KR101024113B1 - PCR primer pair detecting Cowpea chlorotic mottle virus and method for detecting Cowpea chlorotic mottle virus using the same - Google Patents

Abstract

The present invention relates to a PCR primer pair for detecting Eastern Tissue Stain Virus (CCMV) and a method for detecting Eastern Terror Stain Virus using the same, more specifically, a primer pair represented by SEQ ID NO: 8 and SEQ ID NO: 12; Primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15; A pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 18; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; And PCR primer pairs for detection of Eastern T. speck virus selected from the group consisting of the primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23 and by using the same method of RT-PCR or RT-PCR and nested PCR. It relates to a method of detection. The present invention provides a PCR primer pair capable of specifically detecting a CCMV in a sample, particularly a legume sample, a method for detecting a CCMV using the same, and a kit for detecting a CCMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CCMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Eastern Tissue Stain Virus, RT-PCR, Legumes, Nested PCR, Quarantine

Description

PCR primer pair detecting Cowpea chlorotic mottle virus and method for detecting Cowpea chlorotic mottle virus using the same}

The present invention relates to a PCR primer pair for detecting East Telofringent virus and a method for detecting Eastern Teloglobin virus using the same, more specifically, a primer pair represented by SEQ ID NO: 8 and SEQ ID NO: 12; Primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15; A pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 18; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; And PCR primer pairs for detection of Eastern T. speck virus selected from the group consisting of the primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23 and by using the same method of RT-PCR or RT-PCR and nested PCR. It relates to a method of detection.

Various infectious diseases are caused by pathogenic microorganisms or viruses, and efforts are being made to detect pathogenic microorganisms or viruses at an early stage and take appropriate measures to prevent the spread of these diseases. These efforts have focused mainly on the development of methods for the rapid, specific, and low-cost detection of pathogenic microorganisms or viruses that cause disease. Various enzymatic or PCR-based methods have been developed.

Conventionally widely used methods for the detection of pathogens include immunological detection methods such as enzyme linked immunosorbent assay (ELISA), enzyme immunoassay (EIA) and immunofluorescence assay (IFA). This method is disadvantageous in that it is expensive and time consuming.

In addition, if the pathogen is a virus, it was diagnosed using an electron microscope, but it is not only time-consuming and expensive, but also the existence of the virus can be confirmed, but because it is impossible to diagnose the species due to its morphological features, it is not currently used. Do not.

Therefore, in the diagnosis of a virus, a PCR method having high detection sensitivity and convenience is most commonly used. Development of species-specific primers is the most important for PCR diagnosis of pathogens. In general, primers used in general are designed to amplify specific genes of a virus and are not species specific. In addition, in some cases, nonspecific products by nucleic acids of plants or other viruses are produced, which is often unsuitable for use in diagnosis. In addition, there are strains or isolates with slightly different nucleotide sequences in the virus species, and thus there is a risk of failure in diagnosis when isolate-specific primers are used for diagnosis. In other words, the virus diagnostic primer should operate species-specifically for each virus, and in order to increase the detection limit of the virus, the gene that is most replicated among the virus-derived nucleic acids should be selected as a primer design target.

Cowpea chlorotic mottle virus (CCMV) is a spherical virus of about 26 nm diameter composed of single stranded RNA. The total nucleic acid of CCMV is about 8.4 kb, RNA 1 is about 3.2 kb, RNA 2 is about 3.1 kb, and RNA 3 is about 2.2 kb. Taxonomically it belongs to the genus Bromoiridae bromovirus (genus), which is mainly infected by legumes in nature. CCMV infectious means include contact infection by juice and insecticide spreading by beetle, etc. Currently, various legumes are imported from abroad, so it is necessary to quickly and easily detect them for quarantine. No primers have been developed for diagnostic purposes.

Accordingly, the present inventors have conducted a series of studies to develop a new method for specifically detecting Eastern T. blotch virus. As a result, the present inventors have developed six new primer pairs capable of specifically detecting Eastern T. blob virus. The present invention was completed by confirming that the E. coli virus was effectively detected in an unknown sample.

Accordingly, it is an object of the present invention to provide a PCR primer pair for detecting East Telofringent virus and a method for detecting Eastern Teloglobin virus using the same.

