KR100968762B1 - 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 - Google Patents
나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 Download PDFInfo
- Publication number
- KR100968762B1 KR100968762B1 KR1020080015344A KR20080015344A KR100968762B1 KR 100968762 B1 KR100968762 B1 KR 100968762B1 KR 1020080015344 A KR1020080015344 A KR 1020080015344A KR 20080015344 A KR20080015344 A KR 20080015344A KR 100968762 B1 KR100968762 B1 KR 100968762B1
- Authority
- KR
- South Korea
- Prior art keywords
- genebank
- registration number
- gene registration
- protein
- gene
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
Abstract
본 발명은 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 구체적으로 다환 방향족 탄화수소류 중의 하나인 나프탈렌(Naphthalene)에 의해 특이적으로 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 나프탈렌에 대한 노출 여부를 확인하는 방법에 관한 것이다. 본 발명의 바이오마커는 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 환경 시료에서 나프탈렌의 오염을 모니터링 및 판정하는데 유용하게 사용될 수 있으며, 나프탈렌에 의해 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.
나프탈렌(Naphthalene), 다환 방향족 탄화수소, 바이오마커, 마이크로 어레이
Description
본 발명은 나프탈렌(naphthalene)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 더욱 상세하게는 나프탈렌에 의해 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 나프탈렌에 대한 노출 여부를 확인하는 방법에 관한 것이다.
나프탈렌(Naphthalene)은 2개의 인접한 벤젠 고리로 구성된 다환 방향족 탄화수소류로서 물에는 거의 녹지 않으며, 휘발성이 강해서 대기압에서 기체 상태로 존재한다. 주로 프탈레이트 가소제, 수지 및 의약품 생산의 중간체로서 존재하며, 독특한 향을 가지고 있어 곤충기피제나 방취제로 사용된다. 또한, 가솔린과 디젤연료 중에 존재하며 자동차를 포함한 광범위한 발생원으로 인해 나프탈렌 농도는 공간에 따라 변동이 크고 일일 및 계절에 따른 변동 폭도 큰 것으로 알려져 있다. 나프탈렌의 환경 중 이동은 휘발성이 강해서 토양이나 지표수 중에서 대기로 쉽게 배출되어지며 대기 중 반감기는 1일 미만으로 보고되고 있다. 또한, 나프탈렌의 광산화물인 나프토퀴논(naphthoquinone) 및 니트로-나프탈렌(nitro-naphthalene)은 나프탈렌 자체보다 독성이 강한 것으로 알려져 있다.
국내의 상수원수에서 검출되는 미량유해물질조사에서 나프탈렌이 0 ~ 4.6 ㎍/ℓ의 농도범위로 검출되었으며(환경부 자료실, 1996), 도시산업지역의 지하수 오염특성조사연구에서도 약 0.2 ㎍/ℓ의 농도로 검출되었다(이평구 등, 도시산업지역 지하수 오염특성 및 예방 기법연구, 2003). 작업장 중에서도 아스팔트 흄에서의 다환방향족탄화수소류의 성분별 분석연구에서는 4.7 mg/m2의 농도로 나타났다(최재욱 등, 건설업 근로자의 유해 작업 환경 노출 실태에 관한 연구, 2000). 국외의 경우, 미국의 자동차 배기가스로 인한 나프탈렌의 대기농도 조사에서 샌프란시스코의 칼데콧(Caldecott) 터널과 로스엔젤로스 밴 나이스(Van Nuys) 터널에서 수집한 시료에서 각각 104.3 와 1,709 ㎍/m2의 농도로 검출되었다(Zielinska & Fung, Sci Total Environ 146/147:281-8, 1994; Fraser et al., Environ Sci Technol 32:2051-2060, 1998).
동물실험 결과, 나프탈렌의 반복, 및 단기 노출은 일차적으로 간독성 및 신경독성을 유발하는 것으로 보고되어지고 있으나, DNA 손상, 유전자 돌연변이, 염색체구조이상 및 염색체 수적 이상, 차세대 유전 독성 가능성을 유발하지 않는 것으로 보아 인체에서 유전 독성을 보일 가능성은 희박한 것으로 사료된다(국립독성과 학원, 독성물질국가관리사업, 2007).
또한, 나프탈렌은 세계보건기구(WHO) 산하의 국제암연구기관(IARC)에서 '인체 발암 가능성 물질'인 2B등급으로 분류하고 있으며(IARC, IARC Monogr Eval Carcinog Risks Hum 82: 367-435, 2002), 미국 환경부의 발암성 분류 등급에서는 ‘잠재적인 인체 발암물질’로 발암성 C등급으로 구분하고 있다(IRIS, U.S. Environmental Protection Agency Washington, DC: Integrated Risk Information System. http://www.epa.gov/iris/. June 6, 2003).
다환방향족 탄화수소류의 발암성 정도와 유전자 발현 변화에 대한 연구는 일부 보고되고 있지만, 대표적인 다환방향족 탄화수로류로 알려진 벤조에이파이렌(Benzo[a]pyrene)에 대한 연구에 거의 국한되어 있다. 이처럼 나프탈렌의 인간에 대한 발암 가능성에도 불구하고 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법에 국한되어 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한 스크리닝(screening) 방법, 예를 들면 프라이머(primer)를 이용하는 실시간(real-time) PCR(Real-time reverse transcript polymerase chain reaction) 또는 DNA 마이크로어레이 칩 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 나프탈렌의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.
포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행한다(Schena, M., et al., Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996).
마이크로어레이는 cDNA(complementary DNA)나 20 ~ 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 애질런트(Agilent), 지노믹 솔루션(Genomic Solutions) 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화 하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 애피매트릭스(Affymetrix)사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어지고 있으며, 애질런트(Agillent)사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer, K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004).
유전자의 발현 분석을 위해서는 조직 등 시료에서 RNA를 얻어 DNA 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 RNA는 형광이나 동위원소로 표지화하며 cDNA로 전환시킨다. 올리고 마이크로어레이는 주로 두개의 다른 형광(예: Cye3 및 Cye5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 교잡 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두 개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Somasundaram, K. et al., Genomics Proteomics I:1-10, 2002).
최근 DNA 마이크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 대표적인 환경오염물질을 비롯하여 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 이 가능하게 될 것이다.
이에 본 발명자들은 인간 유전자 4만 4천 개가 집적된 올리고마이크로어레이를 이용하여 나프탈렌의 유전자 발현 프로파일을 인간 간암 세포인 HepG2 세포주에서 관찰 및 분석함으로써 나프탈렌에 의해 과발현 또는 저발현 되는 유전자를 발굴 하고, 실시간(real-time) RT-PCR 방법에 의해 상기 유전자들의 발현 양상을 확인함으로써 나프탈렌을 검출할 수 있는 바이오마커 및 이를 이용한 노출 여부를 확인하는 방법을 확립하여 본 발명을 완성하였다.
본 발명의 목적은 나프탈렌(Naphthalene)의 노출에 의해 과발현 또는 저발현되는 바이오마커 및 상기 바이오마커를 이용한 나프탈렌에 대한 노출 여부를 확인하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 나프탈렌(naphthalene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 나프탈렌에 대한 노출 여부 확인용 바이오마커를 제공한다.
또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 이의 상보가닥 분자가 집적된 나프탈렌에 대한 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다.
또한, 본 발명은 상기 바이오마커를 이용한 나프탈렌에 대한 노출 여부를 확인하는 방법을 제공한다.
아울러, 본 발명은 나프탈렌에 대한 노출 여부 확인용 검색 키트를 제공한다.
본 발명의 나프탈렌(naphthalene)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법은 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 나프탈렌의 모니터링 및 위해성을 판정하는데 유용하며, 나프탈렌에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.
이하, 본 발명을 상세히 설명한다.
본 발명은 나프탈렌(naphthalene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 나프탈렌에 대한 노출 여부 확인용 바이오마커를 제공한다.
상기 바이오마커는 2배 이상 발현이 증가 또는 감소한 유전자로써, 세포 주기(cell cycle), 세포 성장(cell growth), 세포 이동(cell migration), 아팝토시스(apoptosis), 전사(transcription), 뉴클레오티드 결합(nucleotide binding), 금속원소 결합(metal binding), 자극에 대한 반응(Response to stimulus), 징크-핑거(Zinc-finger), 단백질 전달(protein transport), 면역반응(immune response), MAPKinase 신호 경로(MAPKinase signaling Pathway), WNT 신호 경로(WNT signaling pathway), 지방산 대사(fatty acid metabolism), 지질 대사(lipid metabolism), 사이토크롬에 의한 외부물질의 대사(metabolism of xenobiotics by cytochrome), 알코올 대사(Alcohol metabolism), DNA 손상 반응(response to DNA damage stimulus) 또는 갭 결합(Gap Junction) 등의 관련 유전자로 구성되어 있다.
본 발명은 하기와 같이 구성된 군에서 선택되어지는 것을 특징으로 하는 바 이오마커를 제공한다:
유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) NM_138639(BCL2L12, BCL2-like 12(proline rich)), 유전자 등록번호(Genebank) AK124526(BCAR1, Breast cancer anti-estrogen resistance 1), 유전자 등록번호(Genebank) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(Genebank) AB209095(CDC2L2, Cell division cycle 2-like 2(PITSLRE proteins)), 유전자 등록번호(Genebank) AK128462(CRR9, Cisplatin resistance related protein CRR9p), 유전자 등록번호(Genebank) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(Genebank) NM_022105(DATF1, Death inducer-obliterator 1), 유전자 등록번호(Genebank) AK127033(DNM2, Dynamin 2), 유전자 등록번호(Genebank) NM_152461(ERN1, Endoplasmic reticulum to nucleus signalling 1), 유전자 등록번호(Genebank) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(Genebank) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_004309(ARHGDIA, Rho GDP dissociation inhibitor(GDI) alpha), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번호(Genebank) NM_006282(STK4, Serine/threonine kinase 4), 유전자 등록번호(Genebank) AB005666(SIPA1, Signal-induced proliferation-associated gene 1), 유전자 등록번호(Genebank) NM_207111(TRIAD3, TRIAD3 protein), 유전자 등록번호(Genebank) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번호(Genebank) AF026071(TNFRSF25, Tumor necrosis factor receptor superfamily, member 25), 유전자 등록번호(Genebank) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(Genebank) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(Genebank) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(Genebank) AK057576(CHFR, Checkpoint with forkhead and ring finger domains), 유전자 등록번호(Genebank) NM_005255(GAK, Cyclin G associated kinase), 유전자 등록번호(Genebank) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) AK094316(MAD2L2, MAD2 mitotic arrest deficient-like 2(yeast)), 유전자 등록번호(Genebank) NM_002595(PCTK2, PCTAIRE protein kinase 2), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform b, alpha subunit 45kDa), 유전자 등록번호(Genebank) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(Genebank) NM_001722(POLR3D, Polymerase(RNA) III(DNA directed) polypeptide D, 44kDa), 유전자 등록번호(Genebank) NM_002808(PSMD2, Proteasome(prosome, macropain) 26S subunit, non-ATPase, 2), 유전자 등록번호(Genebank) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(Genebank) BC023552(SFN, Stratifin), 유전자 등록번호(Genebank) NM_000548(TSC2, Tuberous sclerosis 2), 유전자 등록번호(Genebank) AK223618(ZBTB17, Zinc finger and BTB domain containing 17), 유전자 등록번호(Genebank) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(Genebank) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(Genebank) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(Genebank) NM_014598(SOCS7, Suppressor of cytokine signaling 7), 유전자 등록번호(Genebank) NM_003873(NRP1, Neuropilin 1), 유전자 등록번호(Genebank) NM_015366(FLJ20185, Rho GTPase activating protein 8), 유전자 등록번호(Genebank) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(Genebank) AB209463(CSNK1D, Casein kinase 1, delta), 유전자 등록번호(Genebank) NM_005228(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(Genebank) BC089041(GNA11, Guanine nucleotide binding protein(G protein), alpha 11(Gq class)), 유전자 등록번호(Genebank) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(Genebank) NM_012463(ATP6V0A2, ATPase, H+transport -ing, lysosomal V0 subunit a isoform 2), 유전자 등록번호(Genebank) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(Genebank) NM_000574(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(Genebank) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(Genebank) BG171626(FTH1, Ferritin, heavy polypeptide 1), 유전자 등록번호(Genebank) BM905227(FTH1, Ferritin, heavy polypeptide 1), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_003641(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(Genebank) AF200496(IL1F7, Interleukin 1 family, member 7(zeta)), 유전자 등록번호(Genebank) NM_000641(IL11, Interleukin 11), 유전자 등록번호(Genebank) NM_000565(IL6R, Interleukin 6 receptor), 유전자 등록번호(Genebank) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(Genebank) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(Genebank) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) NM_139276(STAT3, Signal transducer and activator of transcription 3(acute-phase response factor)), 유전자 등록번호(Genebank) NM_003037(SLAMF1, Signaling lymphocytic activation molecule family member 1), 유전자 등록번호(Genebank) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(Genebank) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(Genebank) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(Genebank) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(Genebank) AK095781(CIRBP, Cold inducible RNA binding protein), 유전자 등록번호(Genebank) X14789(CRYAA, Crystallin, alpha A), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_080927(DCBLD2, Discoidin, CUB and LCCL domain containing 2), 유전자 등록번호(Genebank) AY253982(GPR54, G protein-coupled receptor 54), 유전자 등록번호(Genebank) AF073799(GALR3, Galanin receptor 3), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) NM_007353(GNA12, Guanine nucleotide binding protein(G protein) alpha 12), 유전자 등록번호(Genebank) CR623806(HSPA6, Heat shock 70kDa protein 6(HSP70B')), 유전자 등 록번호(Genebank) NM_006597(HSPA8, Heat shock 70kDa protein 8), 유전자 등록번호(Genebank) AK000252(FLJ20245, Hypothetical protein FLJ20245), 유전자 등록번호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) U02389(PRSS15, Protease, serine, 15), 유전자 등록번호(Genebank) NM_005053(RAD23A, RAD23 homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) CD357517(Unknown, Similar to Interferon-induced transmembrane protein 3(Interferon-inducible protein 1-8U)), 유전자 등록번호(Genebank) NM_032038(SPINL, Spinster), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) AK074035(XAB2, XPA binding protein 2), 유전자 등록번호(Genebank) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) NM_030662(MAP2K2, Mitogen-activated protein kinase kinase 2), 유전자 등록번호(Genebank) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(Genebank) NM_138473(SP1, Sp1 transcription factor), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_002880(RAF1, V-raf-1 murine leukemia viral oncogene homolog 1), 유전자 등록번호(Genebank) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(Genebank) AB209210(DVL1, Dishevelled, dsh homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(Genebank) AF077820(LRP5, Low density lipoprotein receptor-related protein 5), 유전자 등록번호(Genebank) NM_033119(NKD1, Naked cuticle homolog 1(Drosophila)), 유전자 등록번호(Genebank) AK090488(PPP2R1A, Protein phosphatase 2(formerly 2A), regulatory subunit A(PR 65), alpha isoform), 유전자 등록번호(Genebank) AL834166(TCF7, Transcription factor 7(T-cell specific, HMG-box)), 유전자 등록번호(Genebank) AY009401(WNT6, Wingless-type MMTV integration site family, member 6), 유전자 등록번호(Genebank) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_014595(NT5C, 5', 3'-nucleotidase, cytosolic), 유전자 등록번호(Genebank) AY461712(ATP13A2, ATPase type 13A2), 유전자 등록번호(Genebank) NM_018590(GALNACT-2, Chondroitin sulfate GalNAcT-2), 유전자 등록번호(Genebank) NM_080757(C20orf127, Chromosome 20 open reading frame 127), 유전자 등록번호(Genebank) X16866(CYP2D7P1, Cytochrome P450, family 2, subfamily D, polypeptide 6), 유전자 등록번호(Genebank) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(Genebank) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(Genebank) NM_000786(CYP51A1, Cytochrome P450, family 51, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(Genebank) AK093560(INPP1, Inositol polyphosphate-1-phosphatase), 유전자 등록번호(Genebank) NM_005578(LPP, LIM domain containing preferred translocation partner in lipoma), 유전자 등록번호(Genebank) AK222601(MMP10, Matrix metallopeptidase 10(stromelysin 2)), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_182924(MICAL-L2, MICAL-like 2), 유전자 등록번호(Genebank) AK127759(NDUFS7, NADH dehydrogenase(ubiquinone) Fe-S protein 7, 20kDa(NADH-coenzyme Q reductase)), 유전자 등록번호(Genebank) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(Genebank) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번호(Genebank) AA862994(S100A3, S100 calcium binding protein A3), 유전자 등록번호(Genebank) NM_003461(ZYX, Zyxin), 유전자 등록번호(Genebank) NM_019112(ABCA7, ATP-binding cassette, sub-family A(ABC1), member 7), 유전자 등록번호(Genebank) AB209054(ABCB6, ATP-binding cassette, sub-family B(MDR/TAP), member 6), 유전자 등록번호(Genebank) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(Genebank) NM_020038(ABCC3, ATP-binding cassette, sub-family C(CFTR/MRP), member 3), 유전자 등록번호(Genebank) BC025358(ABCD1, ATP-binding cassette, sub-family D(ALD), member 1), 유전자 등록번호(Genebank) NM_003992(CLK3, CDC-like kinase 3), 유전자 등록번호(Genebank) AK128154(C9orf86, Chromosome 9 open reading frame 86), 유전자 등록번호(Genebank) BC006404(SKD3, ClpB caseinolytic peptidase B homolog(E. coli)), 유전자 등록번호(Genebank) BC067254(COASY, Coenzyme A synthase), 유전자 등록번호(Genebank) NM_004398(DDX10, DEAD(Asp-Glu-Ala-Asp) box polypeptide 10), 유전자 등록번호(Genebank) BC038417(DHX30, DEAH(Asp-Glu-Ala-His) box polypeptide 30), 유전자 등록번호(Genebank) NM_138614(DHX30, DEAH(Asp-Glu-Ala-His) box polypeptide 30), 유전자 등록번호(Genebank) NM_032656(DHX37, DEAH(Asp-Glu-Ala-His) box polypeptide 37), 유전자 등록번호(Genebank) NM_020812(DOCK6, Dedicator of cytokinesis 6), 유전자 등록번호(Genebank) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(Genebank) NM_001961(EEF2, Eukaryotic translation elongation factor 2), 유전자 등록번호(Genebank) NM_003751(EIF3S9, Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa), 유전자 등록번호(Genebank) AF114818(SIAHBP1, Fuse-binding protein-interacting repressor), 유전자 등록번호(Genebank) NM_019096(GTPBP2, GTP binding protein 2), 유전자 등록번호(Genebank) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(Genebank) AK128226(HK1, Hexokinase 1), 유전자 등록번호(Genebank) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(Genebank) NM_006546(IMP-1, IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_015155(KIAA0217, La ribonucleoprotein domain family, member 5), 유전자 등록번호(Genebank) NM_018357(FLJ11196, La ribonucleoprotein domain family, member 6), 유전자 등록번호(Genebank) AK127089(MTHFD1L, Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 1-like), 유전자 등록번호(Genebank) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(Genebank) AB058686(MYO15B, Myosin XVB pseudogene), 유전자 등록번호(Genebank) BC027875(MYO15B, Myosin XVB pseudogene), 유전자 등록번호(Genebank) K122664(NRBP, Nuclear receptor binding protein), 유전자 등록번호(Genebank) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(Genebank) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_019034(RHOF, Ras homolog gene family, member F(in filopodia)), 유전자 등록번호(Genebank) NM_016084(RASD1, RAS, dexamethasone-induced 1), 유전자 등록번호(Genebank) AY369207(RBPMS2, RNA binding protein with multiple splicing 2), 유전자 등록번호(Genebank) BC069233(SCYL1, SCY1-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) AB209553(STK11, Serine/threonine kinase 11), 유전자 등록번호(Genebank) AK124047(C20orf119, Similar to embryonic poly(A) binding protein), 유전자 등록번호(Genebank) XM_496374(LOC440595, Similar to eukaryotic translation elongation factor 1 alpha 1), 유전자 등록번호(Genebank) NM_005094(SLC27A4, Solute carrier family 27(fatty acid transporter), member 4) 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(Genebank) BC009900(UBE1, Ubiquitin-activating enzyme E1(A1S9T and BN75 temperature sensitivity complementing)), 유전자 등록번호(Genebank) AF045458(ULK1, Unc-51-like kinase 1(C. elegans)), 유전자 등록번호(Genebank) X59303(VARS2, Valyl-tRNA synthetase), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AB208804(AP3D1, Adaptor-related protein complex 3, delta 1 subunit), 유전자 등록번호(Genebank) BC000786(ARFGAP1, ADP- ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) AK125277(APG4B, ATG4 autophagy related 4 homolog B(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) AK091056(COBRA1, Cofactor of BRCA1), 유전자 등록번호(Genebank) AF349676(COG3, Component of oligomeric golgi complex 3), 유전자 등록번호(Genebank) AB002368(XPO6, Exportin 6), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번호(Genebank) NM_004712(HGS, Hepatocyte growth factor-regulated tyrosine kinase substrate), 유전자 등록번호(Genebank) AK094897(IPO4, Importin 4), 유전자 등록번호(Genebank) L38951(KPNB1, Karyopherin(importin) beta 1), 유전자 등록번호(Genebank) NM_002268(KPNA4, Karyopherin alpha 4(importin alpha 3)), 유전자 등록번호(Genebank) AY014403(KIF13A, Kinesin family member 13A), 유전자 등록번호(Genebank) NM_002867(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(Genebank) AK025300(RANBP3, RAN binding protein 3), 유전자 등록번호(Genebank) AB014551(ARHGEF2, Rho/rac guanine nucleotide exchange factor(GEF) 2), 유전자 등록번호(Genebank) CD049342(RPL23, Ribosomal protein L23), 유전자 등록번호(Genebank) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(Genebank) NM_006809(TOMM34, Translocase of outer mitochondrial membrane 34), 유전자 등 록번호(Genebank) BC047528(TOMM40, Translocase of outer mitochondrial membrane 40 homolog(yeast)), 유전자 등록번호(Genebank) AK056701(VPS11, Vacuolar protein sorting 11(yeast)), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) AK095154(AES, Amino-terminal enhancer of split), 유전자 등록번호(Genebank) BC060828(ARID3A, AT rich interactive domain 3A(BRIGHT- like)), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_006532(ELL, Elongation factor RNA polymerase II), 유전자 등록번호(Genebank) NM_001991(EZH1, Enhancer of zeste homolog 1(Drosophila)), 유전자 등록번호(Genebank) U18018(ETV4, Ets variant gene 4(E1A enhancer binding protein, E1AF)), 유전자 등록번호(Genebank) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(Genebank) NM_181430(FOXK2, Forkhead box K2), 유전자 등록번호(Genebank) NM_001012426(FOXP4, Forkhead box P4), 유전자 등록번호(Genebank) BC053850(FOXQ1, Forkhead box Q1), 유전자 등록번호(Genebank) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(Genebank) BC078664(HMGA1, High mobility group AT-hook 1), 유전자 등록번호(Genebank) XM_379934(KIAA1718, KIAA1718 protein), 유전자 등록번호(Genebank) BC069156(LBX1, Ladybird homeobox homolog 1(Drosophila)), 유전 자 등록번호(Genebank) NM_014520(MYBBP1A, MYB binding protein(P160) 1a), 유전자 등록번호(Genebank) NM_002518(NPAS2, Neuronal PAS domain protein 2), 유전자 등록번호(Genebank) NM_001001716(NFKBIB, Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta), 유전자 등록번호(Genebank) AF087856(NCOR1, Nuclear receptor co-repressor 1), 유전자 등록번호(Genebank) NM_002653(PITX1, Paired-like homeodomain transcription factor 1), 유전자 등록번호(Genebank) NM_001003891(PCQAP, PC2(positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein), 유전자 등록번호(Genebank) NM_005035(POLRMT, Polymerase(RNA) mitochondrial(DNA directed)), 유전자 등록번호(Genebank) NM_012448(STAT5B, Signal transducer and activator of transcription 5B), 유전자 등록번호(Genebank) CR607342(RNPS1, Similar to splicing-related factor RNPS1), 유전자 등록번호(Genebank) NM_005986(SOX1, SRY(sex determining region Y)-box 1), 유전자 등록번호(Genebank) NM_003072(SMARCA4, SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4), 유전자 등록번호(Genebank) NM_006951(TAF5, TAF5 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 100kDa), 유전자 등록번호(Genebank) NM_152380(TBX15, T-box 15), 유전자 등록번호(Genebank) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(Genebank) BC006396(TLX2, T-cell leukemia, homeobox 2), 유전자 등록번호(Genebank) AF106934(THRAP5, Thyroid hormone receptor associated protein 5), 유전자 등록번호(Genebank) AF108461(UBN1, Ubinuclein 1), 유전자 등록번호(Genebank) NM_002359(MAFG, V-maf musculoaponeurotic fibrosarcoma oncogene homolog G(avian)), 유전자 등록번호(Genebank) AK092414(MAFK, V-maf musculoaponeurotic fibrosarcoma oncogene homolog K(avian)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_001003694(BRPF1, Bromodomain and PHD finger containing, 1), 유전자 등록번호(Genebank) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(Genebank) NM_139201(GIT2, G protein-coupled receptor kinase interactor 2), 유전자 등록번호(Genebank) AK125974(p66alpha, GATA zinc finger domain containing 2A), 유전자 등록번호(Genebank) CB050471(GLI4, GLI-Kruppel family member GLI4), 유전자 등록번호(Genebank) NM_006734(HIVEP2, Human immunodeficiency virus type I enhancer binding protein 2), 유전자 등록번호(Genebank) NM_031297(DKFZP761H1710, Hypothetical protein DKFZp761H1710), 유전자 등록번호(Genebank) NM_024671(FLJ23436, Hypothetical protein FLJ23436), 유전자 등록번호(Genebank) NM_173680(MGC33584, Hypothetical protein MGC33584), 유전자 등록번호(Genebank) NM_031918(KLF16, Kruppel-like factor 16), 유전자 등록번호(Genebank) BU163740(MKRN1, Makorin, ring finger protein, 1), 유전자 등록번호(Genebank) NM_005885(MARCH-V, Membrane-associated ring finger(C3HC4) 6), 유전자 등록번호(Genebank) AF242768(LOC51333, Mesenchymal stem cell protein DSC43), 유전자 등록번호(Genebank) NM_020774(MIB1, Mindbomb homolog 1(Drosophila)), 유전자 등록번호(Genebank) AJ007041(MLL4, Myeloid/lymphoid or mixed-lineage leukemia 4), 유전자 등록번호(Genebank) BF206103(ZNF286, Peroxisome proliferative activated receptor, alpha-like), 유전자 등록번호(Genebank) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(Genebank) D87076(PHF15, PHD finger protein 15), 유전자 등록번호(Genebank) NM_020122(KCMF1, Potassium channel modulatory factor 1), 유전자 등록번호(Genebank) NM_145214(TRIM11, Tripartite motif-containing 11), 유전자 등록번호(Genebank) NM_033452(TRIM47, Tripartite motif-containing 47), 유전자 등록번호(Genebank) AF281046(TRIM8, Tripartite motif-containing 8), 유전자 등록번호(Genebank) BC004256(ZNF259, Zinc finger protein 259), 유전자 등록번호(Genebank) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(Genebank) NM_198055(ZNF42, Zinc finger protein 42(myeloid-specific retinoic acid-responsive)), 유전자 등록번호(Genebank) BC071620(ZNF581, Zinc finger protein 581), 유전자 등록번호(Genebank) BM544755(ZNF593, Zinc finger protein 593), 유전자 등록번호(Genebank) AK024487(ZNF598, Zinc finger protein 598), 유전자 등록번호(Genebank) BC089449(ZEC, Zinc finger protein 628), 유전자 등록번호(Genebank) NM_153813(ZFPM1, Zinc finger protein, multitype 1), 유전자 등록번호(Genebank) BM451410(ZA20D2, Zinc finger, A20 domain containing 2), 유전자 등록번호(Genebank) BX648551(ZA20D2, Zinc finger, A20 domain containing 2), 유전자 등록번호(Genebank) BC006340(ZCCHC2, Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) BC053544(ZDHHC8, Zinc finger, DHHC-type containing 8), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(Genebank) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)), 유전자 등록번호(Genebank) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(Genebank) NM_012088(PGLS, 6-phosphogluconolactonase), 유전자 등록번호(Genebank) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(Genebank) NM_000402(G6PD, Glucose-6-phosphate dehydrogenase), 유전자 등록번호(Genebank) NM_006715(MAN2C1, Mannosidase, alpha, class 2C, member 1), 유전자 등록번호(Genebank) CR597860(C19orf27, Chromosome 19 open reading frame 27), 유전자 등록번호(Genebank) AK091948(LTB4DH, Leukotriene B4 12-hydroxydehydrogenase), 유전자 등록번호(Genebank) BC042195(MT, Malonyl-CoA:acyl carrier protein transacylase, mitochondrial), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) AK057049(PTGES2, Prostaglandin E synthase 2), 유전자 등록번호(Genebank) AB046825(GBA2, Glucosidase, beta(bile acid) 2), 유전자 등록번호(Genebank) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(Genebank) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(Genebank) NM_007169(PEMT, Phosphatidylethanolamine N-methyltransferase), 유전자 등록번호(Genebank) NM_005028(PIP5K2A, Phosphatidylinositol-4-phosphate 5-kinase, type II, alpha), 유전자 등록번호(Genebank) BC007612(PSAP, Prosaposin(variant Gaucher disease and variant metachromatic leukodystrophy)), 유전자 등록번호(Genebank) BC087612(SBF1, SET binding factor 1), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) AK223291(MMP3, Matrix metallopeptidase 3(stromelysin 1, progelatinase)), 유전자 등록번호(Genebank) NM_178819(DKFZp586M1819, 1-acylglycerol-3-phosphate O-acyltransferase 6(lysophosphatidic acid acyltransferase, zeta)), 유전자 등록번호(Genebank) NM_018694(ARL6IP4, ADP-ribosylation-like factor 6 interacting protein 4), 유전자 등록번호(Genebank) BC014895(MGC10204, Aldehyde dehydrogenase 16 family, member A1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번 호(Genebank) BC008751(CAPN1, Calpain 1,(mu/I) large subunit), 유전자 등록번호(Genebank) AK128552(CAPN10, Calpain 10), 유전자 등록번호(Genebank) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(Genebank) NM_001903(CTNNA1, Catenin(cadherin-associated protein), alpha 1, 102kDa), 유전자 등록번호(Genebank) BC067289(CTSL2, Cathepsin L2), 유전자 등록번호(Genebank) NM_015151(C21orf106, Chromosome 21 open reading frame 106), 유전자 등록번호(Genebank) NM_031434(C7orf21, Chromosome 7 open reading frame 21), 유전자 등록번호(Genebank) NM_001303(COX10, COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase(yeast)), 유전자 등록번호(Genebank) BP317375(COX6A2, Cytochrome c oxidase subunit VIa polypeptide 2), 유전자 등록번호(Genebank) NM_001355(DDT, D-dopachrome tautomerase), 유전자 등록번호(Genebank) NM_032482(DOT1L, DOT1-like, histone H3 methyltransferase(S. cerevisiae)), 유전자 등록번호(Genebank) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(Genebank) AB210013(EIF4G1, Eukaryotic translation initiation factor 4 gamma, 1), 유전자 등록번호(Genebank) NM_020158(EXOSC5, Exosome component 5), 유전자 등록번호(Genebank) NM_178225(FBXW5, F-box and WD-40 domain protein 5), 유전자 등록번호(Genebank) NM_058229(FBXO32, F-box protein 32), 유전자 등록번호(Genebank) AB209592(GMPPA, GDP-mannose pyrophosphorylase A), 유전자 등록번호(Genebank) AJ002231(GNPDA1, Glucosamine-6-phosphate deaminase 1), 유전자 등록번 호(Genebank) AK094940(GCLC, Glutamate-cysteine ligase, catalytic subunit), 유전자 등록번호(Genebank) NM_005318(H1F0, H1 histone family, member 0), 유전자 등록번호(Genebank) NM_004639(BAT3, HLA-B associated transcript 3), 유전자 등록번호(Genebank) NM_032717(MGC11324, Hypothetical protein MGC11324), 유전자 등록번호(Genebank) BX647357(IDS, Iduronate 2-sulfatase(Hunter syndrome)), 유전자 등록번호(Genebank) AY923172(KLK13, Kallikrein 13), 유전자 등록번호(Genebank) AK023137(MGAT4B, Mannosyl(alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B), 유전자 등록번호(Genebank) NM_024864(FLJ22578, Mitochondrial rRNA methyltransferase 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_153006(NAGS, N-acetylglutamate synthase), 유전자 등록번호(Genebank) NM_020230(PPAN, Peter pan homolog(Drosophila)), 유전자 등록번호(Genebank) BC017045(PYGB, Phosphorylase, glycogen; brain), 유전자 등록번호(Genebank) NM_005401(PTPN14, Protein tyrosine phosphatase, non-receptor type 14), 유전자 등록번호(Genebank) AF290614(PTPN23, Protein tyrosine phosphatase, non-receptor type 23), 유전자 등록번호(Genebank) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(Genebank) NM_002840(PTPRF, Protein tyrosine phosphatase, receptor type, F), 유전자 등록번호(Genebank) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(Genebank) AF348492(RBAF600, Retinoblastoma-associated factor 600), 유전자 등록번 호(Genebank) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(Genebank) AB209196(RNH, Ribonuclease/angiogenin inhibitor 1), 유전자 등록번호(Genebank) CR619918(RPL18A, Ribosomal protein L18a), 유전자 등록번호(Genebank) BM553074(RPS15A, Ribosomal protein S15a), 유전자 등록번호(Genebank) CD387408(RPS28, Ribosomal protein S28), 유전자 등록번호(Genebank) CR749837(RPS7, Ribosomal protein S7), 유전자 등록번호(Genebank) BM805682(EEF1D, Similar to eukaryotic translation elongation factor 1 delta isoform 1; guanine nucleotide exchange protein), 유전자 등록번호(Genebank) XM_069734(LOC136143, Similar to ribosomal protein L18; 60S ribosomal protein L18), 유전자 등록번호(Genebank) BG186194(RPS24, Similar to ribosomal protein S24), 유전자 등록번호(Genebank) AB037719(SSH1, Slingshot homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(Genebank) BF680536(SAT, Spermidine/spermine N1-acetyltransferase), 유전자 등록번호(Genebank) AK127286(SMOX, Spermine oxidase), 유전자 등록번호(Genebank) NM_005877(SF3A1, Splicing factor 3a, subunit 1, 120kDa), 유전자 등록번호(Genebank) AF082557(TNKS, Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase), 유전자 등록번호(Genebank) BC002856(TXNDC11, Thioredoxin domain containing 11) 유전자 등록번호(Genebank) NM_017722(FLJ20244, TRM1 tRNA methyltransferase 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) AK023077(USP36, Ubiquitin specific peptidase 36), 유전자 등록번호(Genebank) NM_080605(B3GALT6, UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6), 유전자 등록번호(Genebank) AY358955(B3GNT3, UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자 등록번호(Genebank) AK074143(UAP1L1, UDP-N-acteylglucosamine pyrophosphorylase 1-like 1), 유전자 등록번호(Genebank) C007348(UPP1, Uridine phosphorylase 1), 유전자 등록번호(Genebank) BC047030(UPP1, Uridine phosphorylase 1), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) XM_371474(PLXNB2, Plexin B2), 유전자 등록번호(Genebank) BC050636(FLJ14249, HS1-binding protein 3), 유전자 등록번호(Genebank) NM_004699(FAM50A, Family with sequence similarity 50, member A), 유전자 등록번호(Genebank) AY368150 (CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) AF130077(ALB, Albumin), 유전자 등록번호(Genebank) NM_021631(FKSG2, Apoptosis inhibitor), 유전자 등록번호(Genebank) AF143236(C17orf88, Apoptosis related protein), 유전자 등록번호(Genebank) NM_001621(AHR, Aryl hydrocarbon receptor), 유전자 등록번호(Genebank) AB209123(BIRC1, Baculoviral IAP repeat-containing 1), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001167(BIRC4, Baculoviral IAP repeat-containing 4), 유전자 등록번호(Genebank) AW872828(BIRC6, Baculoviral IAP repeat-containing 6(apollon)), 유전자 등록번호(Genebank) AU146963(BCL2, B-cell CLL/lymphoma 2), 유전자 등록번호(Genebank) NM_004331(BNIP3L, BCL2/adenovirus E1B 19kDa interacting protein 3-like), 유전자 등록번호(Genebank) NM_001015049(BAG5, BCL2-associated athanogene 5), 유전자 등록번호(Genebank) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(Genebank) L33477(HSPD1, Cadherin 12, type 2(N-cadherin 2)), 유전자 등록번호(Genebank) NM_001904(CTNNB1, Catenin(cadherin-associated protein), beta 1, 88kDa), 유전자 등록번호(Genebank) NM_005894(CD5L, CD5 antigen-like(scavenger receptor cysteine rich family)), 유전자 등록번호(Genebank) AK124173(FLJ42179, CDNA FLJ42179 fis, clone THYMU2030796), 유전자 등록번호(Genebank) AB209095(CDC2L2, Cell division cycle 2-like 2(PITSLRE proteins)), 유전자 등록번호(Genebank) AK128462(CRR9, Cisplatin resistance related protein CRR9p), 유전자 등록번호(Genebank) NM_016424(CROP, Cisplatin resistance-associated overexpressed protein), 유전자 등록번호(Genebank) NM_003478(CUL5, Cullin 5), 유전자 등록번호(Genebank) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(Genebank) BC048797(DFFB, DNA fragmentation factor, 40kDa, beta polypeptide(caspase-activated DNase)), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) NM_006144(GZMA, Granzyme A(granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)), 유전자 등록번호(Genebank) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(Genebank) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(Genebank) NM_005338(HIP1, Huntingtin interacting protein 1), 유전자 등록번호(Genebank) AK026927(MGC5297, Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(Genebank) AF208043(IFI16, Interferon, gamma-inducible protein 16), 유전자 등록번호(Genebank) BX648731(JMY, Junction-mediating and regulatory protein), 유전자 등록번호(Genebank) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(Genebank) NM_000314(PTEN, Phosphatase and tensin homolog(mutated in multiple advanced cancers 1)), 유전자 등록번호(Genebank) BC047362(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(Genebank) BX537500(PDCD4, Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) NM_013374(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(Genebank) NM_005400(PRKCE, Protein kinase C, epsilon), 유전자 등록번호(Genebank) CR621593(PRG2, Proteoglycan 2, bone marrow(natural killer cell activator, eosinophil granule major basic protein)), 유전자 등록번호(Genebank) BC041849(ROCK1, Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) NM_000582(SPP1, Secreted phosphoprotein 1(osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)), 유전자 등록번호(Genebank) BC039110(SMNDC1, Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(Genebank) AF520785(TNFSF15, Tumor necrosis factor(ligand) superfamily, member 15), 유전자 등록번호(Genebank) NM_002546(TNFRSF11B, Tumor necrosis factor receptor superfamily, member 11b(osteoprotegerin)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) NM_006290(TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), 유전자 등록번호(Genebank) AK125880(TP53INP1, Tumor protein p53 inducible nuclear protein 1), 유전자 등록번호(Genebank) AB209534(TRA1, Tumor rejection antigen(gp96) 1), 유전자 등록번호(Genebank) NM_012479(YWHAG, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide), 유전자 등록번호(Genebank) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(Genebank) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(Genebank) AK122953(VDAC1, Voltage-dependent anion channel 1), 유전자 등록번호(Genebank) NM_019001(XRN1, 5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) BC016344(ACPP, Acid phosphatase, prostate), 유전자 등록번호(Genebank) BM921310(ANAPC10, Anaphase promoting complex subunit 10), 유전자 등록번호(Genebank) NM_153186(ANKRD15, Ankyrin repeat domain 15), 유전자 등록번호(Genebank) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) NM_004071(CLK1, CDC-like kinase 1), 유전자 등록번호(Genebank) CR933728(CDC2 Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_044472(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) NM_004365(CETN3, Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) BC050310(C10orf9, Chromosome 10 open reading frame 9), 유전자 등록번호(Genebank) NM_016446(C9orf127, Chromosome 9 open reading frame 127), 유전자 등록번호(Genebank) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(Genebank) NM_001761(CCNF, Cyclin F), 유전자 등록번호(Genebank) NM_004354(CCNG2, Cyclin G2), 유전자 등록번호(Genebank) NM_004064(CDKN1B, Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_007068(DMC1, DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination(yeast)), 유전자 등록번호(Genebank) AK025142(BPA, dystonin), 유전자 등록번호(Genebank) NM_001950(E2F4, E2F transcription factor 4, p107/p130-binding), 유전자 등록번호(Genebank) NM_019063(EML4, Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) AJ245671(EGFL6, EGF-like-domain, multiple 6),전자 등록번호(Genebank) NM_004450(ERH, Enhancer of rudimentary homolog(Drosophila)), 유전자 등록번호(Genebank) AL832041(ESCO1, Establishment of cohesion 1 homolog 1(S. cerevisiae)), 유전자 등록번호(Genebank) AL832666(ESCO2, Establishment of cohesion 1 homolog 2(S. cerevisiae)), 유전자 등록번호(Genebank) AK126048(FLJ44060, FLJ44060 protein), 유전자 등록번호(Genebank) BI494022(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(Genebank) NM_000189(HK2, Hexokinase 2), 유전자 등록번호(Genebank) NM_014707(HDAC9, Histone deacetylase 9), 유전자 등록번호(Genebank) BC067253(FLJ40432, Hypothetical protein FLJ40432), 유전자 등록번호(Genebank) AL834276(MGC3207, Hypothetical protein MGC3207), 유전자 등록번호(Genebank) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(Genebank) NM_014751(MTSS1, Metastasis suppressor 1), 유전자 등록번호(Genebank) BC040410(MAPRE1, Microtubule-associated protein, RP/EB family, member 1), 유 전자 등록번호(Genebank) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(Genebank) L20321(NEK4, NIMA(never in mitosis gene a)-related kinase 4), 유전자 등록번호(Genebank) AJ627032(NIPBL, Nipped-B homolog(Drosophila)), 유전자 등록번호(Genebank) AL575067(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(Genebank) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(Genebank) AL833922(PAPD5, PAP associated domain containing 5), 유전자 등록번호(Genebank) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(Genebank) NM_016205(PDGFC, Platelet derived growth factor C), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa), 유전자 등록번호(Genebank) NM_006259(PRKG2, Protein kinase, cGMP-dependent, type II), 유전자 등록번호(Genebank) NM_002709(PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_003463(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(Genebank) BX647606(PTMA, Prothymosin, alpha(gene sequence 28)), 유전자 등록번호(Genebank) BC068483(RINT-1, Rad50-interacting protein 1), 유전자 등록번호(Genebank) NM_006325(RAN, RAN, member RAS oncogene family), 유전자 등록번호(Genebank) NM_213590(RFP2, Ret finger protein 2), 유전자 등록번호(Genebank) NM_006910(RBBP6, Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) BC060806(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) BX648668(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) AB208875(SEPT10, Septin 10), 유전자 등록번호(Genebank) AB209677(SEPT7, Septin 7), 유전자 등록번호(Genebank) BX649128(SESN3, Sestrin 3), 유전자 등록번호(Genebank) XM_497098(LOC441488, Similar to Transcription factor Dp-1(E2F dimerization partner 1)(DRTF1-polypeptide-1)(DRTF1)), 유전자 등록번호(Genebank) AK131071(SLC31A2, Solute carrier family 31(copper transporters), member 2), 유전자 등록번호(Genebank) NM_006930(SKP1A, S-phase kinase-associated protein 1A(p19A)), 유전자 등록번호(Genebank) NM_006542(SPHAR, S-phase response(cyclin-related)), 유전자 등록번호(Genebank) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) NM_014574(STRN3, Striatin, calmodulin binding protein 3), 유전자 등록번호(Genebank) NM_003176(SYCP1, Synaptonemal complex protein 1), 유전자 등록번호(Genebank) BM674777(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_006701(TXNL4A, Thioredoxin-like 4A), 유전자 등록번호(Genebank) NM_030756(TCF7L2, Transcription factor 7-like 2(T-cell specific, HMG-box)), 유전자 등록번호(Genebank) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(Genebank) NM_000368(TSC1, Tuberous sclerosis 1), 유전자 등록번호(Genebank) NM_006826(YWHAQ, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide), 유전자 등록번호(Genebank) NM_001032410(USP16, Ubiquitin specific peptidase 16), 유전자 등록번호(Genebank) AK095164(KRAS2, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_138271(ATRX, Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AK025738(ASF1A, ASF1 anti-silencing function 1 homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK125915(CRY1, Cryptochrome 1(photolyase-like)), 유전자 등록번호(Genebank) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록번호(Genebank) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(Genebank) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(Genebank) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(Genebank) NM_002431(MNAT1, Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) BC032617(POLI, Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) NM_002690(POLB, Polymerase(DNA directed), beta), 유전자 등록번호(Genebank) AK025631(POLH, Polymerase(DNA directed), eta), 유전자 등록번호(Genebank) BC038996(PMS2L1, Postmeiotic segregation increased 2-like 1), 유전자 등록번호(Genebank) BM462208(PCNA, Proliferating cell nuclear antigen), 유전자 등록번호(Genebank) NM_020165(RAD18, RAD18 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_152442(RAD9B, RAD9 homolog B(S. cerevisiae)), 유전 자 등록번호(Genebank) NM_018151(RIF1, RAP1 interacting factor homolog(yeast)), 유전자 등록번호(Genebank) AI281523(SFPQ, Splicing factor proline/glutamine-rich(polypyrimidine tract binding protein associated)), 유전자 등록번호(Genebank) AK057830(TOM1L2, Target of myb1-like 2(chicken)), 유전자 등록번호(Genebank) NM_001012716(TYMS, Thymidylate synthetase), 유전자 등록번호(Genebank) NM_001071(TYMS, Thymidylate synthetase), 유전자 등록번호(Genebank) NM_003368(USP1, Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) AK094617(UBE2V2, Ubiquitin-conjugating enzyme E2 variant 2), 유전자 등록번호(Genebank) NM_003337(UBE2B, Ubiquitin-conjugating enzyme E2B(RAD6 homolog)), 유전자 등록번호(Genebank) CD013992(GSTT2, Glutathione S-transferase theta 2), 유전자 등록번호(Genebank) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(Genebank) NM_000847(GSTA3, Glutathione S-transferase A3), 유전자 등록번호(Genebank) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_017460(CYP3A4, Cytochrome P450, family 3, subfamily A, polypeptide 4), 유전자 등록번호(Genebank) BC039065(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(Genebank) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_000667(ADH1A, Alcohol dehydrogenase 1A(class I), alpha polypeptide), 유전자 등록번호(Genebank) BI762502(GSTA2, Glutathione S-transferase A2), 유전자 등록번호(Genebank) NM_000690(ALDH2, Aldehyde dehydrogenase 2 family(mitochondrial)), 유전자 등록번호(Genebank) NM_000696(ALDH9A1, Aldehyde dehydrogenase 9 family, member A1), 유전자 등록번호(Genebank) AK093311(ACAA2, Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) NM_004457(ACSL3, Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_000016(ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) BC033517(ACOX2, Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(Genebank) NM_000384(APOB, Apolipoprotein B(including Ag(x) antigen)), 유전자 등록번호(Genebank) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) NM_000236(LIPC, Lipase, hepatic), 유전자 등록번호(Genebank) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_003101(SOAT1, Sterol O-acyltransferase(acyl-Coenzyme A: cholesterol acyltransferase) 1), 유전자 등록번호(Genebank) T81314(MBTPS1, Transcribed locus), 유전자 등록번호(Genebank) NM_147156(TMEM23, Transmembrane protein 23), 유전자 등록번호(Genebank) NM_003916(AP1S2, Adaptor-related protein complex 1, sigma 2 subunit), 유전자 등록번호(Genebank) AA298150(AP3S1, Adaptor-related protein complex 3, sigma 1 subunit), 유전자 등록번호(Genebank) AL109702(AP3S2, Adaptor-related protein complex 3, sigma 2 subunit), 유전자 등록번호(Genebank) BU620136(AP4S1, Adaptor-related protein complex 4, sigma 1 subunit), 유전자 등록번호(Genebank) NM_001025595(ARFIP1, ADP-ribosylation factor interacting protein 1(arfaptin 1)), 유전자 등록번호(Genebank) NM_203437(AFTIPHILIN, Aftiphilin protein), 유전자 등록번호(Genebank) NM_006380(APPBP2, Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) BM683433(AP1GBP1, AP1 gamma subunit binding protein 1), 유전자 등록번호(Genebank) AK027773(APG4C, ATG4 autophagy related 4 homolog C(S. cerevisiae)), 유전자 등록번호(Genebank) AF130117(CRBN, Cereblon), 유전자 등록번호(Genebank) NM_001821(CHML, Choroideremia-like(Rab escort protein 2)), 유전자 등록번호(Genebank) AK002165(DKFZP564O123, Chromatin modifying protein 2B), 유전자 등록번호(Genebank) NM_152284(Shax3, Chromatin modifying protein 4C), 유전자 등록번호(Genebank) AW167080(SNF7DC2, Chromatin modifying protein 5), 유전자 등록번호(Genebank) BF790759(SNF7DC2, Chromatin modifying protein 5), 유전자 등록번호(Genebank) NM_018229(C14orf108, Chromosome 14 open reading frame 108), 유전자 등록번호(Genebank) AF130062(CLTC, Clathrin, heavy polypeptide(Hc)), 유전자 등록번호(Genebank) AF273058(CTAGE1, Cutaneous T-cell lymphoma-associated antigen 1), 유전자 등록번호(Genebank) AK023846(DER1, Der1-like domain family, member 1), 유전자 등록번호(Genebank) NM_145261(TIM14, DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) AF447177(GNG10, DnaJ-like protein), 유전자 등록번호(Genebank) NM_004125(GNG10, DnaJ-like protein), 유전자 등록번호(Genebank) NM_015171(XPO6, Exportin 6), 유전자 등록번호(Genebank) CA306634(GTF2H3, General transcription factor IIH, polypeptide 3, 34kDa), 유전자 등록번호(Genebank) M57609(GLI3, GLI-Kruppel family member GLI3(Greig cephalopolysyndactyly syndrome)), 유전자 등록번호(Genebank) BC047660(FLJ25422, Hypothetical protein FLJ25422), 유전자 등록번호(Genebank) BC035090(KPNA3, Karyopherin alpha 3(importin alpha 4)), 유전자 등록번호(Genebank) AK093917(KDELR2, KDEL(Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2), 유전자 등록번호(Genebank) NM_173827(FLJ38991, Mitochondrial COX18), 유전자 등록번호(Genebank) NM_018698(NXT2, Nuclear transport factor 2-like export factor 2), 유전자 등록번호(Genebank) BC039468(NUP50, Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC032755(PEX13, Peroxisome biogenesis factor 13), 유전자 등록번호(Genebank) AK023223(RAB10, RAB10, member RAS oncogene family), 유전자 등록번호(Genebank) AL162081(RAB14, RAB14, member RAS oncogene family), 유전자 등록번호(Genebank) AB209698(RAB18, RAB18, member RAS oncogene family), 유전자 등록번호(Genebank) NM_031296(RAB33B, RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) BC014553(RAB3IP, RAB3A interacting protein(rabin3)), 유전자 등록 번호(Genebank) NM_198490(RAB43, RAB43, member RAS oncogene family), 유전자 등록번호(Genebank) NM_004162(RAB5A, RAB5A, member RAS oncogene family), 유전자 등록번호(Genebank) AL136727(RAB6C, RAB6C, member RAS oncogene family), 유전자 등록번호(Genebank) NM_016530(RAB8B, RAB8B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_006267(RANBP2, RAN binding protein 2), 유전자 등록번호(Genebank) NM_020150(SARA1, SAR1 gene homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) AA418814(SEC22L1, SEC22 vesicle trafficking protein-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) AA484677(SEC22L1, SEC22 vesicle trafficking protein-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_031216(SEH1L, SEH1-like(S. cerevisiae)), 유전자 등록번호(Genebank) BC064351(SRP9, Signal recognition particle 9kDa), 유전자 등록번호(Genebank) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(Genebank) BX648363(SNX10, Sorting nexin 10), 유전자 등록번호(Genebank) AB209439(SNX15, Sorting nexin 15), 유전자 등록번호(Genebank) NM_014758(SNX19, Sorting nexin 19), 유전자 등록번호(Genebank) NM_021249(SNX6, Sorting nexin 6), 유전자 등록번호(Genebank) NM_004782(SNAP29, Synaptosomal-associated protein, 29kDa), 유전자 등록번호(Genebank) AJ420529(STX7, Syntaxin 7), 유전자 등록번호(Genebank) BC028028(STXBP3, Syntaxin binding protein 3), 유전자 등록번호(Genebank) NM_007269(STXBP3, Syntaxin binding protein 3), 유전자 등록번호(Genebank) NM_003262(TLOC1, Translocation protein 1), 유전자 등록번호(Genebank) AK094603(FLJ37284, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AL832866(VPS29, Vacuolar protein sorting 29(yeast)), 유전자 등록번호(Genebank) AK092532(FLJ10979, Vacuolar protein sorting 53(yeast)), 유전자 등록번호(Genebank) NM_015336(ZDHHC17, Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) AB002303(ZFYVE16, Zinc finger, FYVE domain containing 16), 유전자 등록번호(Genebank) NM_007236(CHP, Calcium binding protein P22), 유전자 등록번호(Genebank) AL137653(BARS, C-terminal binding protein 1), 유전자 등록번호(Genebank) AB017363(FZD1, Frizzled homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_017412(FZD3, Frizzled homolog 3(Drosophila)), 유전자 등록번호(Genebank) AB032417(FZD4, Frizzled homolog 4(Drosophila)), 유전자 등록번호(Genebank) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) AK025758(NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) NM_000933(PLCB4, Phospholipase C, beta 4), 유전자 등록번호(Genebank) AK131561(PRKACA, Protein kinase, cAMP-dependent, catalytic, alpha), 유전자 등록번호(Genebank) AF026692(SFRP4, Secreted frizzled-related protein 4), 유전자 등록번호(Genebank) BC078170(WNT2, Wingless-type MMTV integration site family member 2), 유전자 등록번호(Genebank) NM_003392(WNT5A, Wingless-type MMTV integration site family, member 5A), 유전자 등록번호(Genebank) AY009401(WNT6, Wingless-type MMTV integration site family, member 6), 유전자 등록번호(Genebank) AL832664(ANP32E, Acidic(leucine-rich) nuclear phosphoprotein 32 family, member E), 유전자 등록번호(Genebank) NM_138448(ACYP2, Acylphosphatase 2, muscle type), 유전자 등록번호(Genebank) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(Genebank) NM_175873(LOC134548, Ankyrin repeat domain 43), 유전자 등록번호(Genebank) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AB013380(ABCB10, ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) AK131472(FLJ16640, CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(Genebank) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(Genebank) BC004543(C15orf23, Chromosome 15 open reading frame 23), 유전자 등록번호(Genebank) NM_001012507(C6orf173, Chromosome 6 open reading frame 173), 유전자 등록번호(Genebank) AK000972(C9orf40, Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) NM_001801(CDO1, Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_018204(CKAP2, Cytoskeleton associated protein 2), 유전자 등록번호(Genebank) NM_006716(ASK, DBF4 homolog(S. cerevisiae)), 유 전자 등록번호(Genebank) BC045541(LOC200895, Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) NM_152721(DOK6, Docking protein 6), 유전자 등록번호(Genebank) NM_017645(FAM29A, Family with sequence similarity 29, member A), 유전자 등록번호(Genebank) NM_207418(MGC57827, Family with sequence similarity 72, member A), 유전자 등록번호(Genebank) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(Genebank) NM_005141(FGB, Fibrinogen beta chain), 유전자 등록번호(Genebank) AB208919(FGFR1, Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번호(Genebank) NM_032117(GAJ, GAJ protein), 유전자 등록번호(Genebank) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB007893(KIAA0433, Histidine acid phosphatase domain containing 1), 유전자 등록번호(Genebank) AF032862(HMMR, Hyaluronan-mediated motility receptor(RHAMM)), 유전자 등록번호(Genebank) AK123495(Q5XI42, Hypothetical gene supported by AL713796), 유전자 등록번호(Genebank) NM_018291(FLJ10986, Hypothetical protein FLJ10986), 유전자 등록번호(Genebank) AL832022(FLJ13910, Hypothetical protein FLJ13910), 유전자 등록번호(Genebank) AL832208(FLJ32312, Hypothetical protein FLJ32312), 유전자 등록번호(Genebank) AB037805(KLHL14, Kelch-like 14(Drosophila)), 유전자 등록번호(Genebank) NM_014736(KIAA0101, KIAA0101), 유전자 등록번호(Genebank) AB046861(KIAA1641, KIAA1641), 유전자 등록번호(Genebank) BC033021(LOC152831, Klotho beta), 유전자 등록번호(Genebank) NM_182551(LYCAT, Lysocardiolipin acyltransferase), 유전자 등록번호(Genebank) NM_002381(MATN3, Matrilin 3), 유전자 등록번호(Genebank) AB018342(MYO10, Myosin X), 유전자 등록번호(Genebank) BX537509(NET1, Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(Genebank) NM_033222(PSIP1, PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_000277(PAH, Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_176869(PPA2, Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(Genebank) NM_004586(RPS6KA3, Ribosomal protein S6 kinase, 90kDa, polypeptide 3), 유전자 등록번호(Genebank) BC064610(SEPHS1, Selenophosphate synthetase 1), 유전자 등록번호(Genebank) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(Genebank) XM_496355(LOC440577, Similar to nucleophosmin 1), 유전자 등록번호(Genebank) XM_371758(LOC389308, Similar to ribosomal protein L10a), 유전자 등록번호(Genebank) XM_371470(LOC388907, Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_495961(LOC440145, Similar to RIKEN cDNA 2410129H14), 유전자 등록번호(Genebank) XM_496301(LOC440517, Similar to zinc finger protein 91(HPF7, HTF10)), 유전자 등록번호(Genebank) BX640965(SLC22A3, Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) NM_180991(SLCO4C1, Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BM458612(THRAP6, Thyroid hormone receptor associated protein 6), 유전자 등록번호(Genebank) AI300182(PROS1, Transcribed locus, weakly similar to NP_000304.1 protein S(alpha)), 유전자 등록번호(Genebank) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(Genebank) AY358727(FLJ21934, UDP glucuronosyltransferase 2 family, polypeptide A3), 유전자 등록번호(Genebank) BC035579(ZNF100, Zinc finger protein 100), 유전자 등록번호(Genebank) AB209664(ZNF195, Zinc finger protein 195), 유전자 등록번호(Genebank) AY269786(ZNF429, Zinc finger protein 429), 유전자 등록번호(Genebank) NM_003423(ZNF43, Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_016220(ZNF588, Zinc finger protein 588), 유전자 등록번호(Genebank) AK122869(LOC148213, Zinc finger protein 681), 유전자 등록번호(Genebank) AK131527(ZNF15L1, Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) NM_003430(ZNF91, Zinc finger protein 91(HPF7, HTF10)), 유전자 등록번호(Genebank) NM_152626(ZNF92, Zinc finger protein 92(HTF12)).
