KR101161284B1 - PCR detection system for Grapevine fanleaf virusspot virus - Google Patents

Abstract

The present invention relates to a PCR test system for diagnosing grapefruit leaf virus (GFLV) occurring in grapes and the like. The PCR test system includes an optimal primer combination for diagnosis of GFLV and a matching primer combination (nested primer), and a species specific primer combination and a positive control that can support the same.

Description

PCR detection system for Grapevine fanleaf virusspot virus}

This outbreak is caused by grapevine leaf virus ( Grapevine) and a PCR (PCR) test system for diagnosing fanleaf virus , hereinafter referred to as 'GFLV'.

The PSI test system includes an optimal primer combination for diagnosing GFLV and a corresponding assay primer (nested primer), and a species specific primer combination and a positive control which can support it.

In the past, electron microscopy and serological methods were mainly used for virus diagnosis. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among serological methods, enzyme-linked immunosorbent assay (hereinafter referred to as 'ELISA') is about 1000 times lower in sensitivity than the most commonly used diagnostic method or PCR diagnostic method. Failure to diagnose due to poor nonspecific reactions often occurs.

GFLV occurs mainly in grapes in nature, and the means of transmission are juice, grafting, seeds and nematodes. GFLV requires diagnostic methods that can detect it from grapes and soybeans imported as quarantine pathogens. Until now, ELISA has been mainly used for diagnosing GFLV, but it is often misdiagnosed by nonspecific reaction of plant extract and antiserum. In addition, low GFLV infection rates in the seeds to be tested are more likely to fail the test with ELISA. Thus, in order to detect viruses in these seeds, it is generally necessary to diagnose PSI with 1000 times higher detection sensitivity than ELISA. The quarantine site requires the diagnosis of various pathogens on a single test sample, which requires a lot of labor and test costs. Therefore, the development of the same test method for each pathogen is necessary. When diagnosing by PSI, it is necessary to establish pathogen-specific diagnostic primer banks and to test for positive and negative reactions in case of difficulty in discriminating due to the low intensity of specific reactions or for non-specific reactions with other nucleic acids. You need a system that can. On the other hand, when isolate-specific primers are used for diagnosis, the test may fail, and therefore, development of a species-specific primer capable of detecting all isolates present in a viral species is required.

Currently, in the diagnosis of RNA virus, RT-PCR method with high detection sensitivity and convenience is most commonly used. The development of species-specific primers is the most important for the diagnosis of the pathogen. No specific primers for diagnosing GFLV have been patented.

 The present invention has been made to solve the above problems, the detection limit of grape lichen leaf virus (GFLV) PCR test system capable of reacting with all GFLV strains with high detection limits and to test both positive and negative reactions to provide.

The present invention is a primer combination represented by SEQ ID NO: 8 and 19; Primer combinations represented by SEQ ID NOs: 9 and 18; Primer combinations represented by SEQ ID NOs: 11 and 16; And primer combinations represented by SEQ ID NOs: 12 and 15; provides one or more grape leaf leaf virus diagnostic primers selected from the group consisting of:

Preferably, there is provided a primer for diagnosing grape leaf leaf virus consisting of a primer combination represented by SEQ ID NO: 9 and 18 and a primer combination represented by SEQ ID NO: 11 and 16.

More preferably, the RT-PCR product of the primer combinations represented by SEQ ID NOs: 9 and 18 is assayed with at least one selected from the group consisting of a primer combination represented by SEQ ID NOs: 10 and 19 and a combination represented by SEQ ID NOs: 11 and 19 It provides a primer for diagnosing grape lichen leaf virus.

Further, more preferably, at least one RT-PCR product of the primer combination represented by SEQ ID NO: 11 and 16 selected from the group consisting of a primer combination represented by SEQ ID NO: 12 and 17 and a combination represented by SEQ ID NO: 13 and 17 To provide a primer for diagnosing grape leaf leaf virus to be assayed.

According to another embodiment of the present invention, a genomic RNA of a virus sample is provided as a template, and a grape leaf leaf virus diagnostic method of performing RT-PCR using the primer of claim 1 is provided.

Preferably, separating genomic RNA of the viral sample; Using the isolated genomic RNA as a template and performing RT-PCR using the primer of claim 1; And it provides a grape lichen leaf virus diagnostic method comprising the step of separating and analyzing the RT-PCR product by size.

In addition, preferably provides a grape lichen leaf virus diagnostic method further comprising the step of performing the PCR using the assay primer of claim 3 or claim 4 after the step of separating and analyzing the PT-PCR product by size. .

More preferably, the step of performing the PCR provides a grape leaf leaf virus diagnostic method using the nucleotide sequence represented by SEQ ID NO: 28 as a positive control.

According to another embodiment of the present invention, there is provided a grape leaf leaf virus diagnostic kit comprising the primer of claim 1.

Preferably, the grape leaf leaf virus diagnostic kit further comprises a positive control represented by SEQ ID NO: 28.

Within GFLV species there are strains or isolates with slightly different sequences. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus. Accordingly, the primers in the present invention were designed to work species specific. In the present invention, species-specific means that the primer can synthesize a specific RT-PCR product from the genome sequence of the entire virus to be diagnosed, and is common to all strains in the species of the virus to be diagnosed. And nonspecific reactions with nucleic acids from other similar species or plants should not occur.

In other words, the nucleotide sequences known to date have been collected within the species to search for common nucleotide sequences of all strains and isolates. The species-specific sequence was selected by excluding the nucleotide sequences of other viruses with a flexible relationship among the common sequences. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for each combination, and there was no non-specific reaction with nucleic acids other than the target virus. Selected.

In addition, the assay primer (nested primer) was also developed for the final selected primer combination.

In addition, by securing a variety of diagnostic primer combinations for GFLV to build a primer combination that can be tested for PCR positive and negative reactions. A plasmid cloned from the primer design region of GFLV was prepared to obtain a positive control, and the nucleotide sequence was determined to confirm the positive reaction. In addition, PCR reaction conditions were identically developed in all virus and primer combinations to increase the test efficiency at quarantine sites.

The grape lichen leaf virus (GFLV) PCR test system can detect GFLV from plant seeds and tissues with a detection limit of 1,000 times higher than that of conventional antisera. The GFLV diagnostic primers included in the PCR test system have been developed to react with all known GFLV strains, and also include tools for the validation of positive and negative responses. The test system of the present invention may be used for the industrialization of plant virus RT-PCR diagnostic kits and for the testing of GFLV from plant seeds at the quarantine site.

When the diagnostic method of the present invention is carried out, it is possible to precisely diagnose whether GFLV is infected from plants and seeds such as grapes and beans. It is also possible to industrialize RT-PCR diagnostic kits for plant viruses. By implementing the present invention will be able to minimize the damage of GFLV in the country, it can be easily used at the border quarantine site can effectively block the influx of GFLV-infected plants and seeds from foreign countries.

Hereinafter, the present invention will be described in more detail by way of examples.

Example 1 Design and Combination of GFLV Diagnostic Primer

GFLV is a spherical virus of about 30 nm in diameter composed of single stranded RNA. There are two genomes of GFLV, about 11.1 kb in total, about 7.3 kb for RNA 1 and about 3.7 kb for RNA 2. It is taxonomically belonging to the genus Combiiridae Nepovirus. GFLV is mainly transmitted by juice, grafting, seeds, nematodes, and the like. In nature, most hosts are related to vine plants, but experimentally have various hosts such as legumes and eggplants. The design of the diagnostic primers consisted of RNA 2 encoded envelope protein.

The GFLV consensus sequence search was made by multiple comparisons of the nucleotide sequences of 31 GFLV isolates known to date (Table 1). The selected common base sequence was searched for species-specific sequences compared to three viral base sequences of Comoviridae (Table 2), which are taxonomically similar to GFLV. Of these species specific nucleotide sequences, 27 diagnostic primers satisfying primer conditions were designed (Table 3).

[Table 1] Base sequence of GFLV isolate used in common sequencing

[Table 2] Comoviride sequencing used for species-specific sequencing

virus Genbank ac.no. Size (bp) Analysis genome GFLV-F13 NC_003623 3774 RNA 2 TobRSV NC_005096 3929 RNA 2 RpRSV-Cherry NC_005267 3914 RNA 2 ArMV-NW NC_006056 3820 RNA 2

Table 3 Diagnostic Primers Designed from GFLV Species Common Sequence

order SEQ ID NO: Length location* Forward GFLV-F10 GAAATTCGCCATGCTCAARCA One 21 748-768 GFLV-F20 CTACCGCTGCTTCCCCCTCTRC 2 22 1238-1259 GFLV-F30 CTGTGTCGGAGGAAGAGATGGA 3 22 1380-1401 GFLV-F40 GATCTGCTTCCACATTCTTAGG 4 22 1548-1569 GFLV-F60 TGGGACCTCTACAGTGGGAAAGTG 5 24 1908-1931 GFLV-F70 AGAGGATTAGCTGGTAGAGGAGTA 6 24 2045-2068 GFLV-F80 CTTCAAGGGTGTCCAGTATG 7 20 2140-2159 GFLV-F90 TGCCTTTACTGGATTGACRT 8 20 2224-2243 GFLV-F100 RTCTCCAAGGTTGCATTTCACR 9 22 2425-2446 GFLV-F110 TACTTGCCCTCCCATATTCTTTGA 10 24 2593-2616 GFLV-F120 GTTGTGTTTTGGGTATGGGAGGTA 11 24 2718-2741 GFLV-F130 CCCGGGGTGTATGTGGAAGAGGAY 12 24 2852-2875 GFLV-F140 GGTGAGACTGCGCAACTTCCTATT 13 24 3002-3025 Reverse GFLV-R10 CCTAGACTGGGAAACTGGT 14 19 3545-3563 GFLV-R20 AGTGTTTGGRTTTGCTCCTG 15 20 3414-3433 GFLV-R30 CTGCAAAATTCCCAACCAACAACT 16 24 3393-3416 GFLV-R40 ATTCGGTGTTCAGACTCCAYT 17 21 3261-3281 GFLV-R50 TCACCCGAAGGAGCGATAGG 18 20 2987-3006 GFLV-R60 ACTTCCGTCCTCTTCCACATACAC 19 24 2858-2881 GFLV-R70 ACCTCCCATACCCAAAACACAACT 20 24 2717-2740 GFLV-R80 GCTTGCCAGTCTGCCGCTARC 21 21 2470-2490 GFLV-R90 ACATGAAAACGTGCCCAACTTA 22 22 2344-2365 GFLV-R100 TTCAGGGTGCCCAAGTATCTRTTT 23 24 2095-2118 GFLV-R110 GGTTCCTCCACACTTTCCCATTG 24 23 1919-1941 GFLV-R130 CCCTAAGAATGTGGAAGCAGAW 25 22 1549-1570 GFLV-R140 CTTCCATCTCTTCCTCCGACACRG 26 24 1380-1403 GFLV-R150 CTGCGCAGAGGGGGAAGC 27 18 1246-1263

Location ^* : Genbank ac. no. Created based on NC_003623.

The designed primer is shown in FIG. 1. 90 primer combinations were made using these primers. RT-PCR products are shown in Table 4.

Table 4 GFLV Diagnostic Primer Combinations and RT-PCR Expected Products

* Primer position is Genbank ac. no. Created based on NC_003623.

Example 2 Construction of GFLV Diagnostic Primer Combination and Selection of Optimal Primer Combination

The GFLV primers designed as shown in Table 4 were combined in 90 to select the most effective primer combination for diagnosis through RT-PCR assay with GFLV and various related viruses. Selection of the optimal diagnostic primer combination consisted of three steps. The first is the selection by RT-PCR with GFLV infected plants, the second is the analysis of nonspecific responses to comoviride virus with taxonomic similarity, and the third is the virus infected with gourds and plants, the natural host of GFLV. Selection through RT-PCR analysis.

Total RNA isolation and RT-PCR methods used in the present invention are as follows.

(1) Total RNA Separation: Using a commercially available total RNA separation kit (method using phenol (Promega), TRIzol (Invitrogen Co.), easy-spin TM Total RNA Kit (iNtRON Co.)).

(2) RT-PCR: Reverse transcription reaction was 0.5μl total RNA isolated, 12.5pmole downstream primer, 5-fold reverse transcription buffer (250mM Tris-HCl, 150mM KCl, 40mM MgCl ₂ , 5mM DTT , pH 8.5) 5 μl of the reaction solution containing 1 μl, 10 μm dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out with 5 µl of reverse transcription reaction, 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl). ₂ , pH 8.3) 2 mu l was added and distilled water was added to make the reaction solution 25 mu l. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5 × TBE buffer and 1.5% agarose gel and stained with EtBr (ethidium bromide).

Figure 2 assays the specificity with GFLV of the 90 primer combinations in Table 4. The number at the top of Figure 2 means the number of the combination. As the RT-PCR template, total RNA extracted from grape leaf tissue infected with GFLV was used.

As shown in FIG. 2, among the 90 primer combinations in the RT-PCR assay with a GFLV infected plant, 20 were excellent in response strength and did not show a nonspecific response that interfered with diagnosis (combinations 8, 9, 15, 17, 25, 26, 39, 40, 41, 42, 49, 50, 51, 58, 65, 72, 82, 83, 85, 88) primer combinations were selected.

Figure 3 shows the results of RT-PCR analysis of the selected GFLV diagnostic primer combination and comoviride virus. The 20 primer combinations selected above were selected from four (combination 17, 25, 42, 51) primer combinations by analysis of nonspecific reactions with ten viruses of comoviride, a taxonomically similar virus (FIG. 3). Nonspecific response assays included Cowpea mosaic virus (CPMV), Squash mosaic virus (SqMV), Broad bean wilt virus (BBWV), Broad bean wilt virus 2 (BBWV2), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV) ), Tomato black ring virus (TBSV), Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Raspberry ringspot virus (RpRSV) was used.

Figure 4 shows the results of RT-PCR analysis of the selected GFLV diagnostic primer combination (25, 42) and host-associated virus. Of the combinations selected for analysis with taxonomic similar viruses, combinations 25 and 42 finally selected two (combination 25, 42) primer combinations from RT-PCR analysis with 22 viruses associated with GFLV hosts.

TABLE 5 Viruses Used to Analyze Nonspecific Responses with Host-Related Viruses

number virus number virus One Grapevine fanleaf virusspot virusvirus (GFLV) 2 Alfalfa mosaic virus (AMV) 3 Arabis mosaic virus (ArMV) 4 Bean yellow mosaic virus (BYMV) 5 Cherry leaf roll virus (CLRV) 6 Cowpea chlorotic mottle virus (CCMV) 7 Cowpea mild mottle virus (CPMMV) 8 Cucumber mosaic virus (CMV) 9 Cucumber necrosis virus (CuMV) 10 Cymbidium ringspot virus (CymRSV) 11 Lettuce mosaic virus (LMV) 12 Pepper veinal mottle virus (PVMV) 13 Prune dwarf virus (PDV) 14 Ribgrass mosaic virus (RMV) 15 Soybean mosaic virus (SMV) 16 Tobacco mosaic virus (TMV) 17 Tobacco necrosis virus (TNV) 18 Tobacco streak virus (TSV) 19 Tomato black ring virus (TBRV) 20 Tomato bushy stunt virus (TBSV) 21 Tomato ringspot virus (ToRSV) 22 Tomato spotted wilt virus (TSWV) 23 Turnip mosaic virus (TuMV)

Based on the above results, when diagnosing GFLV from seeds or plants, RT-PCR is first performed using primer combinations 25 and 42 selected as optimal diagnostic primers. If this diagnosis is insufficient, it can be verified using a combination of other primers of the GFLV diagnostic primer combination.

