CN104046692A - Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof - Google Patents
Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof Download PDFInfo
- Publication number
- CN104046692A CN104046692A CN201410289146.2A CN201410289146A CN104046692A CN 104046692 A CN104046692 A CN 104046692A CN 201410289146 A CN201410289146 A CN 201410289146A CN 104046692 A CN104046692 A CN 104046692A
- Authority
- CN
- China
- Prior art keywords
- black streak
- rice
- primer
- streak dwarf
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of a rice variety 9194 and a molecular marker method thereof. Four RBSDV resistant genetic loci of the RBSDV resistant variety 9194 are obtained by carrying out genetic linkage analysis on the genotype of a single plant F2 obtained by hybridizing the RBSDV resistant rice variety 9194 (male) with a susceptible variety Suyunuo (female) and the RBSDV resistance grade of a corresponding F2:3 family, wherein qRBSDV11 is between a marker RM26062 and a marker RM536. The RBSDV resistance levels of the resistant variety 9194 and derived varieties (lines) thereof can be predicated, and the selection efficiency of the RBSDV resistant rice can be greatly improved by detecting whether the resistant variety 9194 and the derived varieties (lines) thereof contain the RBSDV resistance genetic loci via the molecular markers of the RBSDV resistant genes.
Description
Division explanation
The application is that the application number of applying for 2013-03-29 day is 2013101097989, and denomination of invention is the divisional application of the Chinese invention patent application of " rice varieties 9194 anti-black streak dwarf site and molecule marking method thereof ".
Technical field
The invention belongs to molecular genetics field, relate to the anti-black streak dwarf of rice varieties 9194 site qRBSDV11 and molecule marking method thereof.
Technical background
Paddy rice is the important food crop of China.Black streaked dwarf virus of rice is a kind of virus disease being caused by rice black-streaked dwarf virus (Rice black-streaked dwarf virus, RBSDV), is mainly propagated without ovum mode with persistence by small brown rice planthopper.In recent years, along with variation, the winter climate of cropping system and planting type warm and the spread of susceptible variety, pass virus mediator small brown rice planthopper generating capacity rising, black streaked dwarf virus of rice in Jiangsu, Zhejiang, Jiangxi and Fujian occurs on a large scale, and rise to rapidly the upper topmost virus disease of production, bring very large threat to the safety in production of paddy rice.The classical symptom of black streaked dwarf virus of rice is that diseased plant stunts, and leaf look dark green is stiff, and blade back, leaf sheath and cane have early stage wax, the irregular projection of billet line that the later stage is chocolate, and the strain of seriously falling ill is not eared.Producing above and there is no specific pesticide for this type of disease at present, is mainly early stage by the control to small brown rice planthopper, alleviate its harm, but prevention effect is unsatisfactory, and contaminate environment, destroys the eubiosis.To prevent and treat the optimal method of virus disease be seed selection and utilize disease-resistant variety, and screening, excavate and innovating disease-resistant germplasm is prerequisite and the basis of carrying out anti-black streak dwarf breeding.
Summary of the invention
The object of the invention is the above-mentioned deficiency for prior art, rice varieties 9194 anti-black streak dwarf site and molecule marking method thereof are provided.
Object of the present invention can be achieved through the following technical solutions:
The anti-black streak dwarf of rice varieties 9194 site, comprise the qRBSDV3 between molecule marker RM282-RM14898, at the qRBSDV6 between molecule marker RM20069-RM30, at the qRBSDV9 between molecule marker RM3912-RM257 and the qRBSDV11 between molecule marker RM26062-RM536; Described molecule marker RM282 primer is SEQ ID NO.1/SEQ ID NO.2, and the amplified band while there is qRBSDV3 is 146bp band; Described molecule marker RM14898 primer is SEQ ID NO.3/SEQ ID NO.4, and the amplified band while there is qRBSDV3 is 176bp band; Described molecule marker RM20069 primer is SEQ ID NO.5/SEQ ID NO.6, and the amplified band while there is qRBSDV6 is 162bp band; Described molecule marker RM30 primer is SEQ ID NO.7/SEQ ID NO.8, and the amplified band while there is qRBSDV6 is 136bp band; Described molecule marker RM3912 primer is SEQ ID NO.9/SEQ ID NO.10, and the amplified band while there is qRBSDV9 is 191bp band; Described molecule marker RM257 primer is SEQ ID NO.11/SEQ ID NO.12, and the amplified band while there is qRBSDV9 is 155bp band; Described molecule marker RM26062 primer is SEQ ID NO.13/SEQ ID NO.14, and the amplified band while there is qRBSDV11 is 149bp band; Described molecule marker RM536 primer is SEQ ID NO.15/SEQ ID NO.16, and the amplified band while there is qRBSDV11 is 242bp band.
The molecule marking method of the anti-black streak dwarf of rice varieties 9194 site qRBSDV3: with molecule marker RM282 primer: SEQ ID NO.1/SEQ ID NO.2 or with molecule marker RM14898 primer: SEQ ID NO.3/SEQ ID NO.4, the anti-black streak dwarf kind of amplifying rice or breeding material DNA, if can amplify the amplified fragments of 146bp with molecule marker RM282 primer, or can amplify the amplified fragments of 176bp with molecule marker RM14898 primer, indicate the existence of Rice Varieties for Resistance black streak dwarf site qRBSDV3.
The molecule marking method of the anti-black streak dwarf of rice varieties 9194 site qRBSDV6: use molecule marker RM20069 primer: SEQ ID NO.5/SEQ ID NO.6, or with molecule marker RM30 primer: the SEQ ID NO.7/SEQ ID anti-black streak dwarf kind of NO.8 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 162bp with molecule marker RM20069 primer, or can amplify the amplified fragments of 136bp with molecule marker RM30 primer, indicate the existence of Rice Varieties for Resistance black streak dwarf site qRBSDV6.
The molecule marking method of the anti-black streak dwarf of rice varieties 9194 site qRBSDV9: use molecule marker RM3912 primer: SEQ ID NO.9/SEQ ID NO.10, or with molecule marker RM257 primer: the SEQ ID NO.11/SEQ ID anti-black streak dwarf kind of NO.12 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 191bp with molecule marker RM3912 primer, or all indicate the existence of Rice Varieties for Resistance black streak dwarf site qRBSDV9 with the amplified fragments that molecule marker RM257 primer can amplify 155bp.
The molecule marking method of the anti-black streak dwarf of rice varieties 9194 site qRBSDV11: use molecule marker RM26062 primer: SEQ ID NO.13/SEQ ID NO.14, or with molecule marker RM536 primer: the SEQ ID NO.15/SEQ ID anti-black streak dwarf kind of NO.16 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 149bp with molecule marker RM26062 primer, or can amplify the amplified fragments of 242bp with molecule marker RM536 primer, indicate the existence of Rice Varieties for Resistance black streak dwarf site qRBSDV11.
The method of the molecule marker in the anti-black streak dwarf of rice varieties 9194 site described in screening, comprises following steps:
(1), taking anti-black streak dwarf kind 9194 as maternal, sense black streak dwarf japonica rice variety Suyunuo is male parent, hybridization F
1, built the F that comprises 200 individual plants
2segregating population, each F
2individual plant obtains corresponding F by selfing
2:3family, carries out anti-black streak dwarf qualification;
(2) extract parent, F by SDS method
1and F
2the DNA of the each strain of colony, adopts simple sequence repeat marker SSR to carry out polymorphism screening to two parents, and PCR carries out on PTC-200 amplification instrument, and amplified production carries out electrophoretic analysis on 8% polyacrylamide gel, has polymorphic primer at F between parent
2in colony, analyze, obtain colony's genotype data;
(3) according to chain exchange rule, utilize colony genotype data to build the genetic map of paddy rice, software used is MAPMARKER/EXP3.0, recombination value is converted to genetic distance with Kosambi function;
(4) adopt field to bring out the Resistance Identification that carries out black streak dwarf in conjunction with indoor inoculation qualification;
(5) utilize the colony genotype of MAPMARKER/EXP3.0 software to each molecule marker and the black streak dwarf resistance rank of corresponding family to carry out linkage analysis, and Kosambi function is converted to genetic distance.Utilize Windows QTL Cartographer V2.0 software composite interval mapping method, scan in full genome range taking 2cM as step-length.The detection of QTL adopts 5% overall conspicuous level, and the remarkable threshold of corresponding LOD statistic is estimated by permutation test method, duplicate sampling 1000 times altogether.Additive effect and the contribution rate in each site have been estimated simultaneously;
(6) obtain four of the anti-black streak dwarf gene locuss of anti-black streak dwarf kind 9194, be respectively qRBSDV3, between mark RM282-RM14898; QRBSDV6, between mark RM20069-RM30; QRBSDV9, between mark RM3912-RM257; QRBSDV11, between mark RM26062-RM536.Detect in resistant variety 9194 and derived varieties (being) thereof whether contain this key-gene site by the molecule marker of anti-black streak dwarf key-gene, measurable its black streak dwarf resistance level, improves the efficiency of selection of anti-black streak dwarf paddy rice greatly.
The application of the anti-black streak dwarf of rice varieties 9194 of the present invention site in rice breeding.
The anti-black streak dwarf of rice varieties 9194 of the present invention site is the application in the anti-black streak dwarf kind of rapid screening or strain preferably.
The application of the molecule marker primer in the anti-black streak dwarf of rice varieties 9194 of the present invention site in rice breeding.
The application of the molecule marker primer in the anti-black streak dwarf of rice varieties 9194 of the present invention site in the anti-black streak dwarf kind of rapid screening or strain.
Beneficial effect
In earlier stage, applicant to derive from 20 countries totally 960 parts of rice varieties carried out anti-black streak dwarf field and bring out with artificial inoculation and identify, screen 4 rice varieties that black streak dwarf sickness rate is lower, wherein rice varieties 9194, within continuous 3 years, annual three place field tests are all to black streak dwarf performance high resistance, further indoor qualification result also shows, this kind has higher black streak dwarf resistance.The excavation in this anti-source is location, clone and the breeding utilization of the water resistant rice black streak dwarf gene material that provides the foundation.The present invention utilizes 9194 to hybridize with susceptible variety Suyunuo the F obtaining
2colony carries out genetic linkage analysis, obtains four anti-black streak dwarf gene locuss, is respectively qRBSDV3, qRBSDV6, qRBSDV9 and qRBSDV11.By detecting in resistant variety 9194 and derived varieties (being) thereof whether contain anti-black streak dwarf gene locus with the chain molecule marker of above-mentioned four gene locuss, measurable its black streak dwarf resistance level, improves the efficiency of selection of anti-black streak dwarf paddy rice greatly.The molecule marking method of the anti-black streak dwarf major gene loci of rice varieties 9194 provided by the present invention, has the following advantages:
(1) located first in the world the gene locus of the anti-black streak dwarf in rice varieties 9194 with SSR mark by the present invention.
(2) the resistant gene site locality specific of locating by molecule marker of the present invention, qualification is convenient.By detecting the chain molecule marker of these and anti-black streak dwarf gene locus, can predict the black streak dwarf resistance of rice plant, for the genotype detection of rice varieties or strain, to judge whether this kind or strain have black streak dwarf resistance, and then rapid screening disease-resistant variety or strain are for rice breeding.Resistant gene site easy to detect fast, not affected by environment;
(3) assistant breeding select target is clear and definite, cost-saving.In traditional breeding way, first to collect parent and the Cultivar with anti-source and carry out a series of hybridization, and will carry out individual plant selection to the resistance of black streak dwarf.Black streaked dwarf virus of rice is carried out to phenotypic evaluation complexity, simultaneously affected by environment, because black streak dwarf can not pass poison through ovum, pass the complicated qualification processes such as poison through raising small brown rice planthopper, band poison and inoculation, very difficult, the result reliability of phenotypic evaluation is low.Therefore, anti-black streak dwarf breeding is not only time-consuming, and difficulty is large, and cost is high.By detecting anti-black streak dwarf gene locus, can just identify in seedling stage the individual plant of anti-black streak dwarf, eliminate other plant, not only save production cost but also greatly improve the efficiency of selection of anti-black streak dwarf paddy rice.
Brief description of the drawings
The postvaccinal resistance performance of Figure 191 94 and Suyunuo.
Figure 29 194 and Suyunuo F
2colony's anti-black streak dwarf number of times distribution plan.
The distribution of the anti-black-streaked dwarf ospc gene of Fig. 3 rice varieties 9194 on karyomit(e).
The electrophoretogram of the anti-black-streaked dwarf ospc gene of Fig. 4 compact linkage molecule mark.M:Mark; 1:9194; 2: Suyunuo; 3:F
1; 4-13: extremely anti-individual plant; 14-23: utmost point sense individual plant.
Embodiment
Materials and methods:
(1) 9194/ Suyunuo F
2colony builds and phenotypic evaluation
(1) taking anti-black streak dwarf kind 9194 as maternal, sense black streak dwarf japonica rice variety Suyunuo is male parent, and hybridization, has built 9194/ Suyunuo F
2segregating population, each F
2individual plant obtains corresponding 9194/ Suyunuo F by selfing
2:3family.
(2) phenotypic evaluation
(2.1) qualification is brought out in field
Material is planted respectively in Huang Chuan town, Donghai County, Ganyu County soil cities and towns and experimental plot, Dong Xin farm, Guanyun County, and selecting surrounding is that material to be identified is planted in the plot of wheatland, to ensure to obtain enough worms source.Material in 2010 and 2011 all repeats sowing May 10 (first 3 weeks of wheat harvest) points two, eachly repeats single kind and broadcasts 80, uniform broadcasting 1 row, the long 50cm of row, line-spacing 10cm.June 27 transplanted, and single seedling is planted, distance between rows and hills 15cm × 20cm, and each kind is planted 60 caves.Conventional rich water quality management, does not use any agricultural chemicals.Within 2012, expert evidence was sowed respectively at May 5, May 10 and 3 dates of seeding of bu in Mays 15, each kind is broadcast 150, transplanting time is respectively June 20, June 25 and June 30, and each kind is planted 120 caves, and other planting patternss are identical with 2010 and 2011.Black streak dwarf is brought out as follows: first by dish bat method investigation small brown rice planthopper population density, the enamel basin of 33cm × 45cm × 5cm is aimed to rice shoot base portion and pat plant, small brown rice planthopper is clapped to be fallen within dish, then rapidly the small brown rice planthopper that falls into dish is imported to the high 60cm of being about, diameter is about in the plastic tank of 35cm.Investigate in experimental plot in early June, fixed 5 samplings of planting material field diagonal lines, clap 0.30m2 at every, record small brown rice planthopper quantity.At random 100 small brown rice planthoppers that come from the collection of experiment field are carried out the RT-PCR detection of rice black-streaked dwarf virus, determine the malicious rate of taking.
In rice tillering Sheng phase late July statistics sickness rate.Now disease plant shows obvious symptom: extremely significantly stunt, lobus cardiacus break through inferior lobe leaf sheath and go out, part plant show as from lower pulvinus mouth stretch out in the shape of a spiral, that the top of partial blade occurs revolving shape is curling.And that healthy rice strain performance is tillered is vigorous, vitality is strong, but jointing not yet, disease plant and healthy plant contrast are very obvious.In addition, disease plant now seldom has osculant symptom, adds up as the anti-black streak dwarf phenotypic number of kind using the morbidity percentage mean value of 2 repetitions in each test point.
(2.2) artificial inoculation black-streaked dwarf virus
By parent, disease-resistant and susceptible check variety presoaking and germinating, to sow 200 and show money or valuables one carries unintentionally chitting piece in the plastic box of 70.5cm × 50.5cm × 41.5cm, bottom connects plastics tubing water flowing, keeps the about 3cm of water layer.Thinning in the time that rice shoot grows to 2.5-3.0 leaf, eliminates sick and weak seedling, retains the strong seedling of approximately 150 strain neat and consistent, and seal with gauze on each plastic box top.The small brown rice planthopper that access gathered from East Sea Huang Chuan (test point, small brown rice planthopper is the highest with malicious rate) on June 10th, 2012 inoculates, and drives small brown rice planthopper every day for several times.After 7d, take away gauze, remove the small brown rice planthopper on seedling, postvaccinal transplantation of seedlings to land for growing field crops, is grown to and while tillering the Sheng phase, investigated the state of an illness.Artificial inoculation each kind same period is done three repetitions, calculates and connects worm by 20 small brown rice planthoppers of every seedling.
(2) 9194/ Suyunuo F
2the molecular marker analysis of colony
(1) extract parent, F by SDS method
1and F
2the DNA of the each strain of colony.
(2) ssr analysis is with reference to the program of Chen et al. (1997).10 μ l reaction systems comprise: 10mM Tris-HCl pH8.3,50mM KCl, 1.5mM MgCl2,50 μ M dNTPs, 0.2 μ M primer, 0.5U Taq polymerase (TaKaRa, Dalian) and 20ng of DNA profiling.Amplified reaction carries out on PTC-200 (MJ Research Inc.) PCR instrument: 94 DEG C of 4min; 94 DEG C of 1min, 55 DEG C of 1min, 72 DEG C of 1.5min, 35 circulations; 72 DEG C of 7min.Amplified production separates with 8% non-sex change PAGE glue, dyes colour developing by silver, and silver dyes program and formulates and form according to the method for Sanguinetti et al. (1994).The lamp box that luminescent lamp is equipped with in the DNA band utilization of amplification is observed.Record result, between parent, have polymorphic primer at F
2in colony, analyze, obtain colony's genotype data;
(3) according to chain exchange rule, utilize colony's genotype data to build the genetic map of paddy rice, software used is MAPMAKER/EXP3.0, minimum LOD value is made as 2, obtains linkage map;
(4) utilize Windows QTL Cartographer V2.0 software (Wang et al., 2003) composite interval mapping method (Composite interval mapping, CIM), scan in full genome range taking 2cM as step-length.The detection of QTL adopts 5% overall conspicuous level, and permutation test for remarkable threshold (Permutation test) (Churchill and Doerge, the 1994) method of corresponding LOD statistic is estimated, duplicate sampling 1000 times altogether.Additive effect and the contribution rate in each site have been estimated simultaneously.Utilize MAPMAKER/3.0 analysis software to carry out the compartment analysis of black streak dwarf resistance and SSR mark.And Kosambi function is converted to genetic distance (cM).
(3) results and analysis:
9194 and Suyunuo through the field of black streak dwarf and its average attack rate of indoor qualification respectively 8.9% and 78%, show that 9194 have higher black streak dwarf resistance, and Suyunuo is to black streak dwarf extremely sensitive (Fig. 1).200 F
2:3family distributes and is continuous distribution the fastness frequency of black streak dwarf, shows may have multiple anti-black streak dwarf sites (Fig. 2) in this colony.From F
2in colony, select individual plant 10 strains that three places and indoor qualification all show high resistance or high sense, carry out 12 chromosomal linkage analysises, in paddy rice the 3rd, 6,9 and 11 karyomit(e)s find there is chain sign with objective trait.Further build the 3rd, the linkage map of 6,9 and 11 whole chromosomes, in conjunction with phenotypic data, the QTL that utilizes Windows QTL Cartographer V2.0 software to carry out anti-black streak dwarf detects.Result detects an anti-black streak dwarf QTL qRBSDV3 between paddy rice the 3rd chromosomal marker RM282-RM14898, and LOD value is 2.34, and contribution rate is 5.4%; An anti-black streak dwarf QTL qRBSDV6 between paddy rice the 6th chromosomal marker RM20069-RM30, detected, LOD value is 4.42, and contribution rate is 10.3%; An anti-black streak dwarf QTL qRBSDV9 between paddy rice the 9th chromosomal marker RM3912-RM257, detected, LOD value is 6.63, and contribution rate is 35.5%; An anti-black streak dwarf QTL qRBSDV11 between paddy rice the 11st chromosomal marker RM26062-RM536, detected, LOD value is 3.55, and contribution rate is 31.1%.The above-mentioned soluble phenotypic variations 82.3% of four QTLs (Fig. 3).