1) 상기 바이오마커 중에서 나프탈렌의 노출에 의해 발현이 증가하는 바이오 마커 유전자는 하기와 같다:
유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) NM_138639(BCL2L12, BCL2-like 12(proline rich)), 유전자 등록번호(Genebank) AK124526(BCAR1, Breast cancer anti-estrogen resistance 1), 유전자 등록번호(Genebank) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(Genebank) AB209095(CDC2L2, Cell division cycle 2-like 2(PITSLRE proteins)), 유전자 등록번호(Genebank) AK128462(CRR9, Cisplatin resistance related protein CRR9p), 유전자 등록번호(Genebank) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(Genebank) NM_022105(DATF1, Death inducer-obliterator 1), 유전자 등록번호(Genebank) AK127033(DNM2, Dynamin 2), 유전자 등록번호(Genebank) NM_152461(ERN1, Endoplasmic reticulum to nucleus signalling 1), 유전자 등록번호(Genebank) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(Genebank) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_004309(ARHGDIA, Rho GDP dissociation inhibitor(GDI) alpha), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번호(Genebank) NM_006282(STK4, Serine/threonine kinase 4), 유전자 등록번호(Genebank) AB005666(SIPA1, Signal-induced proliferation-associated gene 1), 유전자 등록번호(Genebank) NM_207111(TRIAD3, TRIAD3 protein), 유전자 등록번호(Genebank) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번호(Genebank) AF026071(TNFRSF25, Tumor necrosis factor receptor superfamily, member 25), 유전자 등록번호(Genebank) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(Genebank) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(Genebank) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(Genebank) AK057576(CHFR, Checkpoint with forkhead and ring finger domains), 유전자 등록번호(Genebank) NM_005255(GAK, Cyclin G associated kinase), 유전자 등록번호(Genebank) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) AK094316(MAD2L2, MAD2 mitotic arrest deficient-like 2(yeast)), 유전자 등록번호(Genebank) NM_002595(PCTK2, PCTAIRE protein kinase 2), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform b, alpha subunit 45kDa), 유전자 등록번호(Genebank) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(Genebank) NM_001722(POLR3D, Polymerase(RNA) III(DNA directed) polypeptide D, 44kDa), 유전자 등록번호(Genebank) NM_002808(PSMD2, Proteasome(prosome, macropain) 26S subunit, non-ATPase, 2), 유전자 등록번호(Genebank) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(Genebank) BC023552(SFN, Stratifin), 유전자 등록번호(Genebank) NM_000548(TSC2, Tuberous sclerosis 2), 유전자 등록번호(Genebank) AK223618(ZBTB17, Zinc finger and BTB domain containing 17), 유전자 등록번호(Genebank) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(Genebank) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(Genebank) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(Genebank) NM_014598(SOCS7, Suppressor of cytokine signaling 7), 유전자 등록번호(Genebank) NM_003873(NRP1, Neuropilin 1), 유전자 등록번호(Genebank) NM_015366(FLJ20185, Rho GTPase activating protein 8), 유전자 등록번호(Genebank) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(Genebank) AB209463(CSNK1D, Casein kinase 1, delta), 유전자 등록번호(Genebank) NM_005228(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(Genebank) BC089041(GNA11, Guanine nucleotide binding protein(G protein), alpha 11(Gq class)), 유전자 등록번호(Genebank) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(Genebank) NM_012463(ATP6V0A2, ATPase, H+transport -ing, lysosomal V0 subunit a isoform 2), 유전자 등록번호(Genebank) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(Genebank) NM_000574(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(Genebank) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(Genebank) BG171626(FTH1, Ferritin, heavy polypeptide 1), 유전자 등록번호(Genebank) BM905227(FTH1, Ferritin, heavy polypeptide 1), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_003641(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(Genebank) AF200496(IL1F7, Interleukin 1 family, member 7(zeta)), 유전자 등록번호(Genebank) NM_000641(IL11, Interleukin 11), 유전자 등록번호(Genebank) NM_000565(IL6R, Interleukin 6 receptor), 유전자 등록번호(Genebank) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(Genebank) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(Genebank) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) NM_139276(STAT3, Signal transducer and activator of transcription 3(acute-phase response factor)), 유전자 등록번호(Genebank) NM_003037(SLAMF1, Signaling lymphocytic activation molecule family member 1), 유전자 등록번호(Genebank) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(Genebank) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(Genebank) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(Genebank) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(Genebank) AK095781(CIRBP, Cold inducible RNA binding protein), 유전자 등록번호(Genebank) X14789(CRYAA, Crystallin, alpha A), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_080927(DCBLD2, Discoidin, CUB and LCCL domain containing 2), 유전자 등록번호(Genebank) AY253982(GPR54, G protein-coupled receptor 54), 유전자 등록번호(Genebank) AF073799(GALR3, Galanin receptor 3), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) NM_007353(GNA12, Guanine nucleotide binding protein(G protein) alpha 12), 유전자 등록번호(Genebank) CR623806(HSPA6, Heat shock 70kDa protein 6(HSP70B')), 유전자 등록번호(Genebank) NM_006597(HSPA8, Heat shock 70kDa protein 8), 유전자 등록번호(Genebank) AK000252(FLJ20245, Hypothetical protein FLJ20245), 유전자 등록번호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) U02389(PRSS15, Protease, serine, 15), 유전자 등록번호(Genebank) NM_005053(RAD23A, RAD23 homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) CD357517(Unknown, Similar to Interferon-induced transmembrane protein 3(Interferon-inducible protein 1-8U)), 유전자 등록번호(Genebank) NM_032038(SPINL, Spinster), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) AK074035(XAB2, XPA binding protein 2), 유전자 등록번호(Genebank) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) NM_030662(MAP2K2, Mitogen-activated protein kinase kinase 2), 유전자 등록번호(Genebank) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(Genebank) NM_138473(SP1, Sp1 transcription factor), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_002880(RAF1, V-raf-1 murine leukemia viral oncogene homolog 1), 유전자 등록번호(Genebank) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(Genebank) AB209210(DVL1, Dishevelled, dsh homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(Genebank) AF077820(LRP5, Low density lipoprotein receptor-related protein 5), 유전자 등록번호(Genebank) NM_033119(NKD1, Naked cuticle homolog 1(Drosophila)), 유전자 등록번호(Genebank) AK090488(PPP2R1A, Protein phosphatase 2(formerly 2A), regulatory subunit A(PR 65), alpha isoform), 유전자 등록번호(Genebank) AL834166(TCF7, Transcription factor 7(T-cell specific, HMG-box)), 유전자 등록번호(Genebank) AY009401(WNT6, Wingless-type MMTV integration site family, member 6), 유전자 등록번호(Genebank) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_014595(NT5C, 5', 3'-nucleotidase, cytosolic), 유전자 등록번호(Genebank) AY461712(ATP13A2, ATPase type 13A2), 유전자 등록번호(Genebank) NM_018590(GALNACT-2, Chondroitin sulfate GalNAcT-2), 유전자 등록번호(Genebank) NM_080757(C20orf127, Chromosome 20 open reading frame 127), 유전자 등록번호(Genebank) X16866(CYP2D7P1, Cytochrome P450, family 2, subfamily D, polypeptide 6), 유전자 등록번호(Genebank) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(Genebank) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(Genebank) NM_000786(CYP51A1, Cytochrome P450, family 51, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(Genebank) AK093560(INPP1, Inositol polyphosphate-1-phosphatase), 유전자 등록번호(Genebank) NM_005578(LPP, LIM domain containing preferred translocation partner in lipoma), 유전자 등록번호(Genebank) AK222601(MMP10, Matrix metallopeptidase 10(stromelysin 2)), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_182924(MICAL-L2, MICAL-like 2), 유전자 등록번호(Genebank) AK127759(NDUFS7, NADH dehydrogenase(ubiquinone) Fe-S protein 7, 20kDa(NADH- coenzyme Q reductase)), 유전자 등록번호(Genebank) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(Genebank) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번호(Genebank) AA862994(S100A3, S100 calcium binding protein A3), 유전자 등록번호(Genebank) NM_003461(ZYX, Zyxin), 유전자 등록번호(Genebank) NM_019112(ABCA7, ATP-binding cassette, sub-family A(ABC1), member 7), 유전자 등록번호(Genebank) AB209054(ABCB6, ATP-binding cassette, sub-family B(MDR/TAP), member 6), 유전자 등록번호(Genebank) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(Genebank) NM_020038(ABCC3, ATP-binding cassette, sub-family C(CFTR/MRP), member 3), 유전자 등록번호(Genebank) BC025358(ABCD1, ATP-binding cassette, sub-family D(ALD), member 1), 유전자 등록번호(Genebank) NM_003992(CLK3, CDC-like kinase 3), 유전자 등록번호(Genebank) AK128154(C9orf86, Chromosome 9 open reading frame 86), 유전자 등록번호(Genebank) BC006404(SKD3, ClpB caseinolytic peptidase B homolog(E. coli)), 유전자 등록번호(Genebank) BC067254(COASY, Coenzyme A synthase), 유전자 등록번호(Genebank) NM_004398(DDX10, DEAD(Asp-Glu-Ala-Asp) box polypeptide 10), 유전자 등록번호(Genebank) BC038417(DHX30, DEAH(Asp-Glu-Ala-His) box polypeptide 30), 유전자 등록번호(Genebank) NM_138614(DHX30, DEAH(Asp-Glu-Ala-His) box polypeptide 30), 유전자 등록번호(Genebank) NM_032656(DHX37, DEAH(Asp-Glu-Ala-His) box polypeptide 37), 유전자 등록번호(Genebank) NM_020812(DOCK6, Dedicator of cytokinesis 6), 유전자 등록번호(Genebank) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(Genebank) NM_001961(EEF2, Eukaryotic translation elongation factor 2), 유전자 등록번호(Genebank) NM_003751(EIF3S9, Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa), 유전자 등록번호(Genebank) AF114818(SIAHBP1, Fuse-binding protein-interacting repressor), 유전자 등록번호(Genebank) NM_019096(GTPBP2, GTP binding protein 2), 유전자 등록번호(Genebank) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(Genebank) AK128226(HK1, Hexokinase 1), 유전자 등록번호(Genebank) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(Genebank) NM_006546(IMP-1, IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_015155(KIAA0217, La ribonucleoprotein domain family, member 5), 유전자 등록번호(Genebank) NM_018357(FLJ11196, La ribonucleoprotein domain family, member 6), 유전자 등록번호(Genebank) AK127089(MTHFD1L, Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 1-like), 유전자 등록번호(Genebank) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(Genebank) AB058686(MYO15B, Myosin XVB pseudogene), 유전자 등록번호(Genebank) BC027875(MYO15B, Myosin XVB pseudogene), 유전자 등록번호(Genebank) K122664(NRBP, Nuclear receptor binding protein), 유전자 등록번호(Genebank) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(Genebank) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_019034(RHOF, Ras homolog gene family, member F(in filopodia)), 유전자 등록번호(Genebank) NM_016084(RASD1, RAS, dexamethasone-induced 1), 유전자 등록번호(Genebank) AY369207(RBPMS2, RNA binding protein with multiple splicing 2), 유전자 등록번호(Genebank) BC069233(SCYL1, SCY1-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) AB209553(STK11, Serine/threonine kinase 11), 유전자 등록번호(Genebank) AK124047(C20orf119, Similar to embryonic poly(A) binding protein), 유전자 등록번호(Genebank) XM_496374(LOC440595, Similar to eukaryotic translation elongation factor 1 alpha 1), 유전자 등록번호(Genebank) NM_005094(SLC27A4, Solute carrier family 27(fatty acid transporter), member 4) 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(Genebank) BC009900(UBE1, Ubiquitin-activating enzyme E1(A1S9T and BN75 temperature sensitivity complementing)), 유전자 등록번호(Genebank) AF045458(ULK1, Unc-51-like kinase 1(C. elegans)), 유전자 등록번호(Genebank) X59303(VARS2, Valyl-tRNA synthetase), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AB208804(AP3D1, Adaptor-related protein complex 3, delta 1 subunit), 유전자 등록번호(Genebank) BC000786(ARFGAP1, ADP- ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) AK125277(APG4B, ATG4 autophagy related 4 homolog B(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) AK091056(COBRA1, Cofactor of BRCA1), 유전자 등록번호(Genebank) AF349676(COG3, Component of oligomeric golgi complex 3), 유전자 등록번호(Genebank) AB002368(XPO6, Exportin 6), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번호(Genebank) NM_004712(HGS, Hepatocyte growth factor-regulated tyrosine kinase substrate), 유전자 등록번호(Genebank) AK094897(IPO4, Importin 4), 유전자 등록번호(Genebank) L38951(KPNB1, Karyopherin(importin) beta 1), 유전자 등록번호(Genebank) NM_002268(KPNA4, Karyopherin alpha 4(importin alpha 3)), 유전자 등록번호(Genebank) AY014403(KIF13A, Kinesin family member 13A), 유전자 등록번호(Genebank) NM_002867(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(Genebank) AK025300(RANBP3, RAN binding protein 3), 유전자 등록번호(Genebank) AB014551(ARHGEF2, Rho/rac guanine nucleotide exchange factor(GEF) 2), 유전자 등록번호(Genebank) CD049342(RPL23, Ribosomal protein L23), 유전자 등록번호(Genebank) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(Genebank) NM_006809(TOMM34, Translocase of outer mitochondrial membrane 34), 유전자 등 록번호(Genebank) BC047528(TOMM40, Translocase of outer mitochondrial membrane 40 homolog(yeast)), 유전자 등록번호(Genebank) AK056701(VPS11, Vacuolar protein sorting 11(yeast)), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) AK095154(AES, Amino-terminal enhancer of split), 유전자 등록번호(Genebank) BC060828(ARID3A, AT rich interactive domain 3A(BRIGHT- like)), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_006532(ELL, Elongation factor RNA polymerase II), 유전자 등록번호(Genebank) NM_001991(EZH1, Enhancer of zeste homolog 1(Drosophila)), 유전자 등록번호(Genebank) U18018(ETV4, Ets variant gene 4(E1A enhancer binding protein, E1AF)), 유전자 등록번호(Genebank) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(Genebank) NM_181430(FOXK2, Forkhead box K2), 유전자 등록번호(Genebank) NM_001012426(FOXP4, Forkhead box P4), 유전자 등록번호(Genebank) BC053850(FOXQ1, Forkhead box Q1), 유전자 등록번호(Genebank) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(Genebank) BC078664(HMGA1, High mobility group AT-hook 1), 유전자 등록번호(Genebank) XM_379934(KIAA1718, KIAA1718 protein), 유전자 등록번호(Genebank) BC069156(LBX1, Ladybird homeobox homolog 1(Drosophila)), 유전 자 등록번호(Genebank) NM_014520(MYBBP1A, MYB binding protein(P160) 1a), 유전자 등록번호(Genebank) NM_002518(NPAS2, Neuronal PAS domain protein 2), 유전자 등록번호(Genebank) NM_001001716(NFKBIB, Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta), 유전자 등록번호(Genebank) AF087856(NCOR1, Nuclear receptor co-repressor 1), 유전자 등록번호(Genebank) NM_002653(PITX1, Paired-like homeodomain transcription factor 1), 유전자 등록번호(Genebank) NM_001003891(PCQAP, PC2(positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein), 유전자 등록번호(Genebank) NM_005035(POLRMT, Polymerase(RNA) mitochondrial(DNA directed)), 유전자 등록번호(Genebank) NM_012448(STAT5B, Signal transducer and activator of transcription 5B), 유전자 등록번호(Genebank) CR607342(RNPS1, Similar to splicing-related factor RNPS1), 유전자 등록번호(Genebank) NM_005986(SOX1, SRY(sex determining region Y)-box 1), 유전자 등록번호(Genebank) NM_003072(SMARCA4, SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4), 유전자 등록번호(Genebank) NM_006951(TAF5, TAF5 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 100kDa), 유전자 등록번호(Genebank) NM_152380(TBX15, T-box 15), 유전자 등록번호(Genebank) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(Genebank) BC006396(TLX2, T-cell leukemia, homeobox 2), 유전자 등록번호(Genebank) AF106934(THRAP5, Thyroid hormone receptor associated protein 5), 유전자 등록번호(Genebank) AF108461(UBN1, Ubinuclein 1), 유전자 등록번호(Genebank) NM_002359(MAFG, V-maf musculoaponeurotic fibrosarcoma oncogene homolog G(avian)), 유전자 등록번호(Genebank) AK092414(MAFK, V-maf musculoaponeurotic fibrosarcoma oncogene homolog K(avian)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_001003694(BRPF1, Bromodomain and PHD finger containing, 1), 유전자 등록번호(Genebank) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(Genebank) NM_139201(GIT2, G protein-coupled receptor kinase interactor 2), 유전자 등록번호(Genebank) AK125974(p66alpha, GATA zinc finger domain containing 2A), 유전자 등록번호(Genebank) CB050471(GLI4, GLI-Kruppel family member GLI4), 유전자 등록번호(Genebank) NM_006734(HIVEP2, Human immunodeficiency virus type I enhancer binding protein 2), 유전자 등록번호(Genebank) NM_031297(DKFZP761H1710, Hypothetical protein DKFZp761H1710), 유전자 등록번호(Genebank) NM_024671(FLJ23436, Hypothetical protein FLJ23436), 유전자 등록번호(Genebank) NM_173680(MGC33584, Hypothetical protein MGC33584), 유전자 등록번호(Genebank) NM_031918(KLF16, Kruppel-like factor 16), 유전자 등록번호(Genebank) BU163740(MKRN1, Makorin, ring finger protein, 1), 유전자 등록번호(Genebank) NM_005885(MARCH-V, Membrane-associated ring finger(C3HC4) 6), 유전자 등록번호(Genebank) AF242768(LOC51333, Mesenchymal stem cell protein DSC43), 유전자 등록번호(Genebank) NM_020774(MIB1, Mindbomb homolog 1(Drosophila)), 유전자 등록번호(Genebank) AJ007041(MLL4, Myeloid/lymphoid or mixed-lineage leukemia 4), 유전자 등록번호(Genebank) BF206103(ZNF286, Peroxisome proliferative activated receptor, alpha-like), 유전자 등록번호(Genebank) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(Genebank) D87076(PHF15, PHD finger protein 15), 유전자 등록번호(Genebank) NM_020122(KCMF1, Potassium channel modulatory factor 1), 유전자 등록번호(Genebank) NM_145214(TRIM11, Tripartite motif-containing 11), 유전자 등록번호(Genebank) NM_033452(TRIM47, Tripartite motif-containing 47), 유전자 등록번호(Genebank) AF281046(TRIM8, Tripartite motif-containing 8), 유전자 등록번호(Genebank) BC004256(ZNF259, Zinc finger protein 259), 유전자 등록번호(Genebank) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(Genebank) NM_198055(ZNF42, Zinc finger protein 42(myeloid-specific retinoic acid-responsive)), 유전자 등록번호(Genebank) BC071620(ZNF581, Zinc finger protein 581), 유전자 등록번호(Genebank) BM544755(ZNF593, Zinc finger protein 593), 유전자 등록번호(Genebank) AK024487(ZNF598, Zinc finger protein 598), 유전자 등록번호(Genebank) BC089449(ZEC, Zinc finger protein 628), 유전자 등록번호(Genebank) NM_153813(ZFPM1, Zinc finger protein, multitype 1), 유전자 등록번호(Genebank) BM451410(ZA20D2, Zinc finger, A20 domain containing 2), 유전자 등록번호(Genebank) BX648551(ZA20D2, Zinc finger, A20 domain containing 2), 유전자 등록번호(Genebank) BC006340(ZCCHC2, Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) BC053544(ZDHHC8, Zinc finger, DHHC-type containing 8), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(Genebank) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)), 유전자 등록번호(Genebank) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(Genebank) NM_012088(PGLS, 6-phosphogluconolactonase), 유전자 등록번호(Genebank) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(Genebank) NM_000402(G6PD, Glucose-6-phosphate dehydrogenase), 유전자 등록번호(Genebank) NM_006715(MAN2C1, Mannosidase, alpha, class 2C, member 1), 유전자 등록번호(Genebank) CR597860(C19orf27, Chromosome 19 open reading frame 27), 유전자 등록번호(Genebank) AK091948(LTB4DH, Leukotriene B4 12-hydroxydehydrogenase), 유전자 등록번호(Genebank) BC042195(MT, Malonyl-CoA:acyl carrier protein transacylase, mitochondrial), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) AK057049(PTGES2, Prostaglandin E synthase 2), 유전자 등록번호(Genebank) AB046825(GBA2, Glucosidase, beta(bile acid) 2), 유전자 등록번호(Genebank) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(Genebank) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(Genebank) NM_007169(PEMT, Phosphatidylethanolamine N-methyltransferase), 유전자 등록번호(Genebank) NM_005028(PIP5K2A, Phosphatidylinositol-4-phosphate 5-kinase, type II, alpha), 유전자 등록번호(Genebank) BC007612(PSAP, Prosaposin(variant Gaucher disease and variant metachromatic leukodystrophy)), 유전자 등록번호(Genebank) BC087612(SBF1, SET binding factor 1), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) AK223291(MMP3, Matrix metallopeptidase 3(stromelysin 1, progelatinase)), 유전자 등록번호(Genebank) NM_178819(DKFZp586M1819, 1-acylglycerol-3-phosphate O-acyltransferase 6(lysophosphatidic acid acyltransferase, zeta)), 유전자 등록번호(Genebank) NM_018694(ARL6IP4, ADP-ribosylation-like factor 6 interacting protein 4), 유전자 등록번호(Genebank) BC014895(MGC10204, Aldehyde dehydrogenase 16 family, member A1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번 호(Genebank) BC008751(CAPN1, Calpain 1,(mu/I) large subunit), 유전자 등록번호(Genebank) AK128552(CAPN10, Calpain 10), 유전자 등록번호(Genebank) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(Genebank) NM_001903(CTNNA1, Catenin(cadherin-associated protein), alpha 1, 102kDa), 유전자 등록번호(Genebank) BC067289(CTSL2, Cathepsin L2), 유전자 등록번호(Genebank) NM_015151(C21orf106, Chromosome 21 open reading frame 106), 유전자 등록번호(Genebank) NM_031434(C7orf21, Chromosome 7 open reading frame 21), 유전자 등록번호(Genebank) NM_001303(COX10, COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase(yeast)), 유전자 등록번호(Genebank) BP317375(COX6A2, Cytochrome c oxidase subunit VIa polypeptide 2), 유전자 등록번호(Genebank) NM_001355(DDT, D-dopachrome tautomerase), 유전자 등록번호(Genebank) NM_032482(DOT1L, DOT1-like, histone H3 methyltransferase(S. cerevisiae)), 유전자 등록번호(Genebank) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(Genebank) AB210013(EIF4G1, Eukaryotic translation initiation factor 4 gamma, 1), 유전자 등록번호(Genebank) NM_020158(EXOSC5, Exosome component 5), 유전자 등록번호(Genebank) NM_178225(FBXW5, F-box and WD-40 domain protein 5), 유전자 등록번호(Genebank) NM_058229(FBXO32, F-box protein 32), 유전자 등록번호(Genebank) AB209592(GMPPA, GDP-mannose pyrophosphorylase A), 유전자 등록번호(Genebank) AJ002231(GNPDA1, Glucosamine-6-phosphate deaminase 1), 유전자 등록번 호(Genebank) AK094940(GCLC, Glutamate-cysteine ligase, catalytic subunit), 유전자 등록번호(Genebank) NM_005318(H1F0, H1 histone family, member 0), 유전자 등록번호(Genebank) NM_004639(BAT3, HLA-B associated transcript 3), 유전자 등록번호(Genebank) NM_032717(MGC11324, Hypothetical protein MGC11324), 유전자 등록번호(Genebank) BX647357(IDS, Iduronate 2-sulfatase(Hunter syndrome)), 유전자 등록번호(Genebank) AY923172(KLK13, Kallikrein 13), 유전자 등록번호(Genebank) AK023137(MGAT4B, Mannosyl(alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B), 유전자 등록번호(Genebank) NM_024864(FLJ22578, Mitochondrial rRNA methyltransferase 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_153006(NAGS, N-acetylglutamate synthase), 유전자 등록번호(Genebank) NM_020230(PPAN, Peter pan homolog(Drosophila)), 유전자 등록번호(Genebank) BC017045(PYGB, Phosphorylase, glycogen; brain), 유전자 등록번호(Genebank) NM_005401(PTPN14, Protein tyrosine phosphatase, non-receptor type 14), 유전자 등록번호(Genebank) AF290614(PTPN23, Protein tyrosine phosphatase, non-receptor type 23), 유전자 등록번호(Genebank) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(Genebank) NM_002840(PTPRF, Protein tyrosine phosphatase, receptor type, F), 유전자 등록번호(Genebank) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(Genebank) AF348492(RBAF600, Retinoblastoma-associated factor 600), 유전자 등록번 호(Genebank) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(Genebank) AB209196(RNH, Ribonuclease/angiogenin inhibitor 1), 유전자 등록번호(Genebank) CR619918(RPL18A, Ribosomal protein L18a), 유전자 등록번호(Genebank) BM553074(RPS15A, Ribosomal protein S15a), 유전자 등록번호(Genebank) CD387408(RPS28, Ribosomal protein S28), 유전자 등록번호(Genebank) CR749837(RPS7, Ribosomal protein S7), 유전자 등록번호(Genebank) BM805682(EEF1D, Similar to eukaryotic translation elongation factor 1 delta isoform 1; guanine nucleotide exchange protein), 유전자 등록번호(Genebank) XM_069734(LOC136143, Similar to ribosomal protein L18; 60S ribosomal protein L18), 유전자 등록번호(Genebank) BG186194(RPS24, Similar to ribosomal protein S24), 유전자 등록번호(Genebank) AB037719(SSH1, Slingshot homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(Genebank) BF680536(SAT, Spermidine/spermine N1-acetyltransferase), 유전자 등록번호(Genebank) AK127286(SMOX, Spermine oxidase), 유전자 등록번호(Genebank) NM_005877(SF3A1, Splicing factor 3a, subunit 1, 120kDa), 유전자 등록번호(Genebank) AF082557(TNKS, Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase), 유전자 등록번호(Genebank) BC002856(TXNDC11, Thioredoxin domain containing 11) 유전자 등록번호(Genebank) NM_017722(FLJ20244, TRM1 tRNA methyltransferase 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) AK023077(USP36, Ubiquitin specific peptidase 36), 유전자 등록번호(Genebank) NM_080605(B3GALT6, UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6), 유전자 등록번호(Genebank) AY358955(B3GNT3, UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자 등록번호(Genebank) AK074143(UAP1L1, UDP-N-acteylglucosamine pyrophosphorylase 1-like 1), 유전자 등록번호(Genebank) C007348(UPP1, Uridine phosphorylase 1), 유전자 등록번호(Genebank) BC047030(UPP1, Uridine phosphorylase 1), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) XM_371474(PLXNB2, Plexin B2), 유전자 등록번호(Genebank) BC050636(FLJ14249, HS1-binding protein 3), 유전자 등록번호(Genebank) NM_004699(FAM50A, Family with sequence similarity 50, member A), 유전자 등록번호(Genebank) AY368150(CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B).
2) 상기 바이오마커 중에서, 나프탈렌의 노출에 의해 발현이 감소하는 바이오마커 유전자는 하기와 같다:
유전자 등록번호(Genebank) AF130077(ALB, Albumin), 유전자 등록번호(Genebank) NM_021631(FKSG2, Apoptosis inhibitor), 유전자 등록번호(Genebank) AF143236(C17orf88, Apoptosis related protein), 유전자 등록번호(Genebank) NM_001621(AHR, Aryl hydrocarbon receptor), 유전자 등록번호(Genebank) AB209123(BIRC1, Baculoviral IAP repeat-containing 1), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001167(BIRC4, Baculoviral IAP repeat-containing 4), 유전자 등록번호(Genebank) AW872828(BIRC6, Baculoviral IAP repeat-containing 6(apollon)), 유전자 등록번호(Genebank) AU146963(BCL2, B-cell CLL/lymphoma 2), 유전자 등록번호(Genebank) NM_004331(BNIP3L, BCL2/adenovirus E1B 19kDa interacting protein 3-like), 유전자 등록번호(Genebank) NM_001015049(BAG5, BCL2-associated athanogene 5), 유전자 등록번호(Genebank) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(Genebank) L33477(HSPD1, Cadherin 12, type 2(N-cadherin 2)), 유전자 등록번호(Genebank) NM_001904(CTNNB1, Catenin(cadherin-associated protein), beta 1, 88kDa), 유전자 등록번호(Genebank) NM_005894(CD5L, CD5 antigen-like(scavenger receptor cysteine rich family)), 유전자 등록번호(Genebank) AK124173(FLJ42179, CDNA FLJ42179 fis, clone THYMU2030796), 유전자 등록번호(Genebank) AB209095(CDC2L2, Cell division cycle 2-like 2(PITSLRE proteins)), 유전자 등록번호(Genebank) AK128462(CRR9, Cisplatin resistance related protein CRR9p), 유전자 등록번호(Genebank) NM_016424(CROP, Cisplatin resistance-associated overexpressed protein), 유전자 등록번호(Genebank) NM_003478(CUL5, Cullin 5), 유전자 등록번호(Genebank) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(Genebank) BC048797(DFFB, DNA fragmentation factor, 40kDa, beta polypeptide(caspase-activated DNase)), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) NM_006144(GZMA, Granzyme A(granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)), 유전자 등록번호(Genebank) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(Genebank) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(Genebank) NM_005338(HIP1, Huntingtin interacting protein 1), 유전자 등록번호(Genebank) AK026927(MGC5297, Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(Genebank) AF208043(IFI16, Interferon, gamma-inducible protein 16), 유전자 등록번호(Genebank) BX648731(JMY, Junction-mediating and regulatory protein), 유전자 등록번호(Genebank) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(Genebank) NM_000314(PTEN, Phosphatase and tensin homolog(mutated in multiple advanced cancers 1)), 유전자 등록번호(Genebank) BC047362(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(Genebank) BX537500(PDCD4, Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) NM_013374(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(Genebank) NM_005400(PRKCE, Protein kinase C, epsilon), 유전자 등록번호(Genebank) CR621593(PRG2, Proteoglycan 2, bone marrow(natural killer cell activator, eosinophil granule major basic protein)), 유전자 등록번호(Genebank) BC041849(ROCK1, Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) NM_000582(SPP1, Secreted phosphoprotein 1(osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)), 유전자 등록번호(Genebank) BC039110(SMNDC1, Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(Genebank) AF520785(TNFSF15, Tumor necrosis factor(ligand) superfamily, member 15), 유전자 등록번호(Genebank) NM_002546(TNFRSF11B, Tumor necrosis factor receptor superfamily, member 11b(osteoprotegerin)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) NM_006290(TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), 유전자 등록번호(Genebank) AK125880(TP53INP1, Tumor protein p53 inducible nuclear protein 1), 유전자 등록번호(Genebank) AB209534(TRA1, Tumor rejection antigen(gp96) 1), 유전자 등록번호(Genebank) NM_012479(YWHAG, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide), 유전자 등록번호(Genebank) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(Genebank) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(Genebank) AK122953(VDAC1, Voltage-dependent anion channel 1), 유전자 등록번호(Genebank) NM_019001(XRN1, 5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) BC016344(ACPP, Acid phosphatase, prostate), 유전자 등록번호(Genebank) BM921310(ANAPC10, Anaphase promoting complex subunit 10), 유전자 등록번호(Genebank) NM_153186(ANKRD15, Ankyrin repeat domain 15), 유전자 등록번호(Genebank) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) NM_004071(CLK1, CDC-like kinase 1), 유전자 등록번호(Genebank) CR933728(CDC2 Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_044472(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) NM_004365(CETN3, Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) BC050310(C10orf9, Chromosome 10 open reading frame 9), 유전자 등록번호(Genebank) NM_016446(C9orf127, Chromosome 9 open reading frame 127), 유전자 등록번 호(Genebank) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(Genebank) NM_001761(CCNF, Cyclin F), 유전자 등록번호(Genebank) NM_004354(CCNG2, Cyclin G2), 유전자 등록번호(Genebank) NM_004064(CDKN1B, Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_007068(DMC1, DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination(yeast)), 유전자 등록번호(Genebank) AK025142(BPA, dystonin), 유전자 등록번호(Genebank) NM_001950(E2F4, E2F transcription factor 4, p107/p130-binding), 유전자 등록번호(Genebank) NM_019063(EML4, Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) AJ245671(EGFL6, EGF-like-domain, multiple 6), 유전자 등록번호(Genebank) NM_004450(ERH, Enhancer of rudimentary homolog(Drosophila)), 유전자 등록번호(Genebank) AL832041(ESCO1, Establishment of cohesion 1 homolog 1(S. cerevisiae)), 유전자 등록번호(Genebank) AL832666(ESCO2, Establishment of cohesion 1 homolog 2(S. cerevisiae)), 유전자 등록번호(Genebank) AK126048(FLJ44060, FLJ44060 protein), 유전자 등록번호(Genebank) BI494022(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(Genebank) NM_000189(HK2, Hexokinase 2), 유전자 등록번호(Genebank) NM_014707(HDAC9, Histone deacetylase 9), 유전자 등록번호(Genebank) BC067253(FLJ40432, Hypothetical protein FLJ40432), 유전자 등록번호(Genebank) AL834276(MGC3207, Hypothetical protein MGC3207), 유전자 등록번호(Genebank) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(Genebank) NM_014751(MTSS1, Metastasis suppressor 1), 유전자 등록번호(Genebank) BC040410(MAPRE1, Microtubule-associated protein, RP/EB family, member 1), 유전자 등록번호(Genebank) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(Genebank) L20321(NEK4, NIMA(never in mitosis gene a)-related kinase 4), 유전자 등록번호(Genebank) AJ627032(NIPBL, Nipped-B homolog(Drosophila)), 유전자 등록번호(Genebank) AL575067(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(Genebank) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(Genebank) AL833922(PAPD5, PAP associated domain containing 5), 유전자 등록번호(Genebank) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(Genebank) NM_016205(PDGFC, Platelet derived growth factor C), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa), 유전자 등록번호(Genebank) NM_006259(PRKG2, Protein kinase, cGMP-dependent, type II), 유전자 등록번호(Genebank) NM_002709(PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_003463(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(Genebank) BX647606(PTMA, Prothymosin, alpha(gene sequence 28)), 유전자 등록번호(Genebank) BC068483(RINT-1, Rad50-interacting protein 1), 유전자 등록번호(Genebank) NM_006325(RAN, RAN, member RAS oncogene family), 유전자 등록번 호(Genebank) NM_213590(RFP2, Ret finger protein 2), 유전자 등록번호(Genebank) NM_006910(RBBP6, Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) BC060806(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) BX648668(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) AB208875(SEPT10, Septin 10), 유전자 등록번호(Genebank) AB209677(SEPT7, Septin 7), 유전자 등록번호(Genebank) BX649128(SESN3, Sestrin 3), 유전자 등록번호(Genebank) XM_497098(LOC441488, Similar to Transcription factor Dp-1(E2F dimerization partner 1)(DRTF1-polypeptide-1)(DRTF1)), 유전자 등록번호(Genebank) AK131071(SLC31A2, Solute carrier family 31(copper transporters), member 2), 유전자 등록번호(Genebank) NM_006930(SKP1A, S-phase kinase-associated protein 1A(p19A)), 유전자 등록번호(Genebank) NM_006542(SPHAR, S-phase response(cyclin-related)), 유전자 등록번호(Genebank) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) NM_014574(STRN3, Striatin, calmodulin binding protein 3), 유전자 등록번호(Genebank) NM_003176(SYCP1, Synaptonemal complex protein 1), 유전자 등록번호(Genebank) BM674777(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_006701(TXNL4A, Thioredoxin-like 4A), 유전자 등록번호(Genebank) NM_030756(TCF7L2, Transcription factor 7-like 2(T-cell specific, HMG-box)), 유전자 등록번호(Genebank) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(Genebank) NM_000368(TSC1, Tuberous sclerosis 1), 유전자 등록번호(Genebank) NM_006826(YWHAQ, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide), 유전자 등록번호(Genebank) NM_001032410(USP16, Ubiquitin specific peptidase 16), 유전자 등록번호(Genebank) AK095164(KRAS2, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_138271(ATRX, Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AK025738(ASF1A, ASF1 anti-silencing function 1 homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK125915(CRY1, Cryptochrome 1(photolyase-like)), 유전자 등록번호(Genebank) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록번호(Genebank) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(Genebank) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(Genebank) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(Genebank) NM_002431(MNAT1, Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) BC032617(POLI, Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) NM_002690(POLB, Polymerase(DNA directed), beta), 유전자 등록번호(Genebank) AK025631(POLH, Polymerase(DNA directed), eta), 유전자 등록번호(Genebank) BC038996(PMS2L1, Postmeiotic segregation increased 2-like 1), 유전자 등록번호(Genebank) BM462208(PCNA, Proliferating cell nuclear antigen), 유전자 등록번호(Genebank) NM_020165(RAD18, RAD18 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_152442(RAD9B, RAD9 homolog B(S. cerevisiae)), 유전자 등록번호(Genebank) NM_018151(RIF1, RAP1 interacting factor homolog(yeast)), 유전자 등록번호(Genebank) AI281523(SFPQ, Splicing factor proline/glutamine-rich(polypyrimidine tract binding protein associated)), 유전자 등록번호(Genebank) AK057830(TOM1L2, Target of myb1-like 2(chicken)), 유전자 등록번호(Genebank) NM_001012716(TYMS, Thymidylate synthetase), 유전자 등록번호(Genebank) NM_001071(TYMS, Thymidylate synthetase), 유전자 등록번호(Genebank) NM_003368(USP1, Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) AK094617(UBE2V2, Ubiquitin-conjugating enzyme E2 variant 2), 유전자 등록번호(Genebank) NM_003337(UBE2B, Ubiquitin-conjugating enzyme E2B(RAD6 homolog)), 유전자 등록번호(Genebank) CD013992(GSTT2, Glutathione S-transferase theta 2), 유전자 등록번호(Genebank) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(Genebank) NM_000847(GSTA3, Glutathione S-transferase A3), 유전자 등록번호(Genebank) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_017460(CYP3A4, Cytochrome P450, family 3, subfamily A, polypeptide 4), 유전자 등록번호(Genebank) BC039065(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(Genebank) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_000667(ADH1A, Alcohol dehydrogenase 1A(class I), alpha polypeptide), 유전자 등록번호(Genebank) BI762502(GSTA2, Glutathione S-transferase A2), 유전자 등록번호(Genebank) NM_000690(ALDH2, Aldehyde dehydrogenase 2 family(mitochondrial)), 유전자 등록번호(Genebank) NM_000696(ALDH9A1, Aldehyde dehydrogenase 9 family, member A1), 유전자 등록번호(Genebank) AK093311(ACAA2, Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) NM_004457(ACSL3, Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_000016(ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) BC033517(ACOX2, Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(Genebank) NM_000384(APOB, Apolipoprotein B(including Ag(x) antigen)), 유전자 등록번호(Genebank) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) NM_000236(LIPC, Lipase, hepatic), 유전자 등록번호(Genebank) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_003101(SOAT1, Sterol O-acyltransferase(acyl-Coenzyme A: cholesterol acyltransferase) 1), 유전자 등록번호(Genebank) T81314(MBTPS1, Transcribed locus), 유전자 등록번호(Genebank) NM_147156(TMEM23, Transmembrane protein 23), 유전자 등록번호(Genebank) NM_003916(AP1S2, Adaptor-related protein complex 1, sigma 2 subunit), 유전자 등록번호(Genebank) AA298150(AP3S1, Adaptor-related protein complex 3, sigma 1 subunit), 유전자 등록번호(Genebank) AL109702(AP3S2, Adaptor-related protein complex 3, sigma 2 subunit), 유전자 등록번호(Genebank) BU620136(AP4S1, Adaptor-related protein complex 4, sigma 1 subunit), 유전자 등록번호(Genebank) NM_001025595(ARFIP1, ADP-ribosylation factor interacting protein 1(arfaptin 1)), 유전자 등록번호(Genebank) NM_203437(AFTIPHILIN, Aftiphilin protein), 유전자 등록번호(Genebank) NM_006380(APPBP2, Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) BM683433(AP1GBP1, AP1 gamma subunit binding protein 1), 유전자 등록번호(Genebank) AK027773(APG4C, ATG4 autophagy related 4 homolog C(S. cerevisiae)), 유전자 등록번호(Genebank) AF130117(CRBN, Cereblon), 유전자 등록번호(Genebank) NM_001821(CHML, Choroideremia-like(Rab escort protein 2)), 유전자 등록번호(Genebank) AK002165(DKFZP564O123, Chromatin modifying protein 2B), 유전자 등록번호(Genebank) NM_152284(Shax3, Chromatin modifying protein 4C), 유전자 등록번호(Genebank) AW167080(SNF7DC2, Chromatin modifying protein 5), 유전자 등록번호(Genebank) BF790759(SNF7DC2, Chromatin modifying protein 5), 유전자 등록번호(Genebank) NM_018229(C14orf108, Chromosome 14 open reading frame 108), 유전자 등록번호(Genebank) AF130062(CLTC, Clathrin, heavy polypeptide(Hc)), 유전자 등록번호(Genebank) AF273058(CTAGE1, Cutaneous T-cell lymphoma-associated antigen 1), 유전자 등록번호(Genebank) AK023846(DER1, Der1-like domain family, member 1), 유전자 등록번호(Genebank) NM_145261(TIM14, DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) AF447177(GNG10, DnaJ-like protein), 유전자 등록번호(Genebank) NM_004125(GNG10, DnaJ-like protein), 유전자 등록번호(Genebank) NM_015171(XPO6, Exportin 6), 유전자 등록번호(Genebank) CA306634(GTF2H3, General transcription factor IIH, polypeptide 3, 34kDa), 유전자 등록번호(Genebank) M57609(GLI3, GLI-Kruppel family member GLI3(Greig cephalopolysyndactyly syndrome)), 유전자 등록번호(Genebank) BC047660(FLJ25422, Hypothetical protein FLJ25422), 유전자 등록번호(Genebank) BC035090(KPNA3, Karyopherin alpha 3(importin alpha 4)), 유전자 등록번호(Genebank) AK093917(KDELR2, KDEL(Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2), 유전자 등록번호(Genebank) NM_173827(FLJ38991, Mitochondrial COX18), 유전자 등록번호(Genebank) NM_018698(NXT2, Nuclear transport factor 2-like export factor 2), 유전자 등록번호(Genebank) BC039468(NUP50, Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC032755(PEX13, Peroxisome biogenesis factor 13), 유전자 등록번호(Genebank) AK023223(RAB10, RAB10, member RAS oncogene family), 유전자 등록번호(Genebank) AL162081(RAB14, RAB14, member RAS oncogene family), 유전자 등록번호(Genebank) AB209698(RAB18, RAB18, member RAS oncogene family), 유전자 등록번호(Genebank) NM_031296(RAB33B, RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) BC014553(RAB3IP, RAB3A interacting protein(rabin3)), 유전자 등록번호(Genebank) NM_198490(RAB43, RAB43, member RAS oncogene family), 유전자 등록번호(Genebank) NM_004162(RAB5A, RAB5A, member RAS oncogene family), 유전자 등록번호(Genebank) AL136727(RAB6C, RAB6C, member RAS oncogene family), 유전자 등록번호(Genebank) NM_016530(RAB8B, RAB8B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_006267(RANBP2, RAN binding protein 2), 유전자 등록번호(Genebank) NM_020150(SARA1, SAR1 gene homolog A(S. cerevisiae)), 유전자 등록번호(Genebank) AA418814(SEC22L1, SEC22 vesicle trafficking protein-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) AA484677(SEC22L1, SEC22 vesicle trafficking protein-like 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_031216(SEH1L, SEH1-like(S. cerevisiae)), 유전자 등록번호(Genebank) BC064351(SRP9, Signal recognition particle 9kDa), 유전자 등록번호(Genebank) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(Genebank) BX648363(SNX10, Sorting nexin 10), 유전자 등록번호(Genebank) AB209439(SNX15, Sorting nexin 15), 유전자 등록번호(Genebank) NM_014758(SNX19, Sorting nexin 19), 유전자 등록번호(Genebank) NM_021249(SNX6, Sorting nexin 6), 유전자 등록번호(Genebank) NM_004782(SNAP29, Synaptosomal-associated protein, 29kDa), 유전자 등록번호(Genebank) AJ420529(STX7, Syntaxin 7), 유전자 등록번호(Genebank) BC028028(STXBP3, Syntaxin binding protein 3), 유전자 등록번호(Genebank) NM_007269(STXBP3, Syntaxin binding protein 3), 유전자 등록번호(Genebank) NM_003262(TLOC1, Translocation protein 1), 유전자 등록번호(Genebank) AK094603(FLJ37284, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AL832866(VPS29, Vacuolar protein sorting 29(yeast)), 유전자 등록번호(Genebank) AK092532(FLJ10979, Vacuolar protein sorting 53(yeast)), 유전자 등록번호(Genebank) NM_015336(ZDHHC17, Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) AB002303(ZFYVE16, Zinc finger, FYVE domain containing 16), 유전자 등록번호(Genebank) NM_007236(CHP, Calcium binding protein P22), 유전자 등록번호(Genebank) AL137653(BARS, C-terminal binding protein 1), 유전자 등록번호(Genebank) AB017363(FZD1, Frizzled homolog 1(Drosophila)), 유전자 등록번호(Genebank) NM_017412(FZD3, Frizzled homolog 3(Drosophila)), 유전자 등록번호(Genebank) AB032417(FZD4, Frizzled homolog 4(Drosophila)), 유전자 등록번호(Genebank) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) AK025758(NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) NM_000933(PLCB4, Phospholipase C, beta 4), 유전자 등록번호(Genebank) AK131561(PRKACA, Protein kinase, cAMP-dependent, catalytic, alpha), 유전자 등 록번호(Genebank) AF026692(SFRP4, Secreted frizzled-related protein 4), 유전자 등록번호(Genebank) BC078170(WNT2, Wingless-type MMTV integration site family member 2), 유전자 등록번호(Genebank) NM_003392(WNT5A, Wingless-type MMTV integration site family, member 5A), 유전자 등록번호(Genebank) AY009401(WNT6, Wingless-type MMTV integration site family, member 6), 유전자 등록번호(Genebank) AL832664(ANP32E, Acidic(leucine-rich) nuclear phosphoprotein 32 family, member E), 유전자 등록번호(Genebank) NM_138448(ACYP2, Acylphosphatase 2, muscle type), 유전자 등록번호(Genebank) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(Genebank) NM_175873(LOC134548, Ankyrin repeat domain 43), 유전자 등록번호(Genebank) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AB013380(ABCB10, ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) AK131472(FLJ16640, CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(Genebank) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(Genebank) BC004543(C15orf23, Chromosome 15 open reading frame 23), 유전자 등록번호(Genebank) NM_001012507(C6orf173, Chromosome 6 open reading frame 173), 유전자 등록번호(Genebank) AK000972(C9orf40, Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) NM_001801(CDO1, Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_018204(CKAP2, Cytoskeleton associated protein 2), 유전자 등록번호(Genebank) NM_006716(ASK, DBF4 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BC045541(LOC200895, Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) NM_152721(DOK6, Docking protein 6), 유전자 등록번호(Genebank) NM_017645(FAM29A, Family with sequence similarity 29, member A), 유전자 등록번호(Genebank) NM_207418(MGC57827, Family with sequence similarity 72, member A), 유전자 등록번호(Genebank) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(Genebank) NM_005141(FGB, Fibrinogen beta chain), 유전자 등록번호(Genebank) AB208919(FGFR1, Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번호(Genebank) NM_032117(GAJ, GAJ protein), 유전자 등록번호(Genebank) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB007893(KIAA0433, Histidine acid phosphatase domain containing 1), 유전자 등록번호(Genebank) AF032862(HMMR, Hyaluronan-mediated motility receptor(RHAMM)), 유전자 등록번호(Genebank) AK123495(Q5XI42, Hypothetical gene supported by AL713796), 유전자 등록번호(Genebank) NM_018291(FLJ10986, Hypothetical protein FLJ10986), 유전자 등록번호(Genebank) AL832022(FLJ13910, Hypothetical protein FLJ13910), 유전자 등록번호(Genebank) AL832208(FLJ32312, Hypothetical protein FLJ32312), 유전자 등록번호(Genebank) AB037805(KLHL14, Kelch-like 14(Drosophila)), 유전자 등록번호(Genebank) NM_014736(KIAA0101, KIAA0101), 유전자 등록번호(Genebank) AB046861(KIAA1641, KIAA1641), 유전자 등록번호(Genebank) BC033021(LOC152831, Klotho beta), 유전자 등록번호(Genebank) NM_182551(LYCAT, Lysocardiolipin acyltransferase), 유전자 등록번호(Genebank) NM_002381(MATN3, Matrilin 3), 유전자 등록번호(Genebank) AB018342(MYO10, Myosin X), 유전자 등록번호(Genebank) BX537509(NET1, Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(Genebank) NM_033222(PSIP1, PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_000277(PAH, Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_176869(PPA2, Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(Genebank) NM_004586(RPS6KA3, Ribosomal protein S6 kinase, 90kDa, polypeptide 3), 유전자 등록번호(Genebank) BC064610(SEPHS1, Selenophosphate synthetase 1), 유전자 등록번호(Genebank) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(Genebank) XM_496355(LOC440577, Similar to nucleophosmin 1), 유전자 등록번호(Genebank) XM_371758(LOC389308, Similar to ribosomal protein L10a), 유전자 등록번호(Genebank) XM_371470(LOC388907, Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_495961(LOC440145, Similar to RIKEN cDNA 2410129H14), 유전자 등록번호(Genebank) XM_496301(LOC440517, Similar to zinc finger protein 91(HPF7, HTF10)), 유전자 등록번호(Genebank) BX640965(SLC22A3, Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) NM_180991(SLCO4C1, Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BM458612(THRAP6, Thyroid hormone receptor associated protein 6), 유전자 등록번호(Genebank) AI300182(PROS1, Transcribed locus, weakly similar to NP_000304.1 protein S(alpha)), 유전자 등록번호(Genebank) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(Genebank) AY358727(FLJ21934, UDP glucuronosyltransferase 2 family, polypeptide A3), 유전자 등록번호(Genebank) BC035579(ZNF100, Zinc finger protein 100), 유전자 등록번호(Genebank) AB209664(ZNF195, Zinc finger protein 195), 유전자 등록번호(Genebank) AY269786(ZNF429, Zinc finger protein 429), 유전자 등록번호(Genebank) NM_003423(ZNF43, Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_016220(ZNF588, Zinc finger protein 588), 유전자 등록번호(Genebank) AK122869(LOC148213, Zinc finger protein 681), 유전자 등록번호(Genebank) AK131527(ZNF15L1, Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) NM_003430(ZNF91, Zinc finger protein 91(HPF7, HTF10)), 유전자 등록번 호(Genebank) NM_152626(ZNF92, Zinc finger protein 92(HTF12)).
본 발명자들은 나프탈렌에 대한 노출 여부 확인용 바이오마커를 발굴하기 위하여, 나프탈렌을 인간 간암 세포주(HepG2)에 처리하여 세포 독성을 확인하였다. 그 결과, 상기 나프탈렌은 인간 간암 세포주에 독성을 가짐이 확인되었고(도 1 참조), 상기 실험을 바탕으로 나프탈렌의 농도를 결정하였다. 이후 상기 결정된 농도로 나프탈렌을 인간 간암 세포주에 처리하고, 상기 물질을 처리한 세포주에서 mRNA를 분리하여 cDNA를 합성하면서 형광물질(Cy5)로 표지하였으며, 약물을 처리하지 않은 대조군의 경우 Cy3로 표지하였다. 상기 형광표지된 cDNA를 44 k 올리고마이크로어레이 칩 Human whole genome microarray(Agilent, USA)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다(도 2 참조). 분석시 Cy5/Cy3 비율이 2.0배 이상인 경우 발현 증가된 유전자로 분류하였고, 0.5배 이하인 경우 발현 감소된 유전자로 분류하였다. 분석 결과, 발현 증가된 유전자는 0.86%(44,000개의 유전자 중 377개) 발현이 감소된 유전자는 0.71%(44,000개의 유전자 중 313개)임을 확인하였다. 이때, 나프탈렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 분류한 기능별로 분류하면, 세포 주기(cell cycle), 세포 성장(cell growth), 세포 이동(cell migration), 아팝토시스(apoptosis), 전사(transcription), 뉴클레오티드 결합(nucleotide binding), 금속원소 결합(metal binding), 자극에 대한 반응(Response to stimulus), 징크-핑거(Zinc-finger), 단백질 전달(protein transport), 면역반응(immune response), MAPKinase 신호 경 로(MAPKinase signaling Pathway), WNT 신호 경로(WNT signaling pathway), 지방산 대사(fatty acid metabolism), 지질 대사(lipid metabolism), 사이토크롬에 의한 외부물질의 대사(metabolism of xenobiotics by cytochrome), 알코올 대사(Alcohol metabolism), DNA 손상 반응(response to DNA damage stimulus) 또는 갭 결합(Gap Junction) 등의 관련 유전자들이었다(표 2 및 표 3 참조). 상기 유전자들은 본 발명에서 사용한 나프탈렌을 처리했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.
본 발명자들은 상기 유전자 중 과발현된 유전자 24종과 저발현된 유전자 21종을 분리하여 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction) 방법으로 발현 양상을 조사하였다. 그 결과, 24종의 과발현 유전자들과 21종의 저발현 유전자의 발현 양상이 올리고마이크로어레이 칩 결과와 유사하게 나타남을 확인하였다(표 5 참조). 이들 유전자들은 유전자 등록번호(Genebank) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) BU945318(metallothionein 2A), 유전자 등록번호(Genebank) BM926478(Retinol binding protein 1, cellular), 유전자 등록번호(Genebank) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_003897(Immediate early response 3), 유전자 등록번호(Genebank) BC042390(Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) NM_017572(MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) NM_173481(Chromosome 19 open reading frame 21), 유전자 등록번호(Genebank) NM_032468(Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AY247738(Tribbles homolog 3(Drosophila)), 유전자 등록번호(Genebank) AK095363(Aquaporin 3), 유전자 등록번호(Genebank) AA669162(Adenosine monophosphate deaminase(isoform E)), 유전자 등록번호(Genebank) NM_003516(Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_080388(S100 calcium binding protein A16), 유전자 등록번호(Genebank) BX649164(serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_001013632(polo-like kinase 3(Drosophila)), 유전자 등록번호(Genebank) BQ683841(S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AK094474(Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_001769(CD9 antigen(p24)), 유전자 등록번호(Genebank) BC035124(MSFL2541), 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) AF167706(Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유전자 등록번호(Genebank) AB046861(KIAA1641), 유전자 등록번호(Genebank) BC068588(Similar to CG32820-PA, isoform A), 유전자 등록번호(Genebank) AY358727(UDP glucuronosyltransferase 2 family, polypeptide A3), 유전자 등록번호(Genebank) NM_017768(Leucine rich repeat containing 40), 유전자 등록번호(Genebank) AA074156(Transcribed locus, strongly similar to NP_032436.1 integral membrane protein 2B [Mus musculus]), 유전자 등록번호(Genebank) XM_291202(Zinc finger protein 479), 유전자 등록번호(Genebank) AB013380(ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) NM_180991(Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) BC022255(Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) BX640965(Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) CR600021(High-mobility group box 2), 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) AB091343(Centrosomal protein 55kDa), 유전자 등록번호(Genebank) BX640888(Glypican 6), 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) U65410(MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) NM_001067(Topoisomerase(DNA) II alpha 170kDa)이다.
또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보 가닥 분자가 집적된 나프탈렌에 대한 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다.
상기 올리고 뉴클레오티드 또는 이의 상보가닥 분자는 상기 바이오마커 유전자의 18 내지 30개의 핵산을 포함하고, 바람직하게는 20 내지 25개의 핵산을 포함한다.
본 발명의 나프탈렌 검색용 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판 상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 핀 형태의 스폿터인 마이크로어레이를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니며, 본 발명의 바람직한 실시예에서는 아미노-실란이 코팅된 슬라이드 글래스를 이용하였다.
또한, 본 발명은 상기 바이오마커를 이용한 나프탈렌에 대한 노출 여부를 확 인하는 방법을 제공한다.
본 발명은 하기와 같은 과정을 포함하는 나프탈렌에 대한 노출 여부를 확인하는 방법을 제공한다:
1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;
2) 단계 1)의 실험군과 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질을 표지하는 단계;
3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 DNA 마이크로어레이칩과 혼성화시키는 단계;
4) 단계 3)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및
5) 단계 4)의 분석한 데이터에서 본 발명의 바이오마커의 발현 정도를 대조군과 비교하여 확인하는 단계,
상기 노출 여부를 확인하는 방법에 있어서, 단계 1)의 체세포는 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포를 사용하는 것이 바람직하며, 인간 간암 세포주(HepG2)를 사용하는 것이 더욱 바람직하나 이에 한정되는 것은 아니다.
상기 노출 여부를 확인하는 방법에 있어서, 단계 2)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되어지는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.
상기 노출 여부를 확인하는 방법에 있어서, 단계 4)의 DNA 마이크로어레이 칩은 Whole Human Genome Oligo Microarray(Agilent, USA)등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 게놈 중 본 발명에서 상기 공통적으로 과발현 또는 저발현 유전자(표 2 및 포 3 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다. 또한, 단계 4)의 분석 방법은 GenePix 4.1 소프트웨어(Axon Instruments, USA)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.
또한, 본 발명은 하기와 같은 과정을 포함하는 나프탈렌에 대한 노출 여부를 확인하는 방법을 제공한다:
1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;
2) 단계 1)의 RNA를, 본 발명의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및
3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계,
상기 노출 여부를 확인하는 방법에 있어서, 단계 1)의 체세포는 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포를 사용하는 것이 바람직하며, 인간 간암 세포주(HepG2)를 사용하는 것이 더욱 바람직하나 이에 한정되는 것은 아니다.
상기 노출 여부를 확인하는 방법에 있어서, 단계 2)의 프라이머는 본 발명에서 탐색된 바이오마커 유전자와 상보적이고, 바이오마커를 증폭할 수 있는 프라이머라면 모두 사용가능하다. 본 발명에서는 서열번호 1 내지 90으로 기재되는 정방향 및 역방향의 프라이머 45쌍을 제시하였으나 이에 한정되는 것은 아니다.
아울러, 본 발명은 나프탈렌에 대한 노출 여부 확인용 키트를 제공한다.
본 발명은 상기 본 발명에서 제작한 DNA 마이크로어레이 칩을 포함하는 나프탈렌에 대한 노출 여부 확인용 키트를 제공한다.
상기 확인용 키트에 추가적으로 인간 간세포를 포함하는 나프탈렌에 대한 노출 여부 확인용 키트를 제공한다. 상기 인간 간세포는 HepG2를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.
상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 Cy3와 Cy5를 사용하였다.
상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표 식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.
상기 키트에 추가적으로 바이오마커 유전자에 상보적이고, 바이오마커 유전자를 증폭할 수 있는 프라이머를 포함시킬 수 있다. 상기 프라이머는 서열번호 1 내지 90으로 기재되는 서열로 구성된 군으로부터 선택되는 2개 이상의 정방향 및 역방향의 프라이머를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 상기 바이오마커 유전자에 상보적이며, 바이오마커 유전자를 증폭할 수 있으며 증폭산물이 100 내지 300bp가 되도록 설계된 정방향 및 역방향 프라이머쌍은 모두 사용 가능하다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1> 세포 배양 및 화학물질 처리
<1-1> 세포배양
인간 간암 세포주인 HepG2 세포(한국 세포주 은행)를 10% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배 양하였다. 본 발명자들은 기존의 연구와 보고를 통해 다환방향족 탄화수소류의 하나로서 발암성을 가지고 있는 물질인 나프탈렌을 선정하였으며, DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.
<1-2> 세포 독성 실험(
MTT
assay
) 및 화학 물질 처리
Mossman 등(J. Immunol. Methods, 65, 55-63, 1983)의 방법으로 HepG2 세포주를 이용한 MTT 실험을 수행하였다. 세포는 24-웰 플레이트에 4× 105/웰 세포수로 DMEM 배지(Gibro-BRL, USA)에서 DMSO에 용해된 나프탈렌을 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다. HepG2 세포주에서 나프탈렌의 세포독성을 살펴본 결과, 20% 생존율을 보이는 농도(IC20)는 1772.23 uM 이었으며(도 1), 상기 농도들로 결정하여 마이크로어레이 실험을 수행하였다.
<
실시예
2>
마이크로어레이
실험
<2-1> 표적
RNA
의 분리 및 형광 물질 표지
6 × 106 cell/㎖ 농도로 100 mm 디쉬에 HepG2 세포를 분주한 후, 상기 실시 예 <1-2>에서 결정된 나프탈렌의 농도를 48 시간 동안 처리하였다. 이후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하고, RNeasy mini kit(Qiagen, USA)를 사용하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농도는 Agilent 2100 Bioanalyzer(Agilent Technologies, USA)와 아가로스 젤 전기영동으로 확인하였다.
<2-2> 표지된 cDNA 제조
올리고 마이크로어레이 분석을 위하여 상기 실시예 <2-1>에서 수득한 나프탈렌 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)과 혼합하고 65℃에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 표 1과 같이 시약을 혼합하였다.
구성 | 부피(㎕) |
5X first strand buffer | 6 |
dNTPs | 0.6 |
0.1 M DDT | 3 |
SuperScript II enzyme | 3 |
Cy-3 or Cy-5 dUTP | 2 |
대조군인 HepG2 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 나프탈렌을 처리한 HepG2 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, USA)을 사용하여 혼합, 정제되었다.
<2-3>
혼성화
반응
혼성화 및 세척 과정은 지노첵(주)의 지시방법에 따라 수행되었다. 혼성화는 12시간 동안 62℃ 오븐에서 수행되었다. DNA 마이크로어레이 칩으로는 44 k Whole Human Genome Oligo Microarray(Agilent, USA)를 이용하였다. 세척(2분간 2× SSC/0.1% SDS에 세척, 3분간 1× SSC, 2분간 0.2× SSC에 세척) 후 슬라이드는 3분간 800 rpm으로 원심분리하여 건조하였다.
<2-4> 형광 이미지 획득
슬라이드 상의 혼성화 이미지는 Genepix 4000B(Axon Instruments, USA)로 스캔하였다. 결합하지 않은 유전자를 세척한 칩은 레이저 광 스캐너(laser fluorescence scanner)를 사용하여 형광 이미지를 획득하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미한다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 GenePix 4.1 소프트웨어(Axon Instruments, USA)로 분석하였다. 이렇게 하여 얻어진 데이터로부터 나프탈렌에 대한 마커 유전자를 선별하였다(도 2).
그 결과, 올리고 칩 상에 존재하는 대략 4만 4천 개의 유전자 중에서 나프탈렌에 의해 Cy5/Cy3의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 유전자는 0.86%(44,000개의 유전자 중 377개) 발현이 감소된 유전자는 0.71%(44,000개의 유전자 중 313개)임을 확인하였다.
이때, 나프탈렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 기능별로 분류한 결과, 세포 주기(cell cycle), 세포 성장(cell growth), 세포 이동(cell migration), 아팝토시스(apoptosis), 전사(transcription), 뉴클레오티드 결합(nucleotide binding), 금속원소 결합(metal binding), 자극에 대한 반응(Response to stimulus), 징크-핑거(Zinc-finger), 단백질 전달(protein transport), 면역반응(immune response), MAPKinase 신호 경로(MAPKinase signaling Pathway), WNT 신호 경로(WNT signaling pathway), 지방산 대사(fatty acid metabolism), 지질 대사(lipid metabolism), 사이토크롬에 의한 외부물질의 대사(metabolism of xenobiotics by cytochrome), 알코올 대사(Alcohol metabolism), DNA 손상 반응(response to DNA damage stimulus) 또는 갭 결합(Gap Junction)등의 관련 유전자로 선별되었다(표 2 및 3). 상기 유전자들은 본 발명에서 사용한 나프탈렌을 처리 했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.
등록번호 | 유전자약어 | 유전자명 | 중간값의비 |
(a) 아팝토시스 (Apoptosis) | |||
BC063507 | HSPA1B | Heat shock 70kDa protein 1B | 2.4357 |
NM_016639 | TNFRSF12A | Tumor necrosis factor receptor superfamily, member 12A | 2.1347 |
NM_033027 | AXUD1 | AXIN1 up-regulated 1 | 2.1402 |
AF332558 | BBC3 | BCL2 binding component 3 | 2.1291 |
NM_138639 | BCL2L12 | BCL2-like 12 (proline rich) | 2.1552 |
AK124526 | BCAR1 | Breast cancer anti-estrogen resistance 1 | 3.0875 |
NM_147780 | CTSB | Cathepsin B | 2.3656 |
AB209095 | CDC2L2 | Cell division cycle 2-like 2 (PITSLRE proteins) | 2.3134 |
AK128462 | CRR9 | Cisplatin resistance related protein CRR9p | 2.0288 |
NM_016222 | DDX41 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 | 2.0332 |
NM_022105 | DATF1 | Death inducer-obliterator 1 | 2.1301 |
AK127033 | DNM2 | Dynamin 2 | 2.4025 |
NM_152461 | ERN1 | Endoplasmic reticulum to nucleus signalling 1 | 2.8915 |
NM_003806 | HRK | Harakiri, BCL2 interacting protein (contains only BH3 domain) | 2.4428 |
NM_003897 | IER3 | Immediate early response 3 | 4.6678 |
NM_003639 | IKBKG | Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | 2.4820 |
BX640923 | MDM4 | Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse) | 2.3952 |
NM_002648 | PIM1 | Pim-1 oncogene | 2.4084 |
NM_003311 | PHLDA2 | Pleckstrin homology-like domain, family A, member 2 | 5.9649 |
NM_004309 | ARHGDIA | Rho GDP dissociation inhibitor (GDI) alpha | 2.2590 |
BC041022 | SCAND1 | SCAN domain containing 1 | 2.2502 |
NM_006282 | STK4 | Serine/threonine kinase 4 | 2.0747 |
AB005666 | SIPA1 | Signal-induced proliferation-associated gene 1 | 2.4776 |
NM_207111 | TRIAD3 | TRIAD3 protein | 2.1041 |
AY247738 | TRIB3 | Tribbles homolog 3 (Drosophila) | 3.6922 |
AF026071 | TNFRSF25 | Tumor necrosis factor receptor superfamily, member 25 | 2.8035 |
AB209485 | VEGF | Vascular endothelial growth factor | 2.0271 |
(b) 세포 주기 (Cell Cycle) | |||
CR606241 | ACTG1 | Actin, gamma 1 | 3.2399 |
NM_012127 | CIZ1 | CDKN1A interacting zinc finger protein 1 | 2.0297 |
AK057576 | CHFR | Checkpoint with forkhead and ring finger domains | 2.5193 |
NM_005255 | GAK | Cyclin G associated kinase | 2.3904 |
NM_078487 | CDKN2B | Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) | 2.4057 |
NM_001007271 | DUSP13 | Dual specificity phosphatase 13 | 2.1758 |
AK094316 | MAD2L2 | MAD2 mitotic arrest deficient-like 2 (yeast) | 2.1290 |
NM_002595 | PCTK2 | PCTAIRE protein kinase 2 | 2.4224 |
NM_000430 | PAFAH1B1 | Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa | 2.1603 |
X06374 | PDGFA | Platelet-derived growth factor alpha polypeptide | 3.1439 |
NM_001722 | POLR3D | Polymerase (RNA) III (DNA directed) polypeptide D, 44kDa | 2.0189 |
NM_002808 | PSMD2 | Proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 | 2.3245 |
BC038504 | SNF1LK | SNF1-like kinase | 2.3601 |
BC023552 | SFN | Stratifin | 2.6537 |
NM_000548 | TSC2 | Tuberous sclerosis 2 | 2.0129 |
AK223618 | ZBTB17 | Zinc finger and BTB domain containing 17 | 2.1258 |
(c) 세포 성장 (Cell Growth) | |||
BM556279 | EMP3 | Epithelial membrane protein 3 | 3.3902 |
AY258066 | OKL38 | Pregnancy-induced growth inhibitor | 2.1763 |
NM_001012661 | SLC3A2 | Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 | 2.2004 |
NM_014598 | SOCS7 | Suppressor of cytokine signaling 7 | 2.1492 |
(d) 세포 이동 (Cell Migration) | |||
NM_003873 | NRP1 | Neuropilin 1 | 2.6885 |
NM_015366 | FLJ20185 | Rho GTPase activating protein 8 | 2.0080 |
AB209322 | SEMA3B | Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B | 2.2752 |
(e) 갭 결합 (Gap Junction) | |||
AB209463 | CSNK1D | Casein kinase 1, delta | 2.2080 |
NM_005228 | EGFR | Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | 2.2413 |
BC089041 | GNA11 | Guanine nucleotide binding protein (G protein), alpha 11 (Gq class) | 2.1930 |
NM_002224 | ITPR3 | Inositol 1,4,5-triphosphate receptor, type 3 | 5.6827 |
(f) 면역 반응 (Immune Response) | |||
NM_012463 | ATP6V0A2 | ATPase, H+ transporting, lysosomal V0 subunit a isoform 2 | 2.4102 |
BQ053419 | BATF | Basic leucine zipper transcription factor, ATF-like | 3.1080 |
NM_000574 | DAF | Decay accelerating factor for complement (CD55, Cromer blood group system) | 2.0289 |
NM_001421 | ELF4 | E74-like factor 4 (ets domain transcription factor) | 2.4588 |
BG171626 | FTH1 | Ferritin, heavy polypeptide 1 | 2.0666 |
BM905227 | FTH1 | Ferritin, heavy polypeptide 1 | 2.0287 |
NM_001015053 | HDAC5 | Histone deacetylase 5 | 2.6617 |
NM_003641 | IFITM1 | Interferon induced transmembrane protein 1 (9-27) | 2.1200 |
AF200496 | IL1F7 | Interleukin 1 family, member 7 (zeta) | 2.0790 |
NM_000641 | IL11 | Interleukin 11 | 5.2920 |
NM_000565 | IL6R | Interleukin 6 receptor | 2.3392 |
NM_031483 | ITCH | Itchy homolog E3 ubiquitin protein ligase (mouse) | 2.2395 |
NM_001300 | KLF6 | Kruppel-like factor 6 | 2.5226 |
AB209647 | NCF2 | Neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | 4.0020 |
NM_017670 | OTUB1 | OTU domain, ubiquitin aldehyde binding 1 | 2.0192 |
NM_139276 | STAT3 | Signal transducer and activator of transcription 3 (acute-phase response factor) | 2.0518 |
NM_003037 | SLAMF1 | Signaling lymphocytic activation molecule family member 1 | 2.3215 |
AL832287 | ZAP70 | Zeta-chain (TCR) associated protein kinase 70kDa | 2.4777 |
(g) 자극에 대한 반응 (Response to Stimulus) | |||
NM_001353 | AKR1C1 | Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) | 1.8820 |
NM_001769 | CD9 | CD9 antigen (p24) | 2.0750 |
NM_005242 | F2RL1 | Coagulation factor II (thrombin) receptor-like 1 | 2.6078 |
AK095781 | CIRBP | Cold inducible RNA binding protein | 2.1195 |
X14789 | CRYAA | Crystallin, alpha A | 2.4242 |
Y11307 | CYR61 | Cysteine-rich, angiogenic inducer, 61 | 2.4270 |
NM_080927 | DCBLD2 | Discoidin, CUB and LCCL domain containing 2 | 2.1781 |
AY253982 | GPR54 | G protein-coupled receptor 54 | 2.4841 |
AF073799 | GALR3 | Galanin receptor 3 | 2.6980 |
BI767815 | GP9 | Glycoprotein IX (platelet) | 2.1523 |
NM_007353 | GNA12 | Guanine nucleotide binding protein (G protein) alpha 12 | 2.1696 |
CR623806 | HSPA6 | Heat shock 70kDa protein 6 (HSP70B') | 7.6428 |
NM_006597 | HSPA8 | Heat shock 70kDa protein 8 | 2.5025 |
AK000252 | FLJ20245 | Hypothetical protein FLJ20245 | 2.3061 |
AK057577 | IRF3 | Interferon regulatory factor 3 | 2.3088 |
L76191 | IRAK1 | Interleukin-1 receptor-associated kinase 1 | 2.1560 |
BC053882 | MT1X | Metallothionein 1X | 2.6535 |
AK124709 | NDRG1 | N-myc downstream regulated gene 1 | 2.1095 |
NM_002658 | PLAU | Plasminogen activator, urokinase | 2.1652 |
U02389 | PRSS15 | Protease, serine, 15 | 2.7031 |
NM_005053 | RAD23A | RAD23 homolog A (S. cerevisiae) | 2.8373 |
CD357517 | Unknown | Similar to Interferon-induced transmembrane protein 3 (Interferon-inducible protein 1-8U) | 2.1123 |
NM_032038 | SPINL | Spinster | 2.1857 |
H18681 | C20orf139 | Sulfiredoxin 1 homolog (S. cerevisiae) | 4.0214 |
BX648190 | WDR1 | WD repeat domain 1 | 2.6750 |
AK074035 | XAB2 | XPA binding protein 2 | 2.6705 |
(h) MAPKinase 신호 경로 (MAPKinase Signaling Pathway) | |||
NM_004364 | CEBPA | CCAAT/enhancer binding protein (C/EBP), alpha | 2.4652 |
NM_017572 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | 4.3055 |
Z25424 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | 2.4459 |
AB209586 | MAPK13 | Mitogen-activated protein kinase 13 | 2.4541 |
NM_030662 | MAP2K2 | Mitogen-activated protein kinase kinase 2 | 2.1398 |
AB208849 | SHC1 | SHC (Src homology 2 domain containing) transforming protein 1 | 2.2369 |
NM_138473 | SP1 | Sp1 transcription factor | 2.1287 |
X02812 | TGFB1 | Transforming growth factor, beta 1 (Camurati-Engelmann disease) | 5.3455 |
NM_002880 | RAF1 | V-raf-1 murine leukemia viral oncogene homolog 1 | 2.1696 |
(i) WNT 신호 경로 (WNT Signaling Pathway) | |||
NM_152221 | CSNK1E | Casein kinase 1, epsilon | 2.1055 |
AB209210 | DVL1 | Dishevelled, dsh homolog 1 (Drosophila) | 2.8905 |
NM_005438 | FOSL1 | FOS-like antigen 1 | 2.3658 |
AF077820 | LRP5 | Low density lipoprotein receptor-related protein 5 | 2.0509 |
NM_033119 | NKD1 | Naked cuticle homolog 1 (Drosophila) | 2.5071 |
AK090488 | PPP2R1A | Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform | 2.0154 |
AL834166 | TCF7 | Transcription factor 7 (T-cell specific, HMG-box) | 2.2472 |
AY009401 | WNT6 | Wingless-type MMTV integration site family, member 6 | 2.1735 |
(j) 심장 혈관 (Cardiovascular) | |||
BX649164 | PAI | serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 | 2.5347 |
BM913048 | TIMP1 | TIMP metallopeptidase inhibitor 1 | 8.2651 |
NM_003255 | TIMP2 | TIMP metallopeptidase inhibitor 2 | 2.6909 |
(k) 금속 결합 (Metal-Binding) | |||
NM_014595 | NT5C | 5', 3'-nucleotidase, cytosolic | 2.1024 |
AY461712 | ATP13A2 | ATPase type 13A2 | 2.0940 |
NM_018590 | GALNACT-2 | Chondroitin sulfate GalNAcT-2 | 2.0202 |
NM_080757 | C20orf127 | Chromosome 20 open reading frame 127 | 3.0514 |
X16866 | CYP2D7P1 | Cytochrome P450, family 2, subfamily D, polypeptide 6 | 1.5354 |
NM_000782 | CYP24A1 | Cytochrome P450, family 24, subfamily A, polypeptide 1 | 2.1807 |
AB002454 | CYP4F3 | Cytochrome P450, family 4, subfamily F, polypeptide 3 | 1.8791 |
AK096809 | CYP4F8 | Cytochrome P450, family 4, subfamily F, polypeptide 8 | 1.8150 |
NM_000786 | CYP51A1 | Cytochrome P450, family 51, subfamily A, polypeptide 1 | 2.0107 |
NM_017556 | FBLP-1 | Filamin binding LIM protein 1 | 2.7416 |
AK093560 | INPP1 | Inositol polyphosphate-1-phosphatase | 2.8551 |
NM_005578 | LPP | LIM domain containing preferred translocation partner in lipoma | 2.4354 |
AK222601 | MMP10 | Matrix metallopeptidase 10 (stromelysin 2) | 4.5500 |
NM_005947 | MT1B | Metallothionein 1B (functional) | 2.4288 |
BC048334 | MT1G | Metallothionein 1G | 2.3492 |
BI488702 | MT1K | Metallothionein 1M | 2.6949 |
NM_182924 | MICAL-L2 | MICAL-like 2 | 2.1021 |
AK127759 | NDUFS7 | NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase) | 2.1660 |
NM_203353 | PDLIM7 | PDZ and LIM domain 7 (enigma) | 2.5393 |
NM_002627 | PFKP | Phosphofructokinase, platelet | 2.2877 |
AA862994 | S100A3 | S100 calcium binding protein A3 | 2.5978 |
NM_003461 | ZYX | Zyxin | 2.8111 |
(l) 뉴클레오티드 결합 (Nucleotide Binding) | |||
NM_019112 | ABCA7 | ATP-binding cassette, sub-family A (ABC1), member 7 | 2.3438 |
AB209054 | ABCB6 | ATP-binding cassette, sub-family B (MDR/TAP), member 6 | 2.0426 |
U49248 | ABCC2 | ATP-binding cassette, sub-family C (CFTR/MRP), member 2 | 2.2186 |
NM_020038 | ABCC3 | ATP-binding cassette, sub-family C (CFTR/MRP), member 3 | 2.1296 |
BC025358 | ABCD1 | ATP-binding cassette, sub-family D (ALD), member 1 | 2.1904 |
NM_003992 | CLK3 | CDC-like kinase 3 | 2.1613 |
AK128154 | C9orf86 | Chromosome 9 open reading frame 86 | 2.0641 |
BC006404 | SKD3 | ClpB caseinolytic peptidase B homolog (E. coli) | 2.1818 |
BC067254 | COASY | Coenzyme A synthase | 2.0712 |
NM_004398 | DDX10 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 | 2.0691 |
BC038417 | DHX30 | DEAH (Asp-Glu-Ala-His) box polypeptide 30 | 2.2837 |
NM_138614 | DHX30 | DEAH (Asp-Glu-Ala-His) box polypeptide 30 | 2.2717 |
NM_032656 | DHX37 | DEAH (Asp-Glu-Ala-His) box polypeptide 37 | 2.1592 |
NM_020812 | DOCK6 | Dedicator of cytokinesis 6 | 2.1031 |
NM_004431 | EPHA2 | EPH receptor A2 | 2.5182 |
NM_001961 | EEF2 | Eukaryotic translation elongation factor 2 | 2.5914 |
NM_003751 | EIF3S9 | Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa | 2.2418 |
AF114818 | SIAHBP1 | Fuse-binding protein-interacting repressor | 2.3625 |
NM_019096 | GTPBP2 | GTP binding protein 2 | 2.1428 |
NM_006572 | GNA13 | Guanine nucleotide binding protein (G protein), alpha 13 | 2.3739 |
AK128226 | HK1 | Hexokinase 1 | 3.5070 |
BC069201 | FLJ22761 | Hexokinase domain containing 1 | 3.2441 |
NM_006546 | IMP-1 | IGF-II mRNA-binding protein 1 | 3.8699 |
NM_015155 | KIAA0217 | La ribonucleoprotein domain family, member 5 | 2.1035 |
NM_018357 | FLJ11196 | La ribonucleoprotein domain family, member 6 | 4.6953 |
AK127089 | MTHFD1L | Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like | 2.2572 |
XM_038150 | MAST3 | Microtubule associated serine/threonine kinase 3 | 2.2030 |
AB058686 | MYO15B | Myosin XVB pseudogene | 2.7025 |
BC027875 | MYO15B | Myosin XVB pseudogene | 2.1437 |
AK122664 | NRBP | Nuclear receptor binding protein | 2.1497 |
NM_001001852 | PIM3 | Pim-3 oncogene | 2.8912 |
BC094766 | PKN1 | Protein kinase N1 | 2.2451 |
AK094474 | RHOC | Ras homolog gene family, member C | 2.2466 |
NM_019034 | RHOF | Ras homolog gene family, member F (in filopodia) | 2.0637 |
NM_016084 | RASD1 | RAS, dexamethasone-induced 1 | 2.0911 |
AY369207 | RBPMS2 | RNA binding protein with multiple splicing 2 | 2.1833 |
BC069233 | SCYL1 | SCY1-like 1 (S. cerevisiae) | 2.0042 |
AB209553 | STK11 | Serine/threonine kinase 11 | 2.1115 |
AK124047 | C20orf119 | Similar to embryonic poly(A) binding protein | 2.5798 |
XM_496374 | LOC440595 | Similar to eukaryotic translation elongation factor 1 alpha 1 | 3.7535 |
NM_005094 | SLC27A4 | Solute carrier family 27 (fatty acid transporter), member 4 | 2.2003 |
NM_003330 | TXNRD1 | Thioredoxin reductase 1 | 3.7431 |
NM_025195 | TRIB1 | Tribbles homolog 1 (Drosophila) | 2.4698 |
BC009900 | UBE1 | Ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) | 2.0178 |
AF045458 | ULK1 | Unc-51-like kinase 1 (C. elegans) | 2.1305 |
X59303 | VARS2 | Valyl-tRNA synthetase | 2.8905 |
(m) 단백질 전달 (Protein Transport) | |||
AB209808 | AP1M1 | Adaptor-related protein complex 1, mu 1 subunit | 2.2744 |
AB208804 | AP3D1 | Adaptor-related protein complex 3, delta 1 subunit | 2.4371 |
BC000786 | ARFGAP1 | ADP-ribosylation factor GTPase activating protein 1 | 2.1516 |
AK125277 | APG4B | ATG4 autophagy related 4 homolog B (S. cerevisiae) | 2.0954 |
NM_007097 | CLTB | Clathrin, light polypeptide (Lcb) | 2.3501 |
AK091056 | COBRA1 | Cofactor of BRCA1 | 2.2297 |
AF349676 | COG3 | Component of oligomeric golgi complex 3 | 2.5958 |
AB002368 | XPO6 | Exportin 6 | 2.0361 |
BX648781 | GABARAPL1 | GABA(A) receptor-associated protein like 1 | 2.0637 |
AK123405 | GDI1 | GDP dissociation inhibitor 1 | 2.2754 |
NM_004712 | HGS | Hepatocyte growth factor-regulated tyrosine kinase substrate | 2.5054 |
AK094897 | IPO4 | Importin 4 | 2.2353 |
L38951 | KPNB1 | Karyopherin (importin) beta 1 | 2.5530 |
NM_002268 | KPNA4 | Karyopherin alpha 4 (importin alpha 3) | 2.4114 |
AY014403 | KIF13A | Kinesin family member 13A | 2.4062 |
NM_002867 | RAB3B | RAB3B, member RAS oncogene family | 3.7251 |
AK025300 | RANBP3 | RAN binding protein 3 | 2.2109 |
AB014551 | ARHGEF2 | Rho/rac guanine nucleotide exchange factor (GEF) 2 | 2.3320 |
CD049342 | RPL23 | Ribosomal protein L23 | 2.5856 |
NM_005843 | STAM2 | Signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 | 2.1286 |
NM_006809 | TOMM34 | Translocase of outer mitochondrial membrane 34 | 2.1012 |
BC047528 | TOMM40 | Translocase of outer mitochondrial membrane 40 homolog (yeast) | 2.1681 |
AK056701 | VPS11 | Vacuolar protein sorting 11 (yeast) | 2.0597 |
BC042390 | VTI1B | Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) | 4.4705 |
(n) 전사 (Transcription) | |||
AK095154 | AES | Amino-terminal enhancer of split | 2.4747 |
BC060828 | ARID3A | AT rich interactive domain 3A (BRIGHT- like) | 2.3563 |
NM_003670 | BHLHB2 | Basic helix-loop-helix domain containing, class B, 2 | 2.7959 |
NM_006442 | DRAP1 | DR1-associated protein 1 (negative cofactor 2 alpha) | 2.6142 |
NM_006532 | ELL | Elongation factor RNA polymerase II | 2.0523 |
NM_001991 | EZH1 | Enhancer of zeste homolog 1 (Drosophila) | 2.0169 |
U18018 | ETV4 | Ets variant gene 4 (E1A enhancer binding protein, E1AF) | 2.4208 |
NM_002018 | FLII | Flightless I homolog (Drosophila) | 2.2216 |
NM_181430 | FOXK2 | Forkhead box K2 | 2.1459 |
NM_001012426 | FOXP4 | Forkhead box P4 | 2.0507 |
BC053850 | FOXQ1 | Forkhead box Q1 | 2.0124 |
AF176422 | HEY1 | Hairy/enhancer-of-split related with YRPW motif 1 | 3.0373 |
BC078664 | HMGA1 | High mobility group AT-hook 1 | 5.3814 |
XM_379934 | KIAA1718 | KIAA1718 protein | 2.6486 |
BC069156 | LBX1 | Ladybird homeobox homolog 1 (Drosophila) | 2.2588 |
NM_014520 | MYBBP1A | MYB binding protein (P160) 1a | 2.2230 |
NM_002518 | NPAS2 | Neuronal PAS domain protein 2 | 2.5247 |
NM_001001716 | NFKBIB | Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta | 2.0983 |
AF087856 | NCOR1 | Nuclear receptor co-repressor 1 | 2.2704 |
NM_002653 | PITX1 | Paired-like homeodomain transcription factor 1 | 2.9461 |
NM_001003891 | PCQAP | PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein | 2.3417 |
NM_005035 | POLRMT | Polymerase (RNA) mitochondrial (DNA directed) | 2.4502 |
NM_012448 | STAT5B | Signal transducer and activator of transcription 5B | 2.0749 |
CR607342 | RNPS1 | Similar to splicing-related factor RNPS1 | 2.7373 |
NM_005986 | SOX1 | SRY (sex determining region Y)-box 1 | 2.2649 |
NM_003072 | SMARCA4 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 | 2.3172 |
NM_006951 | TAF5 | TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa | 2.7705 |
NM_152380 | TBX15 | T-box 15 | 2.0407 |
NM_016569 | TBX3 | T-box 3 (ulnar mammary syndrome) | 2.5060 |
BC006396 | TLX2 | T-cell leukemia, homeobox 2 | 2.5301 |
AF106934 | THRAP5 | Thyroid hormone receptor associated protein 5 | 2.0678 |
AF108461 | UBN1 | Ubinuclein 1 | 2.5683 |
NM_002359 | MAFG | V-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) | 2.4125 |
AK092414 | MAFK | V-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | 2.9903 |
(o) 징크-핑거 (Zinc-Finger) | |||
AK128553 | ZZANK1 | Mindbomb homolog 2 (Drosophila) | 2.3102 |
NM_001003694 | BRPF1 | Bromodomain and PHD finger containing, 1 | 2.0045 |
CR936799 | FHL2 | Four and a half LIM domains 2 | 2.7892 |
NM_139201 | GIT2 | G protein-coupled receptor kinase interactor 2 | 2.9299 |
AK125974 | p66alpha | GATA zinc finger domain containing 2A | 2.0077 |
CB050471 | GLI4 | GLI-Kruppel family member GLI4 | 2.4802 |
NM_006734 | HIVEP2 | Human immunodeficiency virus type I enhancer binding protein 2 | 2.7432 |
NM_031297 | DKFZP761H1710 | Hypothetical protein DKFZp761H1710 | 2.0282 |
NM_024671 | FLJ23436 | Hypothetical protein FLJ23436 | 2.7168 |
NM_173680 | MGC33584 | Hypothetical protein MGC33584 | 2.3686 |
NM_031918 | KLF16 | Kruppel-like factor 16 | 2.2288 |
BU163740 | MKRN1 | Makorin, ring finger protein, 1 | 2.2720 |
NM_005885 | MARCH-VI | Membrane-associated ring finger (C3HC4) 6 | 2.1710 |
AF242768 | LOC51333 | Mesenchymal stem cell protein DSC43 | 2.1850 |
NM_020774 | MIB1 | Mindbomb homolog 1 (Drosophila) | 3.2826 |
AJ007041 | MLL4 | Myeloid/lymphoid or mixed-lineage leukemia 4 | 2.6133 |
BF206103 | ZNF286 | Peroxisome proliferative activated receptor, alpha-like | 2.1100 |
BC008834 | PHF1 | PHD finger protein 1 | 2.2745 |
D87076 | PHF15 | PHD finger protein 15 | 2.3260 |
NM_020122 | KCMF1 | Potassium channel modulatory factor 1 | 2.2368 |
NM_145214 | TRIM11 | Tripartite motif-containing 11 | 2.4353 |
NM_033452 | TRIM47 | Tripartite motif-containing 47 | 2.1489 |
AF281046 | TRIM8 | Tripartite motif-containing 8 | 2.1328 |
BC004256 | ZNF259 | Zinc finger protein 259 | 2.1638 |
CR597101 | ZFP36 | Zinc finger protein 36, C3H type, homolog (mouse) | 2.0256 |
NM_198055 | ZNF42 | Zinc finger protein 42 (myeloid-specific retinoic acid-responsive) | 2.4424 |
BC071620 | ZNF581 | Zinc finger protein 581 | 2.9613 |
BM544755 | ZNF593 | Zinc finger protein 593 | 2.2741 |
AK024487 | ZNF598 | Zinc finger protein 598 | 2.4525 |
BC089449 | ZEC | Zinc finger protein 628 | 3.2540 |
NM_153813 | ZFPM1 | Zinc finger protein, multitype 1 | 2.8352 |
BM451410 | ZA20D2 | Zinc finger, A20 domain containing 2 | 2.7639 |
BX648551 | ZA20D2 | Zinc finger, A20 domain containing 2 | 2.3342 |
BC006340 | ZCCHC2 | Zinc finger, CCHC domain containing 2 | 2.1475 |
BC053544 | ZDHHC8 | Zinc finger, DHHC-type containing 8 | 3.2750 |
(p) 대사 (Metabolism) | |||
NM_000499 | CYP1A1 | Cytochrome P450, family 1, subfamily A, polypeptide 1 | 1.6642 |
BQ939577 | AKR1C3 | Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) | 1.7959 |
BC020744 | AKR1C4 | Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) | 1.9104 |
AB045292 | TMEM8 | Transmembrane protein 8 (five membrane-spanning domains) | 2.7291 |
NM_012088 | PGLS | 6-phosphogluconolactonase | 2.0756 |
NM_184041 | ALDOA | Aldolase A, fructose-bisphosphate | 2.8600 |
NM_000402 | G6PD | Glucose-6-phosphate dehydrogenase | 2.5537 |
NM_006715 | MAN2C1 | Mannosidase, alpha, class 2C, member 1 | 2.1585 |
CR597860 | C19orf27 | Chromosome 19 open reading frame 27 | 2.0738 |
AK091948 | LTB4DH | Leukotriene B4 12-hydroxydehydrogenase | 2.1620 |
BC042195 | MT | Malonyl-CoA:acyl carrier protein transacylase, mitochondrial | 2.5698 |
BC035124 | UNQ2541 | MSFL2541 | 2.0030 |
AK057049 | PTGES2 | Prostaglandin E synthase 2 | 2.2937 |
AB046825 | GBA2 | Glucosidase, beta (bile acid) 2 | 2.1836 |
BC033110 | HSD17B1 | Hydroxysteroid (17-beta) dehydrogenase 1 | 2.2021 |
BC050553 | NTE | Neuropathy target esterase | 2.0635 |
NM_007169 | PEMT | Phosphatidylethanolamine N-methyltransferase | 2.3922 |
NM_005028 | PIP5K2A | Phosphatidylinositol-4-phosphate 5-kinase, type II, alpha | 2.1013 |
BC007612 | PSAP | Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) | 2.2731 |
BC087612 | SBF1 | SET binding factor 1 | 2.7731 |
BQ683841 | S100A11 | S100 calcium binding protein A11 (calgizzarin) | 2.4391 |
CK000930 | HIST1H2AI | Histone 1, H2ai | 2.1816 |
NM_003516 | HIST2H2AA | Histone 2, H2aa | 2.7899 |
BC069193 | HIST2H2BE | Histone 2, H2be | 2.1012 |
AK223291 | MMP3 | Matrix metallopeptidase 3 (stromelysin 1, progelatinase) | 17.8294 |
NM_178819 | DKFZp586M1819 | 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) | 2.0691 |
NM_018694 | ARL6IP4 | ADP-ribosylation-like factor 6 interacting protein 4 | 2.0069 |
BC014895 | MGC10204 | Aldehyde dehydrogenase 16 family, member A1 | 2.0489 |
NM_032468 | ASPH | Aspartate beta-hydroxylase | 3.9487 |
BC008751 | CAPN1 | Calpain 1, (mu/I) large subunit | 2.2634 |
AK128552 | CAPN10 | Calpain 10 | 2.1500 |
AK124751 | CAPN2 | Calpain 2, (m/II) large subunit | 2.8972 |
NM_001903 | CTNNA1 | Catenin (cadherin-associated protein), alpha 1, 102kDa | 2.1134 |
BC067289 | CTSL2 | Cathepsin L2 | 2.1645 |
NM_015151 | C21orf106 | Chromosome 21 open reading frame 106 | 2.3953 |
NM_031434 | C7orf21 | Chromosome 7 open reading frame 21 | 2.7044 |
NM_001303 | COX10 | COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) | 2.1768 |
BP317375 | COX6A2 | Cytochrome c oxidase subunit VIa polypeptide 2 | 2.0748 |
NM_001355 | DDT | D-dopachrome tautomerase | 2.1380 |
NM_032482 | DOT1L | DOT1-like, histone H3 methyltransferase (S. cerevisiae) | 3.0258 |
NM_004419 | DUSP5 | Dual specificity phosphatase 5 | 4.2893 |
AB210013 | EIF4G1 | Eukaryotic translation initiation factor 4 gamma, 1 | 2.1430 |
NM_020158 | EXOSC5 | Exosome component 5 | 2.4434 |
NM_178225 | FBXW5 | F-box and WD-40 domain protein 5 | 2.4381 |
NM_058229 | FBXO32 | F-box protein 32 | 2.5325 |
AB209592 | GMPPA | GDP-mannose pyrophosphorylase A | 2.0382 |
AJ002231 | GNPDA1 | Glucosamine-6-phosphate deaminase 1 | 2.0840 |
AK094940 | GCLC | Glutamate-cysteine ligase, catalytic subunit | 2.0800 |
NM_005318 | H1F0 | H1 histone family, member 0 | 2.2238 |
NM_004639 | BAT3 | HLA-B associated transcript 3 | 2.0966 |
NM_032717 | MGC11324 | Hypothetical protein MGC11324 | 3.1893 |
BX647357 | IDS | Iduronate 2-sulfatase (Hunter syndrome) | 2.2961 |
AY923172 | KLK13 | Kallikrein 13 | 2.0529 |
AK023137 | MGAT4B | Mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B | 2.1114 |
NM_024864 | FLJ22578 | Mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) | 2.0371 |
NM_153006 | NAGS | N-acetylglutamate synthase | 2.4751 |
NM_020230 | PPAN | Peter pan homolog (Drosophila) | 2.2372 |
BC017045 | PYGB | Phosphorylase, glycogen; brain | 2.1455 |
NM_005401 | PTPN14 | Protein tyrosine phosphatase, non-receptor type 14 | 2.9347 |
AF290614 | PTPN23 | Protein tyrosine phosphatase, non-receptor type 23 | 2.2544 |
BX648253 | PTPN3 | Protein tyrosine phosphatase, non-receptor type 3 | 2.1766 |
NM_002840 | PTPRF | Protein tyrosine phosphatase, receptor type, F | 2.1548 |
D15049 | PTPRH | Protein tyrosine phosphatase, receptor type, H | 2.4000 |
AF348492 | RBAF600 | Retinoblastoma-associated factor 600 | 2.0158 |
BM926478 | RBP1 | Retinol binding protein 1, cellular | 5.9460 |
AB209196 | RNH | Ribonuclease/angiogenin inhibitor 1 | 2.3179 |
CR619918 | RPL18A | Ribosomal protein L18a | 2.0237 |
BM553074 | RPS15A | Ribosomal protein S15a | 2.1388 |
CD387408 | RPS28 | Ribosomal protein S28 | 2.1116 |
CR749837 | RPS7 | Ribosomal protein S7 | 3.8230 |
BM805682 | EEF1D | Similar to eukaryotic translation elongation factor 1 delta isoform 1; guanine nucleotide exchange protein | 2.0044 |
XM_069734 | LOC136143 | Similar to ribosomal protein L18; 60S ribosomal protein L18 | 2.1716 |
BG186194 | RPS24 | Similar to ribosomal protein S24 | 2.1725 |
AB037719 | SSH1 | Slingshot homolog 1 (Drosophila) | 2.0236 |
NM_005415 | SLC20A1 | Solute carrier family 20 (phosphate transporter), member 1 | 2.6617 |
BF680536 | SAT | Spermidine/spermine N1-acetyltransferase | 2.0666 |
AK127286 | SMOX | Spermine oxidase | 2.2385 |
NM_005877 | SF3A1 | Splicing factor 3a, subunit 1, 120kDa | 2.5405 |
AF082557 | TNKS | Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase | 2.2491 |
BC002856 | TXNDC11 | Thioredoxin domain containing 11 | 2.0276 |
NM_017722 | FLJ20244 | TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) | 2.2575 |
AK023077 | USP36 | Ubiquitin specific peptidase 36 | 2.0848 |
NM_080605 | B3GALT6 | UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 | 2.3174 |
AY358955 | B3GNT3 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 | 2.9013 |
AK074143 | UAP1L1 | UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 | 2.2174 |
BC007348 | UPP1 | Uridine phosphorylase 1 | 3.2254 |
BC047030 | UPP1 | Uridine phosphorylase 1 | 4.2413 |
(q) 기타(TheOthers) | |||
AK095363 | AQP3 | Aquaporin 3 | 2.9486 |
NM_022153 | PP2135 | Chromosome 10 open reading frame 54 | 2.6192 |
NM_004864 | GDF15 | Growth differentiation factor 15 | 4.7569 |
BU945318 | MT2A | Hypothetical gene supported by X97260; BC070289 | 5.2013 |
BX537968 | LOC51149 | Hypothetical LOC51149 | 4.0784 |
NM_080388 | S100A16 | S100 calcium binding protein A16 | 2.6299 |
NM_001013632 | LOC343521 | Similar to hypothetical protein 4833401D15 | 2.5106 |
XM_371474 | PLXNB2 | Plexin B2 | 2.0885 |
BC050636 | FLJ14249 | HS1-binding protein 3 | 2.3649 |
NM_004699 | FAM50A | Family with sequence similarity 50, member A | 2.1704 |
AY368150 | CHR2SYT | Family with sequence similarity 62 (C2 domain containing) member B | 2.1260 |
등록번호 | 유전자약어 | 유전자명 | 중간값의비 |
(a) 아팝토시스 (Apoptosis) | |||
AF130077 | ALB | Albumin | 0.2470 |
NM_021631 | FKSG2 | Apoptosis inhibitor | 0.4863 |
AF143236 | C17orf88 | Apoptosis related protein | 0.4860 |
NM_001621 | AHR | Aryl hydrocarbon receptor | 0.4324 |
AB209123 | BIRC1 | Baculoviral IAP repeat-containing 1 | 0.4711 |
NM_001165 | BIRC3 | Baculoviral IAP repeat-containing 3 | 0.3259 |
NM_001167 | BIRC4 | Baculoviral IAP repeat-containing 4 | 0.3782 |
AW872828 | BIRC6 | Baculoviral IAP repeat-containing 6 (apollon) | 0.3599 |
AU146963 | BCL2 | B-cell CLL/lymphoma 2 | 0.3712 |
NM_004331 | BNIP3L | BCL2/adenovirus E1B 19kDa interacting protein 3-like | 0.4869 |
NM_001015049 | BAG5 | BCL2-associated athanogene 5 | 0.2893 |
NM_014739 | BCLAF1 | BCL2-associated transcription factor 1 | 0.3343 |
L33477 | HSPD1 | Cadherin 12, type 2 (N-cadherin 2) | 0.3494 |
NM_001904 | CTNNB1 | Catenin (cadherin-associated protein), beta 1, 88kDa | 0.4256 |
NM_005894 | CD5L | CD5 antigen-like (scavenger receptor cysteine rich family) | 0.4761 |
AK124173 | FLJ42179 | CDNA FLJ42179 fis, clone THYMU2030796 | 0.3375 |
AB209095 | CDC2L2 | Cell division cycle 2-like 2 (PITSLRE proteins) | 0.3329 |
AK128462 | CRR9 | Cisplatin resistance related protein CRR9p | 0.4465 |
NM_016424 | CROP | Cisplatin resistance-associated overexpressed protein | 0.4535 |
NM_003478 | CUL5 | Cullin 5 | 0.4738 |
NM_018947 | CYCS | Cytochrome c, somatic | 0.3804 |
BC048797 | DFFB | DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) | 0.4218 |
AB209361 | FAS | Fas (TNF receptor superfamily, member 6) | 0.4189 |
NM_006144 | GZMA | Granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) | 0.2852 |
BC013326 | GAS2 | Growth arrest-specific 2 | 0.1826 |
AK122825 | HMGB1 | High-mobility group box 1 | 0.4168 |
NM_005338 | HIP1 | Huntingtin interacting protein 1 | 0.4582 |
AK026927 | MGC5297 | Hypothetical protein MGC5297 | 0.4848 |
AB208909 | ITGB2 | Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) | 0.4052 |
AF208043 | IFI16 | Interferon, gamma-inducible protein 16 | 0.2579 |
BX648731 | JMY | Junction-mediating and regulatory protein | 0.4546 |
AK122614 | PPARD | Peroxisome proliferative activated receptor, delta | 0.3613 |
NM_000314 | PTEN | Phosphatase and tensin homolog (mutated in multiple advanced cancers 1) | 0.3736 |
BC047362 | PHLDA1 | Pleckstrin homology-like domain, family A, member 1 | 0.4627 |
BX537500 | PDCD4 | Programmed cell death 4 (neoplastic transformation inhibitor) | 0.4064 |
NM_013374 | PDCD6IP | Programmed cell death 6 interacting protein | 0.3143 |
NM_005400 | PRKCE | Protein kinase C, epsilon | 0.4773 |
CR621593 | PRG2 | Proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) | 0.4124 |
BC041849 | ROCK1 | Rho-associated, coiled-coil containing protein kinase 1 | 0.4088 |
NM_000582 | SPP1 | Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1) | 0.4494 |
BC039110 | SMNDC1 | Survival motor neuron domain containing 1 | 0.3637 |
AB209211 | TIA1 | TIA1 cytotoxic granule-associated RNA binding protein | 0.4163 |
AF520785 | TNFSF15 | Tumor necrosis factor (ligand) superfamily, member 15 | 0.4626 |
NM_002546 | TNFRSF11B | Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) | 0.4829 |
NM_148957 | TNFRSF19 | Tumor necrosis factor receptor superfamily, member 19 | 0.4213 |
NM_006290 | TNFAIP3 | Tumor necrosis factor, alpha-induced protein 3 | 0.4765 |
AK125880 | TP53INP1 | Tumor protein p53 inducible nuclear protein 1 | 0.2437 |
AB209534 | TRA1 | Tumor rejection antigen (gp96) 1 | 0.3700 |
NM_012479 | YWHAG | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | 0.4668 |
AB096256 | UNC5B | Unc-5 homolog B (C. elegans) | 0.3575 |
AF055634 | UNC5C | Unc-5 homolog C (C. elegans) | 0.2450 |
AK122953 | VDAC1 | Voltage-dependent anion channel 1 | 0.3437 |
(b) 세포 주기 (Cell Cycle) | |||
NM_019001 | XRN1 | 5'-3' exoribonuclease 1 | 0.4600 |
BC016344 | ACPP | Acid phosphatase, prostate | 0.2091 |
BM921310 | ANAPC10 | Anaphase promoting complex subunit 10 | 0.2038 |
NM_153186 | ANKRD15 | Ankyrin repeat domain 15 | 0.4849 |
AY367065 | ASPM | Asp (abnormal spindle)-like, microcephaly associated (Drosophila) | 0.4239 |
NM_004071 | CLK1 | CDC-like kinase 1 | 0.4302 |
CR933728 | CDC2 | Cell division cycle 2, G1 to S and G2 to M | 0.3888 |
NM_044472 | CDC42 | Cell division cycle 42 (GTP binding protein, 25kDa) | 0.3824 |
NM_004365 | CETN3 | Centrin, EF-hand protein, 3 (CDC31 homolog, yeast) | 0.3285 |
NM_016343 | CENPF | Centromere protein F, 350/400ka (mitosin) | 0.4456 |
BC050310 | C10orf9 | Chromosome 10 open reading frame 9 | 0.4646 |
NM_016446 | C9orf127 | Chromosome 9 open reading frame 127 | 0.4651 |
AY257469 | CIT | Citron (rho-interacting, serine/threonine kinase 21) | 0.3644 |
NM_001761 | CCNF | Cyclin F | 0.2478 |
NM_004354 | CCNG2 | Cyclin G2 | 0.2704 |
NM_004064 | CDKN1B | Cyclin-dependent kinase inhibitor 1B (p27, Kip1) | 0.2642 |
NM_007068 | DMC1 | DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) | 0.4227 |
AK025142 | BPA | dystonin | 0.3491 |
NM_001950 | E2F4 | E2F transcription factor 4, p107/p130-binding | 0.4681 |
NM_019063 | EML4 | Echinoderm microtubule associated protein like 4 | 0.4562 |
AJ245671 | EGFL6 | EGF-like-domain, multiple 6 | 0.4019 |
NM_004450 | ERH | Enhancer of rudimentary homolog (Drosophila) | 0.4927 |
AL832041 | ESCO1 | Establishment of cohesion 1 homolog 1 (S. cerevisiae) | 0.4949 |
AL832666 | ESCO2 | Establishment of cohesion 1 homolog 2 (S. cerevisiae) | 0.4188 |
AK126048 | FLJ44060 | FLJ44060 protein | 0.4358 |
BI494022 | GRLF1 | Glucocorticoid receptor DNA binding factor 1 | 0.4778 |
NM_000189 | HK2 | Hexokinase 2 | 0.4716 |
NM_014707 | HDAC9 | Histone deacetylase 9 | 0.4727 |
BC067253 | FLJ40432 | Hypothetical protein FLJ40432 | 0.4450 |
AL834276 | MGC3207 | Hypothetical protein MGC3207 | 0.2939 |
NM_006101 | KNTC2 | Kinetochore associated 2 | 0.3694 |
NM_014751 | MTSS1 | Metastasis suppressor 1 | 0.3809 |
BC040410 | MAPRE1 | Microtubule-associated protein, RP/EB family, member 1 | 0.3533 |
AB033337 | MPHOSPH1 | M-phase phosphoprotein 1 | 0.4700 |
L20321 | NEK4 | NIMA (never in mitosis gene a)-related kinase 4 | 0.3915 |
AJ627032 | NIPBL | Nipped-B homolog (Drosophila) | 0.3828 |
AL575067 | NUDC | Nuclear distribution gene C homolog (A. nidulans) | 0.2686 |
NM_003884 | PCAF | P300/CBP-associated factor | 0.4576 |
AL833922 | PAPD5 | PAP associated domain containing 5 | 0.2823 |
NM_018492 | PBK | PDZ binding kinase | 0.4655 |
NM_016205 | PDGFC | Platelet derived growth factor C | 0.3932 |
NM_000430 | PAFAH1B1 | Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa | 0.4222 |
NM_006259 | PRKG2 | Protein kinase, cGMP-dependent, type II | 0.1950 |
NM_002709 | PPP1CB | Protein phosphatase 1, catalytic subunit, beta isoform | 0.4052 |
NM_003463 | PTP4A1 | Protein tyrosine phosphatase type IVA, member 1 | 0.3644 |
BX647606 | PTMA | Prothymosin, alpha (gene sequence 28) | 0.2509 |
BC068483 | RINT-1 | Rad50-interacting protein 1 | 0.2983 |
NM_006325 | RAN | RAN, member RAS oncogene family | 0.2802 |
NM_213590 | RFP2 | Ret finger protein 2 | 0.4913 |
NM_006910 | RBBP6 | Retinoblastoma binding protein 6 | 0.4444 |
BC060806 | RECK | Reversion-inducing-cysteine-rich protein with kazal motifs | 0.4205 |
BX648668 | RECK | Reversion-inducing-cysteine-rich protein with kazal motifs | 0.2887 |
AB208875 | SEPTIN10 | Septin 10 | 0.2853 |
AB209677 | SEPTIN7 | Septin 7 | 0.4812 |
BX649128 | SESN3 | Sestrin 3 | 0.2184 |
XM_497098 | LOC441488 | Similar to Transcription factor Dp-1 (E2F dimerization partner 1) (DRTF1-polypeptide-1) (DRTF1) | 0.3507 |
AK131071 | SLC31A2 | Solute carrier family 31 (copper transporters), member 2 | 0.4756 |
NM_006930 | SKP1A | S-phase kinase-associated protein 1A (p19A) | 0.4155 |
NM_006542 | SPHAR | S-phase response (cyclin-related) | 0.3856 |
BX647885 | STMN1 | Stathmin 1/oncoprotein 18 | 0.4937 |
NM_014574 | STRN3 | Striatin, calmodulin binding protein 3 | 0.2821 |
NM_003176 | SYCP1 | Synaptonemal complex protein 1 | 0.4556 |
BM674777 | TARDBP | TAR DNA binding protein | 0.3287 |
NM_007375 | TARDBP | TAR DNA binding protein | 0.3780 |
NM_006701 | TXNL4A | Thioredoxin-like 4A | 0.4847 |
NM_030756 | TCF7L2 | Transcription factor 7-like 2 (T-cell specific, HMG-box) | 0.1645 |
NM_003318 | TTK | TTK protein kinase | 0.4857 |
NM_000368 | TSC1 | Tuberous sclerosis 1 | 0.4235 |
NM_006826 | YWHAQ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | 0.2534 |
NM_001032410 | USP16 | Ubiquitin specific peptidase 16 | 0.4931 |
AK095164 | KRAS2 | V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog | 0.4194 |
(c) DNA 손상에 대한 반응 (Response to DNA Damage Stimulus) | |||
NM_138271 | ATRX | Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) | 0.3074 |
AK025738 | ASF1A | ASF1 anti-silencing function 1 homolog A (S. cerevisiae) | 0.2657 |
AK074377 | UHRF1 | Chromosome 19 open reading frame 31 | 0.3053 |
AK125915 | CRY1 | Cryptochrome 1 (photolyase-like) | 0.4796 |
S62138 | DDIT3 | DNA-damage-inducible transcript 3 | 0.4310 |
DQ140356 | KIAA1596 | Fanconi anemia, complementation group M | 0.2500 |
CR600021 | HMGB2 | High-mobility group box 2 | 0.3350 |
CR936783 | FLJ40869 | Hypothetical protein LOC284952 | 0.3425 |
NM_002431 | MNAT1 | Menage a trois 1 (CAK assembly factor) | 0.4085 |
BC032617 | POLI | Polymerase (DNA directed) iota | 0.2253 |
NM_002690 | POLB | Polymerase (DNA directed), beta | 0.3335 |
AK025631 | POLH | Polymerase (DNA directed), eta | 0.4675 |
BC038996 | PMS2L1 | Postmeiotic segregation increased 2-like 1 | 0.3834 |
BM462208 | PCNA | Proliferating cell nuclear antigen | 0.2993 |
NM_020165 | RAD18 | RAD18 homolog (S. cerevisiae) | 0.4502 |
NM_152442 | RAD9B | RAD9 homolog B (S. cerevisiae) | 0.3773 |
NM_018151 | RIF1 | RAP1 interacting factor homolog (yeast) | 0.2385 |
AI281523 | SFPQ | Splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated) | 0.4114 |
AK057830 | TOM1L2 | Target of myb1-like 2 (chicken) | 0.2985 |
NM_001012716 | TYMS | Thymidylate synthetase | 0.4997 |
NM_001071 | TYMS | Thymidylate synthetase | 0.4794 |
NM_003368 | USP1 | Ubiquitin specific peptidase 1 | 0.4284 |
AK094617 | UBE2V2 | Ubiquitin-conjugating enzyme E2 variant 2 | 0.4544 |
NM_003337 | UBE2B | Ubiquitin-conjugating enzyme E2B (RAD6 homolog) | 0.4379 |
(d) 대사 (Metabolism) | |||
CD013992 | GSTT2 | Glutathione S-transferase theta 2 | 0.4194 |
J05428 | UGT2B7 | UDP glucuronosyltransferase 2 family, polypeptide B7 | 0.2638 |
NM_000847 | GSTA3 | Glutathione S-transferase A3 | 0.4806 |
M15943 | ADH4 | Alcohol dehydrogenase 4 (class II), pi polypeptide | 0.4973 |
NM_017460 | CYP3A4 | Cytochrome P450, family 3, subfamily A, polypeptide 4 | 0.3676 |
BC039065 | ADH6 | Alcohol dehydrogenase 6 (class V) | 0.4063 |
NM_000671 | ADH5 | Alcohol dehydrogenase 5 (class III), chi polypeptide | 0.4334 |
NM_000667 | ADH1A | Alcohol dehydrogenase 1A (class I), alpha polypeptide | 0.4657 |
BI762502 | GSTA2 | Glutathione S-transferase A2 | 0.3989 |
NM_000690 | ALDH2 | Aldehyde dehydrogenase 2 family (mitochondrial) | 0.2932 |
NM_000696 | ALDH9A1 | Aldehyde dehydrogenase 9 family, member A1 | 0.4254 |
AK093311 | ACAA2 | Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) | 0.2830 |
NM_004457 | ACSL3 | Acyl-CoA synthetase long-chain family member 3 | 0.2528 |
NM_000016 | ACADM | Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain | 0.2904 |
BC033517 | ACOX2 | Acyl-Coenzyme A oxidase 2, branched chain | 0.3508 |
Z28339 | AKR1D1 | Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) | 0.3142 |
NM_000384 | APOB | Apolipoprotein B (including Ag(x) antigen) | 0.3541 |
AF285167 | ABCA1 | ATP-binding cassette, sub-family A (ABC1), member 1 | 0.3587 |
NM_000236 | LIPC | Lipase, hepatic | 0.3989 |
AK124635 | PCSK9 | Proprotein convertase subtilisin/kexin type 9 | 0.3387 |
NM_003101 | SOAT1 | Sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 | 0.3811 |
T81314 | MBTPS1 | Transcribed locus | 0.4962 |
NM_147156 | TMEM23 | Transmembrane protein 23 | 0.4514 |
(e) 단백질 전달 (Protein Transport) | |||
NM_003916 | AP1S2 | Adaptor-related protein complex 1, sigma 2 subunit | 0.3059 |
AA298150 | AP3S1 | Adaptor-related protein complex 3, sigma 1 subunit | 0.3585 |
AL109702 | AP3S2 | Adaptor-related protein complex 3, sigma 2 subunit | 0.4502 |
BU620136 | AP4S1 | Adaptor-related protein complex 4, sigma 1 subunit | 0.2439 |
NM_001025595 | ARFIP1 | ADP-ribosylation factor interacting protein 1 (arfaptin 1) | 0.3191 |
NM_203437 | AFTIPHILIN | Aftiphilin protein | 0.4755 |
NM_006380 | APPBP2 | Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 | 0.3886 |
BM683433 | AP1GBP1 | AP1 gamma subunit binding protein 1 | 0.3501 |
AK027773 | APG4C | ATG4 autophagy related 4 homolog C (S. cerevisiae) | 0.4213 |
AF130117 | CRBN | Cereblon | 0.3682 |
NM_001821 | CHML | Choroideremia-like (Rab escort protein 2) | 0.4712 |
AK002165 | DKFZP564O123 | Chromatin modifying protein 2B | 0.4386 |
NM_152284 | Shax3 | Chromatin modifying protein 4C | 0.3795 |
AW167080 | SNF7DC2 | Chromatin modifying protein 5 | 0.3159 |
BF790759 | SNF7DC2 | Chromatin modifying protein 5 | 0.4922 |
NM_018229 | C14orf108 | Chromosome 14 open reading frame 108 | 0.4247 |
AF130062 | CLTC | Clathrin, heavy polypeptide (Hc) | 0.2665 |
AF273058 | CTAGE1 | Cutaneous T-cell lymphoma-associated antigen 1 | 0.3957 |
AK023846 | DER1 | Der1-like domain family, member 1 | 0.4283 |
NM_145261 | TIM14 | DnaJ (Hsp40) homolog, subfamily C, member 19 | 0.4200 |
AF447177 | GNG10 | DnaJ-like protein | 0.4710 |
NM_004125 | GNG10 | DnaJ-like protein | 0.3898 |
NM_015171 | XPO6 | Exportin 6 | 0.2979 |
CA306634 | GTF2H3 | General transcription factor IIH, polypeptide 3, 34kDa | 0.3048 |
M57609 | GLI3 | GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) | 0.4337 |
BC047660 | FLJ25422 | Hypothetical protein FLJ25422 | 0.2848 |
BC035090 | KPNA3 | Karyopherin alpha 3 (importin alpha 4) | 0.4743 |
AK093917 | KDELR2 | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 | 0.4578 |
NM_173827 | FLJ38991 | Mitochondrial COX18 | 0.3888 |
NM_018698 | NXT2 | Nuclear transport factor 2-like export factor 2 | 0.4276 |
BC039468 | NUP50 | Nucleoporin 50kDa | 0.3488 |
BC032755 | PEX13 | Peroxisome biogenesis factor 13 | 0.4637 |
AK023223 | RAB10 | RAB10, member RAS oncogene family | 0.4531 |
AL162081 | RAB14 | RAB14, member RAS oncogene family | 0.2783 |
AB209698 | RAB18 | RAB18, member RAS oncogene family | 0.4513 |
NM_031296 | RAB33B | RAB33B, member RAS oncogene family | 0.2729 |
BC014553 | RAB3IP | RAB3A interacting protein (rabin3) | 0.1542 |
NM_198490 | RAB43 | RAB43, member RAS oncogene family | 0.4308 |
NM_004162 | RAB5A | RAB5A, member RAS oncogene family | 0.4350 |
AL136727 | RAB6C | RAB6C, member RAS oncogene family | 0.4727 |
NM_016530 | RAB8B | RAB8B, member RAS oncogene family | 0.4640 |
NM_006267 | RANBP2 | RAN binding protein 2 | 0.3676 |
NM_020150 | SARA1 | SAR1 gene homolog A (S. cerevisiae) | 0.3393 |
AA418814 | SEC22L1 | SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) | 0.3155 |
AA484677 | SEC22L1 | SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) | 0.2672 |
NM_031216 | SEH1L | SEH1-like (S. cerevisiae) | 0.3862 |
BC064351 | SRP9 | Signal recognition particle 9kDa | 0.1788 |
NM_005843 | STAM2 | Signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 | 0.3087 |
BX648363 | SNX10 | Sorting nexin 10 | 0.4538 |
AB209439 | SNX15 | Sorting nexin 15 | 0.4678 |
NM_014758 | SNX19 | Sorting nexin 19 | 0.2963 |
NM_021249 | SNX6 | Sorting nexin 6 | 0.4434 |
NM_004782 | SNAP29 | Synaptosomal-associated protein, 29kDa | 0.3200 |
AJ420529 | STX7 | Syntaxin 7 | 0.4040 |
BC028028 | STXBP3 | Syntaxin binding protein 3 | 0.4085 |
NM_007269 | STXBP3 | Syntaxin binding protein 3 | 0.3236 |
NM_003262 | TLOC1 | Translocation protein 1 | 0.2817 |
AK094603 | FLJ37284 | unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. | 0.4770 |
AL832866 | VPS29 | Vacuolar protein sorting 29 (yeast) | 0.3114 |
AK092532 | FLJ10979 | Vacuolar protein sorting 53 (yeast) | 0.3635 |
NM_015336 | ZDHHC17 | Zinc finger, DHHC-type containing 17 | 0.4575 |
AB002303 | ZFYVE16 | Zinc finger, FYVE domain containing 16 | 0.2707 |
(f) WNT 신호 경로(WNT SIGNALING PATHWAY) | |||
NM_007236 | CHP | Calcium binding protein P22 | 0.3399 |
AL137653 | BARS | C-terminal binding protein 1 | 0.3506 |
AB017363 | FZD1 | Frizzled homolog 1 (Drosophila) | 0.4722 |
NM_017412 | FZD3 | Frizzled homolog 3 (Drosophila) | 0.1618 |
AB032417 | FZD4 | Frizzled homolog 4 (Drosophila) | 0.3789 |
AK125150 | MAPK8 | Mitogen-activated protein kinase 8 | 0.3782 |
AK025758 | NFATC2 | Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 | 0.2781 |
NM_000933 | PLCB4 | Phospholipase C, beta 4 | 0.3952 |
AK131561 | PRKACA | Protein kinase, cAMP-dependent, catalytic, alpha | 0.4298 |
AF026692 | SFRP4 | Secreted frizzled-related protein 4 | 0.4533 |
BC078170 | WNT2 | Wingless-type MMTV integration site family member 2 | 0.3878 |
NM_003392 | WNT5A | Wingless-type MMTV integration site family, member 5A | 0.4489 |
AY009401 | WNT6 | Wingless-type MMTV integration site family, member 6 | 0.3447 |
(g) 기타(TheOthers) | |||
AL832664 | ANP32E | Acidic (leucine-rich) nuclear phosphoprotein 32 family, member E | 0.3317 |
NM_138448 | ACYP2 | Acylphosphatase 2, muscle type | 0.3185 |
AK000643 | ASB9 | Ankyrin repeat and SOCS box-containing 9 | 0.4592 |
NM_175873 | LOC134548 | Ankyrin repeat domain 43 | 0.4490 |
AF279145 | ANTXR1 | Anthrax toxin receptor 1 | 0.3494 |
AB013380 | ABCB10 | ATP-binding cassette, sub-family B (MDR/TAP), member 10 | 0.3228 |
M75106 | CPB2 | Carboxypeptidase B2 (plasma, carboxypeptidase U) | 0.4596 |
AK131472 | FLJ16640 | CDNAFLJ16640fis,cloneTESTI4028938,moderately similar to Zinc finger protein 85 | 0.4166 |
NM_001809 | CENPA | Centromere protein A, 17kDa | 0.4694 |
AB091343 | C10orf3 | Centrosomal protein 55kDa | 0.4455 |
BC004543 | C15orf23 | Chromosome 15 open reading frame 23 | 0.3956 |
NM_001012507 | C6orf173 | Chromosome 6 open reading frame 173 | 0.4614 |
AK000972 | C9orf40 | Chromosome 9 open reading frame 40 | 0.4469 |
NM_001801 | CDO1 | Cysteine dioxygenase, type I | 0.2878 |
NM_018204 | CKAP2 | Cytoskeleton associated protein 2 | 0.3130 |
NM_006716 | ASK | DBF4 homolog (S. cerevisiae) | 0.4161 |
BC045541 | LOC200895 | Dihydrofolate reductase-like 1 | 0.2753 |
NM_152721 | DOK6 | Docking protein 6 | 0.4595 |
NM_017645 | FAM29A | Family with sequence similarity 29, member A | 0.3814 |
NM_207418 | MGC57827 | Family with sequence similarity 72, member A | 0.4816 |
AK055221 | FBXO5 | F-box protein 5 | 0.4967 |
NM_005141 | FGB | Fibrinogen beta chain | 0.4363 |
AB208919 | FGFR1 | Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) | 0.3246 |
NM_032117 | GAJ | GAJ protein | 0.3084 |
NM_020918 | GPAM | Glycerol-3-phosphate acyltransferase, mitochondrial | 0.3408 |
AB007893 | KIAA0433 | Histidine acid phosphatase domain containing 1 | 0.3318 |
AF032862 | HMMR | Hyaluronan-mediated motility receptor (RHAMM) | 0.3994 |
AK123495 | Q5XI42 | Hypothetical gene supported by AL713796 | 0.3387 |
NM_018291 | FLJ10986 | Hypothetical protein FLJ10986 | 0.4307 |
AL832022 | FLJ13910 | Hypothetical protein FLJ13910 | 0.4640 |
AL832208 | FLJ32312 | Hypothetical protein FLJ32312 | 0.4060 |
AB037805 | KLHL14 | Kelch-like 14 (Drosophila) | 0.3106 |
NM_014736 | KIAA0101 | KIAA0101 | 0.4374 |
AB046861 | KIAA1641 | KIAA1641 | 0.3217 |
BC033021 | LOC152831 | Klotho beta | 0.3873 |
NM_182551 | LYCAT | Lysocardiolipin acyltransferase | 0.3473 |
NM_002381 | MATN3 | Matrilin 3 | 0.1690 |
AB018342 | MYO10 | Myosin X | 0.4501 |
BX537509 | NET1 | Neuroepithelial cell transforming gene 1 | 0.4179 |
BX537360 | CPSF5 | Nudix (nucleoside diphosphate linked moiety X)-type motif 21 | 0.3747 |
NM_033222 | PSIP1 | PC4 and SFRS1 interacting protein 1 | 0.4576 |
NM_000277 | PAH | Phenylalanine hydroxylase | 0.3631 |
NM_176869 | PPA2 | Pyrophosphatase (inorganic) 2 | 0.3985 |
NM_013277 | RACGAP1 | Rac GTPase activating protein 1 | 0.3540 |
NM_004586 | RPS6KA3 | Ribosomal protein S6 kinase, 90kDa, polypeptide 3 | 0.1936 |
BC064610 | SEPHS1 | Selenophosphate synthetase 1 | 0.4814 |
AK075271 | SPTLC2L | Serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2) | 0.3434 |
XM_496355 | LOC440577 | Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1 | 0.2248 |
XM_371758 | LOC389308 | Similar to ribosomal protein L10a | 0.4247 |
XM_371470 | LOC388907 | Similar to ribosomal protein L5; 60S ribosomal protein L5 | 0.1490 |
XM_495961 | LOC440145 | Similar to RIKEN cDNA 2410129H14 | 0.2230 |
XM_496301 | LOC440517 | Similar to zinc finger protein 91 (HPF7, HTF10) | 0.2857 |
BX640965 | SLC22A3 | Solute carrier family 22 (extraneuronal monoamine transporter), member 3 | 0.3067 |
NM_180991 | SLCO4C1 | Solute carrier organic anion transporter family, member 4C1 | 0.2490 |
BC022255 | Spc25 | Spindle pole body component 25 homolog (S. cerevisiae) | 0.2821 |
BM458612 | THRAP6 | Thyroid hormone receptor associated protein 6 | 0.2969 |
AI300182 | PROS1 | Transcribed locus, weakly similar to NP_000304.1 protein S (alpha) | 0.2130 |
AL133031 | MLR1 | Transcription factor MLR1 | 0.4648 |
AY358727 | FLJ21934 | UDP glucuronosyltransferase 2 family, polypeptide A3 | 0.1343 |
BC035579 | ZNF100 | Zinc finger protein 100 | 0.4610 |
AB209664 | ZNF195 | Zinc finger protein 195 | 0.4953 |
AY269786 | ZNF429 | Zinc finger protein 429 | 0.4502 |
NM_003423 | ZNF43 | Zinc finger protein 43 (HTF6) | 0.2322 |
NM_016220 | ZNF588 | Zinc finger protein 588 | 0.2746 |
AK122869 | LOC148213 | Zinc finger protein 681 | 0.4151 |
AK131527 | ZNF15L1 | Zinc finger protein 708 (KOX8) | 0.2967 |
NM_003430 | ZNF91 | Zinc finger protein 91 (HPF7, HTF10) | 0.4322 |
NM_152626 | ZNF92 | Zinc finger protein 92 (HTF12) | 0.4466 |
<
실시예
3> 실시간
RT
-PCR(
Real
-
time
reverse
transcriptase
polymerase
chain
reaction
) 정량
나프탈렌에 의해 발현 유도된 상기 <실시예 2>의 2배 이상 과발현 및 저발현된 유전자 중 나프탈렌에 의해 과발현되는 유전자 24종과 저발현 되는 유전자 21종을 선별하였다. 이들 유전자들은 유전자 등록번호(Genebank) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) BU945318(metallothionein 2A), 유전자 등록번호(Genebank) BM926478(Retinol binding protein 1, cellular), 유전자 등록번호(Genebank) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_003897(Immediate early response 3), 유전자 등록번호(Genebank) BC042390(Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) NM_017572(MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) NM_173481(Chromosome 19 open reading frame 21), 유전자 등록번호(Genebank) NM_032468(Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AY247738(Tribbles homolog 3(Drosophila)), 유전자 등록번호(Genebank) AK095363(Aquaporin 3), 유전자 등록번호(Genebank) AA669162(Adenosine monophosphate deaminase(isoform E)), 유전자 등록번호(Genebank) NM_003516(Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_080388(S100 calcium binding protein A16), 유전자 등록번호(Genebank) BX649164(serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_001013632(polo-like kinase 3(Drosophila)), 유전자 등록번호(Genebank) BQ683841(S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AK094474(Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_001769(CD9 antigen(p24)), 유전자 등록번호(Genebank) BC035124(MSFL2541), 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) AF167706(Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유전자 등록번호(Genebank) AB046861(KIAA1641), 유전자 등록번호(Genebank) BC068588(Similar to CG32820-PA, isoform A), 유전자 등록번호(Genebank) AY358727(UDP glucuronosyltransferase 2 family, polypeptide A3), 유전자 등록번호(Genebank) NM_017768(Leucine rich repeat containing 40), 유전자 등록번호(Genebank) AA074156(Transcribed locus, strongly similar to NP_032436.1 integral membrane protein 2B [Mus musculus]), 유전자 등록번호(Genebank) XM_291202(Zinc finger protein 479), 유전자 등록번호(Genebank) AB013380(ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) NM_180991(Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) BC022255(Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) BX640965(Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) CR600021(High-mobility group box 2), 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) AB091343(Centrosomal protein 55kDa), 유전자 등록번호(Genebank) BX640888(Glypican 6), 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) U65410(MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) NM_001067(Topoisomerase(DNA) II alpha 170kDa)이다.
상기 유전자들의 발현변화 정도를 조사 및 정량하기 위해 My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다.
구체적으로, 올리고 dT 프라이머와 Superscript kit(Omniscipt™ kit, Qiagen, Co., USA)를 이용하여 역전사반응을 수행하여 cDNA를 합성하였다. PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, USA)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가하게 된다.
먼저, PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(GAPDH)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 4)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다(표 5).
등록번호 | 유전자명 | PCR 프라이머 서열 | |
BM913048 | TIMP metallopeptidase inhibitor 1 | 센스 (서열번호1) |
GATACTTCCACAGGTCCCACAAC |
안티센스 (서열번호2) |
GCAAGAGTCCATCCTGCAGTT | ||
BU945318 | metallothionein 2A | 센스 (서열번호3) |
CTCTAGCCGCCTCTTCAGC |
안티센스 (서열번호4) |
ACTCTTTGCATTTGCAGGAAC | ||
BM926478 | Retinol binding protein 1, cellular | 센스 (서열번호5) |
AGGCATAGATGACCGCAAGT |
안티센스 (서열번호6) |
ACCCTTCTGCACACACTGG | ||
X02812 | Transforming growth factor, beta 1(Camurati-Engelmann disease) | 센스 (서열번호7) |
GCAGCACGTGGAGCTGTA |
안티센스 (서열번호8) |
CAGCCGGTTGCTGAGGTA | ||
NM_004864 | Growth differentiation factor 15 | 센스 (서열번호9) |
CCTGAGACACCCGATTCCT |
안티센스 (서열번호10) |
ACAGTTCCATCAGACCAGCC | ||
NM_003897 | Immediate early response 3 | 센스 (서열번호11) |
AGCCCTTTAATCTGACTTCGGAGC |
안티센스 (서열번호12) |
CAGGTACGCCTGGTGTTTCTTTGT | ||
BC042390 | Vesicle transport through interaction with t-SNAREs homolog 1B(yeast) | 센스 (서열번호13) |
GGGGGACTAACCTATCGAGAA |
안티센스 (서열번호14) |
GATCCAGTGCTGATAGCAACC | ||
NM_017572 | MAP kinase interacting serine/threonine kinase 2 | 센스 (서열번호15) |
CCATGGTCCTGCAGAGGT |
안티센스 (서열번호16) |
TTCTGACCAGTCCTCCAGGT | ||
NM_173481 | Chromosome 19 open reading frame 21 | 센스 (서열번호17) |
TCGGACGGTATCAACTCAGA |
안티센스 (서열번호18) |
TCCTCCTCACTGGCGTAGAT | ||
NM_032468 | Aspartate beta-hydroxylase | 센스 (서열번호19) |
TGCTGATGCAGACCTATCCAGGAA |
안티센스 (서열번호20) |
TGTCATCTTTGTCTCGGGATGCCA | ||
AY247738 | Tribbles homolog 3 (Drosophila) | 센스 (서열번호21) |
GTCTTCGCTGACCGTGAGA |
안티센스 (서열번호22) |
CAGTCAGCACGCAGGAGTC | ||
AK095363 | Aquaporin 3 | 센스 (서열번호23) |
TTCACGATCCACCCTTTCAGGCTA |
안티센스 (서열번호24) |
ACACATACCTGCTGCCCATTCTCT | ||
AA669162 | Adenosine monophosphate deaminase(isoform E) | 센스 (서열번호25) |
AGGTCAAAGAAGCTGCTGCCAAAC |
안티센스 (서열번호26) |
TGGACTCATCATCCACGCTGTCAA | ||
NM_003516 | Histone 2, H2aa | 센스 (서열번호27) |
GAACTGAACAAGCTGCTGGGCAAA |
안티센스 (서열번호28) |
TCTCCGTCTTCTTAGGGAGCAGTA | ||
NM_003255 | TIMP metallopeptidase inhibitor 2 | 센스 (서열번호29) |
CGACATTTATGGCAACCCTATCA |
안티센스 (서열번호30) |
CAGGCCCTTTGAACATCTTTATCT | ||
NM_080388 | S100 calcium binding protein A16 | 센스 (서열번호31) |
CCAGAAAGAGCTGAACCACATGCT |
안티센스 (서열번호32) |
AGGTCCAGTACTCATCGAAGCTGA | ||
BX649164 | serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1 | 센스 (서열번호33) |
CAGACCAAGAGCCTCTCCAC |
안티센스 (서열번호34) |
ATCACTTGGCCCATGAAAAG | ||
NM_001013632 | polo-like kinase 3 (Drosophila) | 센스 (서열번호35) |
GACTACTCCAATAAGTTCGGCTTTG |
안티센스 (서열번호36) |
CATATGTGTGCCATCGTTGAAGA | ||
BQ683841 | S100 calcium binding protein A11(calgizzarin) | 센스 (서열번호37) |
AGTCCCTGATTGCTGTCTTCCAGA |
안티센스 (서열번호38) |
ACCAGGGTCCTTCTGGTTCTTTGT | ||
Y11307 | Cysteine-rich, angiogenic inducer, 61 | 센스 (서열번호39) |
ATTGTAGAAAGGAAGCCTTGCTCAT |
안티센스 (서열번호40) |
TCCAATCGTGGCTGCATTAG | ||
AK094474 | Ras homolog gene family, member C | 센스 (서열번호41) |
ACCTGCCTCCTCATCGTCTTC |
안티센스 (서열번호42) |
CACCTGCTTGCCGTCCAC | ||
NM_001769 | CD9 antigen(p24) | 센스 (서열번호43) |
GCACCAAGTGCATCAAATACCTGC |
안티센스 (서열번호44) |
AGCCATAGTCCAATGGCAAGGACA | ||
BC035124 | MSFL2541 | 센스 (서열번호45) |
TTCGCCGTCCTTTACATCTAC |
안티센스 (서열번호46) |
AGAGCCTGGGGACTCACAT | ||
NM_000499 | Cytochrome P450, family 1, subfamily A, polypeptide 1 | 센스 (서열번호47) |
CACCATCCCCCACAGCAC |
안티센스 (서열번호48) |
ACAAAGACACAACGCCCCTT | ||
AF167706 | Cysteine rich transmembrane BMP regulator 1(chordin-like) | 센스 (서열번호49) |
TGCCCACAGTGTACAGATCAACCT |
안티센스 (서열번호50) |
ATGCAGATGCAGCTGGTACAAACG | ||
AB046861 | KIAA1641 | 센스 (서열번호51) |
AAGGAGGGACAACAATCTGGGACA |
안티센스 (서열번호52) |
TCACTTGTAGCCTTTGAGGGTGGT | ||
BC068588 | Similar to CG32820-PA, isoform A | 센스 (서열번호53) |
ATAGCATCGGGCAGGACTAATGGA |
안티센스 (서열번호54) |
GAAAGAGGGTGTGATGTGGACCAT | ||
AY358727 | UDP glucuronosyltransferase 2 family, polypeptide A3 | 센스 (서열번호55) |
GAAAAGGCTAATATCATTGCTTCAG |
안티센스 (서열번호56) |
TTCCTTTGTACCTCCATAACACC | ||
NM_017768 | Leucine rich repeat containing 40 | 센스 (서열번호57) |
TGCCGCAGTGTGTCTGGAGAATAA |
안티센스 (서열번호58) |
TGCTCCCACCATCTTTCAGTAGCA | ||
AA074156 | Transcribed locus, strongly similar to NP_032436.1 integral membrane protein 2B [Mus musculus] | 센스 (서열번호59) |
AGGCTGGAACCTATTTGCCTCAGT |
안티센스 (서열번호60) |
TGCGAAACAATTGCTGGCTTCACG | ||
XM_291202 | Zinc finger protein 479 | 센스 (서열번호61) |
ATGGTAGCCAAACACCCAGT |
안티센스 (서열번호62) |
TGAATCTTTGATGCCCTGCT | ||
AB013380 | ATP-binding cassette, sub-family B(MDR/TAP), member 10 | 센스 (서열번호63) |
TCAGCCTTTCCATTCCGTCAGGAT |
안티센스 (서열번호64) |
TTTGGATCTCAGCCACACTGGGTT | ||
NM_180991 | Solute carrier organic anion transporter family, member 4C1 | 센스 (서열번호65) |
CCAGCTTCGCAGCTACTCTT |
안티센스 (서열번호66) |
CCACCTAAAATTTGACCGAGAG | ||
BC022255 | Spindle pole body component 25 homolog(S. cerevisiae) | 센스 (서열번호67) |
GAATGGTTGAGATGTTTCTGGA |
안티센스 (서열번호68) |
GCAATCAATTTTAACAAGTTATCCTTT | ||
AK074377 | Chromosome 19 open reading frame 31 | 센스 (서열번호69) |
CTGGTACGACGCGGAGAT |
안티센스 (서열번호70) |
CGACAGTCGTTCAGAGAATCA | ||
BX640965 | Solute carrier family 22(extraneuronal monoamine transporter), member 3 | 센스 (서열번호71) |
GCCCTGTTCCAGCAATAAGA |
안티센스 (서열번호72) |
GAGAGCCAAAAATGTCCCAA | ||
CR600021 | High-mobility group box 2 | 센스 (서열번호73) |
CTTGGCACGATATGCAGCAA |
안티센스 (서열번호74) |
CAGCCAAAGATAAACAACCATATGA | ||
NM_006101 | Kinetochore associated 2 | 센스 (서열번호75) |
TGCTACACATGTTGGGTCTGTA |
안티센스 (서열번호76) |
CCGAGAGATCTTCTGACATGC | ||
NM_145697 | Cell division cycle associated 1 | 센스 (서열번호77) |
TGCCTTCATGTCAGTTGGAAGTGC |
안티센스 (서열번호78) |
TTTGGTCCTCCAAGTTCAGGCTCT | ||
AB091343 | Centrosomal protein 55 kDa | 센스 (서열번호79) |
GCTGTGCATTTCTCTTGGCAGTGA |
안티센스 (서열번호80) |
TAGACGCTGCTCACCACATTCTGT | ||
BX640888 | Glypican 6 | 센스 (서열번호81) |
ACACTGACCAGCTCAAGCCATTTG |
안티센스 (서열번호82) |
GACAAAGGTCCTGGCAGCAATGAA | ||
NM_018492 | PDZ binding kinase | 센스 (서열번호83) |
TCTGGACTGAGAGTGGCTTTCACA |
안티센스 (서열번호84) |
AGCCAAGCTTCTGCATAAACGGAG | ||
NM_003318 | TTK protein kinase | 센스 (서열번호85) |
TCATGCCCATTTGGAAGAGTCCCA |
안티센스 (서열번호86) |
AGGCACAACCAAATCTCGGCATTC | ||
U65410 | MAD2 mitotic arrest deficient-like 1(yeast) | 센스 (서열번호87) |
ACTTAAATATCTCCCTACCTATACTGAGTCAA |
안티센스 (서열번호88) |
TAGTAACTGTAGATGGAAAAACTTGTGCTA | ||
NM_001067 | Topoisomerase(DNA) II alpha 170kDa | 센스 (서열번호89) |
CTAGTTAATGCTGCGGACAACA |
안티센스 (서열번호90) |
CATTTCGACCACCTGTCACTT |
등록번호 | 유전자명 | 약어 |
마이크로어레이
(Cy3/Cy5비율) |
실시간
PCR
(상대적배율) |
과발현 유전자 | ||||
BM913048 | TIMP metallopeptidase inhibitor 1 | TIMP1 | 8.27 | 9.19 |
BU945318 | metallothionein 2A | MT2A | 6.24 | 5.50 |
BM926478 | Retinol binding protein 1, cellular | RBP1 | 5.95 | 7.82 |
X02812 | Transforming growth factor, beta 1(Camurati-Engelmann disease) | TGFB1 | 5.35 | 2.31 |
NM_004864 | Growth differentiation factor 15 | GDF15 | 4.76 | 5.59 |
NM_003897 | Immediate early response 3 | IER3 | 4.67 | 3.76 |
BC042390 | Vesicle transport through interaction with t-SNAREs homolog 1B(yeast) | VTI1B | 4.47 | 6.31 |
NM_017572 | MAP kinase interacting serine/threonine kinase 2 | MKNK2 | 4.31 | 3.37 |
NM_173481 | Chromosome 19 open reading frame 21 | C19orf21 | 4.28 | 5.97 |
NM_032468 | Aspartate beta-hydroxylase | ASPH | 3.95 | 9.27 |
AY247738 | Tribbles homolog 3 (Drosophila) | TRIB3 | 3.69 | 2.51 |
AK095363 | Aquaporin 3 | AQP3 | 2.95 | 16.34 |
AA669162 | Adenosine monophosphate deaminase(isoform E) | AMPD3 | 2.80 | 21.51 |
NM_003516 | Histone 2, H2aa | HIST2H2AA | 2.79 | 1.69 |
NM_003255 | TIMP metallopeptidase inhibitor 2 | TIMP2 | 2.69 | 2.22 |
NM_080388 | S100 calcium binding protein A16 | S100A16 | 2.63 | 3.32 |
BX649164 | serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1 | SERPINE1 | 2.53 | 4.54 |
NM_001013632 | polo-like kinase 3 (Drosophila) | PLK3 | 2.51 | 3.26 |
BQ683841 | S100 calcium binding protein A11(calgizzarin) | S100A11 | 2.44 | 2.16 |
Y11307 | Cysteine-rich, angiogenic inducer, 61 | CYR61 | 2.43 | 2.64 |
AK094474 | Ras homolog gene family, member C | RHOC | 2.25 | 2.98 |
NM_001769 | CD9 antigen(p24) | CD9 | 2.08 | 3.03 |
BC035124 | MSFL2541 | UNQ2541 | 2.00 | 2.62 |
NM_000499 | Cytochrome P450, family 1, subfamily A, polypeptide 1 | CYP1A1 | 1.66 | 4.11 |
저발현 유전자 | ||||
AF167706 | Cysteine rich transmembrane BMP regulator 1(chordin-like) | CRIM1 | 0.10 | 0.60 |
AB046861 | KIAA1641 | KIAA1641 | 0.11 | 0.23 |
BC068588 | Similar to CG32820-PA, isoform A | LOC653071 | 0.12 | 0.54 |
AY358727 | UDP glucuronosyltransferase 2 family, polypeptide A3 | FLJ21934 | 0.13 | 0.58 |
NM_017768 | Leucine rich repeat containing 40 | LRRC40 | 0.14 | 0.60 |
AA074156 | Transcribed locus, strongly similar to NP_032436.1 integral membrane protein 2B [Mus musculus] | ITM2B | 0.15 | 0.65 |
XM_291202 | Zinc finger protein 479 | ZNF479 | 0.23 | 0.56 |
AB013380 | ATP-binding cassette, sub-family B(MDR/TAP), member 10 | ABCB10 | 0.25 | 0.63 |
NM_180991 | Solute carrier organic anion transporter family, member 4C1 | SLCO4C1 | 0.25 | 0.35 |
BC022255 | Spindle pole body component 25 homolog(S. cerevisiae) | Spc25 | 0.28 | 0.48 |
AK074377 | Chromosome 19 open reading frame 31 | UHRF1 | 0.31 | 0.30 |
BX640965 | Solute carrier family 22(extraneuronal monoamine transporter), member 3 | SLC22A3 | 0.31 | 0.68 |
CR600021 | High-mobility group box 2 | HMGB2 | 0.34 | 0.67 |
NM_006101 | Kinetochore associated 2 | KNTC2 | 0.37 | 0.58 |
NM_145697 | Cell division cycle associated 1 | CDCA1 | 0.41 | 0.55 |
AB091343 | Centrosomal protein 55kDa | C10orf3 | 0.45 | 0.38 |
BX640888 | Glypican 6 | GPC6 | 0.46 | 0.31 |
NM_018492 | PDZ binding kinase | PBK | 0.47 | 0.59 |
NM_003318 | TTK protein kinase | TTK | 0.49 | 0.22 |
U65410 | MAD2 mitotic arrest deficient-like 1(yeast) | MAD2L1 | 0.50 | 0.58 |
NM_001067 | Topoisomerase(DNA) II alpha 170kDa | TOP2A | 0.56 | 0.12 |
그 결과, 24종의 과발현 유전자들 및 21종의 저발현 유전자의 유전자 발현 양상은 나프탈렌에 의한 유전자 발현을 조사한 올리고 마이크로어레이 결과와 매우 유사하게 나타남을 확인하였다.