In order to achieve the above object, the present invention is a primer pair represented by SEQ ID NO: 8 and SEQ ID NO: 12; Primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15; A pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 18; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; And it provides a PCR primer pair for detecting the East Teloglobin virus selected from the group consisting of the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 23.

In order to achieve the other object of the present invention,

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And

(c) providing a method for detecting Eastern regression stain virus from a sample comprising separating the PCR products by size.

In order to achieve another object of the present invention, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) it provides a method for detecting the eastern retrograde stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

In order to achieve another object of the present invention, the present invention provides a kit for the detection of eastern retrograde stain virus comprising a PCR primer pair for detection of the present invention.

Hereinafter, the present invention will be described in detail.

The PCR primer pair for detecting Eastern Regression Speckle Virus (CCMV) of the present invention specifically detects CCMV, and does not detect other bromoviride viruses that are similar in phylogeny to CCMV. It does not detect viruses. Therefore, the PCR primer pair for CCMV detection of this invention can detect CCMV specifically, when a legume is used as a sample. PCR primer pair for detecting CCMV of the present invention is preferably a primer pair represented by SEQ ID NO: 8 and SEQ ID NO: 12; Primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15; A pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 18; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; Or a pair of primers represented by SEQ ID NO: 1 and SEQ ID NO: 23. More preferably, the PCR primer pairs for detecting the CCMV of the present invention are primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; Or it may be a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 23, the primer pair does not show non-specific amplification with bromoviride virus or other viruses infected with legumes can be used for more accurate detection.

The PCR primer pair of the present invention can be usefully used for detecting CCMV in a sample, particularly a legume sample. Therefore, the present invention provides a method for detecting CCMV from a sample comprising performing PCR using the PCR primer pair.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And

(c) providing a method for detecting Eastern regression stain virus from a sample comprising separating the PCR products by size.

The extraction of RNA in step (a) may be performed according to a method commonly used in the art, and may be performed using a commercially available RNA extraction kit.

In addition, in step (b), RT-PCR uses the isolated RNA as a template, the reverse primer among the primer pairs of the present invention is used as a primer, and synthesizes complementary DNA strands by reverse transcription using a reverse transcriptase, followed by PCR. The reaction can be carried out. The PCR reaction may be carried out using a PCR reaction mixture containing various components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to the complementary DNA synthesized by reverse transcription and the PCR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification.In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer, preferably 52-57 ° C., and more preferably 55 ° C. . The time and number of cycles in each step can be determined according to the conditions generally made in the art.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by agarose gel electrophoresis. After electrophoresis, the result of electrophoresis can be analyzed by ethidium bromide staining. General reverse transcription reactions, performing PCR and analyzing the results are well known in the art.

In addition, the present invention may further include the step of performing nested PCR to increase the accuracy of the detection reaction.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) it provides a method for detecting the eastern retrograde stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

RNA extraction, RT-PCR and PCR product separation in steps (a), (b) and (d) are as described above, and nested PCR in step (c) is performed in step (b). RT-PCR may be amplified by a method of performing PCR using a nested primer (nested primer pair) to be amplified. At this time, the conditions of the PCR reaction are as described above, the nested primer pair is not limited as long as the RT-PCR product can be amplified, but preferably represented by SEQ ID NO: 8 and SEQ ID NO: 12 Primer pairs for SEQ ID NO: 9 and SEQ ID NO: 14; For primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 8 and SEQ ID NO: 16; For primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 18, primer pairs of SEQ ID NO: 5 and SEQ ID NO: 19; For primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20, primer pairs of SEQ ID NO: 3 and SEQ ID NO: 21; For primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21, primer pairs of SEQ ID NO: 2 and SEQ ID NO: 23; And the primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23 may be primer pairs of SEQ ID NO: 3 and SEQ ID NO: 23.

The addition of such a nested PCR step can minimize errors due to non-specific reactions in the detection of CCMV can be usefully used when necessary.

