볼텍서(vortexer)로 혼합하였다. 상기 혼합물을 얼음에서 5분간 방치한 후 13,000 rpm으로 5분간 원심분리하고, 상층액을 분리하여 새 튜브로 옮겨준 다음 동량의 PCI(phenol:chloroform:isoamylalcohol=25:24:1)를 첨가하여 흔들어 섞어주었으며, 13,000 rpm에서 10분간 원심분리하고 상층액을 분리하여 새 튜브에 옮기고 동량의 아이소프로판올(isopropanol)을 넣어 흔들어 섞은 후 얼음에서 10분간 방치하고 13,000 rpm에서 1분간 원심분리하였다. 상층액을 제거하고 70% 에탄올 1 ㎖을 넣어 DNA 펠렛을 살짝 띄우고 13,000 rpm에서 1분간 원심분리한 후 상층액을 다시 제거하고 13,000 rpm에서 1분간 한번 더 원심분리하였다. 남은 에탄올은 전부 제거하고 DNA 펠렛을 상온에서 5분간 건조시킨 후 RE 버퍼 100 ㎕를 넣어 DNA 펠렛을 녹여주었다.First, add 500 µl of PL buffer to the hyphae transferred to the tube, heat it at 65°C for 10 minutes, mix with a pipette, centrifuge at 13,000 rpm for 1 minute, separate the supernatant, and transfer it to a new tube, then add the PP buffer to the top layer. Put 1/3 of the liquid and mixed with a vortexer. The mixture was left on ice for 5 minutes, then centrifuged at 13,000 rpm for 5 minutes, the supernatant was separated and transferred to a new tube, and then the same amount of PCI (phenol:chloroform:isoamylalcohol=25:24:1) was added and shaken. The mixture was mixed, centrifuged at 13,000 rpm for 10 minutes, and the supernatant was separated and transferred to a new tube, and the same amount of isopropanol was added to the mixture by shaking, followed by standing on ice for 10 minutes, followed by centrifugation at 13,000 rpm for 1 minute. The supernatant was removed, and 1 ml of 70% ethanol was added to lightly float the DNA pellet, centrifuged at 13,000 rpm for 1 minute, and then the supernatant was removed again and centrifuged for 1 minute at 13,000 rpm. After removing all the remaining ethanol, the DNA pellet was dried at room temperature for 5 minutes, and then 100 μl of RE buffer was added to dissolve the DNA pellet.

2. SSR 2. SSR 마커Marker 확보 및 Secure and 프라이머primer 디자인 design

양송이 품종 새정, 새아 및 설강을 구별할 수 있는 마커 염기서열을 확보하기 위하여 양송이 균주 ASI 1038 및 ASI 1346에서 분리된 S1038-211, S1346-110, S1346-15, S1346-17, S1346-20 및 S1346-26(Mycobiology, 2018, 46(4), 421-428)을 Illumina MiSeq platform을 이용하여 분석된 양송이 전장유전체를 이용하였으며, MIcroSAtellite 소프트웨어(http://pgrc.ipk-gatersleben.de/misa/)를 사용하여 SSR(simple sequence repeat)을 포함하고 있는 염기서열을 확보하였다(표 1). 상기 확보된 SSR 마커를 증폭하기 위한 프라이머는 Primer 3 Plus(http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi)를 이용하였으며, 프라이머 염기서열의 길이는 22 bp, PCR산물의 크기는 200~300 bp, 최적 결합(annealing) 온도는 55~57℃(최적 56℃), GC Contents는 50~60%(최적 51%)로 제작되었다(표 2). 농촌진흥청 국립원예특작과학원(http://www.nihhs.go.kr)에서 양송이 품종 새정 및 새아의 교배조합 및 육성 내용을 확인할 수 있으며, 양송이 품종 설강은 단핵균주 CM020913-27과 단핵균주 SSU413-31의 교잡을 통해 육성된 계통임을 알 수 있다(종자원, http://www.seed.go.kr; 품종 등록번호 4378).S1038-211, S1346-110, S1346-15, S1346-17, S1346-20, and S1346 isolated from Mushroom strains ASI 1038 and ASI 1346 in order to secure marker sequences that can distinguish between cultivar cultivar saplings, buds and tongues. -26 (Mycobiology, 2018, 46(4), 421-428) was used as the full length genome of mushrooms analyzed using the Illumina MiSeq platform, and MIcroSAtellite software (http://pgrc.ipk-gatersleben.de/misa/) Was used to obtain a nucleotide sequence containing a simple sequence repeat (SSR) (Table 1). Primer 3 Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) was used as a primer for amplifying the obtained SSR marker, the length of the primer sequence was 22 bp, and the PCR product The size of 200 ~ 300 bp, the optimum annealing temperature is 55 ~ 57 ℃ (optimum 56 ℃), GC Contents was produced 50 ~ 60% (optimum 51%) (Table 2). Rural Development Administration's National Academy of Horticultural Sciences (http://www.nihhs.go.kr) can check the mating associations and cultivation of new and young mushroom varieties. It can be seen that it is a breeding line through the hybridization of 31 (Seed Resources, http://www.seed.go.kr; variety registration number 4378).

