KR100915898B1 - 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 - Google Patents
3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 Download PDFInfo
- Publication number
- KR100915898B1 KR100915898B1 KR1020070017534A KR20070017534A KR100915898B1 KR 100915898 B1 KR100915898 B1 KR 100915898B1 KR 1020070017534 A KR1020070017534 A KR 1020070017534A KR 20070017534 A KR20070017534 A KR 20070017534A KR 100915898 B1 KR100915898 B1 KR 100915898B1
- Authority
- KR
- South Korea
- Prior art keywords
- genebank
- protein
- gene
- registration number
- gene registration
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 다환 방향족 탄화수소류 중의 하나인 3-메틸콜란트렌(3-methylcholanthrene)에 대한 노출 여부 진단용 바이오마커 및 이를 이용한 진단 방법에 관한 것으로, 구체적으로 3-메틸콜란트렌에 특이적으로 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법에 관한 것이며, 본 발명의 바이오마커는 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 환경 시료에서 3-메틸콜란트렌의 오염을 모니터링 및 판정하는데 유용하게 사용될 수 있으며, 3-메틸콜란트렌에 의해 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.
3-메틸콜란트렌, 다환 방향족 탄화수소, 마이크로어레이 칩
Description
도 1은 3-메틸콜란트렌(3-methylcholanthrene)의 인간 간암 세포주에서의 세포 독성을 조사한 그래프이다.
도 2는 마이크로어레이 칩을 이용한 3-메틸콜란트렌을 처리한 인간 간암 세포주의 유전자 발현 양상을 분석한 결과를 나타낸 도면이다.
본 발명은 3-메틸콜란트렌(3-methylcholanthrene)에 대한 노출 여부 진단용 바이오마커 및 이를 이용한 진단 방법에 관한 것으로, 더욱 상세하게는 3-메틸콜란트렌에 의해 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법에 관한 것이다.
다환 방향족 탄화수소류 중에서 3-메틸콜란트렌은 환경오염 물질은 아니지 만, 주로 생화학적인 연구 목적으로 사용되어진다. 동물성 지방을 섭취하게 되면 이것을 소화하기 위해서 데옥시콜린산이라는 담즙산이 분비되는데 이것이 장에 도달하면 장내세균에 의해 3-메틸콜란트렌이 생성되어지며, 이것이 결장암을 유발하는 발암물질로 알려져 있다. 3-메틸콜란트렌은 주로, 발암성 연구에서 cytocrome p450에 의해 특이적인 형태로 유발되는지를 조사하기 위한 연구 목적으로 사용되어진다. 3-메틸콜란트렌은 눈과 피부 접촉시 염증을 유발할 수 있으며, 동물 실험에서 피부암과 유방암을 유발한다고 보고되고 있어, 인간에서의 발암 가능성이 의심되고 있는 물질이다. 이외에는 태아의 성장에도 악영향을 미치는 것으로 보고되고 있으며, 최근에는 원숭이 간과 소장에서 3-메틸콜란트렌이 약물 대사 효소 유전자 발현에 미치는 영향에 관한 연구가 일부 진행되고 있다.
3-메틸콜란트렌은 토양 중에 노출되면 가수분해되거나 생물 분해 되지 않고 토양에 강하게 흡착되며, 수중에 방출되었을 때에도 저질층에 강하게 흡착되어 수생 생물들에서 생물농축이 일어난다.
다환방향족 탄화수소류의 발암성 정도와 유전자 발현 변화에 대한 연구는 일부 보고되고 있지만, 대표적인 다환방향족 탄화수로류로 알려진 벤조에이파이렌 (Benzo[a]pyrene)에 대한 연구에 거의 국한되어 있다. 이처럼 3-메틸콜란트렌의 인간에 대한 발암 가능성에도 불구하고, 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법에 국한되어 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분 석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한 screening 방법, 예를 들면 primer를 이용하는 real-time PCR(Real-time reverse transcript polymerase chain reaction)또는 DNA 마이크로어레이 칩 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 3-메틸콜란트렌의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.
포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고 되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행한다(Schena, M., et al ., Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996).
마이크로어레이는 cDNA(complementary DNA)나 20 - 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화 하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer, K and Belbin, T.J., J. Am . Acad . Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix 사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어 지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer, K. and Belbin, T.J., J. Am . Acad. Dermatol. 51:681-692, 2004).
유전자의 발현을 분석을 위해서는 조직 등 시료에서 RNA를 얻어 DNA 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 RNA는 형광이나 동위원소로 표지화하며, cDNA로 전환시킨다. 올리고 마이크로어레이는 주로 두개의 다른 형광(예: Cye3 및 Cye5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 교잡 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Somasundaram, K., et al ., Genomics Proteomics I:1-10, 2002).
최근 DNA 마크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 진단이 가능하게 될 것이다.
이에 본 발명자들은 인간 유전자 4만 1천개가 집적된 올리고마이크로어레이를 이용하여 3-메틸콜란트렌의 유전자 발현 프로파일을 인간 간암 세포인 HepG2 세포주에서 관찰 및 분석함으로써 3-메틸콜란트렌에 의해 과발현 또는 저발현 되는 유전자를 발굴하고, 실시간(real-time) RT-PCR 방법에 의해 상기 유전자들의 발현 양상을 확인함으로써 3-메틸콜란트렌을 검출할 수 있는 바이오마커 및 이를 이용한 노출 여부를 진단하는 방법을 확립하여 본 발명을 완성하였다.
본 발명의 목적은 3-메틸콜란트렌의 노출에 의해 과발현 또는 저발현되는 바이오마커 및 상기 바이오마커를 이용한 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 3-메틸콜란트렌(3-methylcholanthrene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 3-메틸콜란트렌에 대한 노출 여부 진단용 바이오마커를 제공한다.
또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보가닥 분자가 집적된 3-메틸콜란트렌에 대한 노출 여부 진단용 DNA 마이크로어레이 칩을 제공한다.
또한, 본 발명은 상기 바이오마커를 이용한 3-메틸콜란트렌에 대한 노출 여 부를 진단하는 방법을 제공한다.
아울러, 본 발명은 3-메틸콜란트렌에 대한 노출 여부 진단용 검색 키트를 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명은 3-메틸콜란트렌에의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 3-메틸콜란트렌에 대한 노출 여부 진단용 바이오마커를 제공한다.
상기 바이오마커는 2배 이상 발현이 증가 및 감소한 유전자로써, 대사(고분자, 뉴클레오타이드, 지방산 대사), 신호 변환(signal transduction), 세포기관 구성 및 발생(organelle organization and biogenesis), 면역반응, 전사조절, 아팝토시스(apoptosis), 세포 주기, 세포 증식, 화학물질 자극 반응 (response to chemical stimulus), 전달, DNA 수복(repair), 면역 반응 관련 유전자로 구성되어 있다.
본 발명은 하기와 같이 구성된 군에서 선택되어지는 것을 특징으로 하는 바이오마커를 제공한다: 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_203347(MSFL2541), 유전자 등록번호(Genebank) NM_006227(Phospholipid transfer protein), 유전자 등록번호(Genebank) NM_018837(Sulfatase 2), 유전자 등록번호(Genebank) NM_001769(CD9 molecule), 유전자 등록번호(Genebank) NM_001402(Eukaryotic translation elongation factor 1 alpha 1), 유전자 등록번 호(Genebank) NM_170693(Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(Genebank) NM_021599(ADAM metallopeptidase with thrombospondin type 1 motif, 2), 유전자 등록번호(Genebank) NM_001017973[Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II], 유전자 등록번호(Genebank) NM_032324(Chromosome 1 open reading frame 57), 유전자 등록번호(Genebank) NM_198194(Stomatin), 유전자 등록번호(Genebank) NM_016368(Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) NM_030569[Inter-alpha (globulin) inhibitor H5], 유전자 등록번호(Genebank) NM_001748[Calpain 2, (m/II) large subunit], 유전자 등록번호(Genebank) NM_012467(Tryptase gamma 1), 유전자 등록번호(Genebank) NM_001917(D-amino-acid oxidase), 유전자 등록번호(Genebank) NM_015920(Ribosomal protein S27-like), 유전자 등록번호(Genebank) NM_001009820[Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen)], 유전자 등록번호(Genebank) NM_014010(Pregnancy-associated plasma protein A, pappalysin 1), 유전자 등록번호(Genebank) NM_152640[DCP1 decapping enzyme homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) NM_001019(Ribosomal protein S15a), 유전자 등록번호(Genebank) NM_002842(Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(Genebank) NM_001004(Tetraspanin 4), 유전자 등록번호(Genebank) NM_006929[Superkiller viralicidic activity 2-like (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012190(Aldehyde dehydrogenase 1 family, member L1), 유전 자 등록번호(Genebank) NM_032872(Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000480[Adenosine monophosphate deaminase (isoform E)], 유전자 등록번호(Genebank) NM_000476(Adenylate kinase 1), 유전자 등록번호(Genebank) NM_018161(NAD synthetase 1), 유전자 등록번호(Genebank) NM_003516(Histone cluster 2, H2aa3), 유전자 등록번호(Genebank) NM_021063(Histone cluster 1, H2bd), 유전자 등록번호(Genebank) NM_001005749[Glucosidase, beta; acid (includes glucosylceramidase)], 유전자 등록번호(Genebank) NM_005319(Histone cluster 1, H1c), 유전자 등록번호(Genebank) NM_001015053(Histone deacetylase 5), 유전자 등록번호(Genebank) NM_003528(Histone cluster 2, H2be), 유전자 등록번호(Genebank) NM_002778[Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)], 유전자 등록번호(Genebank) NM_021058(Histone cluster 1, H2bj), 유전자 등록번호(Genebank) NM_003524(Histone cluster 1, H2bh), 유전자 등록번호(Genebank) NM_003519(Histone cluster 1, H2bl), 유전자 등록번호(Genebank) NM_033445(Histone cluster 3, H2a), 유전자 등록번호(Genebank) NM_005572(Lamin A/C), 유전자 등록번호(Genebank) NM_003520(Histone cluster 1, H2bn), 유전자 등록번호(Genebank) NM_003527(Histone cluster 1, H2bo), 유전자 등록번호(Genebank) NM_175055(Histone cluster 3, H2bb), 유전자 등록번호(Genebank) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번 호(Genebank) NM_201525(G protein-coupled receptor 56), 유전자 등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자 등록번호(Genebank) NM_175744(Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자 등록번호(Genebank) NM_006018(G protein-coupled receptor 109B), 유전자 등록번호(Genebank) NM_005310(Growth factor receptor-bound protein 7), 유전자 등록번호(Genebank) NM_002926(Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자 등록번호(Genebank) NM_002194(Inositol polyphosphate-1-phosphatase), 유전자 등록번호(Genebank) BC064982(MCF.2 cell line derived transforming sequence-like), 유전자 등록번호(Genebank) NM_001005339(Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) NM_021077(Neuromedin B), 유전자 등록번호(Genebank) NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_018494(Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) NM_033285(Tumor protein p53 inducible nuclear protein 1), 유전자 등록번호(Genebank) NM_001197[BCL2-interacting killer (apoptosis-inducing)], 유전자 등록번호(Genebank) NM_001540(Heat shock 27 kDa protein 1), 유전자 등록번호(Genebank) NM_003820[Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)], 유전자 등록번호(Genebank) NM_147780(Cathepsin B), 유전자 등록번호(Genebank) NM_001003940(Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_000389[Cyclin-dependent kinase inhibitor 1A (p21, Cip1)], 유전자 등록번호(Genebank) NM_016639(Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) NM_000043[Fas (TNF receptor superfamily, member 6)], 유전자 등록번호(Genebank) NM_002307[Lectin, galactoside-binding, soluble, 7 (galectin 7)], 유전자 등록번호(Genebank) NM_021603(FXYD domain containing ion transport regulator 2), 유전자 등록번호(Genebank) NM_004925[Aquaporin 3 (Gill blood group)], 유전자 등록번호(Genebank) NM_000014(Alpha-2-macroglobulin), 유전자 등록번호(Genebank) NM_022449(RAB17, member RAS oncogene family), 유전자 등록번호(Genebank) NM_005855[Receptor (G protein-coupled) activity modifying protein 1], 유전자 등록번호(Genebank) NM_006868(RAB31, member RAS oncogene family), 유전자 등록번호(Genebank) NM_032493(Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) NM_007097[Clathrin, light chain (Lcb)], 유전자 등록번호(Genebank) NM_005697(Secretory carrier membrane protein 2), 유전자 등록번호(Genebank) NM_004073[Polo-like kinase 3 (Drosophila)], 유전자 등록번호(Genebank) NM_182795(Nucleophosmin/ nucleoplasmin, 2), 유전자 등록번호(Genebank) NM_005072(Solute carrier family 12 (potassium/chloride transporters), member 4), 유전자 등록번호(Genebank) NM_144606(Folliculin), 유전자 등록번호(Genebank) NM_014059(Response gene to complement 32), 유전자 등록번호(Genebank) NM_002754(Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_013376(SERTA domain containing 1), 유전자 등록번호(Genebank) NM_000107(Damage-specific DNA binding protein 2, 48 kDa), 유전자 등록번호(Genebank) NM_004433[E74-like factor 3 (ets domain transcription factor, epithelial-specific)], 유전자 등록번호(Genebank) NM_021969(Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) NM_023039[Ankyrin repeat, family A (RFXANK-like), 2], 유전자 등록번호(Genebank) NM_080875[Mindbomb homolog 2 (Drosophila)], 유전자 등록번호(Genebank) NM_002166(Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(Genebank) NM_001421[E74-like factor 4 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_153813(Zinc finger protein, multitype 1), 유전자 등록번호(Genebank) U68019(SMAD family member 3), 유전자 등록번호(Genebank) NM_015655(Zinc finger protein 337), 유전자 등록번호(Genebank) NM_031918(Kruppel-like factor 16), 유전자 등록번호(Genebank) NM_001554(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_003960(N-acetyltransferase 8), 유전자 등록번호(Genebank) NM_032965[Chemokine (C-C motif) ligand 15], 유전자 등록번호(Genebank) NM_201397(Glutathione peroxidase 1), 유전자 등록번호(Genebank) NM_005064[Chemokine (C-C motif) ligand 23], 유전자 등록번호(Genebank) NM_005345(Heat shock 70 kDa protein 1A), 유전자 등록번호(Genebank) NM_001531(Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) NM_006404[Protein C receptor, endothelial (EPCR)], 유전자 등록번호(Genebank) NM_002119(Major histocompatibility complex, class II, DO alpha), 유전자 등록번호(Genebank) NM_005101(ISG15 ubiquitin-like modifier), 유전자 등록번호(Genebank) NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_020728[Family with sequence similarity 62 (C2 domain containing) member B], 유전자 등록번호(Genebank) NM_016441[Cysteine rich transmembrane BMP regulator 1 (chordin-like)], 유전자 등록번호(Genebank) NM_203391(Glycerol kinase), 유전자 등록번호(Genebank) NM_006775[Quaking homolog, KH domain RNA binding (mouse)], 유전자 등록번호(Genebank) NM_052937[Protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1], 유전자 등록번호(Genebank) NM_003932[Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)], 유전자 등록번호(Genebank) NM_030979[Poly(A) binding protein, cytoplasmic 3], 유전자 등록번호(Genebank) NM_032549[IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)], 유전자 등록번호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유전자 등록번호(Genebank) NM_002139(RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) BC033021(Klotho beta), 유전자 등록번 호(Genebank) NM_016093(Ribosomal protein L26-like 1), 유전자 등록번호(Genebank) CR611166[Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)], 유전자 등록번호(Genebank) NM_017437(Cleavage and polyadenylation specific factor 2, 100 kDa), 유전자 등록번호(Genebank) NM_033114(Zinc finger CCHC-type and RNA binding motif 1), 유전자 등록번호(Genebank) NM_000236(Lipase, hepatic), 유전자 등록번호(Genebank) NM_174936(Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_004375(COX11 homolog, cytochrome c oxidase assembly protein (yeast)), 유전자 등록번호(Genebank) NM_004685(Myotubularin related protein 6), 유전자 등록번호(Genebank) NM_052965(Chromosome 1 open reading frame 19), 유전자 등록번호(Genebank) NM_201278(Myotubularin related protein 2), 유전자 등록번호(Genebank) NM_003093(Small nuclear ribonucleoprotein polypeptide C), 유전자 등록번호(Genebank) AV757313(Ribosomal protein L9), 유전자 등록번호(Genebank) NM_014791(Maternal embryonic leucine zipper kinase), 유전자 등록번호(Genebank) BX537987[Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)], 유전자 등록번호(Genebank) BC041925[Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자 등록번호(Genebank) BC032643(Synaptotagmin binding, cytoplasmic RNA interacting protein), 유전자 등록번호(Genebank) NM_016058(TP53RK binding protein), 유전자 등록번호(Genebank) NM_181886[Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast), 유전자 등록번호(Genebank) NM_016271(Ring finger protein 138), 유전자 등록번호(Genebank) AK021676(Phosphoglucomutase 3), 유전자 등록번호(Genebank) NM_015352(Protein O-fucosyltransferase 1), 유전자 등록번호(Genebank) NM_016304(Chromosome 15 open reading frame 15), 유전자 등록번호(Genebank) NM_020995(Haptoglobin), 유전자 등록번호(Genebank) NM_003017(Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) W04231(Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) NM_006546(Insulin-like growth factor 2 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_212554(Similar to CG9643-PA), 유전자 등록번호(Genebank) BC049823(Ribosomal protein L22-like 1), 유전자 등록번호(Genebank) NM_006937[SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012331(Methionine sulfoxide reductase A), 유전자 등록번호(Genebank) NM_005875(Eukaryotic translation initiation factor 1B), 유전자 등록번호(Genebank) NM_032906(Phosphatidylinositol glycan anchor biosynthesis, class Y), 유전자 등록번호(Genebank) NM_002847(Protein tyrosine phosphatase, receptor type, N polypeptide 2), 유전자 등록번호(Genebank) NM_000947(Primase, polypeptide 2A, 58 kDa), 유전자 등록번호(Genebank) NM_181716 (Phosphatidylinositol glycan anchor biosynthesis, class L), 유전자 등록번호(Genebank) NM_004681(Eukaryotic translation initiation factor 1A, Y-linked), 유전자 등록번호(Genebank) NM_000982(Ribosomal protein L21), 유전자 등록번호(Genebank) T07777(Similar to basic leucine zipper and W2 domains 1), 유전자 등록번호(Genebank) NM_016652(Crn, crooked neck-like 1 (Drosophila)), 유전자 등록번호(Genebank) NM_000986(Ribosomal protein L24), 유전자 등록번호(Genebank) NM_139207(Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AK001406(SUMO1/sentrin specific peptidase 6), 유전자 등록번호(Genebank) NM_145649[Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)], 유전자 등록번호(Genebank) NM_020236(Mitochondrial ribosomal protein L1), 유전자 등록번호(Genebank) NM_001017430[RNA binding motif (RNP1, RRM) protein 3], 유전자 등록번호(Genebank) NM_031157(Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_018981[DnaJ (Hsp40) homolog, subfamily C, member 10], 유전자 등록번호(Genebank) NM_018291(Hypothetical protein FLJ10986), 유전자 등록번호(Genebank) NM_018048(Mago-nashi homolog 2), 유전자 등록번호(Genebank) NM_012207[Heterogeneous nuclear ribonucleoprotein H3 (2H9)], 유전자 등록번호(Genebank) NM_000028[Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III)], 유전자 등록번호(Genebank) NM_014321[Origin recognition complex, subunit 6 like (yeast)], 유전자 등록번호(Genebank) NM_015423(Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase), 유전자 등록번호(Genebank) NM_001034(Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AB032990(Family with sequence similarity 63, member B), 유전자 등록번호(Genebank) NM_000791(Dihydrofolate reductase), 유전자 등록번호(Genebank) NM_199040[Nudix (nucleoside diphosphate linked moiety X)-type motif 4], 유전자 등록번호(Genebank) NM_006886(ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit), 유전자 등록번호(Genebank) NM_004457(Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_007295(Breast cancer 1, early onset), 유전자 등록번호(Genebank) NM_006111[Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)], 유전자 등록번호(Genebank) NM_001443(Fatty acid binding protein 1, liver), 유전자 등록번호(Genebank) NM_000016(Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_001809(Centromere protein A), 유전자 등록번호(Genebank) AL833119(Hypothetical protein DKFZp313A2432), 유전자 등록번호(Genebank) NM_006493(Ceroid-lipofuscinosis, neuronal 5), 유전자 등록번호(Genebank) NM_138271[Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_006136[Capping protein (actin filament) muscle Z-line, alpha 2], 유전자 등록번호(Genebank) CR615278(H2A histone family, member V), 유전자 등록번호(Genebank) NM_024704(Chromosome 20 open reading frame 23), 유전자 등록번호(Genebank) NM_003011[SET translocation (myeloid leukemia-associated)], 유전자 등록번 호(Genebank) NM_203401(Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR749233(Zinc finger protein 626), 유전자 등록번호(Genebank) AF277624(Zinc finger protein 479), 유전자 