In another aspect, the present invention provides a kit for the detection of eastern retrograde stain virus comprising a PCR primer pair according to the present invention. In addition to the PCR primer pairs, the kit may further include a DNA polymerase and a PCR reaction buffer solution of the above-described composition to easily perform the PCR reaction, and perform electrophoresis to confirm whether the PCR product is amplified. Components necessary for may be further included in the kit of the present invention.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

In one embodiment of the present invention to search for CCMV common nucleotide sequence by comparing the base sequences of four CCMV isolates known so far to RNA 3 of the CCMV RNA genome in order to design a CCMV diagnostic primers, and to classify CCMV and taxonomically Sequences that were not similar to the four viral sequences of Comoviridae were selected. 61 primer combinations were made using this.

In another embodiment of the present invention, the primer combinations most effective for diagnosis were selected from the 61 primer combinations by RT-PCR assay with CCMV and various related viruses. As a result, six primer combinations (combination 4, 19, 44, 52, 56, 61) were selected, and the best three primer combinations could be selected.

In one test example of the present invention, a CCMV was detected using a primer combination selected from a sample suspected of being infected with CCMV. As a result, each primer combination and the results of nested PCR for them were also amplified well, confirming that the sample was infected with CCMV.

Accordingly, the present invention provides a PCR primer pair that can specifically detect a CCMV in a sample, particularly a legume sample, a CCMV detection method using the same, and a kit for detecting a CCMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CCMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Design of CCMV Diagnostic Primer

In order to design the CCMV diagnostic primers, a multi-comparison of four known CCMV isolates (Table 1) was carried out on RNA 3 encoded by the subgenomic RNA and the envelope protein-encoded RNA 3. CCMV common base sequence was searched. The selected common base sequence was searched for species-specific sequences compared to four viral sequences of Bromoviridae (Table 2), which are taxonomically similar to CCMV. Of these species specific nucleotide sequences, 23 diagnostic primers were designed that meet the primer conditions (Table 3; the position in Table 3 was based on Genbank ac. No. AF325741). The location of the designed primer is shown in Figure 1. 61 primer combinations were made using these primers, and RT-PCR expected products are shown in Table 4.

CCMV Isolation Sequence Used for Common Base Sequence Analysis Separator or System Genbank ac. no. Size (bp) Analysis genome CCMV-T AF325741 2175 RNA-3 CCMV-R AF325738 2171 RNA-3 CCMV-M AF428092 874 RNA-3 CCMV M28818 2173 RNA-3

Bromoviride virus sequencing used for species-specific sequencing virus Genbank ac. no. Size (bp) Analysis genome CCMV-T AF325741 2175 RNA-3 Broad bean mottle virus (BBMV) M60291 2293 RNA-3 BMV-M2 (Brome mosaic virus-M2) AB183261 2116 RNA-3 CYBV-KU1 (Cassia yellow blotch virus-KU1) AB194808 2091 RNA-3 SBLV-KU1 (Spring beauty latent virus-KU1) AB080600 2213 RNA-3

Diagnostic primers designed from the CCMV species consensus sequence primer order Length location order
number tablet
room
incense CCM-N01 TCCCGTGAGCAGCGTTTACATTACT 25 54-78 One CCM-N05 AAGCCGGCGCCCAGGATGATATGT 24 300-323 2 CCM-N07 CAAGAACACTGGTAGTAGAGCT 22 442-463 3 CCM-N10 TTGATAAGCGCTTCGTCGGTTGA 23 602-624 4 CCM-N16 ACCTAATAACTACAAGCAGTCGCA 24 841-865 5 CCM-N19 TTAGGGGCATAACGAATCAAT 21 936-956 6 CCM-N20 TAGGGGCATAACGAATCAATCTGTA 25 937-961 7 CCM-N22 TAAACCACTACTGAAGACTGACGA 24 982-1005 8 CCM-N25 CGGCCTCGTTGTCTATCA 18 1119-1136 9 CCM-N30 AGAACCCGCCGAAAGGACAGG 21 1227-1247 10 CCM-N40 GCTGCGGCCCGTAAGAAC 18 1407-1424 11 station
room
incense CCM-C10 CGGGGTACATAGCAGCGACAACAT 24 1756-1779 12 CCM-C20 GAAGCAACCCAAGCCATAATAAAA 24 1628-1651 13 CCM-C34 ACAGGTTGGACCACACGAGTGT 22 1432-1453 14 CCM-C30 GCCGCAGCCCTTCGTTGTG 19 1396-1414 15 CCM-C38 CACCCAGCCAGCTACACATGAAT 23 1261-1283 16 CCM-C40 CTTTCGGCGGGTTCTGATTCTT 23 1223-1245 17 CCM-C44 TCACTGACCTCATATGAGTTTTGCT 25 1182-1206 18 CCM-C48 TCTAGCTATCTACGATTGATAG 22 1131-1152 19 CCM-C50 ATCTCTGGATCTTGCTCGTCAGTC 24 997-1020 20 CCM-C53 CTTATACATAGGTGCGTACTGCT 23 855-877 21 CCM-C56 AACGACGGTAGACCCTGAGGATA 23 780-802 22 CCM-C60 ACAAACGATAGCCGGAAGACTA 22 673-694 23