Figure 112019083858321-pat00001
Figure 112019083858321-pat00001

프라이머 서열 정보Primer sequence information 프라이머 명칭Primer name 프라이머 서열(5'→3') (서열번호)Primer sequence (5'→3') (SEQ ID NO) AB-gSSR-0238
AB-gSSR-0238
F: TGATTCGAGATGGAAATTCTTC (1)F: TGATTCGAGATGGAAATTCTTC (1)
R: ATAAGACGGTACGTTCTGATGG (2)R: ATAAGACGGTACGTTCTGATGG (2) AB-gSSR-1142
AB-gSSR-1142
F: GACGCAAGAGGAATTAGATGAG (3)F: GACGCAAGAGGAATTAGATGAG (3)
R: TGAATCTTGGCTTTGACTTTCT (4)R: TGAATCTTGGCTTTGACTTTCT (4)

3. 3. 중합효소연쇄반응Polymerase chain reaction (( PCRPCR ) 및 유전자 단편분석) And gene fragment analysis

상기 추출한 게놈 DNA 20 ng을 주형으로 하고 표 2의 SSR 프라이머 세트를 이용하여 하기 표 3의 조건으로 PCR을 수행하였다. PCR로 증폭된 산물은 Fragment Analyzer(Advanced Analytical Technologies Inc., 미국)를 이용하여 분석하였다.Using 20 ng of the extracted genomic DNA as a template, PCR was performed under the conditions of Table 3 below using the SSR primer set in Table 2. The product amplified by PCR was analyzed using Fragment Analyzer (Advanced Analytical Technologies Inc., USA).

PCR 반응 조건PCR reaction conditions 단계step 온도(℃)Temperature(℃) 시간time 전-변성Pre-degeneration 9595 3분3 minutes 변성denaturalization 9595 30초30 seconds 결합Combination 5656 30초30 seconds 신장kidney 7272 20초20 seconds 변성 단계로 돌아가 35회 추가 반복Return to the denaturation phase and repeat 35 additional reps 최종 신장Final height 7272 5분5 minutes 보관keep 44

실시예Example 1. SSR 1. SSR 분자마커를Molecular marker 이용한 양송이 품종 Used Mushroom Varieties 새정New , , 새아Bird And 설강의Snowy 구별 Distinction

상기 표 1의 SSR 프라이머 세트를 이용하여 양송이 품종 새정, 새아 및 설강의 DNA 시료를 주형으로 하여 PCR을 수행하였고, PCR을 통해 증폭된 산물을 유전자 단편분석하여 PCR 산물의 크기를 비교함으로써, 각각의 프라이머 세트가 검출할 수 있는 양송이 품종을 확인하였다.Using the SSR primer set in Table 1 above, PCR was performed using DNA samples of the mushroom varieties Saejeong, Saeah, and Seolgang as a template, and the amplified products through PCR were analyzed by gene fragments and the sizes of the PCR products were compared. Mushroom varieties that can be detected by the primer set were identified.

