KR102163233B1 - SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof - Google Patents

Abstract

The present invention relates to a set of SSR primers for discriminating varieties of Agaricus bisporus and uses thereof. A molecular marker of the present invention can effectively identify Agaricus bisporus, Sae jeong, Sae-ah, and Seolgang which are novel Agaricus bisporus varieties developed in Korea, thereby being able to be usefully used for protecting varieties and preventing illegal distribution of domestic Agaricus bisporus.

Description

[SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof]

The present invention relates to a set of SSR primers for discriminating between cultivar Saejeong, Saeah, and Seolgang, and uses thereof.

Recently, with the rapid development of molecular biology, a nucleic acid fingerprint analysis method and various DNA markers have been developed that enable the study of bio-diversity at the DNA level. Through this, it is possible to perform simple and rapid analysis of useful traits, species identification of organisms, breed classification and identification, and relationship analysis of population populations. Fingerprinting using polymerase chain reaction (PCR) developed so far includes a randomly amplified polymorphic DNA (RAPD) method, amplified fragment length polymorphic DNA (AFLP) method, and a simple sequence repeat (SSR) method. Among the above methods, the RAPD method has a disadvantage of inferior reproducibility because a non-specific PCR product is amplified, and the AFLP method is in the spotlight for detecting high DNA polymorphism, but the appearance and analysis of bands with poor reproducibility are complicated.

On the other hand, the simple sequence repeat (SSR) analysis method has excellent reproducibility, has many alleles for each gene locus within plant populations, and can clearly indicate the characteristics of alleles, so the genetic diversity and phylogenetic linkage of plants. It analyzes the relationship and is used for fingerprinting and molecular mapping.

Mushroom ( Agaricus bisporus ) is the most widely cultivated edible mushroom in the world, and it contains evenly nutrients such as sugars, proteins, vitamins and minerals, and has a unique taste and aroma. The cultivation of mushrooms is accomplished by forming basidiospore. Of the basidium formed in the basidium of the mushroom, 95% form 2 basidis, 4.5% form 3, 0.5% form 4. Of the 95% of two basidiospores, 63% have 2 heterologous nuclei and 32% have 2 homologous nuclei. Of the remaining 5%, 4.5% has 3 spores, 1 nucleus or 2 homogenous nuclei, and only 0.5% is known to have 4 spores and 1 nucleus in spores. This complex maturation of mushrooms is a limiting factor for breeding, and unlike oyster mushrooms in which various varieties are grown, there is no clamp connection in the mushroom mycelium. This is not easy and the speed of breeding is slow.

Mushrooms are the fifth most cultivated after oysters, tops, large oysters and shiitake, and account for about 5.3% of the total domestic mushroom production. In the past, mushrooms were cultivated in domestic farms by importing seeds from giant seed companies in the United States, Europe, and Australia, but Sae Jeong (Sae Jeong) started with Sae-Ah, which was developed by the Rural Development Administration for the first time in Korea as a single spore hybridization method. ), Saeyeon, Saedo, and Saehan have developed domestic mushroom varieties suitable for the cultivation environment in Korea. In particular, Saejeong and Saedo varieties are recognized for their superior quality compared to foreign varieties.

Meanwhile, Korean Patent No. 0996968 discloses'SSR primers derived from mushrooms and their uses' derived from Oyster Mushroom, and Korean Patent Publication No. 2014-0125912 discloses'For detection of mutant strains of oyster mushrooms. Primers and detection methods using the same are disclosed, but there is no description of the SSR primer set and the use thereof for discriminating between Saejeong, Saeah, and Seolgang varieties of the present invention.

The present invention was derived from the above requirements, and the present inventors analyzed the genomic sequence of new varieties of mushrooms, Sae Jeong, Sae-Ah, and Seolgang, and two simple sequence repeat (SSR) markers Was discovered, and as a result of analyzing DNA samples by preparing a primer set capable of amplifying the SSR marker, it was confirmed that the SSR molecular marker of the present invention can clearly distinguish between the cultivar Saejeong, Saeae and Seolgang, this The invention was completed.