Example 3 Example of Diagnosis and Verification of GFLV

The primary diagnosis is using combination 25 and combination 42 as optimal primers for diagnosing GFLV at the test site. If the assay of the primary RT-PCR test result is necessary, i.e. to confirm that the RT-PCR product is a result derived from GFLV, a PCR test is performed using the assayed primer for this primer combination. Wherein the primer combinations for assay 25 for combination 25 are combination 35 (GFLV R40 / F130) and combination 36 (GFLV R40 / F140), and the assay primer combinations for combination 42 are combination 53 (GFLV R60 / F110) and combination 54 (GFLV R60 / F120).

Figure 5 shows the results of RT-PCR analysis of the GFLV diagnostic optimal primer combination and assay primer combination. In FIG. 5, M represents a size marker. Lane 1 is the RT-PCR result of the optimal diagnostic primer combination 25 (699bp), lane 2 is the assay primer combination for combination 25 RT-PCR result of the combination 35 (430bp), lane 3 is the primer for assay 25 The combination shows the RT-PCR result of combination 36 (280 bp). Lane 4 shows the RT-PCR result of the optimal diagnostic primer combination 42 (582 bp), lane 5 shows the combination of the primers for assay 42 for combination 42, RT-PCR result of the combination 53 (289 bp), and lane 6 for the combination 42. The RT-PCR result (164bp) of the combination 54 is shown as a primer primer for it.

At this time, if the RT-PCR reaction result is derived from GFLV, as shown in Figure 6, it shows a positive reaction in the PCR for assay.

In addition, the nucleotide sequence of FIG. 7 (SEQ ID NO: 28) was prepared as a positive control including the entire region in which the primer was designed to easily identify the PCR product derived from the GFLV primer combination of the present invention. This positive control was used as a positive control for PCR, and the base sequence of the inserted region of the positive control plasmid was determined and provided so that the base sequence of the required PCR product could be easily compared.

6 shows the PCR product of diagnostic primer combinations derived from GFLV positive controls. In FIG. 6, M represents a size marker. Lane 1 is the GFLV DNA fragment inserted into the positive control, PCR result of Combination 1 (SEQ ID NO: 28; 1,656bp), lane 2 PCR result of the diagnostic primer combination 25 (699bp), lane 3 PCR result of the diagnostic primer combination 42 (582 bp) is shown.

Figure 1 shows the location of the primer for grape leaf leaf virus (GFLV). Where the position of the primer is Genbank ac. no. It is based on NC_003623.

Figure 2 shows the RT-PCR results of 90 primer combinations for grape leaf leaf virus (GFLV).

Figure 3 shows the RT-PCR results of the selected primer combination and comoviride virus.

Figure 4 shows the RT-PCR results of the selected primer combination and host-associated virus.

Figure 5 shows the RT-PCR results of the primer combination for the diagnosis of grape leaf leaf virus (GFLV) (combination 25 and 42) and the primer combination for assay.

Figure 6 shows the PCR product of a combination of diagnostic primers derived from grape leaf leaf virus (GFLV) positive control.

7 is a nucleotide sequence of grape leaf leaf virus (GFLV) inserted into the positive control (GFLV-R10 / F60) (1,656 bp).

<110> the Republic of Korea <120> PCR detection system for Grapevine fanleaf virus <160> 28 <170> Kopatentin 1.71 <210> 1 <211> 21 <212> DNA <213> Grapevine fanleaf virus <400> 1 gaaattcgcc atgctcaarc a 21 <210> 2 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 2 ctaccgctgc ttccccctct rc 22 <210> 3 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 3 ctgtgtcgga ggaagagatg ga 22 <210> 4 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 4 gatctgcttc cacattctta gg 22 <210> 5 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 5 tgggacctct acagtgggaa agtg 24 <210> 6 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 6 agaggattag ctggtagagg agta 24 <210> 7 <211> 20 <212> DNA <213> Grapevine fanleaf virus <400> 7 cttcaagggt gtccagtatg 20 <210> 8 <211> 20 <212> DNA <213> Grapevine fanleaf virus <400> 8 tgcctttact ggattgacrt 20 <210> 9 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 9 rtctccaagg ttgcatttca cr 22 <210> 10 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 10 tacttgccct cccatattct ttga 24 <210> 11 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 11 gttgtgtttt gggtatggga ggta 24 <210> 12 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 12 cccggggtgt atgtggaaga ggay 24 <210> 13 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 13 ggtgagactg cgcaacttcc tatt 24 <210> 14 <211> 19 <212> DNA <213> Grapevine fanleaf virus <400> 14 cctagactgg gaaactggt 19 <210> 15 <211> 20 <212> DNA <213> Grapevine fanleaf virus <400> 15 agtgtttggr tttgctcctg 20 <210> 16 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 16 ctgcaaaatt cccaaccaac aact 24 <210> 17 <211> 21 <212> DNA <213> Grapevine fanleaf virus <400> 17 attcggtgtt cagactccay t 21 <210> 18 <211> 20 <212> DNA <213> Grapevine fanleaf virus <400> 18 tcacccgaag gagcgatagg 20 <210> 19 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 19 acttccgtcc tcttccacat acac 24 <210> 20 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 20 acctcccata cccaaaacac aact 24 <210> 21 <211> 21 <212> DNA <213> Grapevine fanleaf virus <400> 21 gcttgccagt ctgccgctar c 21 <210> 22 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 22 acatgaaaac gtgcccaact ta 22 <210> 23 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 23 ttcagggtgc ccaagtatct rttt 24 <210> 24 <211> 23 <212> DNA <213> Grapevine fanleaf virus <400> 24 ggttcctcca cactttccca ttg 23 <210> 25 <211> 22 <212> DNA <213> Grapevine fanleaf virus <400> 25 ccctaagaat gtggaagcag aw 22 <210> 26 <211> 24 <212> DNA <213> Grapevine fanleaf virus <400> 26 cttccatctc ttcctccgac acrg 24 <210> 27 <211> 18 <212> DNA <213> Grapevine fanleaf virus <400> 27 ctgcgcagag ggggaagc 18 <210> 28 <211> 1656 <212> DNA <213> Grapevine fanleaf virus <400> 28 tgggacctct acagtgggaa agtgtagagg aaccagggca aaccttctct attagaagtc 60 gctcacggtc tgtgaggatt gacagaaatg ttgatcttcc tcaacttgag gctgagccca 120 gattgagctc aaccgtgaga ggattagctg gtagaggagt catttacatc cctaaggatt 180 gccaggcaaa caggtatctg ggcaccctga acatacgtga tatgatttca gattttaagg 240 gtgttcagta cgaaaaatgg ataactgcag ggttagtcat gccaactttc aagatagtta 300 ttaggctgcc tgcaaatgct tttaccggat tgacatgggt gatgagcttt gatgcttata 360 atcggataac tagtagaatc actactagtg cagatcctgt atataccctg tccgttccgc 420 actggcttat ccatcataag ttgggcacgt tttcatgtga gatagattat ggagaattgt 480 gtggtcatgc catgtggttt aagtccacaa catttgagtc tccaaggcta catttcacat 540 gtttaacggg caacaacaaa gagctggcgg cagactggca agctgtcgtc gaattgtatg 600 ctgaattgga agaggcctcc tcttttcttg ggaaaccaac tttggttttt gacccaggag 660 tttttaatgg taaattccaa tttcttactt gccctcccat attctttgat ttaacggccg 720 tcacggctct taaaagtgct gggctgacat tgggacaagt cccaatggtt ggcactacta 780 aggtatataa cctaaacagc gctcttgcga gttgtgtttt gggtatggga ggtactatta 840 ggggaagggt gcacatttgt gcgccaatct tttatagtat tgttctgtgg gtcgttagtg 900 agtggaacgg gaccaccatg gattggaatg aactttttaa atatcccggg gtgtatgtgg 960 aagaggacgg aagctttgaa gtcaaaattc gctctccata tcaccggaca cctgctagat 1020 tgcttgctgg tcaaagtcag agggacatga gctctctaaa tttctatgca atagcaggac 1080 ctattgctcc gtcgggtgag accgcgcgac ttcctatcgt tgtacaaatt gatgaaatcg 1140 tgcgcccaga ccttgctcta ccgagttttg aagacgacta ttttgtatgg gtggattttt 1200 ctgagttcac ccttgacaaa gaagaaatag agattggttc tcgtttcttt gattttactt 1260 caaatacttg tagagtgatt atgggggaaa acccatttgc tgcaatgatc gcttgccatg 1320 gattacatag tggtgtatta gacctcaaac ttcaatggag tctgaacacc gattttggca 1380 aaagtagcgg gagcgttaca gtcacgaagc tggtgggcga caaagctaca ggtctggatg 1440 ggccttctca ggtttttgct attcaaaaat tagagggaac tacagaattg ttgattggga 1500 attttgcagg agcaaaccca aacactcatt tctccctata tagtcgatgg atggcaatca 1560 aattagaccg agcaatgagt attaaagtac tccgagtctt gtgcaagcct cgtccaggtt 1620 tcaactttta tggaaggacc agtttcccag tctagg 1656  