그 결과, 프라이머 세트 AB-gSSR-0238을 이용한 경우 새정은 383/383 bp, 새아는 379/385 bp 및 설강은 379/385 bp 크기로 구별할 수 있었고(도 1), 프라이머 세트 AB-gSSR-1142를 이용한 경우 새정은 336/342 bp, 새아는 331/337 bp 및 설강은 336/342 bp 크기로 구별할 수 있었다(도 2). 다만, 프라이머 세트 AB-gSSR-0238을 이용한 경우에는 새아와 설강의 크기가 동일하게 나타났고, 프라이머 세트 AB-gSSR-1142을 이용한 경우에는 새정과 설강의 크기가 동일하게 나타났으므로, 프라이머 세트 AB-gSSR-0238과 AB-gSSR-1142를 모두 이용해야 국내 양송이 품종 새정, 새아 및 설강을 명확하게 구별할 수 있음을 알 수 있었다. 상기 각 품종의 크기에서 왼쪽과 오른쪽 크기가 같으면 동형접합체(homozygote), 왼쪽과 오른쪽의 크기가 다르면 이형접합체(heterozygote)를 의미한다.As a result, in the case of using the primer set AB-gSSR-0238, it was possible to distinguish between 383/383 bp in saejeong, 379/385 bp in sae, and 379/385 bp in seolgang (Fig. 1), and primer set AB-gSSR- In the case of using 1142, the size of Saejeong was 336/342 bp, Saeah was 331/337 bp, and Seolgang was 336/342 bp (Fig. 2). However, in the case of using the primer set AB-gSSR-0238, the size of the sae-a and the seolgang appeared the same, and in the case of using the primer set AB-gSSR-1142, the size of the sae-jeong and the seolgang were the same. It was found that when both -gSSR-0238 and AB-gSSR-1142 were used, it was possible to clearly distinguish the domestic mushroom varieties Saejeong, Saeyoung and Snowgang . When the sizes of the left and the right are the same in the size of each variety, it means a homozygote, and when the sizes of the left and right are different, it means a heterozygote.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof <130> PN19095 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgattcgaga tggaaattct tc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ataagacggt acgttctgat gg 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gacgcaagag gaattagatg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgaatcttgg ctttgacttt ct 22 <210> 5 <211> 374 <212> DNA <213> Agaricus bisporus <400> 5 tgattcgaga tggaaattct tcgagccgcg gtgtaggcga gatcccaccc tgacgaaaga 60 tgaatgtgtg tgtgtgtgcg ccacactggt aaaaggcctc agtgaagttc cttttcctat 120 tgcgtggcgt tgttgaccaa acgaatgttc tgggtgtacg ggtgctattc ggtgtgtgtg 180 tgtgataagg aagaacggat tctatcgccg agtcagtcgg atgatagcga tactcgatac 240 gagcaaagtg ggtcggtggg aggaagagga gcttccttat ccatgcgttg aatcaagaga 300 gaagtgttca gctatgcata tatgagatct tgagaactcg gacgagatct caccatcaga 360 acgtaccgtc ttat 374 <210> 6 <211> 328 <212> DNA <213> Agaricus bisporus <400> 6 gacgcaagag gaattagatg agcaacttgc aagacgtctt atgcttgaag aacaagaaca 60 agctcaagag ctgtggcaac agcaacagca acaacaacaa caacagcgac gccctcaatt 120 acaaactcgg gcagcagcag cagcagcaac aacagcaacc gaatgctgca ggtggcaacg 180 atactctgag cgaagttcaa gagcacttta ataggattgc agcgtgtgag tctcagtgca 240 gtacgaaatg gtcagaagaa actcattatg ttgtagctgg aaagaagacc tttggggcat 300 tcatggagaa agtcaaagcc aagattca 328 <110> Chungbuk National University Industry-Academic Cooperation Foundation <120> SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof <130> PN19095 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgattcgaga tggaaattct tc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ataagacggt acgttctgat gg 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gacgcaagag gaattagatg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgaatcttgg ctttgacttt ct 22 <210> 5 <211> 374 <212> DNA <213> Agaricus bisporus <400> 5 tgattcgaga tggaaattct tcgagccgcg gtgtaggcga gatcccaccc tgacgaaaga 60 tgaatgtgtg tgtgtgtgcg ccacactggt aaaaggcctc agtgaagttc cttttcctat 120 tgcgtggcgt tgttgaccaa acgaatgttc tgggtgtacg ggtgctattc ggtgtgtgtg 180 tgtgataagg aagaacggat tctatcgccg agtcagtcgg atgatagcga tactcgatac 240 gagcaaagtg ggtcggtggg aggaagagga gcttccttat ccatgcgttg aatcaagaga 300 gaagtgttca gctatgcata tatgagatct tgagaactcg gacgagatct caccatcaga 360 acgtaccgtc ttat 374 <210> 6 <211> 328 <212> DNA <213> Agaricus bisporus <400> 6 gacgcaagag gaattagatg agcaacttgc aagacgtctt atgcttgaag aacaagaaca 60 agctcaagag ctgtggcaac agcaacagca acaacaacaa caacagcgac gccctcaatt 120 acaaactcgg gcagcagcag cagcagcaac aacagcaacc gaatgctgca ggtggcaacg 180 atactctgag cgaagttcaa gagcacttta ataggattgc agcgtgtgag tctcagtgca 240 gtacgaaatg gtcagaagaa actcattatg ttgtagctgg aaagaagacc tttggggcat 300 tcatggagaa agtcaaagcc aagattca 328