Molecule marker RM282 primer:
Upstream primer: CTGTGTCGAAAGGCTGCAC (SEQ ID NO.1)
Downstream primer: CAGTCCTGTGTTGCAGCAAG (SEQ ID NO.2)
Molecule marker RM14898 primer:
Upstream primer: ATGTTCAACCTTGTCCCGACTAACC (SEQ ID NO.3)
Downstream primer: TAAAGACGGCAGCTATCACTTTGC (SEQ ID NO.4)
With molecule marker RM282 primer: SEQ ID NO.1/SEQ ID NO.2 or with molecule marker RM14898 primer: SEQ ID NO.3/SEQ ID NO.4, the anti-black streak dwarf kind of amplifying rice or breeding material DNA, if can amplify the amplified fragments of 146bp with molecule marker RM282 primer, or can amplify the amplified fragments of 176bp with molecule marker RM14898 primer, indicate exist (Fig. 4) of Rice Varieties for Resistance black streak dwarf site qRBSDV3.
Molecule marker RM20069 primer:
Upstream primer: GCGAGCGAGAGGAGAGATAGACG (SEQ ID NO.5)
Downstream primer: CGAATTCGGCACGAGTAATAGGG (SEQ ID NO.6)
Molecule marker RM30 primer:
Upstream primer: ACACTGTAGCGGCCACTG (SEQ ID NO.7)
Downstream primer: CCTCCACTGCTCCACATCTT (SEQ ID NO.8)
With molecule marker RM20069 primer: SEQ ID NO.5/SEQ ID NO.6, or with molecule marker RM30 primer: the SEQ ID NO.7/SEQ ID anti-black streak dwarf kind of NO.8 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 162bp with molecule marker RM20069 primer, or can amplify the amplified fragments of 136bp with molecule marker RM30 primer, indicate exist (Fig. 4) of Rice Varieties for Resistance black streak dwarf site qRBSDV6.
Molecule marker RM3912 primer:
Upstream primer: GCGAGCGAGAGGAGAGATAGACG (SEQ ID NO.9)
Downstream primer: CGAATTCGGCACGAGTAATAGGG (SEQ ID NO.10)
Molecule marker RM257 primer:
Upstream primer: ACACTGTAGCGGCCACTG (SEQ ID NO.11)
Downstream primer: CCTCCACTGCTCCACATCTT (SEQ ID NO.12)
With molecule marker RM3912 primer: SEQ ID NO.9/SEQ ID NO.10, or with molecule marker RM257 primer: the SEQ ID NO.11/SEQ ID anti-black streak dwarf kind of NO.12 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 191bp with molecule marker RM3912 primer, or all indicate exist (Fig. 4) of Rice Varieties for Resistance black streak dwarf site qRBSDV9 with the amplified fragments that molecule marker RM257 primer can amplify 155bp.
Molecule marker RM26062 primer:
Upstream primer: TTTGCGTTTGCGTTTGCGTAGG (SEQ ID NO.13)
Downstream primer: ACCCGTACACCTCCACACAGTGC (SEQ ID NO.14)
Molecule marker RM536 primer:
Upstream primer: TCTCTCCTCTTGTTTGGCTC (SEQ ID NO.15)
Downstream primer: ACACACCAACACGACCACAC (SEQ ID NO.16)
With molecule marker RM26062 primer: SEQ ID NO.13/SEQ ID NO.14, or with molecule marker RM536 primer: the SEQ ID NO.15/SEQ ID anti-black streak dwarf kind of NO.16 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 149bp with molecule marker RM26062 primer, or can amplify the amplified fragments of 242bp with molecule marker RM536 primer, indicate exist (Fig. 4) of Rice Varieties for Resistance black streak dwarf site qRBSDV11.
By detecting in resistant variety 9194 and derived varieties (being) thereof whether contain anti-black streak dwarf gene locus with the chain molecule marker of above-mentioned four gene locuss, measurable its black streak dwarf resistance level, improves the efficiency of selection of anti-black streak dwarf paddy rice greatly.
Claims (5)
1. the molecule marking method of the anti-black streak dwarf of rice varieties 9194 site qRBSDV11, it is characterized in that: use molecule marker RM26062 primer: SEQ ID NO.13/SEQ ID NO.14, or with molecule marker RM536 primer: the SEQ ID NO.15/SEQ ID anti-black streak dwarf kind of NO.16 amplifying rice or breeding material DNA, if can amplify the amplified fragments of 149bp with molecule marker RM26062 primer, or can amplify the amplified fragments of 242bp with molecule marker RM536 primer, indicate the existence of Rice Varieties for Resistance black streak dwarf site qRBSDV11.
2. the method for the molecule marker of the anti-black streak dwarf of screening rice varieties 9194 claimed in claim 1 site qRBSDV11, is characterized in that comprising following steps:
(1), taking anti-black streak dwarf kind 9194 as maternal, sense black streak dwarf japonica rice variety Suyunuo is male parent, hybridization F
1, built the F that comprises 200 individual plants
2segregating population, each F
2individual plant obtains corresponding F by selfing
2:3family, carries out anti-black streak dwarf qualification;
(2) extract parent, F by SDS method
1and F
2the DNA of the each strain of colony, adopts simple sequence repeat marker SSR to carry out polymorphism screening to two parents, and PCR carries out on PTC-200 amplification instrument, and amplified production carries out electrophoretic analysis on 8% polyacrylamide gel, has polymorphic primer at F between parent
2in colony, analyze, obtain colony's genotype data;
(3) according to chain exchange rule, utilize colony genotype data to build the genetic map of paddy rice, software used is MAPMARKER/EXP3.0, recombination value is converted to genetic distance with Kosambi function;
(4) adopt field to bring out the Resistance Identification that carries out black streak dwarf in conjunction with indoor inoculation qualification;
(5) utilize the colony genotype of MAPMARKER/EXP3.0 software to each molecule marker and the black streak dwarf resistance rank of corresponding family to carry out linkage analysis, and Kosambi function is converted to genetic distance, utilize Windows QTL Cartographer V2.0 software composite interval mapping method, scan in full genome range taking 2cM as step-length, the detection of QTL adopts 5% overall conspicuous level, the remarkable threshold of corresponding LOD statistic is estimated by permutation test method, duplicate sampling 1000 times altogether, additive effect and the contribution rate in each site have been estimated simultaneously,
(6) obtain four of the anti-black streak dwarf gene locuss of anti-black streak dwarf kind 9194, be respectively qRBSDV3, between mark RM282-RM14898; QRBSDV6, between mark RM20069-RM30; QRBSDV9, between mark RM3912-RM257; QRBSDV11, between mark RM26062-RM536; Detect in resistant variety 9194 and derived varieties (being) thereof whether contain this key-gene site by the molecule marker of anti-black streak dwarf key-gene, predict its black streak dwarf resistance level, greatly improve the efficiency of selection of anti-black streak dwarf paddy rice.
3. the molecule marker primer in the anti-black streak dwarf of rice varieties 9194 claimed in claim 1 site, it is characterized in that being selected from molecule marker RM26062 primer: SEQ ID NO.13/SEQ ID NO.14, or molecule marker RM536 primer: SEQ ID NO.15/SEQ ID NO.16.
4. the application of the molecule marker primer in the anti-black streak dwarf of rice varieties 9194 claimed in claim 3 site in rice breeding.
5. application according to claim 4, is characterized in that the application of described molecule marker primer in the anti-black streak dwarf kind of rapid screening or strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410289146.2A CN104046692A (en) | 2014-06-25 | 2014-06-25 | Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410289146.2A CN104046692A (en) | 2014-06-25 | 2014-06-25 | Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104046692A true CN104046692A (en) | 2014-09-17 |
Family
ID=51500087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410289146.2A Pending CN104046692A (en) | 2014-06-25 | 2014-06-25 | Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104046692A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063030A (en) * | 2015-08-04 | 2015-11-18 | 苏州市种子管理站 | ISSR-SCAR marker for identifying Suyunuo and screening method thereof |
| CN105349539A (en) * | 2015-12-04 | 2016-02-24 | 江苏强农农业技术服务有限公司 | SSR markers in close linkage to rice black-streaked dwarf resistant QTL on chromosome 9 and application thereof |
| CN106834281A (en) * | 2015-12-04 | 2017-06-13 | 无锡南理工科技发展有限公司 | SSR marker with black streaked dwarf virus of rice Resistance QTL close linkage and its application on No. 4 chromosomes |
| CN109652583A (en) * | 2019-01-08 | 2019-04-19 | 扬州大学 | The anti-black streak dwarf site qRBSDV-1 of rice varieties IR36 and its molecule labelling method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100801558B1 (en) * | 2006-12-15 | 2008-02-11 | 대한민국 | Primer for detecting Rice black-streaked dwarf virus Rice dwarf virus and Rice stripe virus and method for detecting simultaneously said viruses using the same |
| CN103146700A (en) * | 2013-03-29 | 2013-06-12 | 南京农业大学 | Rice variety 9194 black streaked dwarf restricting locus and molecular marking method thereof |
-
2014
- 2014-06-25 CN CN201410289146.2A patent/CN104046692A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100801558B1 (en) * | 2006-12-15 | 2008-02-11 | 대한민국 | Primer for detecting Rice black-streaked dwarf virus Rice dwarf virus and Rice stripe virus and method for detecting simultaneously said viruses using the same |
| CN103146700A (en) * | 2013-03-29 | 2013-06-12 | 南京农业大学 | Rice variety 9194 black streaked dwarf restricting locus and molecular marking method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 王宝祥等: "水稻黑条矮缩病抗性资源的筛选和抗性QTL的定位", 《作物学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063030A (en) * | 2015-08-04 | 2015-11-18 | 苏州市种子管理站 | ISSR-SCAR marker for identifying Suyunuo and screening method thereof |
| CN105349539A (en) * | 2015-12-04 | 2016-02-24 | 江苏强农农业技术服务有限公司 | SSR markers in close linkage to rice black-streaked dwarf resistant QTL on chromosome 9 and application thereof |
| CN106834281A (en) * | 2015-12-04 | 2017-06-13 | 无锡南理工科技发展有限公司 | SSR marker with black streaked dwarf virus of rice Resistance QTL close linkage and its application on No. 4 chromosomes |
| CN105349539B (en) * | 2015-12-04 | 2018-08-03 | 宿迁中江种业有限公司 | On No. 9 chromosomes with the SSR marker of black streaked dwarf virus of rice Resistance QTL close linkage and its application |
| CN109652583A (en) * | 2019-01-08 | 2019-04-19 | 扬州大学 | The anti-black streak dwarf site qRBSDV-1 of rice varieties IR36 and its molecule labelling method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146700B (en) | Rice variety 9194 black streaked dwarf restricting locus and molecular marking method thereof | |
| Sabar et al. | Identification and mapping of QTLs associated with drought tolerance traits in rice by a cross between Super Basmati and IR55419-04 | |
| CN101138313B (en) | Maize inbred line resistant to MRDV bred by using molecule making | |
| CN101418349B (en) | Molecular marker method of rice variety brown planthopper resistance main gene Bph3 | |
| CN113179945B (en) | Breeding method of high-yield lodging-resistant disease-resistant new wheat variety | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN101956019B (en) | Molecular marker of anti-nilaparvata-lugens major gene Bph3 of rice | |
| US20190191645A1 (en) | Method for cultivating perennial rice using asexual propagation characteristic of oryza longistaminata | |
| CN104046692A (en) | Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof | |
| CN104450694A (en) | q SRBSDV6 (Southern rice black-streaked dwarf virus 6) and molecular marker method thereof | |
| CN103160584B (en) | Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance | |
| CN103160502A (en) | Single nucleotide polymorphism (SNP) molecular markers for corn germplasm salt-resistant quantitative trait loci (QTL) and application thereof | |
| CN108486273B (en) | Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice | |
| CN104109713B (en) | With the multilocus assisted selection method that wheat conventional breeding whole process is combined | |
| CN101773067B (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| CN101176425B (en) | Method for selecting and cultivating hybridized rice infertility series resisting ear germination using molecule marker | |
| CN102766625B (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| CN101487050B (en) | Molecular marker method for rice anti-rice stripe major gene loci qSTV11 | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN106399498A (en) | Molecular marker assisted selection method for cauliflower flower ball pedicel length | |
| CN105524998A (en) | Molecular marker linked with sea island cotton fiber strength of cotton | |
| CN105821135B (en) | Molecular labeling and application with muskmelon downy mildew resistance gene close linkage | |
| CN108504760B (en) | QTL excavation and application of excellent salt-tolerant resources of rice | |
| CN101828521A (en) | Method for quick transformation of major QTL with resistance to fusarium head blight through combination of embryo culture of wheat and sign selection | |
| CN106244716B (en) | The molecular labeling of the high vigor gene qSE3 of the strong salt tolerant of rice and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140917 |