Claims (12)

Primer combinations represented by SEQ ID NOs: 8 and 19; Primer combinations represented by SEQ ID NOs: 9 and 18; Primer combinations represented by SEQ ID NOs: 11 and 16; And primer combinations represented by SEQ ID NOs: 12 and 15; one or more grape leaf leaf virus diagnostic primers selected from the group consisting of: The method of claim 1, A primer for diagnosing grape leaf leaf virus, comprising a primer combination represented by SEQ ID NOs: 9 and 18 and a primer combination represented by SEQ ID NOs: 11 and 16. The method according to claim 1 or 2, RT-PCR product of the primer combination represented by SEQ ID NO: 9 and 18 A primer for diagnosing grape leaf leaf virus, characterized in that the assay is performed with at least one selected from the group consisting of a primer combination represented by SEQ ID NO: 10 and 19 and a combination represented by SEQ ID NO: 11 and 19. The method according to claim 1 or 2, RT-PCR product of the primer combination represented by SEQ ID NO: 11 and 16 A primer for diagnosing grape leaf leaf virus, characterized in that the assay is performed with at least one selected from the group consisting of a primer combination represented by SEQ ID NOs: 12 and 17 and a combination represented by SEQ ID NOs: 13 and 17. A genomic RNA of a virus sample as a template, and grape leaf leaf virus diagnostic method characterized in that by performing the RT-PCR using the primer of claim 1. The method of claim 5, Isolating genomic RNA of the viral sample; Using the isolated genomic RNA as a template and performing RT-PCR using the primer of claim 1; And Grapefruit leaf virus diagnostic method comprising the step of separating and analyzing the RT-PCR product by size. The method of claim 6, After the step of separating and analyzing the PT-PCR product by size, PCR is performed using at least one assay primer selected from the group consisting of a primer combination represented by SEQ ID NOs: 10 and 19 and a combination represented by SEQ ID NOs: 11 and 19. Grape lichen leaf virus diagnostic method comprising the step of further comprising. The method of claim 7, wherein In the step of performing the PCR, grape leaf leaf virus diagnostic method, characterized in that using the nucleotide sequence represented by SEQ ID NO: 28 as a positive control. Grape leaf leaf virus diagnostic kit comprising the primer of claim 1. 10. The method of claim 9, The grape leaf leaf virus diagnostic kit grape leaf leaf virus diagnostic kit further comprises a positive control represented by SEQ ID NO: 28. The method of claim 6, After the step of separating and analyzing the PT-PCR product by size, PCR is performed using at least one assay primer selected from the group consisting of a primer combination represented by SEQ ID NOs: 12 and 17 and a combination represented by SEQ ID NOs: 13 and 17. Grape lichen leaf virus diagnostic method comprising the step of further comprising. 12. The method of claim 11, Grape lichen leaf virus diagnostic method, characterized in that using the nucleotide sequence represented by SEQ ID NO: 28 as a positive control in the step of performing the PCR.

Images