In order to solve the above problems, the present invention provides a set of oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom comprising the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 ( Agaricus bisporus ) Provides a simple sequence repeat (SSR) primer set for breeding.

In addition, the present invention is the SSR primer set; And it provides a kit for identifying the variety of mushrooms comprising a reagent for performing the amplification reaction.

In addition, the present invention provides a method of distinguishing a variety of mushrooms using the SSR primer set.

The SSR molecular marker for discriminating mushroom varieties of the present invention can effectively discriminate new varieties of mushrooms developed in Korea with low cost and high efficiency, as well as to be useful for protecting varieties of mushrooms and researching molecular breeding. It is expected.

1 is a result of a DNA fragment analysis (fragment analyzer) distinguishing between a mushroom cultivar Saejeong, Saea, and Seolgang using the primer set AB-gSSR-0238 (SEQ ID NO: 1 and 2) of the present invention.
2 is a DNA fragment analysis result of distinguishing between a mushroom cultivar Saejung, Saeah, and Seolgang using the primer set AB-gSSR-1142 (SEQ ID NOs: 3 and 4) of the present invention.

In order to achieve the object of the present invention, the present invention is a set of oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom comprising the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 ( Agaricus bisporus ) Provides a simple sequence repeat (SSR) primer set for breeding.

In the primer set of the present invention, the mushroom variety may be Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013) and Seolgang (variety registration number 4378) developed in Korea. have.

When the two SSR primer sets according to the present invention are used at the same time, it is possible to distinguish all of the mushroom varieties Saejeong, Saeah and Seolgang.

The primers are oligonucleotides consisting of segments of 20 or more, 21 or more, 22 or more, 23 or more, 24 or more contiguous nucleotides in the sequence of SEQ ID NOs: 1, 2, 3 and 4 according to the sequence length of each primer. Can include. For example, the primer of SEQ ID NO: 1 (22 oligonucleotides) may include an oligonucleotide consisting of segments of 18 or more, 19 or more, 20 or more, 21 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. . In addition, the primer may include an addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 to 4. In the above sequence numbers, the oligonucleotides with odd numbers are a forward primer, and the oligonucleotide primers with an even number are reverse primers.

In the present specification, the term "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present invention, the oligonucleotide used as a primer may also include a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or It may include an intercalating agent.

The present invention also, the SSR primer set according to the present invention; And it provides a kit for identifying the variety of mushrooms comprising a reagent for performing the amplification reaction.

In the kit of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, buffers, and the like. In addition, the kit of the present invention may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare PCR buffer, suggested reaction conditions, etc. The guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

In the kit for distinguishing varieties of mushrooms of the present invention, the varieties of mushrooms are preferably Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013), and Seolgang (Seolgang; variety registration number 4378). Can be

The present invention also provides a method for discriminating mushroom varieties using the SSR primer set. The method is specifically,

Separating genomic DNA from the mushroom sample;

Using the isolated genomic DNA as a template and performing an amplification reaction using the SSR primer set to amplify a target sequence; And

It may include the step of detecting the product of the amplification step.

In the method according to the present invention, the mushroom varieties may be Sae Jeong (variety registration number 5567), Sae-Ah (variety registration number 4013) and Seolgang (variety registration number 4378) developed in Korea. have.

In addition, if two sets of SSR primers of the present invention are used at the same time, it is possible to distinguish all of the mushroom varieties Saejeong, Saeah, and Seolgang.

The method of the present invention comprises the step of isolating genomic DNA from a mushroom sample. The method of separating genomic DNA from the mushroom sample may use a method known in the art, for example, the CTAB method may be used, or the Wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, the target sequence may be amplified by performing an amplification reaction using the SSR primer set according to an embodiment of the present invention.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling material. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer when amplifying the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, for labeling using a radioactive material, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radiolabeled. The oligonucleotide primer combinations used to amplify the target sequence are as described above.