도 1은 나프탈렌(Naphthalene)의 인간 간암 세포주에서의 세포 독성을 나타내는 그래프이다.
도 2는 마이크로어레이 칩을 이용한 나프탈렌을 처리한 인간 간암 세포주의 유전자 발현 양상을 분석한 결과를 나타내는 그림이다.
<110> Korea Institute of Science and Technology
<120> Biomarker for identification of exposure to naphthalene and the
method of identification using thereof
<130> 8p-02-06
<160> 90
<170> KopatentIn 1.71
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> TIMP metallopeptidase inhibitor 1 sense primer
<400> 1
gatacttcca caggtcccac aac 23
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> TIMP metallopeptidase inhibitor 1 antisense primer
<400> 2
gcaagagtcc atcctgcagt t 21
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> metallothionein 2A sense primer
<400> 3
ctctagccgc ctcttcagc 19
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> metallothionein 2A antisense primer
<400> 4
actctttgca tttgcaggaa c 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Retinol binding protein 1, cellular sense primer
<400> 5
aggcatagat gaccgcaagt 20
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Retinol binding protein 1, cellular antisense primer
<400> 6
acccttctgc acacactgg 19
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Transforming growth factor, beta 1 sense primer
<400> 7
gcagcacgtg gagctgta 18
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Transforming growth factor, beta 1 antisense primer
<400> 8
cagccggttg ctgaggta 18
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Growth differentiation factor 15 sense primer
<400> 9
cctgagacac ccgattcct 19
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Growth differentiation factor 15 antisense primer
<400> 10
acagttccat cagaccagcc 20
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Immediate early response 3 sense primer
<400> 11
agccctttaa tctgacttcg gagc 24
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Immediate early response 3 antisense primer
<400> 12
caggtacgcc tggtgtttct ttgt 24
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Vesicle transport through interaction with t-SNAREs homolog 1B
sense primer
<400> 13
gggggactaa cctatcgaga a 21
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Vesicle transport through interaction with t-SNAREs homolog 1B
antisense primer
<400> 14
gatccagtgc tgatagcaac c 21
<210> 15
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> MAP kinase interacting serine/threonine kinase 2 sense primer
<400> 15
ccatggtcct gcagaggt 18
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> MAP kinase interacting serine/threonine kinase 2 antisense
primer
<400> 16
ttctgaccag tcctccaggt 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Chromosome 19 open reading frame 21 sense primer
<400> 17
tcggacggta tcaactcaga 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Chromosome 19 open reading frame 21 antisense primer
<400> 18
tcctcctcac tggcgtagat 20
<210> 19
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Aspartate beta-hydroxylase sense primer
<400> 19
tgctgatgca gacctatcca ggaa 24
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Aspartate beta-hydroxylase antisense primer
<400> 20
tgtcatcttt gtctcgggat gcca 24
<210> 21
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Tribbles homolog 3 sense primer
<400> 21
gtcttcgctg accgtgaga 19
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Tribbles homolog 3 antisense primer
<400> 22
cagtcagcac gcaggagtc 19
<210> 23
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Aquaporin 3 sense primer
<400> 23
ttcacgatcc accctttcag gcta 24
<210> 24
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Aquaporin 3 antisense primer
<400> 24
acacatacct gctgcccatt ctct 24
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Adenosine monophosphate deaminase sense primer
<400> 25
aggtcaaaga agctgctgcc aaac 24
<210> 26
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Adenosine monophosphate deaminase antisense primer
<400> 26
tggactcatc atccacgctg tcaa 24
<210> 27
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Histone 2, H2aa sense primer
<400> 27
gaactgaaca agctgctggg caaa 24
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Histone 2, H2aa antisense primer
<400> 28
tctccgtctt cttagggagc agta 24
<210> 29
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> TIMP metallopeptidase inhibitor 2 sense primer
<400> 29
cgacatttat ggcaacccta tca 23
<210> 30
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> TIMP metallopeptidase inhibitor 2 antisense primer
<400> 30
caggcccttt gaacatcttt atct 24
<210> 31
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> S100 calcium binding protein A16 sense primer
<400> 31
ccagaaagag ctgaaccaca tgct 24
<210> 32
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> S100 calcium binding protein A16 antisense primer
<400> 32
aggtccagta ctcatcgaag ctga 24
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> serpin peptidase inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1 snese primer
<400> 33
cagaccaaga gcctctccac 20
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> serpin peptidase inhibitor, clade E(nexin, plasminogen activator
inhibitor type 1), member 1 antisense primer
<400> 34
atcacttggc ccatgaaaag 20
<210> 35
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> polo-like kinase 3 (Drosophila) snese primer
<400> 35
gactactcca ataagttcgg ctttg 25
<210> 36
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> polo-like kinase 3 (Drosophila) antisense primer
<400> 36
catatgtgtg ccatcgttga aga 23
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> S100 calcium binding protein A11 (calgizzarin) sense primer
<400> 37
agtccctgat tgctgtcttc caga 24
<210> 38
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> S100 calcium binding protein A11 (calgizzarin) antisense primer
<400> 38
accagggtcc ttctggttct ttgt 24
<210> 39
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Cysteine-rich, angiogenic inducer, 61 snese primer
<400> 39
attgtagaaa ggaagccttg ctcat 25
<210> 40
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Cysteine-rich, angiogenic inducer, 61 antisense primer
<400> 40
tccaatcgtg gctgcattag 20
<210> 41
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Ras homolog gene family, member C sense primer
<400> 41
acctgcctcc tcatcgtctt c 21
<210> 42
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Ras homolog gene family, member C antisense primer
<400> 42
cacctgcttg ccgtccac 18
<210> 43
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> CD9 antigen (p24) sense primer
<400> 43
gcaccaagtg catcaaatac ctgc 24
<210> 44
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> CD9 antigen (p24) antisense primer
<400> 44
agccatagtc caatggcaag gaca 24
<210> 45
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> MSFL2541 sense primer
<400> 45
ttcgccgtcc tttacatcta c 21
<210> 46
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> MSFL2541 antisense primer
<400> 46
agagcctggg gactcacat 19
<210> 47
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Cytochrome P450, family 1, subfamily A, polypeptide 1 sense
primer
<400> 47
caccatcccc cacagcac 18
<210> 48
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Cytochrome P450, family 1, subfamily A, polypeptide 1 antisense
primer
<400> 48
acaaagacac aacgcccctt 20
<210> 49
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Cysteine rich transmembrane BMP regulator 1(chordin-like) sense
primer
<400> 49
tgcccacagt gtacagatca acct 24
<210> 50
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Cysteine rich transmembrane BMP regulator 1(chordin-like)
antisense primer
<400> 50
atgcagatgc agctggtaca aacg 24
<210> 51
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> KIAA1641 sense primer
<400> 51
aaggagggac aacaatctgg gaca 24
<210> 52
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> KIAA1641 antisense primer
<400> 52
tcacttgtag cctttgaggg tggt 24
<210> 53
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Similar to CG32820-PA, isoform A sense primer
<400> 53
atagcatcgg gcaggactaa tgga 24
<210> 54
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Similar to CG32820-PA, isoform A antisense primer
<400> 54
gaaagagggt gtgatgtgga ccat 24
<210> 55
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> UDP glucuronosyltransferase 2 family, polypeptide A3 snese primer
<400> 55
gaaaaggcta atatcattgc ttcag 25
<210> 56
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> UDP glucuronosyltransferase 2 family, polypeptide A3 antisense
primer
<400> 56
ttcctttgta cctccataac acc 23
<210> 57
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Leucine rich repeat containing 40 sense primer
<400> 57
tgccgcagtg tgtctggaga ataa 24
<210> 58
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Leucine rich repeat containing 40 antisense primer
<400> 58
tgctcccacc atctttcagt agca 24
<210> 59
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Transcribed locus, strongly similar to NP_032436.1 integral
membrane protein 2B[Mus musculus] sense primer
<400> 59
aggctggaac ctatttgcct cagt 24
<210> 60
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Transcribed locus, strongly similar to NP_032436.1 integral
membrane protein 2B[Mus musculus] antisense primer
<400> 60
tgcgaaacaa ttgctggctt cacg 24
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Zinc finger protein 479 sense primer
<400> 61
atggtagcca aacacccagt 20
<210> 62
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Zinc finger protein 479 antisense primer
<400> 62
tgaatctttg atgccctgct 20
<210> 63
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> ATP-binding cassette, sub-family B (MDR/TAP), member 10 sense
primer
<400> 63
tcagcctttc cattccgtca ggat 24
<210> 64
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> ATP-binding cassette, sub-family B (MDR/TAP), member 10 antisense
primer
<400> 64
tttggatctc agccacactg ggtt 24
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Solute carrier organic anion transporter family, member 4C1
sense primer
<400> 65
ccagcttcgc agctactctt 20
<210> 66
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Solute carrier organic anion transporter family, member 4C1
antisense primer
<400> 66
ccacctaaaa tttgaccgag ag 22
<210> 67
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Spindle pole body component 25 homolog (S. cerevisiae) sense
primer
<400> 67
gaatggttga gatgtttctg ga 22
<210> 68
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Spindle pole body component 25 homolog (S. cerevisiae) antisense
primer
<400> 68
gcaatcaatt ttaacaagtt atccttt 27
<210> 69
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Chromosome 19 open reading frame 31 sense primer
<400> 69
ctggtacgac gcggagat 18
<210> 70
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Chromosome 19 open reading frame 31 antisense primer
<400> 70
cgacagtcgt tcagagaatc a 21
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Solute carrier family 22(extraneuronal monoamine transporter),
member 3 sense primer
<400> 71
gccctgttcc agcaataaga 20
<210> 72
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Solute carrier family 22(extraneuronal monoamine transporter),
member 3 antisense primer
<400> 72
gagagccaaa aatgtcccaa 20
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> High-mobility group box 2 sense primer
<400> 73
cttggcacga tatgcagcaa 20
<210> 74
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> High-mobility group box 2 antisense primer
<400> 74
cagccaaaga taaacaacca tatga 25
<210> 75
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Kinetochore associated 2 sense primer
<400> 75
tgctacacat gttgggtctg ta 22
<210> 76
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Kinetochore associated 2 antisense primer
<400> 76
ccgagagatc ttctgacatg c 21
<210> 77
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Cell division cycle associated 1 sense primer
<400> 77
tgccttcatg tcagttggaa gtgc 24
<210> 78
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Cell division cycle associated 1 antisense primer
<400> 78
tttggtcctc caagttcagg ctct 24
<210> 79
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Centrosomal protein 55 kDa sense primer
<400> 79
gctgtgcatt tctcttggca gtga 24
<210> 80
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Centrosomal protein 55 kDa antisense primer
<400> 80
tagacgctgc tcaccacatt ctgt 24
<210> 81
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Glypican 6 sense primer
<400> 81
acactgacca gctcaagcca tttg 24
<210> 82
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Glypican 6 antisense primer
<400> 82
gacaaaggtc ctggcagcaa tgaa 24
<210> 83
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> PDZ binding kinase antisense primer
<400> 83
tctggactga gagtggcttt caca 24
<210> 84
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> PDZ binding kinase antisense primer
<400> 84
agccaagctt ctgcataaac ggag 24
<210> 85
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> TTK protein kinase sense primer
<400> 85
tcatgcccat ttggaagagt ccca 24
<210> 86
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> TTK protein kinase antisense primer
<400> 86
aggcacaacc aaatctcggc attc 24
<210> 87
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> MAD2 mitotic arrest deficient-like 1(yeast) sense primer
<400> 87
acttaaatat ctccctacct atactgagtc aa 32
<210> 88
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> MAD2 mitotic arrest deficient-like 1(yeast) antisense primer
<400> 88
tagtaactgt agatggaaaa acttgtgcta 30
<210> 89
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Topoisomerase(DNA) II alpha 170 kDa sense primer
<400> 89
ctagttaatg ctgcggacaa ca 22
<210> 90
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Topoisomerase(DNA) II alpha 170 kDa antisense primer
<400> 90
catttcgacc acctgtcact t 21
Claims (15)
- 하기 모든 유전자의 핵산서열의 전부 또는 그의 상보가닥 분자가 집적된 나프탈렌에 대한 세포주기조절 관련 유전자 발현 여부 확인용 DNA 마이크로어레이 칩:유전자 등록번호(Genebank) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(Genebank) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(Genebank) AK057576(CHFR, Checkpoint with forkhead and ring finger domains), 유전자 등록번호(Genebank) NM_005255(GAK, Cyclin G associated kinase), 유전자 등록번호(Genebank) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) AK094316(MAD2L2, MAD2 mitotic arrest deficient-like 2(yeast)), 유전자 등록번호(Genebank) NM_002595(PCTK2, PCTAIRE protein kinase 2), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform b, alpha subunit 45kDa), 유전자 등록번호(Genebank) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(Genebank) NM_001722(POLR3D, Polymerase(RNA) III(DNA directed) polypeptide D, 44kDa), 유전자 등록번호(Genebank) NM_002808(PSMD2, Proteasome(prosome, macropain) 26S subunit, non-ATPase, 2), 유전자 등록번호(Genebank) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(Genebank) BC023552(SFN, Stratifin), 유전자 등록번호(Genebank) NM_000548(TSC2, Tuberous sclerosis 2), 유전자 등록번호(Genebank) AK223618(ZBTB17, Zinc finger and BTB domain containing 17), 유전자 등록번호(Genebank) NM_019001(XRN1, 5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) BC016344(ACPP, Acid phosphatase, prostate), 유전자 등록번호(Genebank) BM921310(ANAPC10, Anaphase promoting complex subunit 10), 유전자 등록번호(Genebank) NM_153186(ANKRD15, Ankyrin repeat domain 15), 유전자 등록번호(Genebank) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) NM_004071(CLK1, CDC-like kinase 1), 유전자 등록번호(Genebank) CR933728(CDC2 Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_044472(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) NM_004365(CETN3, Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) BC050310(C10orf9, Chromosome 10 open reading frame 9), 유전자 등록번호(Genebank) NM_016446(C9orf127, Chromosome 9 open reading frame 127), 유전자 등록번호(Genebank) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(Genebank) NM_001761(CCNF, Cyclin F), 유전자 등록번호(Genebank) NM_004354(CCNG2, Cyclin G2), 유전자 등록번호(Genebank) NM_004064(CDKN1B, Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_007068(DMC1, DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination(yeast)), 유전자 등록번호(Genebank) AK025142(BPA, dystonin), 유전자 등록번호(Genebank) NM_001950(E2F4, E2F transcription factor 4, p107/p130-binding), 유전자 등록번호(Genebank) NM_019063(EML4, Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) AJ245671(EGFL6, EGF-like-domain, multiple 6),전자 등록번호(Genebank) NM_004450(ERH, Enhancer of rudimentary homolog(Drosophila)), 유전자 등록번호(Genebank) AL832041(ESCO1, Establishment of cohesion 1 homolog 1(S. cerevisiae)), 유전자 등록번호(Genebank) AL832666(ESCO2, Establishment of cohesion 1 homolog 2(S. cerevisiae)), 유전자 등록번호(Genebank) AK126048(FLJ44060, FLJ44060 protein), 유전자 등록번호(Genebank) BI494022(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(Genebank) NM_000189(HK2, Hexokinase 2), 유전자 등록번호(Genebank) NM_014707(HDAC9, Histone deacetylase 9), 유전자 등록번호(Genebank) BC067253(FLJ40432, Hypothetical protein FLJ40432), 유전자 등록번호(Genebank) AL834276(MGC3207, Hypothetical protein MGC3207), 유전자 등록번호(Genebank) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(Genebank) NM_014751(MTSS1, Metastasis suppressor 1), 유전자 등록번호(Genebank) BC040410(MAPRE1, Microtubule-associated protein, RP/EB family, member 1), 유전자 등록번호(Genebank) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(Genebank) L20321(NEK4, NIMA(never in mitosis gene a)-related kinase 4), 유전자 등록번호(Genebank) AJ627032(NIPBL, Nipped-B homolog(Drosophila)), 유전자 등록번호(Genebank) AL575067(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(Genebank) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(Genebank) AL833922(PAPD5, PAP associated domain containing 5), 유전자 등록번호(Genebank) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(Genebank) NM_016205(PDGFC, Platelet derived growth factor C), 유전자 등록번호(Genebank) NM_000430(PAFAH1B1, Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa), 유전자 등록번호(Genebank) NM_006259(PRKG2, Protein kinase, cGMP-dependent, type II), 유전자 등록번호(Genebank) NM_002709(PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_003463(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(Genebank) BX647606(PTMA, Prothymosin, alpha(gene sequence 28)), 유전자 등록번호(Genebank) BC068483(RINT-1, Rad50-interacting protein 1), 유전자 등록번호(Genebank) NM_006325(RAN, RAN, member RAS oncogene family), 유전자 등록번호(Genebank) NM_213590(RFP2, Ret finger protein 2), 유전자 등록번호(Genebank) NM_006910(RBBP6, Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) BC060806(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) BX648668(RECK, Reversion-inducing-cysteine-rich protein with kazal motifs), 유전자 등록번호(Genebank) AB208875(SEPT10, Septin 10), 유전자 등록번호(Genebank) AB209677(SEPT7, Septin 7), 유전자 등록번호(Genebank) BX649128(SESN3, Sestrin 3), 유전자 등록번호(Genebank) XM_497098(LOC441488, Similar to Transcription factor Dp-1(E2F dimerization partner 1)(DRTF1-polypeptide-1)(DRTF1)), 유전자 등록번호(Genebank) AK131071(SLC31A2, Solute carrier family 31(copper transporters), member 2), 유전자 등록번호(Genebank) NM_006930(SKP1A, S-phase kinase-associated protein 1A(p19A)), 유전자 등록번호(Genebank) NM_006542(SPHAR, S-phase response(cyclin-related)), 유전자 등록번호(Genebank) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) NM_014574(STRN3, Striatin, calmodulin binding protein 3), 유전자 등록번호(Genebank) NM_003176(SYCP1, Synaptonemal complex protein 1), 유전자 등록번호(Genebank) BM674777(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(Genebank) NM_006701(TXNL4A, Thioredoxin-like 4A), 유전자 등록번호(Genebank) NM_030756(TCF7L2, Transcription factor 7-like 2(T-cell specific, HMG-box)), 유전자 등록번호(Genebank) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(Genebank) NM_000368(TSC1, Tuberous sclerosis 1), 유전자 등록번호(Genebank) NM_006826(YWHAQ, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide), 유전자 등록번호(Genebank) NM_001032410(USP16, Ubiquitin specific peptidase 16), 유전자 등록번호(Genebank) AK095164(KRAS2, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog).
- 삭제
- 삭제
- 삭제
- 1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 제 1항의 DNA 마이크로어레이칩과 혼성화시키는 단계;4) 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및5) 분석한 데이터에서 제 1항의 DNA 마이크로어레이칩에 집적된 유전자의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부를 확인하는 방법.
- 제 5항에 있어서, 단계 1)의 체세포는 인간 간 세포 또는 인간 간암 세포인 것을 특징으로 하는 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부를 확인하는 방법.
- 제 6항에 있어서, 상기 인간 간암 세포는 HepG2인 것을 특징으로 하는 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부를 확인하는 방법.
- 제 5항에 있어서, 단계 2)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택하여 사용하는 것을 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부를 확인하는 방법.
- 삭제
- 삭제
- 삭제
- 제 1항의 DNA 마이크로어레이 칩을 포함하는 것을 특징으로 하는 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부 확인용 키트.
- 제 12항에 있어서, 인간 간 세포 또는 인간 간암 세포를 추가적으로 포함하는 것을 특징으로 하는 나프탈렌에 대한 세포주기 조절 관련 유전자 발현 여부 확인용 키트.
- 삭제
- 삭제
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080015344A KR100968762B1 (ko) | 2008-02-20 | 2008-02-20 | 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080015344A KR100968762B1 (ko) | 2008-02-20 | 2008-02-20 | 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20090090083A KR20090090083A (ko) | 2009-08-25 |
KR100968762B1 true KR100968762B1 (ko) | 2010-07-08 |
Family
ID=41208033
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020080015344A KR100968762B1 (ko) | 2008-02-20 | 2008-02-20 | 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100968762B1 (ko) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101735415B1 (ko) | 2015-07-31 | 2017-05-16 | 한국과학기술연구원 | 헥산알 노출 특이적 메틸화 마커 유전자 및 이를 이용한 확인 방법 |
KR20230064006A (ko) | 2021-11-01 | 2023-05-10 | 동국대학교 산학협력단 | 페놀 노출 여부 평가용 바이오마커 및 이를 이용한 페놀 노출 여부 평가 방법 |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101432171B1 (ko) * | 2013-01-22 | 2014-08-22 | 한국원자력의학원 | Cdk11a를 측정하는 제제를 포함하는 방사선 저항성 또는 민감성 진단용 조성물 및 이의 용도 |
KR20200048741A (ko) | 2018-10-30 | 2020-05-08 | (주)아모레퍼시픽 | Ell 발현 촉진 물질을 포함하는 피부 장벽기능 강화용 조성물 및 ell 촉진 물질의 스크리닝 방법 |
CN116586048B (zh) * | 2023-07-17 | 2023-09-08 | 江苏恰瑞生物科技有限公司 | 一种血液灌流器用改性聚苯乙烯吸附树脂及其制备方法 |
-
2008
- 2008-02-20 KR KR1020080015344A patent/KR100968762B1/ko not_active IP Right Cessation
Non-Patent Citations (3)
Title |
---|
논문 1: Toxicology |
논문 2: Fundam. Appl. Toxicol. |
논문 3: J. Vet. Med. Sci. |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101735415B1 (ko) | 2015-07-31 | 2017-05-16 | 한국과학기술연구원 | 헥산알 노출 특이적 메틸화 마커 유전자 및 이를 이용한 확인 방법 |
KR20230064006A (ko) | 2021-11-01 | 2023-05-10 | 동국대학교 산학협력단 | 페놀 노출 여부 평가용 바이오마커 및 이를 이용한 페놀 노출 여부 평가 방법 |
Also Published As
Publication number | Publication date |
---|---|
KR20090090083A (ko) | 2009-08-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR100985090B1 (ko) | 크라이센 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR101134029B1 (ko) | 인체 독성 유발 약물 탐색용 마커유전자 및 이를 이용한 탐색 방법 | |
US20110190156A1 (en) | Molecular signatures for diagnosing scleroderma | |
KR101008385B1 (ko) | 다환 방향족 탄화수소류 노출 여부 확인용 바이오마커 및이를 이용한 확인 방법 | |
KR100968762B1 (ko) | 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR100994996B1 (ko) | 페난트렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR101342035B1 (ko) | 신장독성 및 부작용 유발 약물 검색용 바이오마커 및 이를이용한 신장독성 및 부작용 유발 약물 검색 방법 | |
KR100967546B1 (ko) | 벤조에이안트라센 노출 여부 확인용 바이오마커 및 이를이용한 확인 방법 | |
KR100961487B1 (ko) | 다이벤조에이에이취안트라센 노출 여부 확인용 바이오마커및 이를 이용한 확인 방법 | |
KR100957055B1 (ko) | 트리클로로에틸렌 노출 여부 확인용 바이오마커 및 이를이용한 확인 방법 | |
KR102101807B1 (ko) | 인슐린 저항성 진단용 조성물 및 이의 용도 | |
KR100958545B1 (ko) | 벤조케이플루오란텐 노출 여부 확인용 바이오마커 및 이를이용한 확인 방법 | |
KR101749566B1 (ko) | 디젤 배기 미립자(diesel exhaust particle) 노출에 따른 염증반응 관련 유전자 발현 여부 확인용 바이오마커 및 이를 이용한 확인 방법 | |
Verner et al. | Gene expression profiling of acute graft-vs-host disease after hematopoietic stem cell transplantation | |
KR101018788B1 (ko) | 클로르덴 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR100974228B1 (ko) | 최기형성 및 부작용 유발 약물 검색용 바이오마커 및 이를이용한 최기형성 및 부작용 유발 약물 검색 방법 | |
KR100936286B1 (ko) | 아미오다론 처리에 따른, 폐독성 유발 약물 검색용마커유전자 및 이를 이용한 검색 방법 | |
KR101011155B1 (ko) | 아미오다론 및 카르바마제핀 처리에 따른, 폐독성 유발약물 검색용 마커유전자 및 이를 이용한 검색 방법 | |
KR100915898B1 (ko) | 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 | |
KR101108694B1 (ko) | 메토트렉세이트 처리에 따른, 최기형성 유발 약물 검색용바이오마커 및 이를 이용한 검색 방법 | |
US20140066324A1 (en) | Gene expression signature in skin predicts response to mycophenolate mofetil | |
KR20100094705A (ko) | 톡사펜 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR100978791B1 (ko) | 디클로로메탄 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR101386075B1 (ko) | 헥사클로로벤젠 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR20210049684A (ko) | 피막형 여포변이 갑상선 유두암과 유두암종유사핵모양비침습소포종양 분류용 조성물 및 이를 이용한 분류 방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E90F | Notification of reason for final refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20130628 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20140701 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20150630 Year of fee payment: 6 |
|
LAPS | Lapse due to unpaid annual fee |