CCMV diagnostic primer combination and RT-PCR expected product Combination Reverse primer Forward primer Product size (bp) Combination Reverse primer Forward primer Product size (bp) One CCM-C10 CCM-N40 373 32 CCM-C38 CCM-N10 682 2 CCM-N30 553 33 CCM-N07 842 3 CCM-N25 661 34 CCM-N05 984 4 CCM-N22 798 35 CCM-C40 CCM-N20 309 5 CCM-N20 843 36 CCM-N19 310 6 CCM-N19 844 37 CCM-N16 405 7 CCM-C20 CCM-N40 245 38 CCM-N10 644 8 CCM-N30 425 39 CCM-N07 804 9 CCM-N25 533 40 CCM-N05 946 10 CCM-N22 670 41 CCM-C44 CCM-N16 366 11 CCM-N20 715 42 CCM-N10 605 12 CCM-N19 716 43 CCM-N07 765 13 CCM-N16 811 44 CCM-N05 907 14 CCM-C30 CCM-N30 188 45 CCM-C48 CCM-N16 312 15 CCM-N25 295 46 CCM-N10 551 16 CCM-N22 433 47 CCM-N07 711 17 CCM-N20 478 48 CCM-N05 853 18 CCM-N19 479 49 CCM-C50 CCM-N10 419 19 CCM-N16 574 50 CCM-N07 579 20 CCM-N10 813 51 CCM-N05 721 21 CCM-C34 CCM-N25 335 52 CCM-N01 967 22 CCM-N22 472 53 CCM-C53 CCM-N10 276 23 CCM-N20 517 54 CCM-N07 436 24 CCM-N19 518 55 CCM-N05 578 25 CCM-N16 613 56 CCM-N01 824 26 CCM-N10 852 57 CCM-C56 CCM-N07 361 27 CCM-N07 1012 58 CCM-N05 503 28 CCM-C38 CCM-N22 302 59 CCM-N01 749 29 CCM-N20 347 60 CCM-C60 CCM-N05 395 30 CCM-N19 348 61 CCM-N01 641 31 CCM-N16 443

<Example 2>

Selection of CCMV Diagnostic Primer Combinations

<2-1> Selection through RT-PCR with CCMV Infected Plants

According to the location of the designed CCMV primers, 61 combinations were selected as shown in Table 4 above, and the most effective primer combination was selected through RT-PCR assay with CCMV and various related viruses.

To this end, first, RNA was isolated from a CCMV infected plant as a sample, and it was confirmed whether the genome of CCMV could be amplified through RT-PCR.

Separation of total RNA from the sample was carried out using a commercially available total RNA separation kit (method using phenol (Promega), TRIzol (Invitrogen Co.), easy-spin TM Total RNA Kit (iNtRON Co.).

Using this as a template, RT-PCR reactions were performed for each primer pair combination as follows: Reverse transcription reaction was performed with 0.5 [mu] l of total RNA isolated, 12.5 pmole downstream primer (reverse primer), 5 μl reverse transcriptase (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT, pH 8.5) 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase 5 μl of the reaction solution was reacted at 42 ° C. for 1 hour and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out with 5 µl of reverse transcription reaction, 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM). 2 μl of KCl, 15 mM MgCl ₂ , pH 8.3) was added and distilled water was added to make the reaction solution 25 μl. The reaction solution was amplified 40 times at 95 ° C. 45 seconds, 55 ° C. 60 seconds, 72 ° C. 60 seconds and finally reacted at 72 ° C. for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5 × TBE buffer and 1.5% agarose gel and stained with ethidium bromide.