Claims (7)

서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트를 포함하는 양송이(Agaricus bisporus) 품종 새정(Sae Jeong), 새아(Sae-Ah) 및 설강(Seolgang) 구별용 SSR(simple sequence repeat) 프라이머 세트.An oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom ( Agaricus bisporus ) cultivar Sae Jeong (Sae Jeong), Sae-Ah (Sae-Ah) and Seolgang (Seolgang) distinction SSR (simple sequence repeat) primer set comprising an oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4. 삭제delete 제1항의 SSR 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는 양송이 품종 새정(Sae Jeong), 새아(Sae-Ah) 및 설강(Seolgang) 구별용 키트.The SSR primer set of claim 1; And a kit for distinguishing the mushroom varieties Sae Jeong, Sae-Ah, and Seolgang including a reagent for performing an amplification reaction. 제3항에 있어서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs 및 버퍼를 포함하는 것인 키트.The kit according to claim 3, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dNTPs, and buffer. 양송이 시료로부터 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제1항의 SSR 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
상기 증폭 단계의 산물을 검출하는 단계를 포함하는 양송이 품종 새정(Sae Jeong), 새아(Sae-Ah) 및 설강(Seolgang)을 구별하는 방법.
Separating genomic DNA from the mushroom sample;
Using the isolated genomic DNA as a template and performing an amplification reaction using the SSR primer set of claim 1 to amplify the target sequence; And
Method for discriminating between the mushroom varieties Sae Jeong, Sae-Ah, and Seolgang comprising the step of detecting the product of the amplification step.
삭제delete 제5항에 있어서, 상기 증폭 단계의 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것인 방법.The method of claim 5, wherein the detection of the product of the amplification step is performed through a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
KR1020190100078A 2019-08-16 2019-08-16 SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof KR102163233B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190100078A KR102163233B1 (en) 2019-08-16 2019-08-16 SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190100078A KR102163233B1 (en) 2019-08-16 2019-08-16 SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof

Publications (1)

Publication Number Publication Date
KR102163233B1 true KR102163233B1 (en) 2020-10-08

Family

ID=72897418

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190100078A KR102163233B1 (en) 2019-08-16 2019-08-16 SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof

Country Status (1)