등록번호(Genebank) NM_013282(Ubiquitin-like, containing PHD and RING finger domains, 1), 유전자 등록번호(Genebank) NM_198893(Zinc finger protein 160), 유전자 등록번호(Genebank) NM_013361(Zinc finger protein 223), 유전자 등록번호(Genebank) NM_002129(High-mobility group box 2), 유전자 등록번호(Genebank) NM_002128(High-mobility group box 1), 유전자 등록번호(Genebank) NM_003429(Zinc finger protein 85), 유전자 등록번호(Genebank) NM_003423(Zinc finger protein 43), 유전자 등록번호(Genebank) NM_016220(Zinc finger protein 588), 유전자 등록번호(Genebank) NM_022103(Zinc finger protein 667), 유전자 등록번호(Genebank) NM_021269(Zinc finger protein 708), 유전자 등록번호(Genebank) NM_016649[ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_199132(Zinc finger protein 468), 유전자 등록번호(Genebank) AK098175(Zinc finger protein 283), 유전자 등록번호(Genebank) NM_198381[E74-like factor 5 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_138330(Zinc finger protein 675), 유전자 등록번호(Genebank) NM_030824(Zinc finger protein 442), 유전자 등록번호(Genebank) NM_003441(Zinc finger protein 141), 유전자 등록번호(Genebank) NM_001001415(Zinc finger protein 493), 유전자 등록번호(Genebank) AK128731(Activating transcription factor 2), 유전자 등록번호(Genebank) NM_203282(Zinc finger protein 254), 유전자 등록번호(Genebank) CR627133(Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_007139(Zinc finger protein 92), 유전자 등록번호(Genebank) NM_178558(Zinc finger protein 680), 유전자 등록번호(Genebank) NM_024498(Zinc finger protein 117), 유전자 등록번호(Genebank) NM_003430(Zinc finger protein 91), 유전자 등록번호(Genebank) NM_003410(Zinc finger protein, X-linked), 유전자 등록번호(Genebank) NM_178549(Zinc finger protein 678), 유전자 등록번호(Genebank) NM_152601(Zinc finger protein 564), 유전자 등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자 등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자 등록번호(Genebank) NM_145233(Zinc finger protein 20), 유전자 등록번호(Genebank) NM_031942(Cell division cycle associated 7), 유전자 등록번호(Genebank) NM_133473(Zinc finger protein 714), 유전자 등록번호(Genebank) NM_005655(Kruppel-like factor 10), 유전자 등록번호(Genebank) NM_021994(Zinc finger protein 277 pseudogene), 유전자 등록번호(Genebank) NM_025189(Zinc finger protein 430), 유전자 등록번호(Genebank) NM_001008390(CGG triplet repeat binding protein 1), 유전자 등록번호(Genebank) NM_024087(Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(Genebank) NM_032828(Zinc finger protein 587), 유전자 등록번호(Genebank) NM_006980(Mitochondrial transcription termination factor), 유전자 등록번호(Genebank) NM_024561(NMDA receptor regulated 1-like), 유전자 등록번호(Genebank) NM_173531(Zinc finger protein 100), 유전자 등록번호(Genebank) NM_003864(Sin3A-associated protein, 30 kDa), 유전자 등록번호(Genebank) NM_012345(Nuclear fragile X mental retardation protein interacting protein 1), 유전자 등록번호(Genebank) NM_003079(SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1), 유전자 등록번호(Genebank) NM_006193(Paired box gene 4), 유전자 등록번호(Genebank) NM_003599[Suppressor of Ty 3 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006311(Nuclear receptor co-repressor 1), 유전자 등록번호(Genebank) NM_020675[Spindle pole body component 25 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_145697[NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) NM_002358[MAD2 mitotic arrest deficient-like 1 (yeast)], 유전자 등록번호(Genebank) NM_006716[DBF4 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) NM_018131(Centrosomal protein 55 kDa), 유전자 등록번호(Genebank) NM_012177(F-box protein 5), 유전자 등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자 등록번호(Genebank) NM_018136[Asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자 등록번호(Genebank) NM_014750[Discs, large homolog 7 (Drosophila)], 유전자 등록번호(Genebank) NM_016343[Centromere protein F, 350/400 ka (mitosin)], 유전자 등록번호(Genebank) NM_017489[Telomeric repeat binding factor (NIMA-interacting) 1], 유전자 등록번호(Genebank) NM_006461[Sperm associated antigen 5], 유전자 등록번호(Genebank) NM_001790[Cell division cycle 25 homolog C (S. cerevisiae)], 유전자 등록번호(Genebank) NM_004064[Cyclin-dependent kinase inhibitor 1B (p27, Kip1)], 유전자 등록번호(Genebank) NM_080668(Cell division cycle associated 5), 유전자 등록번호(Genebank) NM_021211(Eukaryotic translation initiation factor 4 gamma, 2), 유전자 등록번호(Genebank) NM_001274[CHK1 checkpoint homolog (S. pombe)] 유전자 등록번호(Genebank), NM_001005414(ZW10 interactor), 유전자 등록번호(Genebank) NM_144710(Septin 10), 유전자 등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자 등록번호(Genebank) NM_005496(Structural maintenance of chromosomes 4), 유전자 등록번호(Genebank) NM_181803(Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) NM_018101(Cell division cycle associated 8), 유전자 등록번호(Genebank) AF147440(Kinesin family member 15), 유전자 등록번호(Genebank) NM_005030[Polo-like kinase 1 (Drosophila)], 유전자 등록번호(Genebank) NM_022346(Non-SMC condensin I complex, subunit G), 유전자 등록번호(Genebank) NM_019084(Cyclin J), 유전자 등록번호(Genebank) NM_005504(Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_004523(Kinesin family member 11), 유전자 등록번호(Genebank) NM_004354(Cyclin G2), 유전자 등 록번호(Genebank) NM_001237(Cyclin A2), 유전자 등록번호(Genebank) NM_032626(Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) NM_021930(RAD50 interactor 1), 유전자 등록번호(Genebank) NM_018685(Anillin, actin binding protein), 유전자 등록번호(Genebank) NM_016195(M-phase phosphoprotein 1), 유전자 등록번호(Genebank) NM_001827(CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_138555(Kinesin family member 23), 유전자 등록번호(Genebank) NM_031966(Cyclin B1), 유전자 등록번호(Genebank) NM_005915[Minichromosome maintenance deficient 6 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_014751(Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_003981(Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_001826(CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) NM_198219(Inhibitor of growth family, member 1), 유전자 등록번호(Genebank) NM_014881[DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_001255[Cell division cycle 20 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_016359(Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AF085846[Rap guanine nucleotide exchange factor (GEF) 6], 유전자 등록번호(Genebank) NM_001656(Tripartite motif-containing 23), 유전자 등록번호(Genebank) NM_145307(Pleckstrin homology domain containing, family K member 1), 유전자 등록번호(Genebank) NM_080651(Thyroid hormone receptor associated protein 6), 유전자 등록번호(Genebank) NM_003714(Stanniocalcin 2), 유전자 등록번호(Genebank) NM_018098(Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) NM_004586(Ribosomal protein S6 kinase, 90 kDa, polypeptide 3), 유전자 등록번호(Genebank) NM_002317(Lysyl oxidase), 유전자 등록번호(Genebank) NM_031296(RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_014736(Casein kinase 1, gamma 1), 유전자 등록번호(Genebank) XM_292197(Diacylglycerol kinase, eta), 유전자 등록번호(Genebank) NM_016513[Intestinal cell (MAK-like) kinase], 유전자 등록번호(Genebank) NM_001331[Catenin (cadherin-associated protein), delta 1], 유전자 등록번호(Genebank) AB032991(Nedd4 family interacting protein 2), 유전자 등록번호(Genebank) NM_004232(Suppressor of cytokine signaling 6), 유전자 등록번호(Genebank) NM_003472[DEK oncogene (DNA binding)], 유전자 등록번호(Genebank) NM_012334(Myosin X), 유전자 등록번호(Genebank) NM_012425(Ras suppressor protein 1), 유전자 등록번호(Genebank) NM_002140(Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) NM_005271(Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) NM_145203(Casein kinase 1, alpha 1-like), 유전자 등록번호(Genebank) BU679059(GDP dissociation inhibitor 2), 유전자 등록번호(Genebank) NM_006305[Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A], 유전자 등록번호(Genebank) NM_020824(Rho GTPase activating protein 21), 유전자 등록번호(Genebank) NM_012120(CD2- associated protein), 유전자 등록번호(Genebank) NM_012089[ATP-binding cassette, sub-family B (MDR/TAP), member 10], 유전자 등록번호(Genebank) NM_021977[Solute carrier family 22 (extraneuronal monoamine transporter), member 3], 유전자 등록번호(Genebank) NM_015171(Exportin 6), 유전자 등록번호(Genebank) NM_016467[ORM1-like 1 (S. cerevisiae)], 유전자 등록번호(Genebank) AA484677[SEC22 vesicle trafficking protein homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) BC035622(Adaptor-related protein complex 4, sigma 1 subunit), 유전자 등록번호(Genebank) NM_002520(Nucleophosmin (nucleolar phosphoprotein B23, numatrin)), 유전자 등록번호(Genebank) NM_014043(Chromatin modifying protein 2B), 유전자 등록번호(Genebank) NM_003133(Signal recognition particle 9 kDa), 유전자 등록번호(Genebank) NM_013322(Sorting nexin 10), 유전자 등록번호(Genebank) NM_005733(Kinesin family member 20A), 유전자 등록번호(Genebank) NM_014322[Choroideremia-like (Rab escort protein 2)], 유전자 등록번호(Genebank) NM_020401(Nucleoporin 107 kDa), 유전자 등록번호(Genebank) NM_138285(Nucleoporin 35 kDa), 유전자 등록번호(Genebank) NM_001786(Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_001067[Topoisomerase (DNA) II alpha 170 kDa], 유전자 등록번호(Genebank) NM_001012271[Baculoviral IAP repeat-containing 5 (survivin)], 유전자 등록번호(Genebank) NM_024854(Islet amyloid polypeptide), 유전자 등록번호(Genebank) NM_021631(Apoptosis inhibitor), 유전자 등록번호(Genebank) NM_018204(Cytoskeleton associated protein 2), 유전자 등록번호(Genebank) NM_021999(Integral membrane protein 2B), 유전자 등록번호(Genebank) NM_005400(Protein kinase C, epsilon), 유전자 등록번호(Genebank) NM_148957(Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) NM_001006(Ribosomal protein S3A), 유전자 등록번호(Genebank) NM_006437(Poly (ADP-ribose) polymerase family, member 4), 유전자 등록번호(Genebank) NM_024055[Solute carrier family 30 (zinc transporter), member 5], 유전자 등록번호(Genebank) NM_000582[Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자 등록번호(Genebank) NM_016951(Chemokine-like factor), 유전자 등록번호(Genebank) NM_002737(Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_004836(Eukaryotic translation initiation factor 2-alpha kinase 3), 유전자 등록번호(Genebank) NM_020686(4-aminobutyrate aminotransferase), 유전자 등록번호(Genebank) NM_004134[Heat shock 70 kDa protein 9 (mortalin)], 유전자 등록번호(Genebank) NM_053039(UDP glucuronosyltransferase 2 family, polypeptide B28), 유전자 등록번호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유전자 등록번호(Genebank) NM_005256(Fanconi anemia, complementation group F), 유전자 등록번호(Genebank) NM_003368(Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_001018115(Fanconi anemia, complementation group D2), 유 전자 등록번호(Genebank) AI281523(Splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)), 유전자 등록번호(Genebank) NM_004075[Cryptochrome 1 (photolyase-like)], 유전자 등록번호(Genebank) NM_002389(CD46 molecule, complement regulatory protein), 유전자 등록번호(Genebank) NM_000584(Interleukin 8), 유전자 등록번호(Genebank) NM_001801(Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_000715(Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) NM_144503(F11 receptor), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) NM_001010914(Protein immuno-reactive with anti-PTH polyclonal antibodies).
상기 바이오마커 중에서 3-메틸콜란트렌의 노출에 의해 발현이 증가하는 바이오마커 유전자는 하기와 같다:
유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_203347(MSFL2541), 유전자 등록번호(Genebank) NM_006227(Phospholipid transfer protein), 유전자 등록번호(Genebank) NM_018837(Sulfatase 2), 유전자 등록번호(Genebank) NM_001769(CD9 molecule), 유전자 등록번호(Genebank) NM_001402(Eukaryotic translation elongation factor 1 alpha 1), 유전자 등록번호(Genebank) NM_170693(Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(Genebank) NM_021599(ADAM metallopeptidase with thrombospondin type 1 motif, 2), 유전자 등록번호(Genebank) NM_001017973[Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II], 유전자 등록번호(Genebank) NM_032324(Chromosome 1 open reading frame 57), 유전자 등록번호(Genebank) NM_198194(Stomatin), 유전자 등록번호(Genebank) NM_016368(Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) NM_030569[Inter-alpha (globulin) inhibitor H5], 유전자 등록번호(Genebank) NM_001748[Calpain 2, (m/II) large subunit], 유전자 등록번호(Genebank) NM_012467(Tryptase gamma 1), 유전자 등록번호(Genebank) NM_001917(D-amino-acid oxidase), 유전자 등록번호(Genebank) NM_015920(Ribosomal protein S27-like), 유전자 등록번호(Genebank) NM_001009820[Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen)], 유전자 등록번호(Genebank) NM_014010(Pregnancy-associated plasma protein A, pappalysin 1), 유전자 등록번호(Genebank) NM_152640[DCP1 decapping enzyme homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) NM_001019(Ribosomal protein S15a), 유전자 등록번호(Genebank) NM_002842(Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(Genebank) NM_001004(Tetraspanin 4), 유전자 등록번호(Genebank) NM_006929[Superkiller viralicidic activity 2-like (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012190(Aldehyde dehydrogenase 1 family, member L1), 유전자 등록번호(Genebank) NM_032872(Synaptotagmin-like 1), 유전자 등록번 호(Genebank) NM_000480[Adenosine monophosphate deaminase (isoform E)], 유전자 등록번호(Genebank) NM_000476(Adenylate kinase 1), 유전자 등록번호(Genebank) NM_018161(NAD synthetase 1), 유전자 등록번호(Genebank) NM_003516(Histone cluster 2, H2aa3), 유전자 등록번호(Genebank) NM_021063(Histone cluster 1, H2bd), 유전자 등록번호(Genebank) NM_001005749[Glucosidase, beta; acid (includes glucosylceramidase)], 유전자 등록번호(Genebank) NM_005319(Histone cluster 1, H1c), 유전자 등록번호(Genebank) NM_001015053(Histone deacetylase 5), 유전자 등록번호(Genebank) NM_003528(Histone cluster 2, H2be), 유전자 등록번호(Genebank) NM_002778[Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)], 유전자 등록번호(Genebank) NM_021058(Histone cluster 1, H2bj), 유전자 등록번호(Genebank) NM_003524(Histone cluster 1, H2bh), 유전자 등록번호(Genebank) NM_003519(Histone cluster 1, H2bl), 유전자 등록번호(Genebank) NM_033445(Histone cluster 3, H2a), 유전자 등록번호(Genebank) NM_005572(Lamin A/C), 유전자 등록번호(Genebank) NM_003520(Histone cluster 1, H2bn), 유전자 등록번호(Genebank) NM_003527(Histone cluster 1, H2bo), 유전자 등록번호(Genebank) NM_175055(Histone cluster 3, H2bb), 유전자 등록번호(Genebank) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_201525(G protein-coupled receptor 56), 유전자 등록번 호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자 등록번호(Genebank) NM_175744(Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자 등록번호(Genebank) NM_006018(G protein-coupled receptor 109B), 유전자 등록번호(Genebank) NM_005310(Growth factor receptor-bound protein 7), 유전자 등록번호(Genebank) NM_002926(Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자 등록번호(Genebank) NM_002194(Inositol polyphosphate-1-phosphatase), 유전자 등록번호(Genebank) BC064982(MCF.2 cell line derived transforming sequence-like), 유전자 등록번호(Genebank) NM_001005339(Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) NM_021077(Neuromedin B), 유전자 등록번호(Genebank) NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_018494(Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) NM_033285(Tumor protein p53 inducible nuclear protein 1), 유전자 등록번호(Genebank) NM_001197(BCL2-interacting killer (apoptosis-inducing)), 유전자 등록번호(Genebank) NM_001540(Heat shock 27 kDa protein 1), 유전자 등록번호(Genebank) NM_003820(Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)), 유전자 등록번호(Genebank) NM_147780(Cathepsin B), 유전자 등록번호(Genebank) NM_001003940(Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_000389[Cyclin-dependent kinase inhibitor 1A (p21, Cip1)], 유전자 등록번호(Genebank) NM_016639(Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) NM_000043[Fas (TNF receptor superfamily, member 6)], 유전자 등록번호(Genebank) NM_002307[Lectin, galactoside-binding, soluble, 7 (galectin 7)], 유전자 등록번호(Genebank) NM_021603(FXYD domain containing ion transport regulator 2), 유전자 등록번호(Genebank) NM_004925[Aquaporin 3 (Gill blood group)], 유전자 등록번호(Genebank) NM_000014(Alpha-2-macroglobulin), 유전자 등록번호(Genebank) NM_022449(RAB17, member RAS oncogene family), 유전자 등록번호(Genebank) NM_005855[Receptor (G protein-coupled) activity modifying protein 1], 유전자 등록번호(Genebank) NM_006868(RAB31, member RAS oncogene family), 유전자 등록번호(Genebank) NM_032493(Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) NM_007097[Clathrin, light chain (Lcb)], 유전자 등록번호(Genebank) NM_005697(Secretory carrier membrane protein 2), 유전자 등록번호(Genebank) NM_004073[Polo-like kinase 3 (Drosophila)], 유전자 등록번호(Genebank) NM_182795(Nucleophosmin/ nucleoplasmin, 2), 유전자 등록번호(Genebank) NM_005072[Solute carrier family 12 (potassium/chloride transporters), member 4], 유전자 등록번호(Genebank) NM_144606(Folliculin), 유전자 등록번호(Genebank) NM_014059(Response gene to complement 32), 유전자 등록번호(Genebank) NM_002754(Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_013376(SERTA domain containing 1), 유전자 등록번호(Genebank) NM_000107(Damage-specific DNA binding protein 2, 48 kDa), 유전자 등록번호(Genebank) NM_004433[E74-like factor 3 (ets domain transcription factor, epithelial-specific)], 유전자 등록번호(Genebank) NM_021969(Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) NM_023039[Ankyrin repeat, family A (RFXANK-like), 2], 유전자 등록번호(Genebank) NM_080875[Mindbomb homolog 2 (Drosophila)], 유전자 등록번호(Genebank) NM_002166(Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(Genebank) NM_001421[E74-like factor 4 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_153813(Zinc finger protein, multitype 1), 유전자 등록번호(Genebank) U68019(SMAD family member 3), 유전자 등록번호(Genebank) NM_015655(Zinc finger protein 337), 유전자 등록번호(Genebank) NM_031918(Kruppel-like factor 16), 유전자 등록번호(Genebank) NM_001554(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_003960(N-acetyltransferase 8), 유전자 등록번호(Genebank) NM_032965[Chemokine (C-C motif) ligand 15], 유전자 등록번호(Genebank) NM_201397(Glutathione peroxidase 1), 유전자 등록번호(Genebank) NM_005064[Chemokine (C-C motif) ligand 23], 유전자 등록번호(Genebank) NM_005345(Heat shock 70 kDa protein 1A), 유전자 등록번호(Genebank) NM_001531(Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) NM_006404[Protein C receptor, endothelial (EPCR)], 유전자 등록번호(Genebank) NM_002119(Major histocompatibility complex, class II, DO alpha), 유전자 등록번호(Genebank) NM_005101(ISG15 ubiquitin-like modifier), 유전자 등록번호(Genebank) NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_020728[Family with sequence similarity 62 (C2 domain containing) member B].
상기 바이오마커 중에서, 3-메틸콜란트렌의 노출에 의해 발현이 감소하는 바이오마커 유전자는 하기와 같다:
유전자 등록번호(Genebank) NM_016441[Cysteine rich transmembrane BMP regulator 1 (chordin-like)], 유전자 등록번호(Genebank) NM_203391(Glycerol kinase), 유전자 등록번호(Genebank) NM_006775[Quaking homolog, KH domain RNA binding (mouse)], 유전자 등록번호(Genebank) NM_052937[Protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1], 유전자 등록번호(Genebank) NM_003932[Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)], 유전자 등록번호(Genebank) NM_030979(Poly(A) binding protein, cytoplasmic 3), 유전자 등록번호(Genebank) NM_032549[IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)], 유전자 등록번 호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유전자 등록번호(Genebank) NM_002139(RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) BC033021(Klotho beta), 유전자 등록번호(Genebank) NM_016093(Ribosomal protein L26-like 1), 유전자 등록번호(Genebank) CR611166[Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)], 유전자 등록번호(Genebank) NM_017437(Cleavage and polyadenylation specific factor 2, 100 kDa), 유전자 등록번호(Genebank) NM_033114(Zinc finger CCHC-type and RNA binding motif 1), 유전자 등록번호(Genebank) NM_000236(Lipase, hepatic), 유전자 등록번호(Genebank) NM_174936(Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_004375(COX11 homolog, cytochrome c oxidase assembly protein (yeast)), 유전자 등록번호(Genebank) NM_004685(Myotubularin related protein 6), 유전자 등록번호(Genebank) NM_052965(Chromosome 1 open reading frame 19), 유전자 등록번호(Genebank) NM_201278(Myotubularin related protein 2), 유전자 등록번호(Genebank) NM_003093(Small nuclear ribonucleoprotein polypeptide C), 유전자 등록번호(Genebank) AV757313(Ribosomal protein L9), 유전자 등록번호(Genebank) NM_014791(Maternal embryonic leucine zipper kinase), 유전자 등록번호(Genebank) BX537987[Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)], 유전자 등록번호(Genebank) BC041925[Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유 전자 등록번호(Genebank) BC032643(Synaptotagmin binding, cytoplasmic RNA interacting protein), 유전자 등록번호(Genebank) NM_016058(TP53RK binding protein), 유전자 등록번호(Genebank) NM_181886[Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)], 유전자 등록번호(Genebank) NM_016271(Ring finger protein 138), 유전자 등록번호(Genebank) AK021676(Phosphoglucomutase 3), 유전자 등록번호(Genebank) NM_015352(Protein O-fucosyltransferase 1), 유전자 등록번호(Genebank) NM_016304(Chromosome 15 open reading frame 15), 유전자 등록번호(Genebank) NM_020995(Haptoglobin), 유전자 등록번호(Genebank) NM_003017(Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) W04231(Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) NM_006546(Insulin-like growth factor 2 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_212554(Similar to CG9643-PA), 유전자 등록번호(Genebank) BC049823(Ribosomal protein L22-like 1), 유전자 등록번호(Genebank) NM_006937[SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012331(Methionine sulfoxide reductase A), 유전자 등록번호(Genebank) NM_005875(Eukaryotic translation initiation factor 1B), 유전자 등록번호(Genebank) NM_032906(Phosphatidylinositol glycan anchor biosynthesis, class Y), 유전자 등록번호(Genebank) NM_002847(Protein tyrosine phosphatase, receptor type, N polypeptide 2), 유전자 등록번호(Genebank) NM_000947(Primase, polypeptide 2A, 58 kDa), 유전자 등록번호(Genebank) NM_181716 (Phosphatidylinositol glycan anchor biosynthesis, class L), 유전자 등록번호(Genebank) NM_004681(Eukaryotic translation initiation factor 1A, Y-linked), 유전자 등록번호(Genebank) NM_000982(Ribosomal protein L21), 유전자 등록번호(Genebank) T07777(Similar to basic leucine zipper and W2 domains 1), 유전자 등록번호(Genebank) NM_016652[Crn, crooked neck-like 1 (Drosophila)], 유전자 등록번호(Genebank) NM_000986(Ribosomal protein L24), 유전자 등록번호(Genebank) NM_139207(Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AK001406(SUMO1/sentrin specific peptidase 6), 유전자 등록번호(Genebank) 유전자 등록번호(Genebank) NM_145649[Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)], 유전자 등록번호(Genebank) NM_020236(Mitochondrial ribosomal protein L1), 유전자 등록번호(Genebank) NM_001017430[RNA binding motif (RNP1, RRM) protein 3], 유전자 등록번호(Genebank) NM_031157(Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_018981[DnaJ (Hsp40) homolog, subfamily C, member 10], 유전자 등록번호(Genebank) NM_018291(Hypothetical protein FLJ10986), 유전자 등록번호(Genebank) NM_018048(Mago-nashi homolog 2), 유전자 등록번호(Genebank) NM_012207[Heterogeneous nuclear ribonucleoprotein H3 (2H9)], 유전자 등록번호(Genebank) NM_000028[Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III)], 유전자 등록번호(Genebank) NM_014321(Origin recognition complex, subunit 6 like (yeast)), 유전자 등록번호(Genebank) NM_015423(Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase), 유전자 등록번호(Genebank) NM_001034(Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AB032990(Family with sequence similarity 63, member B), 유전자 등록번호(Genebank) NM_000791(Dihydrofolate reductase), 유전자 등록번호(Genebank) NM_199040[Nudix (nucleoside diphosphate linked moiety X)-type motif 4], 유전자 등록번호(Genebank) NM_006886(ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit), 유전자 등록번호(Genebank) NM_004457(Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_007295(Breast cancer 1, early onset), 유전자 등록번호(Genebank) NM_006111[Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)], 유전자 등록번호(Genebank) NM_001443(Fatty acid binding protein 1, liver), 유전자 등록번호(Genebank) NM_000016(Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_001809(Centromere protein A), 유전자 등록번호(Genebank) AL833119(Hypothetical protein DKFZp313A2432), 유전자 등록번호(Genebank) NM_006493(Ceroid-lipofuscinosis, neuronal 5), 유전자 등록번호(Genebank) NM_138271[Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_006136(Capping protein (actin filament) muscle Z-line, alpha 2), 유전자 등록번호(Genebank) CR615278(H2A histone family, member V), 유전자 등록번호(Genebank) NM_024704(Chromosome 20 open reading frame 23), 유전자 등록번호(Genebank) NM_003011[SET translocation (myeloid leukemia-associated)], 유전자 등록번호(Genebank) NM_203401(Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR749233(Zinc finger protein 626), 유전자 등록번호(Genebank) AF277624(Zinc finger protein 479), 유전자 등록번호(Genebank) NM_013282(Ubiquitin-like, containing PHD and RING finger domains, 1), 유전자 등록번호(Genebank) NM_198893(Zinc finger protein 160), 유전자 등록번호(Genebank) NM_013361(Zinc finger protein 223), 유전자 등록번호(Genebank) NM_002129(High-mobility group box 2), 유전자 등록번호(Genebank) NM_002128(High-mobility group box 1), 유전자 등록번호(Genebank) NM_003429(Zinc finger protein 85), 유전자 등록번호(Genebank) NM_003423(Zinc finger protein 43), 유전자 등록번호(Genebank) NM_016220(Zinc finger protein 588), 유전자 등록번호(Genebank) NM_022103(Zinc finger protein 667), 유전자 등록번호(Genebank) NM_021269(Zinc finger protein 708), 유전자 등록번호(Genebank) NM_016649[ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_199132(Zinc finger protein 468), 유전자 등록번호(Genebank) AK098175(Zinc finger protein 283), 유전자 등록번호(Genebank) NM_198381[E74-like factor 5 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_138330(Zinc finger protein 675), 유전자 등록번호(Genebank) NM_030824(Zinc finger protein 442), 유전자 등록번호(Genebank) NM_003441(Zinc finger protein 141), 유전자 등록번호(Genebank) NM_001001415(Zinc finger protein 493), 유전자 등록번호(Genebank) AK128731(Activating transcription factor 2), 유전자 등록번호(Genebank) NM_203282(Zinc finger protein 254), 유전자 등록번호(Genebank) CR627133(Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_007139(Zinc finger protein 92), 유전자 등록번호(Genebank) NM_178558(Zinc finger protein 680), 유전자 등록번호(Genebank) NM_024498(Zinc finger protein 117), 유전자 등록번호(Genebank) NM_003430(Zinc finger protein 91), 유전자 등록번호(Genebank) NM_003410(Zinc finger protein, X-linked), 유전자 등록번호(Genebank) NM_178549(Zinc finger protein 678), 유전자 등록번호(Genebank) NM_152601(Zinc finger protein 564), 유전자 등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자 등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자 등록번호(Genebank) NM_145233(Zinc finger protein 20), 유전자 등록번호(Genebank) NM_031942(Cell division cycle associated 7), 유전자 등록번호(Genebank) NM_133473(Zinc finger protein 714), 유전자 등록번호(Genebank) NM_005655(Kruppel-like factor 10), 유전자 등록번호(Genebank) NM_021994(Zinc finger protein 277 pseudogene), 유전자 등록번호(Genebank) NM_025189(Zinc finger protein 430), 유전자 등록번호(Genebank) NM_001008390(CGG triplet repeat binding protein 1), 유전자 등록번호(Genebank) NM_024087(Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(Genebank) NM_032828(Zinc finger protein 587), 유전자 등록번호(Genebank) NM_006980(Mitochondrial transcription termination factor), 유전자 등록번호(Genebank) NM_024561(NMDA receptor regulated 1-like), 유전자 등록번호(Genebank) NM_173531(Zinc finger protein 100), 유전자 등록번호(Genebank) NM_003864(Sin3A-associated protein, 30 kDa), 유전자 등록번호(Genebank) NM_012345(Nuclear fragile X mental retardation protein interacting protein 1), 유전자 등록번호(Genebank) NM_003079(SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1), 유전자 등록번호(Genebank) NM_006193(Paired box gene 4), 유전자 등록번호(Genebank) NM_003599[Suppressor of Ty 3 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006311(Nuclear receptor co-repressor 1), 유전자 등록번호(Genebank) NM_020675[Spindle pole body component 25 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_145697[NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) NM_002358[MAD2 mitotic arrest deficient-like 1 (yeast)], 유전자 등록번호(Genebank) NM_006716[DBF4 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) NM_018131(Centrosomal protein 55 kDa), 유전자 등록번호(Genebank) NM_012177(F-box protein 5), 유전자 등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자 등록번호(Genebank) NM_018136[Asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자 등록번호(Genebank) NM_014750[Discs, large homolog 7 (Drosophila)], 유전자 등록번호(Genebank) NM_016343[Centromere protein F, 350/400ka (mitosin)], 유전자 등록번호(Genebank) NM_017489[Telomeric repeat binding factor (NIMA-interacting) 1], 유전자 등록번호(Genebank) NM_006461(Sperm associated antigen 5), 유전자 등록번호(Genebank) NM_001790[Cell division cycle 25 homolog C (S. cerevisiae)], 유전자 등록번호(Genebank) NM_004064[Cyclin-dependent kinase inhibitor 1B (p27, Kip1)], 유전자 등록번호(Genebank) NM_080668(Cell division cycle associated 5), 유전자 등록번호(Genebank) NM_021211(Eukaryotic translation initiation factor 4 gamma, 2), 유전자 등록번호(Genebank) NM_001274[CHK1 checkpoint homolog (S. pombe)] 유전자 등록번호(Genebank), NM_001005414(ZW10 interactor), 유전자 등록번호(Genebank) NM_144710(Septin 10), 유전자 등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자 등록번호(Genebank) NM_005496(Structural maintenance of chromosomes 4), 유전자 등록번호(Genebank) NM_181803(Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) NM_018101(Cell division cycle associated 8), 유전자 등록번호(Genebank) AF147440(Kinesin family member 15), 유전자 등록번호(Genebank) NM_005030[Polo-like kinase 1 (Drosophila)], 유전자 등록번호(Genebank) NM_022346(Non-SMC condensin I complex, subunit G), 유전자 등록번호(Genebank) NM_019084(Cyclin J), 유전자 등록번호(Genebank) NM_005504(Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_004523(Kinesin family member 11), 유전자 등록번호(Genebank) NM_004354(Cyclin G2), 유전자 등록번호(Genebank) NM_001237(Cyclin A2), 유전자 등록번호(Genebank) NM_032626(Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) NM_021930(RAD50 interactor 1), 유전자 등록번호(Genebank) NM_018685(Anillin, actin binding protein), 유전자 등록번호(Genebank) NM_016195(M-phase phosphoprotein 1), 유전자 등록번호(Genebank) NM_001827(CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_138555(Kinesin family member 23), 유전자 등록번호(Genebank) NM_031966(Cyclin B1), 유전자 등록번호(Genebank) NM_005915[Minichromosome maintenance deficient 6 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_014751(Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_003981(Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_001826(CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) NM_198219(Inhibitor of growth family, member 1), 유전자 등록번호(Genebank) NM_014881[DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_001255[Cell division cycle 20 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_016359(Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AF085846(Rap guanine nucleotide exchange factor (GEF) 6), 유전자 등록번호(Genebank) NM_001656(Tripartite motif-containing 23), 유전자 등록번호(Genebank) NM_145307(Pleckstrin homology domain containing, family K member 1), 유전자 등록번호(Genebank) NM_080651(Thyroid hormone receptor associated protein 6), 유전자 등록번호(Genebank) NM_003714(Stanniocalcin 2), 유전자 등록번호(Genebank) NM_018098(Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) NM_004586(Ribosomal protein S6 kinase, 90 kDa, polypeptide 3), 유전자 등록번호(Genebank) NM_002317(Lysyl oxidase), 유전자 등록번호(Genebank) NM_031296(RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_014736(Casein kinase 1, gamma 1), 유전자 등록번호(Genebank) XM_292197(Diacylglycerol kinase, eta), 유전자 등록번호(Genebank) NM_016513[Intestinal cell (MAK-like) kinase], 유전자 등록번호(Genebank) NM_001331[Catenin (cadherin-associated protein), delta 1], 유전자 등록번호(Genebank) AB032991(Nedd4 family interacting protein 2), 유전자 등록번호(Genebank) NM_004232(Suppressor of cytokine signaling 6), 유전자 등록번호(Genebank) NM_003472[DEK oncogene (DNA binding)], 유전자 등록번호(Genebank) NM_012334(Myosin X), 유전자 등록번호(Genebank) NM_012425(Ras suppressor protein 1), 유전자 등록번호(Genebank) NM_002140(Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) NM_005271(Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) NM_145203(Casein kinase 1, alpha 1-like), 유전자 등록번호(Genebank) BU679059(GDP dissociation inhibitor 2), 유 전자 등록번호(Genebank) NM_006305[Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A], 유전자 등록번호(Genebank) NM_020824(Rho GTPase activating protein 21), 유전자 등록번호(Genebank) NM_012120(CD2-associated protein), 유전자 등록번호(Genebank) NM_012089[ATP-binding cassette, sub-family B (MDR/TAP), member 10], 유전자 등록번호(Genebank) NM_021977[Solute carrier family 22 (extraneuronal monoamine transporter), member 3], 유전자 등록번호(Genebank) NM_015171(Exportin 6), 유전자 등록번호(Genebank) NM_016467[ORM1-like 1 (S. cerevisiae)], 유전자 등록번호(Genebank) AA484677[SEC22 vesicle trafficking protein homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) BC035622(Adaptor-related protein complex 4, sigma 1 subunit), 유전자 등록번호(Genebank) NM_002520[Nucleophosmin (nucleolar phosphoprotein B23, numatrin)], 유전자 등록번호(Genebank) NM_014043(Chromatin modifying protein 2B), 유전자 등록번호(Genebank) NM_003133(Signal recognition particle 9 kDa), 유전자 등록번호(Genebank) NM_013322(Sorting nexin 10), 유전자 등록번호(Genebank) NM_005733(Kinesin family member 20A), 유전자 등록번호(Genebank) NM_014322[Choroideremia-like (Rab escort protein 2)], 유전자 등록번호(Genebank) NM_020401(Nucleoporin 107 kDa), 유전자 등록번호(Genebank) NM_138285(Nucleoporin 35 kDa), 유전자 등록번호(Genebank) NM_001786(Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_001067[Topoisomerase (DNA) II alpha 170 kDa], 유전자 등록번호(Genebank) NM_001012271[Baculoviral IAP repeat-containing 5 (survivin)], 유전자 등록번호(Genebank) NM_024854(Islet amyloid polypeptide), 유전자 등록번호(Genebank) NM_021631(Apoptosis inhibitor), 유전자 등록번호(Genebank) NM_018204(Cytoskeleton associated protein 2), 유전자 등록번호(Genebank) NM_021999(Integral membrane protein 2B), 유전자 등록번호(Genebank) NM_005400(Protein kinase C, epsilon), 유전자 등록번호(Genebank) NM_148957(Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) NM_001006(Ribosomal protein S3A), 유전자 등록번호(Genebank) NM_006437(Poly (ADP-ribose) polymerase family, member 4), 유전자 등록번호(Genebank) NM_024055(Solute carrier family 30 (zinc transporter), member 5), 유전자 등록번호(Genebank) NM_000582[Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자 등록번호(Genebank) NM_016951(Chemokine-like factor), 유전자 등록번호(Genebank) NM_002737(Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_004836(Eukaryotic translation initiation factor 2-alpha kinase 3), 유전자 등록번호(Genebank) NM_020686(4-aminobutyrate aminotransferase), 유전자 등록번호(Genebank) NM_004134[Heat shock 70 kDa protein 9 (mortalin)], 유전자 등록번호(Genebank) NM_053039(UDP glucuronosyltransferase 2 family, polypeptide B28), 유전자 등록번호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유 전자 등록번호(Genebank) NM_005256(Fanconi anemia, complementation group F), 유전자 등록번호(Genebank) NM_003368(Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_001018115(Fanconi anemia, complementation group D2), 유전자 등록번호(Genebank) AI281523(Splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)), 유전자 등록번호(Genebank) NM_004075(Cryptochrome 1 (photolyase-like)), 유전자 등록번호(Genebank) NM_002389(CD46 molecule, complement regulatory protein), 유전자 등록번호(Genebank) NM_000584(Interleukin 8), 유전자 등록번호(Genebank) NM_001801(Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_000715(Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) NM_144503(F11 receptor), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) NM_001010914(Protein immuno-reactive with anti-PTH polyclonal antibodies).
본 발명자들은 3-메틸콜란트렌에 대한 노출 여부 진단용 바이오마커를 발굴하기 위하여, 3-메틸콜란트렌을 인간 간암 세포주(HepG2)에 처리하여 세포 독성을 확인하였다. 그 결과, 상기 3-메틸콜란트렌는 인간 간암 세포주에 독성을 가짐이 확인되었고(도 1 참조), 상기 실험을 바탕으로 3-메틸콜란트렌의 농도를 결정하였다. 이후 상기 결정된 농도로 3-메틸콜란트렌을 인간 간암 세포주에 처리하고, 상기 물질을 처리한 세포주에서 mRNA를 분리하여 cDNA를 합성하면서 형광물질(Cy5)로 표지하였으며, 약물을 처리하지 않은 대조군의 경우 Cy3로 표지하였다. 상기 형광표지된 cDNA를 44 k 올리고마이크로어레이 칩 Human whole genome microarray(Agilent, USA)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다(도 2 참조). 분석시 Cy5/Cy3 비율이 2.0배 이상인 경우 발현 증가된 유전자로 분류하였고, 0.5배 이하인 경우 발현 감소된 유전자로 분류하였다. 분석 결과, 발현 증가된 유전자는 0.25%(44,000개의 유전자 중 112개) 발현이 감소된 유전자는 0.57%(44,000개의 유전자 중 252개)임을 확인하였다. 이때, 3-메틸콜란트렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 분류한 기능별로 분류하면, 대사(고분자, 뉴클레오타이드, 지방산 대사), 신호 변환(signal transduction), 세포기관 구성 및 발생(organelle organization and biogenesis), 면역반응, 전사조절, 아팝토시스(apoptosis), 세포 주기, 세포 증식, 화학물질 자극 반응(response to chemical stimulus), 전달, DNA 수복(repair), 면역 반응 관련 유전자들이었다(표 2 및 표 3 참조). 상기 유전자들은 본 발명에서 사용한 3-메틸콜란트렌을 처리 했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.
이후, 본 발명자들은 상기 유전자 중 과발현된 유전자 19종과 저발현된 유전자 6종을 분리하여 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction) 방법으로 발현 양상을 조사하였다. 그 결과, 19종의 과발현 유전자들과 6종의 저발현 유전자의 발현 양상이 올리고마이크로어레이 칩 결과와 유사하게 나타남을 확인하였다(표 5 참조).
또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보 가닥 분자가 집적된 3-메틸콜란트렌에 대한 노출 여부 진단용 DNA 마이크로어레이 칩을 제공한다.
본 발명의 3-메틸콜란트렌 검색용 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판 상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나, 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 핀 형태의 스폿터인 마이크로어레이를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나, 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니며 본 발명의 바람직한 실시예에서는 아미노-실란이 코팅된 슬라이드 글래스를 이용하였다.
또한, 본 발명은 상기 바이오마커를 이용한 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법을 제공한다.
본 발명은 하기와 같은 과정을 포함하는 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법을 제공한다: 1) 실험군으로서 3-메틸콜란트렌에 대한 노출이 의심되는 개체의 체세포로부터 RNA를 분리하는 단계; 2) 대조군으로서 3-메틸콜란트렌에 노출이 되지 않은 개체의 체세포로부터 RNA를 분리하는 단계; 3) 단계 1)의 실험군의 RNA 및 단계 2)의 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계; 4) 단계 3)의 각기 다른 형광물질로 표지된 cDNA를 DNA 마이크로어레이 칩과 혼성화시키는 단계; 5) 단계 4)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및 6) 단계 5)의 분석한 데이터에서 제 1항의 바이오마커의 발현 정도를 대조군과 비교하여 3-메틸콜란트렌에 노출 여부를 판단하는 단계.
상기 노출 여부를 진단하는 방법에 있어서, 단계 1)의 체세포는 간세포(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간, 간암 세포 및 조직에서 유래된 세포라면 모두 이용 가능하다.
상기 노출 여부를 진단하는 방법에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되어지는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.
상기 노출 여부를 진단하는 방법에 있어서, 단계 5)의 DNA 마이크로어레이 칩은 Whole Human Genome Oligo Microarray(Agilent, USA)등을 사용하는 것이 바람 직하나, 이에 한정되는 것은 아니며, 인간 게놈 중 본 발명에서 상기 공통적으로 과발현 또는 저발현 유전자(표 2 및 포 3 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다. 또한, 단계 5)의 분석 방법은 GenePix 4.1 소프트웨어(Axon Instruments, USA)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.
또한, 본 발명은 하기와 같은 과정을 포함하는 3-메틸콜란트렌에 대한 노출 여부를 진단하는 방법을 제공한다: 1) 실험군으로서 3-메틸콜란트렌에 대한 노출이 의심되는 개체의 체세포로부터 RNA를 분리하는 단계; 2) 대조군으로서 3-메틸콜란트렌에 노출이 되지 않은 개체의 체세포로부터 RNA를 분리하는 단계; 3) 단계 1)의 실험군의 RNA 및 단계 2)의 대조군의 RNA를, 상기의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및 4) 단계 3)의 유전자 산물을 대조군과 비교하여 3-메틸콜란트렌에 노출 여부를 판단하는 단계.
상기 노출 여부를 진단하는 방법에 있어서, 단계 1)의 체세포는 간세포(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간, 간암 세포 및 조직에서 유래된 세포라면 모두 이용 가능하다.
상기 노출 여부를 진단하는 방법에 있어서, 단계 3)의 프라이머는 본 발명에 서 탐색된 바이오마커 유전자와 상보적이고, 바이오마커를 증폭할 수 있는 프라이머라면 모두 사용가능하다. 본 발명에서는 서열번호 1 내지 50으로 기재되는 정방향 및 역방향의 프라이머 25쌍을 제시하였으나 이에 한정되는 것은 아니다.
아울러, 본 발명은 3-메틸콜란트렌에 대한 노출 여부 진단용 키트를 제공한다.
본 발명은 상기 본 발명에서 제작한 DNA 마이크로어레이 칩을 포함하는 3-메틸콜란트렌에 대한 노출 여부 진단용 키트를 제공한다.
상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 Cy3와 Cy5를 사용하였다. 아울러, 상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.
또한, 본 발명은 상기 바이오마커 유전자에 상보적이고, 바이오마커 유전자 를 증폭할 수 있는 프라이머를 포함하는 3-메틸콜란트렌에 대한 노출 여부 진단용 키트를 제공한다.
상기 키트의 프라이머는 서열번호 1 내지 50으로 기재되는 서열로 구성된 군으로부터 선택되어지는 정방향 및 역방향의 한개 이상의 프라이머 쌍을 사용하는 것이 바람직하나, 이에 한정되는 것은 아니며, 상기 바이오마커 유전자에 상보적이며, 바이오마커 유전자를 증폭할 수 있는 정방향 및 역방향 프라이머 쌍은 모두 사용 가능하다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<
실시예
1> 세포 배양 및 화학물질 처리
<1-1> 세포배양
인간 간암 세포주인 HepG2 세포(한국 세포주 은행)를 10% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 다환방향족 탄화수소류의 하나로서 발암성을 가지고 있는 물질인 3-메틸콜란트렌을 선정하였으며, DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.
<1-2> 세포 독성 실험(
MTT
assay
) 및 화학 물질 처리
Mossman 등(J. Immunol . Methods, 65, 55-63, 1983)의 방법으로 HepG2 세포주를 이용한 MTT 실험을 수행하였다. 세포는 24-웰 플레이트에 4× 105/웰 세포수로 DMEM 배지(Gibro-BRL, USA)에서 DMSO에 용해된 3-메틸콜란트렌을 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다.
HepG2 세포주에서 3-메틸콜란트렌의 세포독성을 살펴본 결과, 20% 생존율을 보이는 농도(IC20)는 2.14 uM 이었으며(도 1), 상기 농도들로 결정하여 마이크로어레이 실험을 수행하였다.
<
실시예
2>
마이크로어레이
실험
<2-1> 표적
RNA
의 분리 및 형광 물질 표지
6 × 106 cell/㎖ 농도로 100 mm 디쉬에 HepG2 세포를 분주한 후, 실시예 1-2에서 결정된 3-메틸콜란트렌의 농도를 48 시간 동안 처리하였다. 이후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하고, RNeasy mini kit(Qiagen, USA)를 사용 하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농도는 Agilent 2100 Bioanalyzer(Agilent Technologies, USA)와 아가로스 젤 전기영동으로 확인하였다.
<2-2>
표지된
cDNA
제조
올리고 마이크로어레이 분석을 위하여 실시예 2-1에서 수득한 3-메틸콜란트렌 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)과 혼합하고 65℃에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 표 1과 같이 시약을 혼합하였다.
구성 | 부피(㎕) |
5X first strand buffer | 6 |
dNTPs | 0.6 |
0.1 M DDT | 3 |
SuperScript II enzyme | 3 |
Cy-3 또는 Cy-5 dUTP | 2 |
대조군인 HepG2 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 3-메틸콜란트렌을 처리한 HepG2 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화 하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, USA)을 사용하여 혼합, 정제되었다.
<2-3>
혼성화
반응
혼성화 및 세척 과정은 지노첵(주)의 지시방법에 따라 수행되었다. 혼성화는 12시간 동안 62℃ 오븐에서 수행되었다. DNA 마이크로어레이 칩으로는 44 k Whole Human Genome Oligo Microarray(Agilent, USA)를 이용하였다. 세척(2분간 2× SSC/0.1% SDS에 세척, 3분간 1× SSC, 2분간 0.2× SSC에 세척) 후 슬라이드는 3분간 800 rpm으로 원심분리하여 건조하였다.
<2-4> 형광 이미지 획득
슬라이드 상의 혼성화 이미지는 Genepix 4000B(Axon Instruments, USA)로 스캔하였다. 결합되지 않은 유전자를 세척한 칩은 레이저 광 스캐너(laser fluorescence scanner)를 사용하여 형광 이미지를 획득하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미한다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 GenePix 4.1 소프트웨어(Axon Instruments, USA)로 분석하였다. 이렇게 하여 얻어진 데이터로부터 3-메틸콜란트렌에 대한 마커 유전자를 선별하였다(도 2).
그 결과, 올리고 칩 상에 존재하는 대략 4만 4천 개의 유전자 중에서 3-메틸콜란트렌에 의해 Cy5/Cy3의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 유전자는 0.25%(44,000개의 유전자 중 112개) 발현이 감소된 유전자는 0.57%(44,000개의 유전자 중 252개)임을 확인하였다.
이때, 3-메틸콜란트렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 기능별로 분류한 결과, 대사(고분자, 뉴클레오타이드, 지방산 대사), 신호 변환(signal transduction), 세포기관 구성 및 발생(organelle organization and biogenesis), 면역반응, 전사조절, 아팝토시스(apoptosis), 세포 주기, 세포 증식, 화학물질 자극 반응(response to chemical stimulus), 전달, DNA 수복(repair), 면역 반응 관련 유전자로 선별되었다(표 2 및 표 3). 상기 유전자들은 본 발명에서 사용한 3-메틸콜란트렌을 처리 했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.
등록번호 | 유전자 약어 | 유전자 명 | 중간값의 비 |
(a) Macromolecule metabolism | |||
NM_000499 | CYP1A1 | Cytochrome P450, family 1, subfamily A, polypeptide 1 | 10.23 |
NM_203347 | UNQ2541 | MSFL2541 | 6.676 |
NM_006227 | PLTP | Phospholipid transfer protein | 6.223 |
NM_018837 | SULF2 | Sulfatase 2 | 4.439 |
NM_001769 | CD9 | CD9 molecule | 3.515 |
NM_001402 | EEF1A1 | Eukaryotic translation elongation factor 1 alpha 1 | 2.813 |
NM_170693 | SGK2 | Serum/glucocorticoid regulated kinase 2 | 2.628 |
NM_021599 | ADAMTS2 | ADAM metallopeptidase with thrombospondin type 1 motif, 2 | 2.555 |
NM_001017973 | P4HA2 | Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II | 2.511 |
NM_032324 | C1orf57 | Chromosome 1 open reading frame 57 | 2.49 |
NM_198194 | STOM | Stomatin | 2.398 |
NM_016368 | ISYNA1 | Myo-inositol 1-phosphate synthase A1 | 2.315 |
NM_030569 | ITIH5 | Inter-alpha (globulin) inhibitor H5 | 2.286 |
NM_001748 | CAPN2 | Calpain 2, (m/II) large subunit | 2.183 |
NM_012467 | TPSG1 | Tryptase gamma 1 | 2.181 |
NM_001917 | DAO | D-amino-acid oxidase | 2.178 |
NM_015920 | RPS27L | Ribosomal protein S27-like | 2.146 |
NM_001009820 | SNRP70 | Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen) | 2.117 |
NM_014010 | PAPPA | Pregnancy-associated plasma protein A, pappalysin 1 | 2.107 |
NM_152640 | DCP1B | DCP1 decapping enzyme homolog B (S. cerevisiae) | 2.103 |
NM_001019 | RPS15A | Ribosomal protein S15a | 2.076 |
NM_002842 | PTPRH | Protein tyrosine phosphatase, receptor type, H | 2.056 |
NM_001004 | TSPAN4 | Tetraspanin 4 | 2.055 |
NM_006929 | SKIV2L | Superkiller viralicidic activity 2-like (S. cerevisiae) | 2.038 |
NM_012190 | ALDH1L1 | Aldehyde dehydrogenase 1 family, member L1 | 2.036 |
(b) Nucleotide metabolism | |||
NM_032872 | SYTL1 | Synaptotagmin-like 1 | 3.714 |
NM_000480 | AMPD3 | Adenosine monophosphate deaminase (isoform E) | 2.511 |
NM_000476 | AK1 | Adenylate kinase 1 | 2.687 |
NM_018161 | NADSYN1 | NAD synthetase 1 | 2.434 |
(c) Organelle organization and biogenesis | |||
NM_003516 | HIST2H2AA3 | Histone cluster 2, H2aa3 | 2.649 |
NM_021063 | HIST1H2BD | Histone cluster 1, H2bd | 2.905 |
NM_001005749 | GBA | Glucosidase, beta; acid (includes glucosylceramidase) | 2.521 |
NM_005319 | HIST1H1C | Histone cluster 1, H1c | 2.494 |
NM_001015053 | HDAC5 | Histone deacetylase 5 | 2.33 |
NM_003528 | HIST2H2BE | Histone cluster 2, H2be | 2.317 |
NM_002778 | PSAP | Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) | 2.296 |
NM_021058 | HIST1H2BJ | Histone cluster 1, H2bj | 2.264 |
NM_003524 | HIST1H2BH | Histone cluster 1, H2bh | 2.225 |
NM_003519 | HIST1H2BL | Histone cluster 1, H2bl | 2.219 |
NM_033445 | HIST3H2A | Histone cluster 3, H2a | 2.212 |
NM_005572 | LMNA | Lamin A/C | 2.152 |
NM_003520 | HIST1H2BN | Histone cluster 1, H2bn | 2.142 |
NM_003527 | HIST1H2BO | Histone cluster 1, H2bo | 2.126 |
NM_175055 | HIST3H2BB | Histone cluster 3, H2bb | 2.031 |
(d) Signal transduction | |||
NM_000596 | IGFBP1 | Insulin-like growth factor binding protein 1 | 6.05 |
NM_004864 | GDF15 | Growth differentiation factor 15 | 4.374 |
NM_201525 | GPR56 | G protein-coupled receptor 56 | 3.371 |
NM_014624 | S100A6 | S100 calcium binding protein A6 | 3.295 |
NM_175744 | RHOC | Ras homolog gene family, member C | 2.683 |
NM_005620 | S100A11 | S100 calcium binding protein A11 | 2.331 |
NM_006018 | GPR109B | G protein-coupled receptor 109B | 2.219 |
NM_005310 | GRB7 | Growth factor receptor-bound protein 7 | 2.188 |
NM_002926 | RGS12 | Regulator of G-protein signalling 12 | 2.179 |
NM_021913 | AXL | AXL receptor tyrosine kinase | 2.131 |
NM_002194 | INPP1 | Inositol polyphosphate-1-phosphatase | 2.108 |
BC064982 | MCF2L | MCF.2 cell line derived transforming sequence-like | 2.096 |
NM_001005339 | RGS10 | Regulator of G-protein signalling 10 | 2.07 |
NM_021077 | NMB | Neuromedin B | 2.038 |
(e) Apoptosis | |||
NM_004881 | TP53I3 | Tumor protein p53 inducible protein 3 | 4.226 |
NM_018494 | LRDD | Leucine-rich repeats and death domain containing | 3.555 |
NM_033285 | TP53INP1 | Tumor protein p53 inducible nuclear protein 1 | 2.524 |
NM_001197 | BIK | BCL2-interacting killer (apoptosis-inducing) | 2.496 |
NM_001540 | HSPB1 | Heat shock 27 kDa protein 1 | 2.295 |
NM_003820 | TNFRSF14 | Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) | 2.272 |
NM_147780 | CTSB | Cathepsin B | 2.232 |
NM_001003940 | BMF | Bcl2 modifying factor | 2.211 |
NM_000389 | CDKN1A | Cyclin-dependent kinase inhibitor 1A (p21, Cip1) | 2.144 |
NM_016639 | TNFRSF12A | Tumor necrosis factor receptor superfamily, member 12A | 2.135 |
NM_000043 | FAS | Fas (TNF receptor superfamily, member 6) | 2.03 |
NM_002307 | LGALS7 | Lectin, galactoside-binding, soluble, 7 (galectin 7) | 2.014 |
(f) Transport | |||
NM_021603 | FXYD2 | FXYD domain containing ion transport regulator 2 | 4.873 |
NM_004925 | AQP3 | Aquaporin 3 (Gill blood group) | 3.406 |
NM_000014 | A2M | Alpha-2-macroglobulin | 2.597 |
NM_022449 | RAB17 | RAB17, member RAS oncogene family | 2.38 |
NM_005855 | RAMP1 | Receptor (G protein-coupled) activity modifying protein 1 | 2.176 |
NM_006868 | RAB31 | RAB31, member RAS oncogene family | 2.115 |
NM_032493 | AP1M1 | Adaptor-related protein complex 1, mu 1 subunit | 2.068 |
NM_007097 | CLTB | Clathrin, light chain (Lcb) | 2.064 |
NM_005697 | SCAMP2 | Secretory carrier membrane protein 2 | 2.033 |
(g) Cell cycle | |||
NM_004073 | PLK3 | Polo-like kinase 3 (Drosophila) | 2.566 |
NM_182795 | NPM2 | Nucleophosmin/nucleoplasmin, 2 | 2.409 |
NM_005072 | SLC12A4 | Solute carrier family 12 (potassium/chloride transporters), member 4 | 2.358 |
NM_144606 | FLCN | Folliculin | 2.196 |
NM_014059 | RGC32 | Response gene to complement 32 | 2.114 |
NM_002754 | MAPK13 | Mitogen-activated protein kinase 13 | 2.089 |
(h) Cell proliferation | |||
NM_003254 | TIMP1 | TIMP metallopeptidase inhibitor 1 | 4.058 |
NM_001553 | IGFBP7 | Insulin-like growth factor binding protein 7 | 4.027 |
NM_003255 | TIMP2 | TIMP metallopeptidase inhibitor 2 | 2.3 |
NM_013376 | SERTAD1 | SERTA domain containing 1 | 2.134 |
(i) regulation of transcription | |||
NM_000107 | DDB2 | Damage-specific DNA binding protein 2, 48 kDa | 3.103 |
NM_004433 | ELF3 | E74-like factor 3 (ets domain transcription factor, epithelial-specific ) | 2.372 |
NM_021969 | NR0B2 | Nuclear receptor subfamily 0, group B, member 2 | 2.287 |
NM_023039 | ANKRA2 | Ankyrin repeat, family A (RFXANK-like), 2 | 2.265 |
NM_080875 | MIB2 | Mindbomb homolog 2 (Drosophila) | 2.203 |
NM_002166 | ID2 | Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein | 2.113 |
NM_001421 | ELF4 | E74-like factor 4 (ets domain transcription factor) | 2.109 |
NM_153813 | ZFPM1 | Zinc finger protein, multitype 1 | 2.098 |
U68019 | SMAD3 | SMAD family member 3 | 2.062 |
NM_015655 | ZNF337 | Zinc finger protein 337 | 2.025 |
NM_031918 | KLF16 | Kruppel-like factor 16 | 2.014 |
(j) response to chemical stimulus | |||
NM_001554 | CYR61 | Cysteine-rich, angiogenic inducer, 61 | 2.603 |
NM_003960 | NAT8 | N-acetyltransferase 8 | 2.248 |
NM_032965 | CCL15 | Chemokine (C-C motif) ligand 15 | 2.133 |
NM_201397 | GPX1 | Glutathione peroxidase 1 | 2.073 |
NM_005064 | CCL23 | Chemokine (C-C motif) ligand 23 | 2.07 |
NM_005345 | HSPA1A | Heat shock 70 kDa protein 1A | 2.056 |
(k) immune response | |||
NM_001531 | MR1 | Major histocompatibility complex, class I-related | 2.927 |
NM_006404 | PROCR | Protein C receptor, endothelial (EPCR) | 2.689 |
NM_002119 | HLA-DOA | Major histocompatibility complex, class II, DO alpha | 2.35 |
NM_005101 | ISG15 | ISG15 ubiquitin-like modifier | 2.228 |
(l) 기타 | |||
NM_006426 | DPYSL4 | Dihydropyrimidinase-like 4 | 5.008 |
NM_020728 | FAM62B | Family with sequence similarity 62 (C2 domain containing) member B | 2.308 |
등록번호 | 유전자 약어 | 유전자 명 | 중간값의 비 |
(a) Macromolecule metabolism | |||
NM_016441 | CRIM1 | Cysteine rich transmembrane BMP regulator 1 (chordin-like) | 0.191 |
NM_203391 | GK | Glycerol kinase | 0.204 |
NM_006775 | QKI | Quaking homolog, KH domain RNA binding (mouse) | 0.248 |
NM_052937 | PCMTD1 | Protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 | 0.258 |
NM_003932 | ST13 | Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) | 0.279 |
NM_030979 | PABPC3 | Poly(A) binding protein, cytoplasmic 3 | 0.284 |
NM_032549 | IMMP2L | IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) | 0.29 |
NM_007195 | POLI | Polymerase (DNA directed) iota | 0.292 |
NM_002139 | RBMX | RNA binding motif protein, X-linked | 0.296 |
BC033021 | KLB | Klotho beta | 0.325 |
NM_016093 | RPL26L1 | Ribosomal protein L26-like 1 | 0.325 |
CR611166 | SFRS1 | Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) | 0.326 |
NM_017437 | CPSF2 | Cleavage and polyadenylation specific factor 2, 100 kDa | 0.349 |
NM_033114 | ZCRB1 | Zinc finger CCHC-type and RNA binding motif 1 | 0.35 |
NM_000236 | LIPC | Lipase, hepatic | 0.371 |
NM_174936 | PCSK9 | Proprotein convertase subtilisin/kexin type 9 | 0.376 |
NM_004375 | COX11 | COX11 homolog, cytochrome c oxidase assembly protein (yeast) | 0.382 |
NM_004685 | MTMR6 | Myotubularin related protein 6 | 0.386 |
NM_052965 | C1orf19 | Chromosome 1 open reading frame 19 | 0.387 |
NM_201278 | MTMR2 | Myotubularin related protein 2 | 0.39 |
NM_003093 | SNRPC | Small nuclear ribonucleoprotein polypeptide C | 0.396 |
AV757313 | RPL9 | Ribosomal protein L9 | 0.4 |
NM_014791 | MELK | Maternal embryonic leucine zipper kinase | 0.401 |
BX537987 | B3GAT3 | Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) | 0.412 |
BC041925 | SLC7A11 | Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 | 0.415 |
BC032643 | SYNCRIP | Synaptotagmin binding, cytoplasmic RNA interacting protein | 0.418 |
NM_016058 | TPRKB | TP53RK binding protein | 0.418 |
NM_181886 | UBE2D3 | Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) | 0.421 |
NM_016271 | RNF138 | Ring finger protein 138 | 0.423 |
AK021676 | PGM3 | Phosphoglucomutase 3 | 0.429 |
NM_015352 | POFUT1 | Protein O-fucosyltransferase 1 | 0.429 |
NM_016304 | C15orf15 | Chromosome 15 open reading frame 15 | 0.431 |
NM_020995 | HP | Haptoglobin | 0.438 |
NM_003017 | SFRS3 | Splicing factor, arginine/serine-rich 3 | 0.439 |
W04231 | BHMT | Betaine-homocysteine methyltransferase | 0.447 |
NM_006546 | IGF2BP1 | Insulin-like growth factor 2 mRNA binding protein 1 | 0.448 |
NM_212554 | LOC399818 | Similar to CG9643-PA | 0.45 |
BC049823 | RPL22L1 | Ribosomal protein L22-like 1 | 0.453 |
NM_006937 | SUMO2 | SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) | 0.453 |
NM_012331 | MSRA | Methionine sulfoxide reductase A | 0.457 |
NM_005875 | EIF1B | Eukaryotic translation initiation factor 1B | 0.462 |
NM_032906 | PIGY | Phosphatidylinositol glycan anchor biosynthesis, class Y | 0.462 |
NM_002847 | PTPRN2 | Protein tyrosine phosphatase, receptor type, N polypeptide 2 | 0.462 |
NM_000947 | PRIM2A | Primase, polypeptide 2A, 58 kDa | 0.464 |
NM_181716 | PIGL | Phosphatidylinositol glycan anchor biosynthesis, class L | 0.465 |
NM_004681 | EIF1AY | Eukaryotic translation initiation factor 1A, Y-linked | 0.466 |
NM_000982 | RPL21 | Ribosomal protein L21 | 0.466 |
T07777 | LOC151579 | Similar to basic leucine zipper and W2 domains 1 | 0.468 |
NM_016652 | CRNKL1 | Crn, crooked neck-like 1 (Drosophila) | 0.47 |
NM_000986 | RPL24 | Ribosomal protein L24 | 0.476 |
NM_139207 | NAP1L1 | Nucleosome assembly protein 1-like 1 | 0.48 |
AK001406 | SENP6 | SUMO1/sentrin specific peptidase 6 | 0.481 |
NM_145649 | GCNT2 | Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) | 0.482 |
NM_020236 | MRPL1 | Mitochondrial ribosomal protein L1 | 0.483 |
NM_001017430 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | 0.483 |
NM_031157 | HNRPA1 | Heterogeneous nuclear ribonucleoprotein A1 | 0.487 |
NM_018981 | DNAJC10 | DnaJ (Hsp40) homolog, subfamily C, member 10 | 0.488 |
NM_018291 | FLJ10986 | Hypothetical protein FLJ10986 | 0.489 |
NM_018048 | FLJ10292 | Mago-nashi homolog 2 | 0.496 |
NM_012207 | HNRPH3 | Heterogeneous nuclear ribonucleoprotein H3 (2H9) | 0.497 |
NM_000028 | AGL | Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III) | 0.498 |
NM_014321 | ORC6L | Origin recognition complex, subunit 6 like (yeast) | 0.499 |
NM_015423 | AASDHPPT | Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | 0.5 |
(b) Nucleotide metabolism | |||
NM_001034 | RRM2 | Ribonucleotide reductase M2 polypeptide | 0.374 |
AB032990 | FAM63B | Family with sequence similarity 63, member B | 0.392 |
NM_000791 | DHFR | Dihydrofolate reductase | 0.403 |
NM_199040 | NUDT4 | Nudix (nucleoside diphosphate linked moiety X)-type motif 4 | 0.447 |
NM_006886 | ATP5E | ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit | 0.49 |
(c) Fatty acid metabolism | |||
NM_004457 | ACSL3 | Acyl-CoA synthetase long-chain family member 3 | 0.37 |
NM_007295 | BRCA1 | Breast cancer 1, early onset | 0.374 |
NM_006111 | ACAA2 | Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) | 0.437 |
NM_001443 | FABP1 | Fatty acid binding protein 1, liver | 0.466 |
NM_000016 | ACADM | Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain | 0.496 |
(d) Organelle organization and biogenesis | |||
NM_001809 | CENPA | Centromere protein A | 0.308 |
AL833119 | DKFZp313A2432 | Hypothetical protein DKFZp313A2432 | 0.321 |
NM_006493 | CLN5 | Ceroid-lipofuscinosis, neuronal 5 | 0.34 |
NM_138271 | ATRX | Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) | 0.343 |
NM_006136 | CAPZA2 | Capping protein (actin filament) muscle Z-line, alpha 2 | 0.392 |
CR615278 | H2AFV | H2A histone family, member V | 0.399 |
NM_024704 | C20orf23 | Chromosome 20 open reading frame 23 | 0.418 |
NM_003011 | SET | SET translocation (myeloid leukemia-associated) | 0.452 |
NM_203401 | STMN1 | Stathmin 1/oncoprotein 18 | 0.463 |
(e) Regulation of transcription | |||
CR749233 | ZNF626 | Zinc finger protein 626 | 0.157 |
AF277624 | ZNF479 | Zinc finger protein 479 | 0.168 |
NM_013282 | UHRF1 | Ubiquitin-like, containing PHD and RING finger domains, 1 | 0.208 |
NM_198893 | ZNF160 | Zinc finger protein 160 | 0.236 |
NM_013361 | ZNF223 | Zinc finger protein 223 | 0.238 |
NM_002129 | HMGB2 | High-mobility group box 2 | 0.244 |
NM_002128 | HMGB1 | High-mobility group box 1 | 0.259 |
NM_003429 | ZNF85 | Zinc finger protein 85 | 0.268 |
NM_003423 | ZNF43 | Zinc finger protein 43 | 0.27 |
NM_016220 | ZNF588 | Zinc finger protein 588 | 0.282 |
NM_022103 | ZNF667 | Zinc finger protein 667 | 0.284 |
NM_021269 | ZNF708 | Zinc finger protein 708 | 0.295 |
NM_016649 | ESF1 | ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) | 0.3 |
NM_199132 | ZNF468 | Zinc finger protein 468 | 0.324 |
AK098175 | ZNF283 | Zinc finger protein 283 | 0.327 |
NM_198381 | ELF5 | E74-like factor 5 (ets domain transcription factor) | 0.337 |
NM_138330 | ZNF675 | Zinc finger protein 675 | 0.342 |
NM_030824 | ZNF442 | Zinc finger protein 442 | 0.345 |
NM_003441 | ZNF141 | Zinc finger protein 141 | 0.347 |
NM_001001415 | ZNF493 | Zinc finger protein 493 | 0.35 |
AK128731 | ATF2 | Activating transcription factor 2 | 0.358 |
NM_203282 | ZNF254 | Zinc finger protein 254 | 0.361 |
CR627133 | LOC342892 | Hypothetical protein LOC342892 | 0.362 |
NM_007139 | ZNF92 | Zinc finger protein 92 | 0.362 |
NM_178558 | ZNF680 | Zinc finger protein 680 | 0.367 |
NM_024498 | ZNF117 | Zinc finger protein 117 | 0.373 |
NM_003430 | ZNF91 | Zinc finger protein 91 | 0.383 |
NM_003410 | ZFX | Zinc finger protein, X-linked | 0.387 |
NM_178549 | ZNF678 | Zinc finger protein 678 | 0.391 |
NM_152601 | ZNF564 | Zinc finger protein 564 | 0.401 |
NM_024629 | MLF1IP | MLF1 interacting protein | 0.402 |
BC015987 | KLF6 | Kruppel-like factor 6 | 0.402 |
NM_145233 | ZNF20 | Zinc finger protein 20 | 0.419 |
NM_031942 | CDCA7 | Cell division cycle associated 7 | 0.423 |
NM_133473 | ZNF714 | Zinc finger protein 714 | 0.425 |
NM_005655 | KLF10 | Kruppel-like factor 10 | 0.43 |
NM_021994 | ZNF277P | Zinc finger protein 277 pseudogene | 0.434 |
NM_025189 | ZNF430 | Zinc finger protein 430 | 0.446 |
NM_001008390 | CGGBP1 | CGG triplet repeat binding protein 1 | 0.449 |
NM_024087 | ASB9 | Ankyrin repeat and SOCS box-containing 9 | 0.454 |
NM_032828 | ZNF587 | Zinc finger protein 587 | 0.474 |
NM_006980 | MTERF | Mitochondrial transcription termination factor | 0.483 |
NM_024561 | NARG1L | NMDA receptor regulated 1-like | 0.484 |
NM_173531 | ZNF100 | Zinc finger protein 100 | 0.485 |
NM_003864 | SAP30 | Sin3A-associated protein, 30 kDa | 0.491 |
NM_012345 | NUFIP1 | Nuclear fragile X mental retardation protein interacting protein 1 | 0.492 |
NM_003079 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | 0.494 |
NM_006193 | PAX4 | Paired box gene 4 | 0.496 |
NM_003599 | SUPT3H | Suppressor of Ty 3 homolog (S. cerevisiae) | 0.499 |
NM_006311 | NCOR1 | Nuclear receptor co-repressor 1 | 0.5 |
(f) Cell cycle | |||
NM_020675 | SPBC25 | Spindle pole body component 25 homolog (S. cerevisiae) | 0.189 |
NM_018492 | PBK | PDZ binding kinase | 0.197 |
NM_145697 | NUF2 | NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) | 0.199 |
NM_006101 | KNTC2 | Kinetochore associated 2 | 0.208 |
NM_002358 | MAD2L1 | MAD2 mitotic arrest deficient-like 1 (yeast) | 0.23 |
NM_006716 | DBF4 | DBF4 homolog (S. cerevisiae) | 0.251 |
NM_003318 | TTK | TTK protein kinase | 0.252 |
NM_018131 | CEP55 | Centrosomal protein 55 kDa | 0.254 |
NM_012177 | FBXO5 | F-box protein 5 | 0.261 |
NM_013277 | RACGAP1 | Rac GTPase activating protein 1 | 0.262 |
NM_018136 | ASPM | Asp (abnormal spindle) homolog, microcephaly associated (Drosophila) | 0.263 |
NM_014750 | DLG7 | Discs, large homolog 7 (Drosophila) | 0.268 |
NM_016343 | CENPF | Centromere protein F, 350/400ka (mitosin) | 0.273 |
NM_017489 | TERF1 | Telomeric repeat binding factor (NIMA-interacting) 1 | 0.29 |
NM_006461 | SPAG5 | Sperm associated antigen 5 | 0.291 |
NM_001790 | CDC25C | Cell division cycle 25 homolog C (S. cerevisiae) | 0.329 |
NM_004064 | CDKN1B | Cyclin-dependent kinase inhibitor 1B (p27, Kip1) | 0.329 |
NM_080668 | CDCA5 | Cell division cycle associated 5 | 0.334 |
NM_021211 | EIF4G2 | Eukaryotic translation initiation factor 4 gamma, 2 | 0.351 |
NM_001274 | CHEK1 | CHK1 checkpoint homolog (S. pombe) | 0.362 |
NM_001005414 | ZWINT | ZW10 interactor | 0.366 |
NM_144710 | Septin 10 | Septin 10 | 0.368 |
NM_004336 | BUB1 | BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) | 0.374 |
NM_005496 | SMC4 | Structural maintenance of chromosomes 4 | 0.378 |
NM_181803 | UBE2C | Ubiquitin-conjugating enzyme E2C | 0.382 |
NM_018101 | CDCA8 | Cell division cycle associated 8 | 0.384 |
AF147440 | KIF15 | Kinesin family member 15 | 0.384 |
NM_005030 | PLK1 | Polo-like kinase 1 (Drosophila) | 0.39 |
NM_022346 | NCAPG | Non-SMC condensin I complex, subunit G | 0.39 |
NM_019084 | CCNJ | Cyclin J | 0.396 |
NM_005504 | BCAT1 | Branched chain aminotransferase 1, cytosolic | 0.399 |
NM_004523 | KIF11 | Kinesin family member 11 | 0.41 |
NM_004354 | CCNG2 | Cyclin G2 | 0.423 |
NM_001237 | CCNA2 | Cyclin A2 | 0.434 |
NM_032626 | RBBP6 | Retinoblastoma binding protein 6 | 0.435 |
NM_021930 | RINT1 | RAD50 interactor 1 | 0.435 |
NM_018685 | ANLN | Anillin, actin binding protein | 0.437 |
NM_016195 | MPHOSPH1 | M-phase phosphoprotein 1 | 0.447 |
NM_001827 | CKS2 | CDC28 protein kinase regulatory subunit 2 | 0.459 |
NM_138555 | KIF23 | Kinesin family member 23 | 0.468 |
NM_031966 | CCNB1 | Cyclin B1 | 0.472 |
NM_005915 | MCM6 | Minichromosome maintenance deficient 6 homolog (S. cerevisiae) | 0.472 |
NM_014751 | MTSS1 | Metastasis suppressor 1 | 0.475 |
NM_003981 | PRC1 | Protein regulator of cytokinesis 1 | 0.476 |
NM_001826 | CKS1B | CDC28 protein kinase regulatory subunit 1B | 0.486 |
NM_198219 | ING1 | Inhibitor of growth family, member 1 | 0.486 |
NM_014881 | DCLRE1A | DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) | 0.487 |
NM_001255 | CDC20 | Cell division cycle 20 homolog (S. cerevisiae) | 0.495 |
NM_016359 | NUSAP1 | Nucleolar and spindle associated protein 1 | 0.496 |
(g) Signal transduction | |||
AF085846 | RAPGEF6 | Rap guanine nucleotide exchange factor (GEF) 6 | 0.245 |
NM_001656 | TRIM23 | Tripartite motif-containing 23 | 0.247 |
NM_145307 | PLEKHK1 | Pleckstrin homology domain containing, family K member 1 | 0.274 |
NM_080651 | THRAP6 | Thyroid hormone receptor associated protein 6 | 0.309 |
NM_003714 | STC2 | Stanniocalcin 2 | 0.31 |
NM_018098 | ECT2 | Epithelial cell transforming sequence 2 oncogene | 0.314 |
NM_004586 | RPS6KA3 | Ribosomal protein S6 kinase, 90 kDa, polypeptide 3 | 0.35 |
NM_002317 | LOX | Lysyl oxidase | 0.354 |
NM_031296 | RAB33B | RAB33B, member RAS oncogene family | 0.386 |
NM_014736 | CSNK1G1 | Casein kinase 1, gamma 1 | 0.389 |
XM_292197 | DGKH | Diacylglycerol kinase, eta | 0.394 |
NM_016513 | ICK | Intestinal cell (MAK-like) kinase | 0.397 |
NM_001331 | CTNND1 | Catenin (cadherin-associated protein), delta 1 | 0.437 |
AB032991 | NDFIP2 | Nedd4 family interacting protein 2 | 0.445 |
NM_004232 | SOCS6 | Suppressor of cytokine signaling 6 | 0.447 |
NM_003472 | DEK | DEK oncogene (DNA binding) | 0.451 |
NM_012334 | MYO10 | Myosin X | 0.455 |
NM_012425 | RSU1 | Ras suppressor protein 1 | 0.461 |
NM_002140 | HNRPK | Heterogeneous nuclear ribonucleoprotein K | 0.463 |
NM_005271 | GLUD1 | Glutamate dehydrogenase 1 | 0.466 |
NM_145203 | CSNK1A1L | Casein kinase 1, alpha 1-like | 0.489 |
BU679059 | GDI2 | GDP dissociation inhibitor 2 | 0.489 |
NM_006305 | ANP32A | Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A | 0.492 |
NM_020824 | ARHGAP21 | Rho GTPase activating protein 21 | 0.492 |
NM_012120 | CD2AP | CD2-associated protein | 0.494 |
(h) Transport | |||
NM_012089 | ABCB10 | ATP-binding cassette, sub-family B (MDR/TAP), member 10 | 0.279 |
NM_021977 | SLC22A3 | Solute carrier family 22 (extraneuronal monoamine transporter), member 3 | 0.325 |
NM_015171 | XPO6 | Exportin 6 | 0.379 |
NM_016467 | ORMDL1 | ORM1-like 1 (S. cerevisiae) | 0.397 |
AA484677 | SEC22B | SEC22 vesicle trafficking protein homolog B (S. cerevisiae) | 0.401 |
BC035622 | AP4S1 | Adaptor-related protein complex 4, sigma 1 subunit | 0.44 |
NM_002520 | NPM1 | Nucleophosmin (nucleolar phosphoprotein B23, numatrin) | 0.442 |
NM_014043 | CHMP2B | Chromatin modifying protein 2B | 0.445 |
NM_003133 | SRP9 | Signal recognition particle 9 kDa | 0.446 |
NM_013322 | SNX10 | Sorting nexin 10 | 0.469 |
NM_005733 | KIF20A | Kinesin family member 20A | 0.483 |
NM_014322 | CHML | Choroideremia-like (Rab escort protein 2) | 0.485 |
NM_020401 | NUP107 | Nucleoporin 107 kDa | 0.493 |
NM_138285 | NUP35 | Nucleoporin 35 kDa | 0.493 |
(i) Apoptosis | |||
NM_001786 | CDC2 | Cell division cycle 2, G1 to S and G2 to M | 0.239 |
NM_001067 | TOP2A | Topoisomerase (DNA) II alpha 170 kDa | 0.302 |
NM_001012271 | BIRC5 | Baculoviral IAP repeat-containing 5 (survivin) | 0.341 |
NM_024854 | IAPP | Islet amyloid polypeptide | 0.393 |
NM_021631 | FKSG2 | Apoptosis inhibitor | 0.427 |
NM_018204 | CKAP2 | Cytoskeleton associated protein 2 | 0.436 |
NM_021999 | ITM2B | Integral membrane protein 2B | 0.442 |
NM_005400 | PRKCE | Protein kinase C, epsilon | 0.443 |
NM_148957 | TNFRSF19 | Tumor necrosis factor receptor superfamily, member 19 | 0.449 |
NM_001006 | RPS3A | Ribosomal protein S3A | 0.453 |
(j) Response to chemical stimulus | |||
NM_006437 | PARP4 | Poly (ADP-ribose) polymerase family, member 4 | 0.172 |
NM_024055 | SLC30A5 | Solute carrier family 30 (zinc transporter), member 5 | 0.355 |
NM_000582 | SPP1 | Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1) | 0.405 |
NM_016951 | CKLF | Chemokine-like factor | 0.413 |
NM_002737 | PRKCA | Protein kinase C, alpha | 0.431 |
NM_004836 | EIF2AK3 | Eukaryotic translation initiation factor 2-alpha kinase 3 | 0.466 |
NM_020686 | ABAT | 4-aminobutyrate aminotransferase | 0.484 |
NM_004134 | HSPA9 | Heat shock 70 kDa protein 9 (mortalin) | 0.491 |
NM_053039 | UGT2B28 | UDP glucuronosyltransferase 2 family, polypeptide B28 | 0.5 |
(k) DNA repair | |||
NM_007195 | POLI | Polymerase (DNA directed) iota | 0.292 |
NM_005256 | FANCF | Fanconi anemia, complementation group F | 0.39 |
NM_003368 | USP1 | Ubiquitin specific peptidase 1 | 0.413 |
NM_001018115 | FANCD2 | Fanconi anemia, complementation group D2 | 0.437 |
AI281523 | SFPQ | Splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated) | 0.471 |
NM_004075 | CRY1 | Cryptochrome 1 (photolyase-like) | 0.495 |
(l) immune response | |||
NM_002389 | CD46 | CD46 molecule, complement regulatory protein | 0.0872 |
NM_000584 | IL8 | Interleukin 8 | 0.263 |
NM_001801 | CDO1 | Cysteine dioxygenase, type I | 0.38 |
NM_000715 | C4BPA | Complement component 4 binding protein, alpha | 0.397 |
NM_144503 | F11R | F11 receptor | 0.412 |
(m) 기타 | |||
NM_145697 | CDCA1 | Cell division cycle associated 1 | 0.199 |
NM_001010914 | LOC400986 | Protein immuno-reactive with anti-PTH polyclonal antibodies | 0.228 |
<
실시예
3> 실시간
RT
-PCR(
Real
-
time
reverse
transcriptase
polymerase
chain
reaction
) 정량
3-메틸콜란트렌에 의해 발현 유도된 상기 실시예 2의 2배 이상 과발현 및 저발현된 유전자 중 3-메틸콜란트렌에 의해 과발현되는 유전자 19종과 저발현 되는 유전자 6종을 선별하였다. 이들 유전자들은 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호 NM_003254(TIMP metallopeptidase inhibitor 1), 유전자 등록번호 NM_004864(Growth differentiation factor 15), 유전자 등록번호 NM_001554(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호 NM_000480[Adenosine monophosphate deaminase (isoform E)], 유전자 등록번호 NM_004073[Polo-like kinase 3 (Drosophila)], 유전자 등록번호 NM_001769(CD9 molecule), 유전자 등록번호 NM_004925[Aquaporin 3 (Gill blood group)], 유전자 등록번호 NM_003516(Histone 2, H2aa), 유전자 등록번호 NM_020728[Family with sequence similarity 62 (C2 domain containing) member B], 유전자 등록번호 NM_203347 (MSFL2541), 유전자 등록번호 NM_006227(Phospholipid transfer protein), 유전자 등록번호 NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호 NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호 NM_021603(FXYD domain containing ion transport regulator 2) , 유전자 등록번호 NM_018837(Sulfatase 2), 유전자 등록번호 NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호 NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호 NM_032872(Synaptotagmin-like 1), 유전자 등록번호 NM_020675[Spindle pole body component 25 homolog (S. cerevisiae)], 유전자 등록번호 NM_001010914(Protein immuno-reactive with anti-PTH polyclonal antibodies), 유전자 등록번호 NM_021977[Solute carrier family 22 (extraneuronal monoamine transporter), member 3], 유전자 등록번호 NM_012089[ATP-binding cassette, sub-family B (MDR/TAP), member 10], 유전자 등록번호 NM_018492(PDZ binding kinase), 유전자 등록번호 NM_145697(Cell division cycle associated 1)이다.
상기 유전자들의 발현변화 정도를 조사 및 정량하기 위해 My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다.
구체적으로, 올리고 dT 프라이머와 Superscript kit(Omniscipt™ kit, Qiagen, Co., USA)를 이용하여 역전사반응을 수행하여 cDNA를 합성하였다. PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, USA)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광 강도(fluroscense intensity)가 증가하게 된다. 먼저 PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(GAPDH)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 4)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다(표 5).
등록번호 | 유전자명 | PCR 프라이머 서열 | |
NM_000499 | Cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1) | 센스 (서열번호1) | CACCATCCCCCACAGCAC |
안티센스 (서열번호2) | ACAAAGACACAACGCCCCTT | ||
NM_003254 | TIMP metallopeptidase inhibitor 1 (TIMP1) | 센스 (서열번호3) | GATACTTCCACAGGTCCCACAAC |
안티센스 (서열번호4) | GCAAGAGTCCATCCTGCAGTT | ||
NM_004864 | Growth differentiation factor 15 (GDF15) | 센스 (서열번호5) | CCTGAGACACCCGATTCCT |
안티센스 (서열번호6) | ACAGTTCCATCAGACCAGCC | ||
NM_001554 | Cysteine-rich, angiogenic inducer, 61 (CYR61) | 센스 (서열번호7) | ATTGTAGAAAGGAAGCCTTGCTCAT |
안티센스 (서열번호8) | TCCAATCGTGGCTGCATTAG | ||
NM_000480 | Adenosine monophosphate deaminase (isoform E) (AMPD3) | 센스 (서열번호9) | AGGTCAAAGAAGCTGCTGCCAAAC |
안티센스 (서열번호10) | TGGACTCATCATCCACGCTGTCAA | ||
NM_004073 | Polo-like kinase 3 (Drosophila) (PLK3) | 센스 (서열번호11) | GACTACTCCAATAAGTTCGGCTTTG |
안티센스 (서열번호12) | CATATGTGTGCCATCGTTGAAGA | ||
NM_001769 | CD9 molecule 9 (CD9) | 센스 (서열번호13) | GCACCAAGTGCATCAAATACCTGC |
안티센스 (서열번호14) | AGCCATAGTCCAATGGCAAGGACA | ||
NM_004925 | Aquaporin 3 (Gill blood group) (AQP3) | 센스 (서열번호15) | TTCACGATCCACCCTTTCAGGCTA |
안티센스 (서열번호16) | ACACATACCTGCTGCCCATTCTCT | ||
NM_003516 | Histone 2, H2aa (HIST2H2AA) | 센스 (서열번호17) | GAACTGAACAAGCTGCTGGGCAAA |
안티센스 (서열번호18) | TCTCCGTCTTCTTAGGGAGCAGTA | ||
NM_020728 | Family with sequence similarity 62 (C2 domain containing) member B (FAM62B) | 센스 (서열번호19) | GGAAAACACACGTGTCAAAGAA |
안티센스 (서열번호20) | TTCTTCACGGCAACGTCA | ||
NM_203347 | MSFL2541 (UNQ2541) | 센스 (서열번호21) | TTCGCCGTCCTTTACATCTAC |
안티센스 (서열번호22) | AGAGCCTGGGGACTCACAT | ||
NM_006227 | Phospholipid transfer protein (PLTP) | 센스 (서열번호23) | TGCCACAGAGAAGACGGGATTTGA |
안티센스 (서열번호24) | AGGTGGTGGACGGACTGTAATTGA | ||
NM_000596 | Insulin-like growth factor binding protein 1 (IGFBP1) | 센스 (서열번호25) | ATCATTCCATCCTTTGGGACGCCA |
안티센스 (서열번호26) | TGTCTCCTGTGCCTTGGCTAAACT | ||
NM_006426 | Dihydropyrimidinase-like 4 (DPYSL4) | 센스 (서열번호27) | TGGGAAGATGGACGAGAATGAGTTCG |
안티센스 (서열번호28) | ACTCCACTCCCTCGAAGATGTTGT | ||
NM_021603 | FXYD domain containing ion transport regulator 2 (FXYD2) | 센스 (서열번호29) | GGCAATAAGAAGCGCAGGCAAATC |
안티센스 (서열번호30) | AAGGTCTAAAGCCCAGGGAAGAAG | ||
NM_018837 | Sulfatase 2 (SULF2) | 센스 (서열번호31) | TGCGGATATGGACGGGAAATCCAT |
안티센스 (서열번호32) | TCTCTTGTGTAGCAGCTTGCCTCT | ||
NM_004881 | Tumor protein p53 inducible protein 3 (TP53I3) | 센스 (서열번호33) | AGGGTGAAGTCCTCCTGAAGGT |
안티센스 (서열번호34) | GTGGGTCATACTGGCCTTGTCT | ||
NM_001553 | Insulin-like growth factor binding protein 7 (IGFBP7) | 센스 (서열번호35) | ACTTGAGCTGTGAGGTCATCGGAA |
안티센스 (서열번호36) | ATACCAGCACCCAGCCAGTTACTT | ||
NM_032872 | Synaptotagmin-like 1 (SYTL1) | 센스 (서열번호37) | GGCGGTGAAGAAACGGAATCTGAA |
안티센스 (서열번호38) | GAAAGATGTTGCGACCCAGGCTTT | ||
NM_020675 | Spindle pole body component 25 homolog (S. cerevisiae) (SPBC25) | 센스 (서열번호39) | GAATGGTTGAGATGTTTCTGGA |
안티센스 (서열번호40) | GCAATCAATTTTAACAAGTTATCCTTT | ||
NM_001010914 | Protein immuno-reactive with anti-PTH polyclonal antibodies (LOC400986) | 센스 (서열번호41) | AAGGAGGGACAACAATCTGGGACA |
안티센스 (서열번호42) | TCACTTGTAGCCTTTGAGGGTGGT | ||
NM_021977 | Solute carrier family 22 (extraneuronal monoamine transporter), member 3 (SLC22A3) | 센스 (서열번호43) | GCCCTGTTCCAGCAATAAGA |
안티센스 (서열번호44) | GAGAGCCAAAAATGTCCCAA | ||
NM_012089 | ATP-binding cassette, sub-family B (MDR/TAP), member 10 (ABCB10) | 센스 (서열번호45) | TCAGCCTTTCCATTCCGTCAGGAT |
안티센스 (서열번호46) | TTTGGATCTCAGCCACACTGGGTT | ||
NM_018492 | PDZ binding kinase (PBK) | 센스 (서열번호47) | TCTGGACTGAGAGTGGCTTTCACA |
안티센스 (서열번호48) | AGCCAAGCTTCTGCATAAACGGAG | ||
NM_145697 | Cell division cycle associated 1 (CDCA1) | 센스 (서열번호49) | TGCCTTCATGTCAGTTGGAAGTGC |
안티센스 (서열번호50) | TTTGGTCCTCCAAGTTCAGGCTCT |
등록번호 | 유전자명 | 마이크로어레이 ( Cy3 / Cy5 비율) | 실시간 PCR (상대적 배율) |
과발현 유전자 | |||
NM_000499 | Cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1) | 10.23 | 71.56 |
NM_003254 | TIMP metallopeptidase inhibitor 1 (TIMP1) | 4.06 | 4.42 |
NM_004864 | Growth differentiation factor 15 (GDF15) | 4.37 | 6.43 |
NM_001554 | Cysteine-rich, angiogenic inducer, 61 (CYR61) | 2.60 | 2.95 |
NM_000480 | Adenosine monophosphate deaminase (isoform E) (AMPD3) | 2.51 | 7.05 |
NM_004073 | Polo-like kinase 3 (Drosophila) (PLK3) | 2.57 | 3.52 |
NM_001769 | CD9 molecule (CD9) | 3.52 | 6.59 |
NM_004925 | Aquaporin 3 (Gill blood group) (AQP3) | 3.41 | 22.14 |
NM_003516 | Histone 2, H2aa (HIST2H2AA) | 2.65 | 2.52 |
NM_020728 | Family with sequence similarity 62 (C2 domain containing) member B (FAM62B) | 2.31 | 1.56 |
NM_203347 | MSFL2541 (UNQ2541) | 6.68 | 29.45 |
NM_006227 | Phospholipid transfer protein (PLTP) | 6.22 | 24.69 |
NM_000596 | Insulin-like growth factor binding protein 1 (IGFBP1) | 6.05 | 7.41 |
NM_006426 | Dihydropyrimidinase-like 4 (DPYSL4) | 5.01 | 14.93 |
NM_021603 | FXYD domain containing ion transport regulator 2 (FXYD2) | 4.87 | 17.86 |
NM_018837 | Sulfatase 2 (SULF2) | 4.44 | 7.77 |
NM_004881 | Tumor protein p53 inducible protein 3 (TP53I3) | 4.23 | 9.40 |
NM_001553 | Insulin-like growth factor binding protein 7 (IGFBP7) | 4.03 | 15.59 |
NM_032872 | Synaptotagmin-like 1 (SYTL1) | 3.71 | 4.34 |
저발현 유전자 | |||
NM_020675 | Spindle pole body component 25 homolog (S. cerevisiae) (SPBC25) (SPBC25) | 0.19 | 0.13 |
NM_001010914 | Protein immuno-reactive with anti-PTH polyclonal antibodies (LOC400986) | 0.23 | 0.52 |
NM_021977 | Solute carrier family 22 (extraneuronal monoamine transporter), member 3 (SLC22A3) | 0.33 | 0.45 |
NM_012089 | ATP-binding cassette, sub-family B (MDR/TAP), member 10 (ABCB10) | 0.28 | 0.59 |
NM_018492 | PDZ binding kinase (PBK) | 0.20 | 0.11 |
NM_145697 | Cell division cycle associated 1 (CDCA1) | 0.20 | 0.13 |
그 결과, 19종의 과발현 유전자들 및 6종의 저발현 유전자의 유전자 발현 양상은 3-메틸콜란트렌에 의한 유전자 발현을 조사한 올리고 마이크로어레이 결과와 매우 유사하게 나타남을 확인하였다.
본 발명의 3-메틸콜란트렌에 대한 노출 여부 진단용 바이오마커 및 이를 이용한 진단 방법은 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 3-메틸콜란트렌의 모니터링 및 위해성을 판정하는데 유용하며, 3-메틸콜란트렌에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.
<110> Korea Institute of Science and Technology
<120> Biomaker and screenig method of 3-methylcholanthrene having
polycyclic aromatic ring using thereof
<130> 7p-02-08
<160> 50
<170> KopatentIn 1.71
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000499
<400> 1
caccatcccc cacagcac 18
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000499-R
<400> 2
acaaagacac aacgcccctt 20
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_003254
<400> 3
gatacttcca caggtcccac aac 23
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_003254-R
<400> 4
gcaagagtcc atcctgcagt t 21
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004864
<400> 5
cctgagacac ccgattcct 19
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004864-R
<400> 6
acagttccat cagaccagcc 20
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001554
<400> 7
attgtagaaa ggaagccttg ctcat 25
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001554-R
<400> 8
tccaatcgtg gctgcattag 20
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000480
<400> 9
aggtcaaaga agctgctgcc aaac 24
<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000480-R
<400> 10
tggactcatc atccacgctg tcaa 24
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004073
<400> 11
gactactcca ataagttcgg ctttg 25
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004073-R
<400> 12
catatgtgtg ccatcgttga aga 23
<210> 13
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001769
<400> 13
gcaccaagtg catcaaatac ctgc 24
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001769-R
<400> 14
agccatagtc caatggcaag gaca 24
<210> 15
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004925
<400> 15
ttcacgatcc accctttcag gcta 24
<210> 16
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004925-R
<400> 16
acacatacct gctgcccatt ctct 24
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_003516
<400> 17
gaactgaaca agctgctggg caaa 24
<210> 18
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_003516-R
<400> 18
tctccgtctt cttagggagc agta 24
<210> 19
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_020728
<400> 19
ggaaaacaca cgtgtcaaag aa 22
<210> 20
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_020728-R
<400> 20
ttcttcacgg caacgtca 18
<210> 21
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_203347
<400> 21
ttcgccgtcc tttacatcta c 21
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_203347-R
<400> 22
agagcctggg gactcacat 19
<210> 23
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_006227
<400> 23
tgccacagag aagacgggat ttga 24
<210> 24
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_006227-R
<400> 24
aggtggtgga cggactgtaa ttga 24
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000596
<400> 25
atcattccat cctttgggac gcca 24
<210> 26
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_000596-R
<400> 26
tgtctcctgt gccttggcta aact 24
<210> 27
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_006426
<400> 27
tgggaagatg gacgagaatg agttcg 26
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_006426-R
<400> 28
actccactcc ctcgaagatg ttgt 24
<210> 29
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_021603
<400> 29
ggcaataaga agcgcaggca aatc 24
<210> 30
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_021603-R
<400> 30
aaggtctaaa gcccagggaa gaag 24
<210> 31
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_018837
<400> 31
tgcggatatg gacgggaaat ccat 24
<210> 32
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_018837-R
<400> 32
tctcttgtgt agcagcttgc ctct 24
<210> 33
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004881
<400> 33
agggtgaagt cctcctgaag gt 22
<210> 34
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_004881-R
<400> 34
gtgggtcata ctggccttgt ct 22
<210> 35
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001553
<400> 35
acttgagctg tgaggtcatc ggaa 24
<210> 36
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001553-R
<400> 36
ataccagcac ccagccagtt actt 24
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_032872
<400> 37
ggcggtgaag aaacggaatc tgaa 24
<210> 38
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_032872-R
<400> 38
gaaagatgtt gcgacccagg cttt 24
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_020675
<400> 39
gaatggttga gatgtttctg ga 22
<210> 40
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_020675-R
<400> 40
gcaatcaatt ttaacaagtt atccttt 27
<210> 41
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001010914
<400> 41
aaggagggac aacaatctgg gaca 24
<210> 42
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_001010914
<400> 42
tcacttgtag cctttgaggg tggt 24
<210> 43
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_021977
<400> 43
gccctgttcc agcaataaga 20
<210> 44
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_021977-R
<400> 44
gagagccaaa aatgtcccaa 20
<210> 45
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_012089
<400> 45
tcagcctttc cattccgtca ggat 24
<210> 46
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_012089-R
<400> 46
tttggatctc agccacactg ggtt 24
<210> 47
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_018492
<400> 47
tctggactga gagtggcttt caca 24
<210> 48
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_018492-R
<400> 48
agccaagctt ctgcataaac ggag 24
<210> 49
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_145697
<400> 49
tgccttcatg tcagttggaa gtgc 24
<210> 50
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NM_145697-R
<400> 50
tttggtcctc caagttcagg ctct 24
Claims (11)
- 하기의 군으로부터 선택되는 유전자 서열의 전부 또는 일부로 구성되는 올리고뉴클레오티드 또는 그의 상보적인 올리고뉴클레오티드가 집적된 3-메틸콜란트렌에 대한 노출 여부 진단용 DNA 마이크로어레이 칩:유전자 등록번호(Genebank) NM_203347(MSFL2541), 유전자 등록번호(Genebank) NM_018837(Sulfatase 2), 유전자 등록번호(Genebank) NM_001769(CD9 molecule), 유전자 등록번호(Genebank) NM_001402(Eukaryotic translation elongation factor 1 alpha 1), 유전자 등록번호(Genebank) NM_170693(Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(Genebank) NM_021599(ADAM metallopeptidase with thrombospondin type 1 motif, 2), 유전자 등록번호(Genebank) NM_001017973(Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II), 유전자 등록번호(Genebank) NM_032324(Chromosome 1 open reading frame 57), 유전자 등록번호(Genebank) NM_198194(Stomatin), 유전자 등록번호(Genebank) NM_016368(Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) NM_030569(Inter-alpha (globulin) inhibitor H5), 유전자 등록번호(Genebank) NM_001748(Calpain 2, (m/II) large subunit), 유전자 등록번호(Genebank) NM_012467(Tryptase gamma 1), 유전자 등록번호(Genebank) NM_001917(D-amino-acid oxidase), 유전자 등록번호(Genebank) NM_015920(Ribosomal protein S27-like), 유전자 등록번호(Genebank) NM_001009820[Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen)], 유전자 등록번호(Genebank) NM_014010(Pregnancy-associated plasma protein A, pappalysin 1), 유전자 등록번호(Genebank) NM_152640[DCP1 decapping enzyme homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) NM_001019(Ribosomal protein S15a), 유전자 등록번호(Genebank) NM_002842(Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(Genebank) NM_001004(Tetraspanin 4), 유전자 등록번호(Genebank) NM_006929[Superkiller viralicidic activity 2-like (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012190(Aldehyde dehydrogenase 1 family, member L1), 유전자 등록번호(Genebank) NM_032872(Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000480[Adenosine monophosphate deaminase (isoform E)], 유전자 등록번호(Genebank) NM_000476(Adenylate kinase 1), 유전자 등록번호(Genebank) NM_018161(NAD synthetase 1), 유전자 등록번호(Genebank) NM_003516(Histone cluster 2, H2aa3), 유전자 등록번호(Genebank) NM_021063(Histone cluster 1, H2bd), 유전자 등록번호(Genebank) NM_001005749[Glucosidase, beta; acid (includes glucosylceramidase)], 유전자 등록번호(Genebank) NM_005319(Histone cluster 1, H1c), 유전자 등록번호(Genebank) NM_001015053(Histone deacetylase 5), 유전자 등록번호(Genebank) NM_003528(Histone cluster 2, H2be), 유전자 등록번호(Genebank) NM_002778[Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)], 유전자 등록번호(Genebank) NM_021058(Histone cluster 1, H2bj), 유전자 등록번호(Genebank) NM_003524(Histone cluster 1, H2bh), 유전자 등록번호(Genebank) NM_003519(Histone cluster 1, H2bl), 유전자 등록번호(Genebank) NM_033445(Histone cluster 3, H2a), 유전자 등록번호(Genebank) NM_005572(Lamin A/C), 유전자 등록번호(Genebank) NM_003520(Histone cluster 1, H2bn), 유전자 등록번호(Genebank) NM_003527(Histone cluster 1, H2bo), 유전자 등록번호(Genebank) NM_175055(Histone cluster 3, H2bb), 유전자 등록번호(Genebank) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_201525(G protein-coupled receptor 56), 유전자 등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자 등록번호(Genebank) NM_175744(Ras homolog gene family, member C), 유전자 등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자 등록번호(Genebank) NM_006018(G protein-coupled receptor 109B), 유전자 등록번호(Genebank) NM_005310(Growth factor receptor-bound protein 7), 유전자 등록번호(Genebank) NM_002926(Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자 등록번호(Genebank) NM_002194(Inositol polyphosphate-1-phosphatase), 유전자 등록번호(Genebank) BC064982(MCF.2 cell line derived transforming sequence-like), 유전자 등록번호(Genebank) NM_001005339(Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) NM_021077(Neuromedin B), 유전자 등록번호(Genebank) NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_018494(Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) NM_033285(Tumor protein p53 inducible nuclear protein 1), 유전자 등록번호(Genebank) NM_001197[BCL2-interacting killer (apoptosis-inducing)], 유전자 등록번호(Genebank) NM_001540(Heat shock 27 kDa protein 1), 유전자 등록번호(Genebank) NM_003820[Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)], 유전자 등록번호(Genebank) NM_147780(Cathepsin B), 유전자 등록번호(Genebank) NM_001003940(Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_000389[Cyclin-dependent kinase inhibitor 1A (p21, Cip1)], 유전자 등록번호(Genebank) NM_016639(Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) NM_000043[Fas (TNF receptor superfamily, member 6)], 유전자 등록번호(Genebank) NM_002307[Lectin, galactoside-binding, soluble, 7 (galectin 7)], 유전자 등록번호(Genebank) NM_021603(FXYD domain containing ion transport regulator 2), 유전자 등록번호(Genebank) NM_004925[Aquaporin 3 (Gill blood group)], 유전자 등록번호(Genebank) NM_000014(Alpha-2-macroglobulin), 유전자 등록번호(Genebank) NM_022449(RAB17, member RAS oncogene family), 유전자 등록번호(Genebank) NM_005855[Receptor (G protein-coupled) activity modifying protein 1], 유전자 등록번호(Genebank) NM_006868(RAB31, member RAS oncogene family), 유전자 등록번호(Genebank) NM_032493(Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) NM_007097(Clathrin, light chain (Lcb)), 유전자 등록번호(Genebank) NM_005697(Secretory carrier membrane protein 2), 유전자 등록번호(Genebank) NM_004073(Polo-like kinase 3 (Drosophila)), 유전자 등록번호(Genebank) NM_182795(Nucleophosmin/ nucleoplasmin, 2), 유전자 등록번호(Genebank) NM_005072[Solute carrier family 12 (potassium/chloride transporters), member 4], 유전자 등록번호(Genebank) NM_144606(Folliculin), 유전자 등록번호(Genebank) NM_014059(Response gene to complement 32), 유전자 등록번호(Genebank) NM_002754(Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_013376(SERTA domain containing 1), 유전자 등록번호(Genebank) NM_000107(Damage-specific DNA binding protein 2, 48 kDa), 유전자 등록번호(Genebank) NM_004433[E74-like factor 3 (ets domain transcription factor, epithelial-specific)], 유전자 등록번호(Genebank) NM_021969(Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) NM_023039[Ankyrin repeat, family A (RFXANK-like), 2], 유전자 등록번호(Genebank) NM_080875[Mindbomb homolog 2 (Drosophila)], 유전자 등록번호(Genebank) NM_002166(Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(Genebank) NM_001421[E74-like factor 4 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_153813(Zinc finger protein, multitype 1), 유전자 등록번호(Genebank) U68019(SMAD family member 3), 유전자 등록번호(Genebank) NM_015655(Zinc finger protein 337), 유전자 등록번호(Genebank) NM_031918(Kruppel-like factor 16), 유전자 등록번호(Genebank) NM_001554(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_003960(N-acetyltransferase 8), 유전자 등록번호(Genebank) NM_032965[Chemokine (C-C motif) ligand 15], 유전자 등록번호(Genebank) NM_005064[Chemokine (C-C motif) ligand 23], 유전자 등록번호(Genebank) NM_001531(Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) NM_006404[Protein C receptor, endothelial (EPCR)], 유전자 등록번호(Genebank) NM_002119(Major histocompatibility complex, class II, DO alpha), 유전자 등록번호(Genebank) NM_005101(ISG15 ubiquitin-like modifier), 유전자 등록번호(Genebank) NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_020728[Family with sequence similarity 62 (C2 domain containing) member B], 유전자 등록번호(Genebank) NM_016441[Cysteine rich transmembrane BMP regulator 1 (chordin-like)], 유전자 등록번호(Genebank) NM_203391(Glycerol kinase), 유전자 등록번호(Genebank) NM_006775[Quaking homolog, KH domain RNA binding (mouse)], 유전자 등록번호(Genebank) NM_052937[Protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1], 유전자 등록번호(Genebank) NM_003932[Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)], 유전자 등록번호(Genebank) NM_030979[Poly(A) binding protein, cytoplasmic 3], 유전자 등록번호(Genebank) NM_032549[IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)], 유전자 등록번호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유전자 등록번호(Genebank) NM_002139(RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) BC033021(Klotho beta), 유전자 등록번호(Genebank) NM_016093(Ribosomal protein L26-like 1), 유전자 등록번호(Genebank) CR611166[Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)], 유전자 등록번호(Genebank) NM_017437(Cleavage and polyadenylation specific factor 2, 100 kDa), 유전자 등록번호(Genebank) NM_033114(Zinc finger CCHC-type and RNA binding motif 1), 유전자 등록번호(Genebank) NM_000236(Lipase, hepatic), 유전자 등록번호(Genebank) NM_174936(Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_004375(COX11 homolog, cytochrome c oxidase assembly protein (yeast)), 유전자 등록번호(Genebank) NM_004685(Myotubularin related protein 6), 유전자 등록번호(Genebank) NM_052965(Chromosome 1 open reading frame 19), 유전자 등록번호(Genebank) NM_201278(Myotubularin related protein 2), 유전자 등록번호(Genebank) NM_003093(Small nuclear ribonucleoprotein polypeptide C), 유전자 등록번호(Genebank) AV757313(Ribosomal protein L9), 유전자 등록번호(Genebank) NM_014791(Maternal embryonic leucine zipper kinase), 유전자 등록번호(Genebank) BX537987[Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)], 유전자 등록번호(Genebank) BC041925[Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자 등록번호(Genebank) BC032643(Synaptotagmin binding, cytoplasmic RNA interacting protein), 유전자 등록번호(Genebank) NM_016058(TP53RK binding protein), 유전자 등록번호(Genebank) NM_181886[Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)], 유전자 등록번호(Genebank) NM_016271(Ring finger protein 138), 유전자 등록번호(Genebank) AK021676(Phosphoglucomutase 3), 유전자 등록번호(Genebank) NM_015352(Protein O-fucosyltransferase 1), 유전자 등록번호(Genebank) NM_016304(Chromosome 15 open reading frame 15), 유전자 