As a result, as shown in FIG. 2, in the RT-PCR assay with CCMV infected plants, CCMV-specific responses were confirmed in all 61 primer combinations (Figure 2). Of these, 10 primer combinations were selected first (combination 4, 9, 19, 25, 34, 44, 48, 52, 56, 61), which showed excellent reaction intensity and showed no nonspecific reactions that interfere with diagnosis.

<2-2> Nonspecific Response Analysis with Bromoviride Virus

About the 10 primer combinations selected in Example <2-1>, it was confirmed whether CCMV can be specifically amplified by distinguishing from five viruses, Bromoviridae, which are taxonomically similar viruses.

To this end, Alfafa mosaic virus (AMV), Tobacco streak virus (TSV), Prune dwarf virus (PDV), Purnus necrotic ringspot virus (PNRSV), Cucumber mosaic virus (CMV) and CCMV, respectively, were used as samples. RNA isolation and RT-PCR reactions were performed as in -1>.

As a result, as shown in Figure 3, seven primer combinations (combinations 4, 9, 19, 44, 52, 56, 61) were not amplified in five viruses belonging to bromoviride, but combinations 25, 34 and 48 was amplified to secondaryly select seven primer combinations (combinations 4, 9, 19, 44, 52, 56, 61) excluding them.

<2-3> Analysis of nonspecific reaction with virus infected with legumes

The seven primer combinations selected above were distinguished from 18 viruses infected with legumes to determine whether CCMV could be specifically amplified.

For this purpose, Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Bean yellow mosaic virus (BYMV), Beet mosaic virus (BtMV), Broad bean wilt virus (BBWV), Cherry leaf roll virus (CLRV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Pepper veinal mottle virus (PVMV), Prunus necrotic ringspot virus (PNRSV), Ribgrass mosaic virus (RMV), Soybean mosaic virus (SMV) , Tobacco necrosis virus (TNV), Tobacco streak virus (TSV), Tomato black ring virus (TBRV), Tomato bushy stunt virus (TBSV), Tomato spotted wilt virus (TSWV) and CCMV, respectively. RNA isolation and RT-PCR reactions were performed as in -1>.

As a result, as shown in Figure 4, the six primer combinations (combination 4, 19, 44, 52, 56, 61) was not specifically amplified in 18 viruses infected with legumes, but in the case of combination 9 Specific amplification was shown in the virus. In particular, primer combinations 52 (SEQ ID NO: 1 and SEQ ID NO: 20), 56 (SEQ ID NO: 1 and SEQ ID NO: 21), and 61 (SEQ ID NO: 1 and SEQ ID NO: 23) were nonspecific amplifications for 18 viruses infected with legumes. It was not shown at all and was judged to be the best primer combination.

<Test Example 1>

Detection of CCMV in Samples and Assay of Results

Samples suspected of being infected with CCMV were subjected to RNA isolation and RT-PCR as in Example <2-1> using primer combination 52, combination 56, and combination 61 of the present invention. In addition, to test the results, the combinations of SEQ ID NO: 3 (CCM-N07) and SEQ ID NO: 21 (CCM-C53) for the combination 52, SEQ ID NO: 2 (CCM-N05) and SEQ ID NO: 23 (CCM- C60), nested PCR was performed using the primers of SEQ ID NO: 3 (CCM-N07) and SEQ ID NO: 23 (CCM-C60) as assay primers (nested primer).

As a result, as shown in Figure 5, amplification was well performed for the primer combinations 52, 56 and 61, respectively, and the results of nested PCR for these also confirmed that the sample was infected with CCMV well.

In addition, in order to use as a positive control for the detection of CCMV, polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 was produced by cloning into the pGEM-T easy (Promega Co.) vector. As a result of performing PCR on primer combinations 52, 56, and 61, it was found that amplification was well performed as shown in FIG.

As described above, the present invention provides a PCR primer pair capable of specifically detecting a CCMV in a sample, particularly a legume sample, a method for detecting a CCMV using the same, and a kit for detecting a CCMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CCMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Figure 1 shows the primer positions for CCMV RNA 3. Primer position is Genbank ac. no. Created on the basis of AF325741.