Country Link
KR (1) KR102163233B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220169541A (en) * 2021-06-21 2022-12-28 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Sae-Ah, Sae Jeong, Dahyang and uses thereof
KR20220169542A (en) * 2021-06-21 2022-12-28 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Saeyoen, Saehan, Hogam and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105255882A (en) * 2015-11-22 2016-01-20 吉林农业大学 Agaricus bisporus ssr molecular marker specific primer system and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105255882A (en) * 2015-11-22 2016-01-20 吉林农业大学 Agaricus bisporus ssr molecular marker specific primer system and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Genbank accession No. CP015458 (2016.07.15.)* *
GenBank accession No.CP015463 (2016.07.15.)* *
WANG et al, Journal of Integrative Agriculture 2019, 18(3): 580-589 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220169541A (en) * 2021-06-21 2022-12-28 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Sae-Ah, Sae Jeong, Dahyang and uses thereof
KR20220169542A (en) * 2021-06-21 2022-12-28 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Saeyoen, Saehan, Hogam and uses thereof
KR102526584B1 (en) 2021-06-21 2023-04-26 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Sae-Ah, Sae Jeong, Dahyang and uses thereof
KR102526589B1 (en) 2021-06-21 2023-04-26 충북대학교 산학협력단 Molecular marker for discriminating Agaricus bisporus cultivar Saeyoen, Saehan, Hogam and uses thereof

Similar Documents

Publication Publication Date Title
KR102029016B1 (en) SSR primer set for discriminating Agaricus bisporus strain and uses thereof
KR101912192B1 (en) Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof
KR101954673B1 (en) Molecular marker for discriminating Codonopsis lanceolata cultivars and uses thereof
KR101804120B1 (en) Complete sequencing of chloroplast genome and nrDNA of Aloe vera, Aloe saponaria and Aloe Saengjang-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof
KR101543365B1 (en) Method for Identifying Genetic Resources of Yam Using SSR Markers
KR102163233B1 (en) SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof
KR101912933B1 (en) Molecular marker and primer set for discriminating Codonopsis lanceolata and Adenophora triphylla and uses thereof
KR102010279B1 (en) Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof
KR101054459B1 (en) Specific primer and its use for distinguishing rice varieties
KR101166781B1 (en) Specific primer for strain discrimination of Pleurotus spp. by analysis of mitochondria DNA polymorphism and uses thereof
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
KR102335806B1 (en) Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba &#39;SanJo&#39; cultivar and uses thereof
KR102174274B1 (en) Molecular marker for discriminating Zizyphus jujuba &#39;Boeun&#39; and &#39;Chuseok&#39; cultivar and uses thereof
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR101137799B1 (en) Specific primers for discriminating Suhan strains in Pleurotus ostreatus, and uses thereof
KR101993289B1 (en) Molecular marker for discriminating purple color of Perilla leaf and uses thereof
KR20100079527A (en) Ssr primer derived from azuki-bean and use thereof
KR102526584B1 (en) Molecular marker for discriminating Agaricus bisporus cultivar Sae-Ah, Sae Jeong, Dahyang and uses thereof
KR20170068093A (en) Complete sequencing of chloroplast genome and nrDNA of Ledebouriella seseloides, Peucedanum japonicum and Glehnia littoralis-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof
KR101795937B1 (en) Primer set KSLG-CP001 for identification of Phalaenopsis and composition of marker comprising the same
KR101699518B1 (en) Primer set for discrimination of a ginseng cultivar Gumpoong and a landrace Hwangsook and uses thereof
KR102212518B1 (en) SSR marker for discriminating cultivars or resources of Atractylodes japonica and uses thereof
KR102526589B1 (en) Molecular marker for discriminating Agaricus bisporus cultivar Saeyoen, Saehan, Hogam and uses thereof
KR101137803B1 (en) Specific primers for discriminating Wonhyeong strains in Pleurotus ostreatus, and uses thereof
KR102098310B1 (en) Composition for identification of Pleurotus ostreatus cultivar and discrimination method using the same

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant