KR100846174B1 - 4 Multiplex detection primer set for PVY PLRV PVX and PVS infecting potato and the method diagnosing infectious diseases by using the same - Google Patents

Abstract

The invention potato Y virus generated in the potato (Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato X virus (Potato virus X, PVX), and Potato S virus (Potato virus S, PVS The present invention relates to a primer set for simultaneous diagnosis of SEQ ID NOs. 1 to 8 and a diagnostic method using the same.

Potato, Virus, Simultaneous Diagnosis, Multiplex, PVY, PLRV, PVX, PVS, RT-PCR, Diagnostic Primer Sets

Description

Multiplex detection primer set for PVY, PLRV, PVX and PVS infecting potato and the method diagnosing infectious diseases by using the same}

1 is a cleavage map showing the position of the nucleotide sequence of the PVY primer.

2 is a cleavage map showing the position of the nucleotide sequence of the PLRV primer.

3 shows RT-PCR results for four viruses using various primer combinations:

Lanes 1-4: PVX mF and PVXmR 10 pM, PVSF and PVSR 10 pM

Lanes 5-8: PVX mF and PVXmR 2 pM, PVSF and PVSR 5 pM

Lane M: 100 bp size marker.

Figure 4 shows the results of RT-PCR performance to determine the conditions for optimal primer concentration composition [M: 100bp ladder size marker; PVY64F + PVYCPR (260 bp), PLRVmF + PLRVmR (431 bp), PVXmF + PVXmR (598 bp) and PVSF + PVSR (720 bp) at 10, 10, 1 and 3 pM concentrations (lane 1), respectively; 10, 8, 2 and 4 pM (lane 2); 10, 5, 1 and 5 pM (lane 3)].

Figure 5 shows the RT-PCR co-diagnosis results of four viruses occurring in potatoes using the co-diagnostic primer combination:

Lanes 1 to 4: Infection of PVY (1), PLRV (2), PVX (3), PVS (4) alone

Lanes 5 to 10: two kinds of virus complex infections [PVY + PLRV (5), PVY + PVX (6),

PVY + PVS (7), PLRV + PVX (8), PLRV + PVS (9), PVX + PVS (10)]

Lanes 11-14: Three virus combinations each

Lane 15: four virus combinations (PVY, PLRV, PVX, PVS)

The invention potato Y virus generated in the potato (Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato X virus (Potato virus X, PVX), and Potato S virus (Potato virus S, PVS The present invention relates to a primer set for simultaneous diagnosis of SEQ ID NOs. 1 to 8 and a diagnostic method using the same.

Viruses are pathogens smaller than 1 μm in size and cannot be seen by optical microscopy, and require an electron microscope to see them with the naked eye. And yet, the pharmaceutical control method that acts directly on the virus has not been developed yet. For this reason, precise and rapid diagnosis is a prerequisite for the management of viral diseases.

The serological diagnostic methods that have been widely used up to now have been mainly used for diagnosing a large number of samples with general accuracy, but have had problems up to a few. In other words, a virus that has a serologically flexible relationship with a virus to be diagnosed may be misidentified, and may be misdiagnosed due to a nonspecific reaction by a host-derived material depending on the type of plant infected with the virus. In addition, in case of diagnosing a multi-infected virus, it is inconvenient to diagnose several times with different antibodies. The reverse transcription-polymerase chain reaction (RT-PCR) method, which is commonly used for precise diagnosis in plant viruses, determines the specificity and precision of the diagnosis. In general, primers used in general are designed for the purpose of gene cloning of the virus and are not species specific. In addition, the production of non-specific products by plants or other viruses is often unsuitable for use in diagnostics. In addition, in order to diagnose several kinds of viruses in the same sample, the reverse transcription-polymerase chain reaction using various kinds of primers has a problem that requires a lot of diagnostic cost and labor.

Therefore, the present inventors collected base sequences so far known in four viruses, searched for common base sequences possessed by all strains and isolates of the species, and then sequenced sequences among other viruses having a flexible relationship among the common sequences. Species specific sequences can be selected by excluding them from the design of the primers, and then the sequences having optimal conditions from these species specific sequences to the primers are designed as species specific primers, and these primers are combined by actual reverse transcription-polymerase chain reaction. Through RT-PCR, there was no non-specific reaction with nucleic acids other than the target virus, and finally, a combination having excellent sensitivity to the target virus was selected to complete the present invention.

Accordingly, an object of the present invention is Potato virus Y (PVY), Potato leafroll virus (PLRV), Potato virus X (PVX) and Potato S virus ( Patoto) Virus S , PVS) is to provide a set of simultaneous diagnostic primers of SEQ ID NO: 1 to 8 and the diagnostic method using the same can be diagnosed four viruses at the same time.

In order to achieve the above object, the present invention potato occurring potato Y virus (Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato X virus (Potato virus X, PVX), and Potato S Provided is a primer set for simultaneous diagnosis of SEQ ID NOs: 1 to 8 that can simultaneously diagnose four viruses of the virus ( Patoto virus S , PVS).

In another aspect, the present invention provides a method for diagnosing infection by a virus in potatoes comprising the steps of:

1) separating the nucleic acid from the viral infection sample; And

2) performing RT-PCR using a specific primer of SEQ ID NOs: 1 to 8 as a template of the nucleic acid separated in step 1).

Hereinafter, the present invention will be described in more detail.

Potatoes grown in Korea are potato Y virus ( Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato virus X (Potato Four viruses, including virus X , PVX) and Potato virus S (PVS), cause most of the disease. The most problematic viruses in potatoes are PVY and PLRV, with annual yield reductions of 10-80%. PVX is a virus that is easily transmitted by contact, and its damage is great with one occurrence. PVS is difficult to diagnose because the symptoms are not visible to the naked eye.

Within virus species, there are lines or isolates with slightly different sequences. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus.
In the present invention, for the effective diagnosis of these viruses, a combination of primers capable of simultaneously diagnosing four viruses has been developed. More specifically, the nucleotide sequences known to date are collected within four viruses to search for common nucleotide sequences possessed by all strains and isolates of the species, and among these nucleotide sequences, primers are sequenced by other viruses with flexible relationships. Species specific sequences were selected by exclusion from the design. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual reverse transcriptase-polymerase chain reaction (RT-PCR) for each combination and did not have a nonspecific reaction with nucleic acids other than the target virus, and finally selected a combination having excellent sensitivity to the target virus.

Primer combination according to the present invention was designed to easily distinguish species by the size of the reverse transcription-polymerase chain reaction product of the species-specific primers selected by virus, among these combinations of the single infection and any combination of four viruses The combination of all infections and excellent detection sensitivity was selected to minimize the diagnosis cost and labor.

Four simultaneous diagnostic primers of the present invention are designed in a common base sequence that all strains in the target virus species can be species-specific diagnosis. In addition, RT-PCR diagnosis using a combination of primers for simultaneous diagnosis has more than 1,000 times the detection ability compared with the antiserum method, and compared to the RT-PCR method using a pair of primers, the diagnostic cost and labor are 4 minutes while maintaining the precision. Could save by one.

In addition, in the present invention, potato Y virus comprising the following steps ( Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato virus X (Potato virus X , PVX) and potato S virus ( Potato virus S , PVS) provides diagnostic methods for infectious diseases:

1) First, a potato virus Y (Potato virus Y, PVY), potato leaf curl virus (Potato leafroll virus, PLRV), potato virus X (Potato virus X , PVX) and potato S virus ( Potato nucleic acid is isolated from potatoes infected with or suspected of being infected with one or more of virus S , PVS).

2) RT-PCR is performed on the nucleic acid separated in step 1) using specific primers of SEQ ID NOs. At this time, RT-PCR reaction conditions were reverse transcription reaction at 45 ℃ 30 minutes and then reverse transcription enzyme at 94 ℃ 4 minutes and then repeated 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 60 seconds reaction 35 times 72 After treatment for 5 minutes, it is maintained at 4 ℃ until the next step. In addition, the optimal concentration of the primers SEQ ID NO: 1 and 2: SEQ ID NO: 3 and 4: SEQ ID NO: 5 and 6: It is preferable that the concentration ratio of SEQ ID NO: 7 and 8 is combined 10: 10: 1: 3.

The present invention consists of a combination of primers that can simultaneously diagnose four types of viruses (PVY, PLRV, PVX, PVS) occurring in potatoes. Hereinafter will be described in detail with reference to the embodiment of the present invention. However, the following examples are intended to illustrate the present invention in detail, and the scope of the present invention is not limited by these examples.

[ Example  One] primer  Design and Selection

1) In order to select primers that can be used for diagnosing four types of viruses (PVY, PLRV, PVX, PVS) occurring in potatoes, as shown in Table 1 below, the parts with high homology of all strains for each virus are shown. Primers for each virus were designed. The present inventors designed primer sequences of various sizes because the virus should be classified according to the size of the RT-PCR product, and the optimum primers were selected by examining the reactivity to each virus. For PVY and PLRV, the best primers were selected with all combinations of primers selected to select suitable primers (FIGS. 1-2, Table 2-3). Reverse transcription at 45 ° C. for 30 minutes using the primers followed by removal of reverse transcriptase at 94 ° C. for 4 minutes, followed by denaturation at 94 ° C. for 30 seconds, annealing at 50 ° C. for 30 seconds, and expansion at 72 ° C. for 60 seconds. After treatment for 5 minutes at 72 ℃ was performed RT-PCR maintained at 4 ℃ until the next step.

Primer Sequence and Design for Four Viruses virus Primer Name Sequence (5 '→ 3') mer PVY PVYF AAGAAAGATGCAAAACCAGA 20 PVYR TCGTGATGTGACCTCATAAA 20 PVYCPF ATGACACAATTGATGCAGGAGGAA 24 PVYCPR GGTGGTGTGCCTCTCTGTGTTCT 23 PVY64F GATGTTGCAGAAGCGTATAT 20 PVY64R GTCTCCTGATTGAAGTTTAC 20 PVYmF ATGGGAATGAACAAGTTGAG 20 PVYmR TCGTGATGTGACCTCATAAA 20 PLRV PLRVF TGGTGTACAACAACCAAGAA 20 PLRVR AAGATTTTCCATTTCCCTTC 20 PLRVCPF GAGTACGGTCGTGGTTAAAG 20 PLRVCPR AGATTTTCCATTTCCCTTCC 20 PLRV62F GAAATTCCAGCTTTAGCGCA 20 PLRV62R ACGGCAGACTTTGGCGGTTT 20 PLRVmF TGGTGTACAACAACCAAGAA 20 PLRVmR CCTTCGTAATTTGGAACTTG 20 PVX PVXF AATGATAGATACGGGTCCCT 20 PVXR AGACGTAGTTATGGTGGTGG 20 PVX30F CTGACTAACAACAGTCCACC 20 PVX30R GTAGGCGTCGGTTATGTA 18 PVXmF ACAGCTTCAGGACTGTTCAC 20 PVXmR TTGTTGTTCCAGTGATACGA 20 PVS PVSF CAGAATGAAGAGGCTATGCT 20 PVSR CCCTCCAGTGTACTCAACAT 20 PVSCPF ATGCCGCCTAAACCAGATCCG 21 PVSCPR CATTGGTTGATCGCATTACGGTG 23 PVSmF CTAAACCAGATCCAACAAGC 20 PVSmR CCCTCCAGTGTACTCAACAT 20

Primer Combination and Size of RT-PCR Products for PVY Primer Selection Sense primer Antisense primer product PVYCP F PVY R 650 PVY F PVY R 590 PVY F PVYCP R 720 PVY64 F PVY R 130 PVY64 F PVYCP R 255 PVY64 F PVY64 R 640 64F CPR 260 mF CPR 347

Primer Combination and Size of RT-PCR Products for PLRV Primer Selection Sense primer Antisense primer product PLRVCP F PLRVCP R 530 PLRVCP F PLRV R 532 PLRV F LPRVCP R 565 PLRV F PLRV R 563 PLRVmF PLRVmR 431

 2) In order to select the best primers for the diagnosis of 4 types of viruses (PVY, PLRV, PVX, PVS) in potatoes, nucleic acids were isolated from two virus-infected two strains and reverse-transcribed at 45 ° C for 30 minutes, followed by 94 ° C. After removing the reverse transcriptase for 4 minutes at and then denatured at 94 ° C for 30 seconds, annealing at 50 ° C for 30 seconds, and expanding for 60 seconds at 72 ° C, the reaction was repeated 35 times, followed by 72 ° C for 5 minutes, and then maintained at 4 ° C until the next step. RT-PCR was performed. First, PVY and PLRV were selected from two combinations of the most effective ones selected above, and two combinations of PVX and PVS, and four pairs of primers were tested at various concentrations. Through many iterations, three combinations with four bands are best seen as in FIG. To determine the combination of PVX and PVS based on the combination of PVY 64F and PVY CPR and PLRVmF and PLRVmR in FIG. 3, the concentrations of PVX mF and PVXmR are 10 pM in lanes 1 to 4 and lanes 5 to 8. The concentrations of PVSF and PVSR were 2 pM, lanes 1 to 4 were 10 pM, lanes 5 to 8 were 5 pM, and lane M was a 100bp size marker. The most optimal primer combination at this time is shown in Table 4 below. PVY was selected as PVY64F / PVYCPR, PLRV as PLRVmF / PLRVmR, PVX as PVXmF / PVXmR and PVS as PVSF / PVSR. The size of the product is 260, 431, 598 and 720 bp, respectively, about 150 bp, so there is no confusion of band position.

Combination of primers for each virus to form optimal conditions Virus name PVY PLRV PVX PVS Primer Name PVY64F PLRVmF PVXmF PVSF PVYCPR PLRVmR PVXmR PVSR Product length 260 431 598 720

3) In order to determine the optimal primer concentration for each virus selected, a number of combinations were prepared and reverse transcription reaction was performed at 45 ° C. for 30 minutes using the same. Then, the reverse transcriptase was removed at 94 ° C. for 4 minutes, followed by denaturation at 94 ° C. for 30 seconds. RT-PCR was performed by annealing at 50 ° C. for 30 seconds and expanding the reaction at 72 ° C. for 60 seconds for 35 times, followed by treatment at 72 ° C. for 5 minutes, and then maintained at 4 ° C. until the next step. Basically, various combinations were prepared by increasing or decreasing the concentration based on 10 pM. At this time, the primer concentration for optimizing PVY showing the most difference in reaction was set first. The primer concentration of PVY was most effective at 10 pM, so that the concentration of the remaining viral primers was adjusted after fixing the PVY concentration. The high concentration of PLRV was 10 pM, and the high concentration of PVX influenced the response of other viruses and was sufficient even at low concentration of 1 pM. At low concentrations of 3 pM, higher PVS concentrations resulted in the most intestinal response without affecting other viruses (Table 5 and Figure 4).

Finding Conditions for Optimal Primer Concentration Composition virus Primer Name Length of product Primer Concentration Composition (pM) One 2 3 PVY PVY64F PVYCPR 260 10 10 10 PLRV PLRVmF PLRVmR 431 10 8 5 PVX PVXmF PVXmR 598 One 2 One PVS PVSF PVSR 720 3 4 5

virus Primer Name Sequence (5 '→ 3') Primer Concentration (pM) PVY PVY64F  GATGTTGCAGAAGCGTAT (SEQ ID NO: 1) 10 PVYCPR  GGTGGTGTGCCTCTCTGTGTTCT (SEQ ID NO: 2) PLRV PLRVmF  TGGTGTACAACAACCAAGAA (SEQ ID NO: 3) 10 PLRVmR  CCTTCGTAATTTGGAACTTG (SEQ ID NO: 4) PVX PVXmF  ACAGCTTCAGGACTGTTCAC (SEQ ID NO: 5) One PVXmR  TTGTTGTTCCAGTGATACGA (SEQ ID NO: 6) PVS PVSF  CAGAATGAAGAGGCTATGCT (SEQ ID NO: 7) 3 PVSR  CCCTCCAGTGTACTCAACAT (SEQ ID NO: 8)

[ Example  2] RT - PCR

end. Nucleic Acid Isolation

1) 0.1 g potato tissue was added to 600 µl of cold 2X STE buffer, 100 µl of 10% SDS, and 20 µl of mercaptoethanol, and ground in an e-tube using a pestle. STE (5.86 g NaCl, 1.22 g Tris, 0.38 g EDTA, total 1,000 mL H ₂ O).

2) 700 μl of phenol: chloroform: isoamyl alcohol (25: 24: 1) was added to the mixture of 1) and shaken vigorously for 5 minutes.

3) After centrifuging the mixture of 2) for 20 minutes at 10,000 g, 600 μl of the supernatant was transferred to a new e-tube, and then 115 μl of 95% frozen ethanol was shaken well.

4) The CF-11 column was washed once with 16.5% ethanol-impregnated STE buffer, and the sample of 3) was added to the column.

5) The column was washed 7-9 times 600 μl each with 16.5% ethanol-impregnated STE buffer, and then dried by centrifugation at 10,000 g for 2 minutes.

6) 50 μl of sterilized distilled water was added to the sample of 5) and centrifuged at 10,000 g for 1 minute to extract the nucleic acid.

I. RT-PCR and Check Results

Nucleic acid isolated using the developed column was directly assayed by one-step RT-PCR method. 8 μl of a one-step premix (intron) enzyme, 2 μl of the isolated nucleic acid, 4 μl of the multiplex primer cocktail, and 6 μl of distilled water were added to make the whole 20 μl. RT-PCR reaction first reverse transcription at 45 ° C. for 30 minutes, followed by removal of reverse transcriptase at 94 ° C. for 4 minutes, followed by denaturation at 94 ° C. for 30 seconds, annealing at 50 ° C. for 30 seconds, and expansion at 72 ° C. for 60 seconds. After repeated treatment for 5 minutes at 72 ℃ was kept at 4 ℃ until the next step.

After the RT-PCR reaction was completed, electrophoresis was performed for 30 minutes at 100V on a 1% agarose gel. It was confirmed in the back.

[ Example  3] detailed Primer  Simultaneous Diagnosis

RT-PCR diagnosis was performed for single infection, two combination infections, three combination infections, and four combination infections using selected PVY64F / PVYCPR, PLRVmF / PLRVmR, PVXmF / PVXmR, and PVSF / PVSR primers. The results are shown in FIG.

First, nucleic acids were isolated from single and complex infected samples and RT-PCR was added to four diagnostic primer cocktails. As a result, as shown in FIG. 5, the response was accurate even in the single infection and the complex infection. The band position was 260 bp for PVY, 431 for PLRV, 598 for PVX, and 720 bp for PVS. The difference in the size of adjacent RT-PCR products was 171 bp for PVY and PLRV, 167 bp for PLRV and PVX, and 122 bp for PVX and PVS. It was easy to see if the virus was infected.

Simultaneous diagnosis of four viruses (PVY, PLRV, PVX, PVS) in potato is not only diagnosed for each virus with one RT-PCR response, but also specifically for the combination of all four viruses. It is possible. The use of this diagnostic method can reduce the cost and labor of diagnosis to a quarter. In addition, RT-PCR diagnosis using a specific primer for diagnosis has a detection limit of 1,000 times or more than that using antiserum, and may promote industrialization of plant virus RT-PCR diagnostic kit.

Attach sequence list electronic file  

Claims (3)

Potato virus Y (PVY), Potato leafroll virus (PLRV), Potato virus X (PVX) and Potato virus S (PVS), which occur on potatoes simultaneously As a set of primers that can be diagnosed, A primer set consisting of the primers of SEQ ID NOs: 1-8. 1) Potato virus Y (Potato virus Y , PVY), Potato leafroll virus (PLRV), Potato X virus ( Potato virus X , PVX) and potato S virus ( Potato separating nucleic acid from potatoes infected with or suspected of being infected with one or more of virus S , PVS); And 2) Reverse transcription of the nucleic acid separated in step 1) using a specific primer of SEQ ID NOS: 1 to 8 at 45 ° C. for 30 minutes, followed by removal of reverse transcriptase at 94 ° C. for 4 minutes, followed by denaturation at 94 ° C. for 30 seconds, and 50 ° C. Performing an RT-PCR process of annealing for 30 seconds and expanding the reaction for 60 seconds at 72 ° C for 35 times, followed by treatment for 5 minutes at 72 ° C, and maintaining at 4 ° C until the next step; Method of diagnosis of potato virus infection comprising a. The potato according to claim 2, wherein the specific primers have a concentration ratio of SEQ ID NO: 1 and 2: SEQ ID NO: 3 and 4: SEQ ID NO: 5 and 6: SEQ ID NO: 7 and 8 in combination of 10: 10: 1: 3. Method of diagnosis of viral infections.

Images