Figure 2 confirms the specificity with CCMV of 61 primer combinations. Total RNA extracted from CCMV-infected eastern leaf tissues was used as RT-PCR template. M: size marker; Lanes 1 to 61 each represent 1 to 61 combinations.

Figure 3 shows the RT-PCR results of the selected CCMV primer combination and bromoviride virus. 1, 7, 13, 19: CCMV; 2, 8, 14, 20: AMV; 3, 9, 15, 21: TSV; 4, 10, 16, 22: PDV; 5, 11, 17, 23: PNRSV; 6, 12, 18, 24: CMV.

Figure 4 shows the RT-PCR results of the selected CCMV diagnostic primer combination and legume-associated virus. 1: CCMV, 2: AMV, 3: ArMV, 4: BYMV, 5: BtMV, 6: BBWV, 7: CLRV, 8: CPMMV, 9: CPSMV, 10: CMV, 11: PVMV, 12: PNRSV, 13: RMV, 14: SMV, 15: TNV, 16: TSV, 17: TBRV, 18: TBSV, 19: TSWV.

Figure 5 shows the CCMV diagnostic primer combination and nested PCR results. (1: primer combination 52 (967bp); 2: nested PCR for combination 52 (CCM-C53 / CCM-N07) (436bp); 3: primer combination 56 (824bp); 4: nested PCR for combination 56 (CCM-C60 / CCM-N05) (395bp); 5: primer combination 61 (641bp); 6: nested PCR for combination 61 (CCM-C60 / CCM-N07 ) (253 bp))

Fig. 6 shows PCR results using a sample of the CCMV positive control (1: CCMV DNA fragment (1,726 bp) inserted into the positive control); 2: primer combination 52 (967 bp); 3: primer combination 56 (824 bp); 4 : Primer combination 61 (641 bp))

<110> Republic of Korea <120> PCR primer pair detecting Cowpea chlorotic mottle virus and          method for detecting Cowpea chlorotic mottle virus using the same <130> NP08-0142 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCM-N01 <400> 1 tcccgtgagc agcgtttaca ttact 25 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-N05 <400> 2 aagccggcgc ccaggatgat atgt 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CCM-N07 <400> 3 caagaacact ggtagtagag ct 22 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CCM-N10 <400> 4 ttgataagcg cttcgtcggt tga 23 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-N16 <400> 5 acctaataac tacaagcagt cgca 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CCM-N19 <400> 6 ttaggggcat aacgaatcaa t 21 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCM-N20 <400> 7 taggggcata acgaatcaat ctgta 25 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-N22 <400> 8 taaaccacta ctgaagactg acga 24 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CCM-N25 <400> 9 cggcctcgtt gtctatca 18 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CCM-N30 <400> 10 agaacccgcc gaaaggacag g 21 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CCM-N40 <400> 11 gctgcggccc gtaagaac 18 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-C10 <400> 12 cggggtacat agcagcgaca acat 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-C20 <400> 13 gaagcaaccc aagccataat aaaa 24 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CCM-C34 <400> 14 acaggttgga ccacacgagt gt 22 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CCM-C30 <400> 15 gccgcagccc ttcgttgtg 19 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CCM-C38 <400> 16 cacccagcca gctacacatg aat 23 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CCM-C40 <400> 17 ctttcggcgg gttctgattc tt 22 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CCM-C44 <400> 18 tcactgacct catatgagtt ttgct 25 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CCM-C48 <400> 19 tctagctatc tacgattgat ag 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CCM-C50 <400> 20 atctctggat cttgctcgtc agtc 24 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CCM-C53 <400> 21 cttatacata ggtgcgtact gct 23 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CCM-C56 <400> 22 aacgacggta gaccctgagg ata 23 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CCM-C60 <400> 23 acaaacgata gccggaagac ta 22 <210> 24 <211> 1719 <212> DNA <213> Artificial Sequence <220> Positive control sequence <400> 24 tcccgtgagc agcgtttaca ttactgactt ggacacatcg gtttttgaag catcggatag 60 aggtgattaa cgctaaaccg taccatagta ggctgttacc tgactcgaac tcaggcggac 120 gtcagctgac attcacggaa tagttcgata tcataattcc tcgttctttg ctgttatagc 180 tcccgatgtc taacactact tttagacctt ttactggttc ctccaggacc gtggtcgagg 240 gagaacaagc cggcgcccag gatgatatgt cgttgttaca gtcacttttt tccgacaaat 300 ccagggagga gtttgctaag gagtgtaagt tgggtatgta taccaattta tcctctaata 360 accggcttaa ttatatagat ctagtcccca agaacactgg tagtagagct ctgaacttat 420 ttaagtcaga gtatgaaaaa ggtcacattc cctccagcgg tgtgcttagt atacctagag 480 tgctggtttt tcttgtgagg acgacaacag tgactgaatc tgggagtgtc accattagat 540 tggttgactt gataagcgct tcgtcggttg agattttaga acctgtggat ggtacgcaag 600 aggctactat tcctatttct agtcttccgg ctatcgtttg tttttctcct agttatgact 660 gtcccatgca gatgataggg aatagacaca gatgtttcgg tttggtaact caactggatg 720 gtgtcatatc ctcagggtct accgtcgtta tgagtcatgc gtattggtct gcgaactttc 780 gtagtaaacc taataactac aagcagtacg cacctatgta taagtatgtg gaaccctttg 840 acaggttgaa acgtttgagc cgtaaacaat tgaaaaatta tgttaggggc ataacgaatc 900 aatctgtaaa tcatggttat ctattgggta aaccactact gaagactgac gagcaagatc 960 cagagatgat tgtgttagag gaggaatcac taacccctac cgacagcaac ggagtcggca 1020 aggataaaat cgccgtaacc gctaaatccg ttgcggggct tccgacggcc tcgttgtcta 1080 tcaatcgtag atagctagat ctattgctaa cagacttagt gtcatgggag caaaactcat 1140 atgaggtcag tgaaacatga attgggaaga atcagaaccc gccgaaagga caggctgacg 1200 gcgtacgatt catgtgtagc tggctgggtg tgagacacaa aaaaaaaaaa aaaaaaaaaa 1260 aaaaaaaaaa aaaaaaaaaa aaaacctatg tttaatttga tagtaattta tcatgtctac 1320 agtcggaaca gggaagttaa ctcgtgcaca acgaagggct gcggcccgta agaacaagcg 1380 gaacactcgt gtggtccaac ctgttattgt agaacccatc gcttcaggcc aaggcaaggc 1440 tattaaagca tggaccggtt acagcgtatc gaagtggacc gcctcttgtg cggctgccga 1500 agctaaagta acctcggcta taactatctc tctccctatg agctatcgtc cgaaagacag 1560 cagctcagta gtagagttta ttatggcttg gtgcttccca gtgtagtggc acagtgaaat 1620 cctgtgttac agagacgcag actactgctg ctgcctcctt tcaggtggca ttagctgtgg 1680 ccgacaactc gaaagatgtt gtcgctgcta tgtaccccg 1719  

Claims (6)

Primer pairs represented by SEQ ID NO: 8 and SEQ ID NO: 12; Primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15; A pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 18; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; And a PCR primer pair for detecting Cowpea chlorotic mottle virus selected from the group consisting of primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23. The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 20; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21; And a PCR primer pair for detecting Eastern T. erythroid virus selected from the group consisting of the primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And (c) A method for detecting Eastern T. erug virus from a sample comprising the step of separating the PCR product by size. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; (c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And (d) a method for detecting eastern regression stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size. The method according to claim 4, wherein the nested primer pair is a primer pair of SEQ ID NO: 9 and SEQ ID NO: 14 for the primer pair represented by SEQ ID NO: 8 and SEQ ID NO: 12; For primer pairs represented by SEQ ID NO: 5 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 8 and SEQ ID NO: 16; For primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 18, primer pairs of SEQ ID NO: 5 and SEQ ID NO: 19; For primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 20, primer pairs of SEQ ID NO: 3 and SEQ ID NO: 21; For primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 21, primer pairs of SEQ ID NO: 2 and SEQ ID NO: 23; And the primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 23 are primer pairs of SEQ ID NO: 3 and SEQ ID NO: 23. A kit for detecting eastern relapsing stain virus comprising a primer pair of claim 1.

Images