In one embodiment of the present invention, the method of distinguishing the varieties of mushrooms includes detecting the amplification product, and the detection of the amplification product includes DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement Alternatively, it may be performed through phosphorescence measurement, but is not limited thereto. As one of the methods of detecting the amplification product, capillary electrophoresis may be performed. For capillary electrophoresis, for example, an ABI Sequencer can be used. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. In addition, when performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the fluorescence measurement method is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. DNA extraction of mushroom mycelium

Mushroom varieties grown by spreading cellophane on the top of compost dextrose agar (CDA) The mycelium was harvested, frozen in liquid nitrogen, and then finely ground in a mortar to extract genomic DNA with GeneAll ^® GenEx™ Plant kit (GeneAll, Korea).

First, add 500 µl of PL buffer to the hyphae transferred to the tube, heat it at 65°C for 10 minutes, mix with a pipette, centrifuge at 13,000 rpm for 1 minute, separate the supernatant, and transfer it to a new tube, then add the PP buffer to the top layer. Put 1/3 of the liquid and mixed with a vortexer. The mixture was left on ice for 5 minutes, then centrifuged at 13,000 rpm for 5 minutes, the supernatant was separated and transferred to a new tube, and then the same amount of PCI (phenol:chloroform:isoamylalcohol=25:24:1) was added and shaken. The mixture was mixed, centrifuged at 13,000 rpm for 10 minutes, and the supernatant was separated and transferred to a new tube, and the same amount of isopropanol was added to the mixture by shaking, followed by standing on ice for 10 minutes, followed by centrifugation at 13,000 rpm for 1 minute. The supernatant was removed, and 1 ml of 70% ethanol was added to lightly float the DNA pellet, centrifuged at 13,000 rpm for 1 minute, and then the supernatant was removed again and centrifuged for 1 minute at 13,000 rpm. After removing all the remaining ethanol, the DNA pellet was dried at room temperature for 5 minutes, and then 100 μl of RE buffer was added to dissolve the DNA pellet.

2. SSR Marker Secure and primer design

S1038-211, S1346-110, S1346-15, S1346-17, S1346-20, and S1346 isolated from Mushroom strains ASI 1038 and ASI 1346 in order to secure marker sequences that can distinguish between cultivar cultivar saplings, buds and tongues. -26 (Mycobiology, 2018, 46(4), 421-428) was used as the full length genome of mushrooms analyzed using the Illumina MiSeq platform, and MIcroSAtellite software (http://pgrc.ipk-gatersleben.de/misa/) Was used to obtain a nucleotide sequence containing a simple sequence repeat (SSR) (Table 1). Primer 3 Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) was used as a primer for amplifying the obtained SSR marker, the length of the primer sequence was 22 bp, and the PCR product The size of 200 ~ 300 bp, the optimum annealing temperature is 55 ~ 57 ℃ (optimum 56 ℃), GC Contents was produced 50 ~ 60% (optimum 51%) (Table 2). Rural Development Administration's National Academy of Horticultural Sciences (http://www.nihhs.go.kr) can check the mating associations and cultivation of new and young mushroom varieties. It can be seen that it is a breeding line through the hybridization of 31 (Seed Resources, http://www.seed.go.kr; variety registration number 4378).

Primer sequence information Primer name Primer sequence (5'→3') (SEQ ID NO) AB-gSSR-0238
F: TGATTCGAGATGGAAATTCTTC (1) R: ATAAGACGGTACGTTCTGATGG (2) AB-gSSR-1142
F: GACGCAAGAGGAATTAGATGAG (3) R: TGAATCTTGGCTTTGACTTTCT (4)

3. Polymerase chain reaction ( PCR ) And gene fragment analysis

Using 20 ng of the extracted genomic DNA as a template, PCR was performed under the conditions of Table 3 below using the SSR primer set in Table 2. The product amplified by PCR was analyzed using Fragment Analyzer (Advanced Analytical Technologies Inc., USA).

PCR reaction conditions step Temperature(℃) time Pre-degeneration 95 3 minutes denaturalization 95 30 seconds Combination 56 30 seconds kidney 72 20 seconds Return to the denaturation phase and repeat 35 additional reps Final height 72 5 minutes keep 4 ∞

Example 1. SSR Molecular marker Used Mushroom Varieties New , Bird And Snowy Distinction

Using the SSR primer set in Table 1 above, PCR was performed using DNA samples of the mushroom varieties Saejeong, Saeah, and Seolgang as a template, and the amplified products through PCR were analyzed by gene fragments and the sizes of the PCR products were compared. Mushroom varieties that can be detected by the primer set were identified.

As a result, in the case of using the primer set AB-gSSR-0238, it was possible to distinguish between 383/383 bp in saejeong, 379/385 bp in sae, and 379/385 bp in seolgang (Fig. 1), and primer set AB-gSSR- In the case of using 1142, the size of Saejeong was 336/342 bp, Saeah was 331/337 bp, and Seolgang was 336/342 bp (Fig. 2). However, in the case of using the primer set AB-gSSR-0238, the size of the sae-a and the seolgang appeared the same, and in the case of using the primer set AB-gSSR-1142, the size of the sae-jeong and the seolgang were the same. It was found that when both -gSSR-0238 and AB-gSSR-1142 were used, it was possible to clearly distinguish the domestic mushroom varieties Saejeong, Saeyoung and Snowgang . When the sizes of the left and the right are the same in the size of each variety, it means a homozygote, and when the sizes of the left and right are different, it means a heterozygote.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof <130> PN19095 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tgattcgaga tggaaattct tc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ataagacggt acgttctgat gg 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gacgcaagag gaattagatg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgaatcttgg ctttgacttt ct 22 <210> 5 <211> 374 <212> DNA <213> Agaricus bisporus <400> 5 tgattcgaga tggaaattct tcgagccgcg gtgtaggcga gatcccaccc tgacgaaaga 60 tgaatgtgtg tgtgtgtgcg ccacactggt aaaaggcctc agtgaagttc cttttcctat 120 tgcgtggcgt tgttgaccaa acgaatgttc tgggtgtacg ggtgctattc ggtgtgtgtg 180 tgtgataagg aagaacggat tctatcgccg agtcagtcgg atgatagcga tactcgatac 240 gagcaaagtg ggtcggtggg aggaagagga gcttccttat ccatgcgttg aatcaagaga 300 gaagtgttca gctatgcata tatgagatct tgagaactcg gacgagatct caccatcaga 360 acgtaccgtc ttat 374 <210> 6 <211> 328 <212> DNA <213> Agaricus bisporus <400> 6 gacgcaagag gaattagatg agcaacttgc aagacgtctt atgcttgaag aacaagaaca 60 agctcaagag ctgtggcaac agcaacagca acaacaacaa caacagcgac gccctcaatt 120 acaaactcgg gcagcagcag cagcagcaac aacagcaacc gaatgctgca ggtggcaacg 180 atactctgag cgaagttcaa gagcacttta ataggattgc agcgtgtgag tctcagtgca 240 gtacgaaatg gtcagaagaa actcattatg ttgtagctgg aaagaagacc tttggggcat 300 tcatggagaa agtcaaagcc aagattca 328

Claims (7)

An oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; And Mushroom ( Agaricus bisporus ) cultivar Sae Jeong (Sae Jeong), Sae-Ah (Sae-Ah) and Seolgang (Seolgang) distinction SSR (simple sequence repeat) primer set comprising an oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4. delete The SSR primer set of claim 1; And a kit for distinguishing the mushroom varieties Sae Jeong, Sae-Ah, and Seolgang including a reagent for performing an amplification reaction. The kit according to claim 3, wherein the reagent for performing the amplification reaction comprises DNA polymerase, dNTPs, and buffer. Separating genomic DNA from the mushroom sample;
Using the isolated genomic DNA as a template and performing an amplification reaction using the SSR primer set of claim 1 to amplify the target sequence; And
Method for discriminating between the mushroom varieties Sae Jeong, Sae-Ah, and Seolgang comprising the step of detecting the product of the amplification step. delete The method of claim 5, wherein the detection of the product of the amplification step is performed through a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images