등록번호(Genebank) NM_003017(Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) W04231(Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) NM_006546(Insulin-like growth factor 2 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_212554(Similar to CG9643-PA), 유전자 등록번호(Genebank) BC049823(Ribosomal protein L22-like 1), 유전자 등록번호(Genebank) NM_006937[SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)], 유전자 등록번호(Genebank) NM_012331(Methionine sulfoxide reductase A), 유전자 등록번호(Genebank) NM_005875(Eukaryotic translation initiation factor 1B), 유전자 등록번호(Genebank) NM_032906(Phosphatidylinositol glycan anchor biosynthesis, class Y), 유전자 등록번호(Genebank) NM_002847(Protein tyrosine phosphatase, receptor type, N polypeptide 2), 유전자 등록번호(Genebank) NM_000947(Primase, polypeptide 2A, 58 kDa), 유전자 등록번호(Genebank) NM_181716 (Phosphatidylinositol glycan anchor biosynthesis, class L), 유전자 등록번호(Genebank) NM_004681(Eukaryotic translation initiation factor 1A, Y-linked), 유전자 등록번호(Genebank) NM_000982(Ribosomal protein L21), 유전자 등록번호(Genebank) T07777(Similar to basic leucine zipper and W2 domains 1), 유전자 등록번호(Genebank) NM_016652[Crn, crooked neck-like 1 (Drosophila)], 유전자 등록번호(Genebank) NM_000986(Ribosomal protein L24), 유전자 등록번호(Genebank) NM_139207(Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AK001406(SUMO1/sentrin specific peptidase 6), 유전자 등록번호(Genebank) NM_145649[Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)], 유전자 등록번호(Genebank) NM_020236(Mitochondrial ribosomal protein L1), 유전자 등록번호(Genebank) NM_001017430[RNA binding motif (RNP1, RRM) protein 3], 유전자 등록번호(Genebank) NM_031157(Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_018981[DnaJ (Hsp40) homolog, subfamily C, member 10], 유전자 등록번호(Genebank) NM_018291(Hypothetical protein FLJ10986), 유전자 등록번호(Genebank) NM_018048(Mago-nashi homolog 2), 유전자 등록번호(Genebank) NM_012207[Heterogeneous nuclear ribonucleoprotein H3 (2H9)], 유전자 등록번호(Genebank) NM_000028[Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III)], 유전자 등록번호(Genebank) NM_014321(Origin recognition complex, subunit 6 like (yeast)), 유전자 등록번호(Genebank) NM_015423(Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase), 유전자 등록번호(Genebank) NM_001034(Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AB032990(Family with sequence similarity 63, member B), 유전자 등록번호(Genebank) NM_000791(Dihydrofolate reductase), 유전자 등록번호(Genebank) NM_199040[Nudix (nucleoside diphosphate linked moiety X)-type motif 4], 유전자 등록번호(Genebank) NM_006886(ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit), 유전자 등록번호(Genebank) NM_004457(Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_007295(Breast cancer 1, early onset), 유전자 등록번호(Genebank) NM_006111[Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)], 유전자 등록번호(Genebank) NM_001443(Fatty acid binding protein 1, liver), 유전자 등록번호(Genebank) NM_000016(Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_001809(Centromere protein A), 유전자 등록번호(Genebank) AL833119(Hypothetical protein DKFZp313A2432), 유전자 등록번호(Genebank) NM_006493(Ceroid-lipofuscinosis, neuronal 5), 유전자 등록번호(Genebank) NM_138271[Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_006136[Capping protein (actin filament) muscle Z-line, alpha 2], 유전자 등록번호(Genebank) CR615278(H2A histone family, member V), 유전자 등록번호(Genebank) NM_024704(Chromosome 20 open reading frame 23), 유전자 등록번호(Genebank) NM_003011[SET translocation (myeloid leukemia-associated)], 유전자 등록번호(Genebank) NM_203401(Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR749233(Zinc finger protein 626), 유전자 등록번호(Genebank) AF277624(Zinc finger protein 479), 유전자 등록번호(Genebank) NM_013282(Ubiquitin-like, containing PHD and RING finger domains, 1), 유전자 등록번호(Genebank) NM_198893(Zinc finger protein 160), 유전자 등록번호(Genebank) NM_013361(Zinc finger protein 223), 유전자 등록번호(Genebank) NM_002129(High-mobility group box 2), 유전자 등록번호(Genebank) NM_002128(High-mobility group box 1), 유전자 등록번호(Genebank) NM_003429(Zinc finger protein 85), 유전자 등록번호(Genebank) NM_003423(Zinc finger protein 43), 유전자 등록번호(Genebank) NM_016220(Zinc finger protein 588), 유전자 등록번호(Genebank) NM_022103(Zinc finger protein 667), 유전자 등록번호(Genebank) NM_021269(Zinc finger protein 708), 유전자 등록번호(Genebank) NM_016649[ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_199132(Zinc finger protein 468), 유전자 등록번호(Genebank) AK098175(Zinc finger protein 283), 유전자 등록번호(Genebank) NM_198381[E74-like factor 5 (ets domain transcription factor)], 유전자 등록번호(Genebank) NM_138330(Zinc finger protein 675), 유전자 등록번호(Genebank) NM_030824(Zinc finger protein 442), 유전자 등록번호(Genebank) NM_003441(Zinc finger protein 141), 유전자 등록번호(Genebank) NM_001001415(Zinc finger protein 493), 유전자 등록번호(Genebank) AK128731(Activating transcription factor 2), 유전자 등록번호(Genebank) NM_203282(Zinc finger protein 254), 유전자 등록번호(Genebank) CR627133(Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_007139(Zinc finger protein 92), 유전자 등록번호(Genebank) NM_178558(Zinc finger protein 680), 유전자 등록번호(Genebank) NM_024498(Zinc finger protein 117), 유전자 등록번호(Genebank) NM_003430(Zinc finger protein 91), 유전자 등록번호(Genebank) NM_003410(Zinc finger protein, X-linked), 유전자 등록번호(Genebank) NM_178549(Zinc finger protein 678), 유전자 등록번호(Genebank) NM_152601(Zinc finger protein 564), 유전자 등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자 등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자 등록번호(Genebank) NM_145233(Zinc finger protein 20), 유전자 등록번호(Genebank) NM_031942(Cell division cycle associated 7), 유전자 등록번호(Genebank) NM_133473(Zinc finger protein 714), 유전자 등록번호(Genebank) NM_005655(Kruppel-like factor 10), 유전자 등록번호(Genebank) NM_021994(Zinc finger protein 277 pseudogene), 유전자 등록번호(Genebank) NM_025189(Zinc finger protein 430), 유전자 등록번호(Genebank) NM_001008390(CGG triplet repeat binding protein 1), 유전자 등록번호(Genebank) NM_024087(Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(Genebank) NM_032828(Zinc finger protein 587), 유전자 등록번호(Genebank) NM_006980(Mitochondrial transcription termination factor), 유전자 등록번호(Genebank) NM_024561(NMDA receptor regulated 1-like), 유전자 등록번호(Genebank) NM_173531(Zinc finger protein 100), 유전자 등록번호(Genebank) NM_003864(Sin3A-associated protein, 30 kDa), 유전자 등록번호(Genebank) NM_012345(Nuclear fragile X mental retardation protein interacting protein 1), 유전자 등록번호(Genebank) NM_003079(SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1), 유전자 등록번호(Genebank) NM_006193(Paired box gene 4), 유전자 등록번호(Genebank) NM_003599[Suppressor of Ty 3 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006311(Nuclear receptor co-repressor 1), 유전자 등록번호(Genebank) NM_020675[Spindle pole body component 25 homolog(S. cerevisiae)], 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_145697[NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) NM_002358[MAD2 mitotic arrest deficient-like 1 (yeast)], 유전자 등록번호(Genebank) NM_006716[DBF4 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) NM_018131(Centrosomal protein 55 kDa), 유전자 등록번호(Genebank) NM_012177(F-box protein 5), 유전자 등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자 등록번호(Genebank) NM_018136[Asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자 등록번호(Genebank) NM_014750[Discs, large homolog 7 (Drosophila)], 유전자 등록번호(Genebank) NM_016343[Centromere protein F, 350/400ka (mitosin)], 유전자 등록번호(Genebank) NM_017489[Telomeric repeat binding factor (NIMA-interacting) 1], 유전자 등록번호(Genebank) NM_006461(Sperm associated antigen 5), 유전자 등록번호(Genebank) NM_001790[Cell division cycle 25 homolog C (S. cerevisiae)], 유전자 등록번호(Genebank) NM_004064[Cyclin-dependent kinase inhibitor 1B (p27, Kip1)], 유전자 등록번호(Genebank) NM_080668(Cell division cycle associated 5), 유전자 등록번호(Genebank) NM_021211(Eukaryotic translation initiation factor 4 gamma, 2), 유전자 등록번호(Genebank) NM_001274[CHK1 checkpoint homolog (S. pombe)] 유전자 등록번호(Genebank), NM_001005414(ZW10 interactor), 유전자 등록번호(Genebank) NM_144710(Septin 10), 유전자 등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자 등록번호(Genebank) NM_005496(Structural maintenance of chromosomes 4), 유전자 등록번호(Genebank) NM_181803(Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) NM_018101(Cell division cycle associated 8), 유전자 등록번호(Genebank) AF147440(Kinesin family member 15), 유전자 등록번호(Genebank) NM_005030[Polo-like kinase 1 (Drosophila)], 유전자 등록번호(Genebank) NM_022346(Non-SMC condensin I complex, subunit G), 유전자 등록번호(Genebank) NM_019084(Cyclin J), 유전자 등록번호(Genebank) NM_005504(Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_004523(Kinesin family member 11), 유전자 등록번호(Genebank) NM_004354(Cyclin G2), 유전자 등록번호(Genebank) NM_001237(Cyclin A2), 유전자 등록번호(Genebank) NM_032626(Retinoblastoma binding protein 6), 유전자 등록번호(Genebank) NM_021930(RAD50 interactor 1), 유전자 등록번호(Genebank) NM_018685(Anillin, actin binding protein), 유전자 등록번호(Genebank) NM_016195(M-phase phosphoprotein 1), 유전자 등록번호(Genebank) NM_001827(CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_138555(Kinesin family member 23), 유전자 등록번호(Genebank) NM_031966(Cyclin B1), 유전자 등록번호(Genebank) NM_005915[Minichromosome maintenance deficient 6 homolog (S. cerevisiae)], 유전자 등록번호(Genebank) NM_014751(Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_003981(Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_001826(CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) NM_198219(Inhibitor of growth family, member 1), 유전자 등록번호(Genebank) NM_014881[DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)], 유전자 등록번호(Genebank) NM_001255[Cell division cycle 20 homolog(S. cerevisiae)], 유전자 등록번호(Genebank) NM_016359(Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AF085846[Rap guanine nucleotide exchange factor (GEF) 6], 유전자 등록번호(Genebank) NM_001656(Tripartite motif-containing 23), 유전자 등록번호(Genebank) NM_145307(Pleckstrin homology domain containing, family K member 1), 유전자 등록번호(Genebank) NM_080651(Thyroid hormone receptor associated protein 6), 유전자 등록번호(Genebank) NM_003714(Stanniocalcin 2), 유전자 등록번호(Genebank) NM_018098(Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) NM_004586(Ribosomal protein S6 kinase, 90 kDa, polypeptide 3), 유전자 등록번호(Genebank) NM_002317(Lysyl oxidase), 유전자 등록번호(Genebank) NM_031296(RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_014736(Casein kinase 1, gamma 1), 유전자 등록번호(Genebank) XM_292197(Diacylglycerol kinase, eta), 유전자 등록번호(Genebank) NM_016513[Intestinal cell (MAK-like) kinase], 유전자 등록번호(Genebank) NM_001331[Catenin (cadherin-associated protein), delta 1], 유전자 등록번호(Genebank) AB032991(Nedd4 family interacting protein 2), 유전자 등록번호(Genebank) NM_004232(Suppressor of cytokine signaling 6), 유전자 등록번호(Genebank) NM_003472[DEK oncogene (DNA binding)], 유전자 등록번호(Genebank) NM_012334(Myosin X), 유전자 등록번호(Genebank) NM_012425(Ras suppressor protein 1), 유전자 등록번호(Genebank) NM_002140(Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) NM_005271(Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) NM_145203(Casein kinase 1, alpha 1-like), 유전자 등록번호(Genebank) BU679059(GDP dissociation inhibitor 2), 유전자 등록번호(Genebank) NM_006305[Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A], 유전자 등록번호(Genebank) NM_020824(Rho GTPase activating protein 21), 유전자 등록번호(Genebank) NM_012120(CD2-associated protein), 유전자 등록번호(Genebank) NM_012089[ATP-binding cassette, sub-family B (MDR/TAP), member 10], 유전자 등록번호(Genebank) NM_021977[Solute carrier family 22 (extraneuronal monoamine transporter), member 3], 유전자 등록번호(Genebank) NM_015171(Exportin 6), 유전자 등록번호(Genebank) NM_016467[ORM1-like 1 (S. cerevisiae)], 유전자 등록번호(Genebank) AA484677[SEC22 vesicle trafficking protein homolog B (S. cerevisiae)], 유전자 등록번호(Genebank) BC035622(Adaptor-related protein complex 4, sigma 1 subunit), 유전자 등록번호(Genebank) NM_002520[Nucleophosmin (nucleolar phosphoprotein B23, numatrin)], 유전자 등록번호(Genebank) NM_014043(Chromatin modifying protein 2B), 유전자 등록번호(Genebank) NM_003133(Signal recognition particle 9 kDa), 유전자 등록번호(Genebank) NM_013322(Sorting nexin 10), 유전자 등록번호(Genebank) NM_005733(Kinesin family member 20A), 유전자 등록번호(Genebank) NM_014322[Choroideremia-like (Rab escort protein 2)], 유전자 등록번호(Genebank) NM_020401(Nucleoporin 107 kDa), 유전자 등록번호(Genebank) NM_138285(Nucleoporin 35 kDa), 유전자 등록번호(Genebank) NM_001786(Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) NM_001067[Topoisomerase (DNA) II alpha 170 kDa)], 유전자 등록번호(Genebank) NM_001012271[Baculoviral IAP repeat-containing 5 (survivin)], 유전자 등록번호(Genebank) NM_024854(Islet amyloid polypeptide), 유전자 등록번호(Genebank) NM_021631(Apoptosis inhibitor), 유전자 등록번호(Genebank) NM_018204(Cytoskeleton associated protein 2), 유전자 등록번호(Genebank) NM_021999(Integral membrane protein 2B), 유전자 등록번호(Genebank) NM_005400(Protein kinase C, epsilon), 유전자 등록번호(Genebank) NM_148957(Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) NM_001006(Ribosomal protein S3A), 유전자 등록번호(Genebank) NM_006437[Poly (ADP-ribose) polymerase family, member 4], 유전자 등록번호(Genebank) NM_024055[Solute carrier family 30 (zinc transporter), member 5], 유전자 등록번호(Genebank) NM_000582[Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자 등록번호(Genebank) NM_016951(Chemokine-like factor), 유전자 등록번호(Genebank) NM_002737(Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_004836(Eukaryotic translation initiation factor 2-alpha kinase 3), 유전자 등록번호(Genebank) NM_020686(4-aminobutyrate aminotransferase), 유전자 등록번호(Genebank) NM_004134[Heat shock 70 kDa protein 9 (mortalin)], 유전자 등록번호(Genebank) NM_053039(UDP glucuronosyltransferase 2 family, polypeptide B28), 유전자 등록번호(Genebank) NM_007195[Polymerase (DNA directed) iota], 유전자 등록번호(Genebank) NM_005256(Fanconi anemia, complementation group F), 유전자 등록번호(Genebank) NM_003368(Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_001018115(Fanconi anemia, complementation group D2), 유전자 등록번호(Genebank) AI281523[Splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)], 유전자 등록번호(Genebank) NM_004075[Cryptochrome 1 (photolyase-like)], 유전자 등록번호(Genebank) NM_002389(CD46 molecule, complement regulatory protein), 유전자 등록번호(Genebank) NM_000584(Interleukin 8), 유전자 등록번호(Genebank) NM_001801(Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_000715(Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) NM_144503(F11 receptor), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) NM_001010914(Protein immuno-reactive with anti-PTH polyclonal antibodies).
- 삭제
- 삭제
- 삭제
- 3-메틸콜란트렌에 대한 노출이 의심되는 개체(실험군) 및 대조군으로부터 분리된 RNA 시료로부터1) cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;2) 단계 1)의 각기 다른 형광물질로 표지된 cDNA를 DNA 마이크로어레이 칩과 혼성화시키는 단계;3) 단계 2)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및4) 단계 3)의 분석한 데이터에서 제 1항의 DNA 마이크로어레이 칩 상의 유전자의 발현 정도를 대조군과 비교하여 3-메틸콜란트렌에 노출 여부를 측정하는 단계를 포함하는 3-메틸콜란트렌에 대한 노출 여부를 측정하는 방법.
- 제 5항에 있어서, 단계 2) 및 단계 3)의 마이크로어레이 칩은 제 1항의 마이크로어레이 칩인 것을 특징으로 하는 3-메틸콜란트렌에 대한 노출 여부를 측정하는 방법.
- 제 5항에 있어서, 단계 1)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택하여 사용하는 것을 3-메틸콜란트렌에 대한 노출 여부를 측정하는 방법.
- 3-메틸콜란트렌에 대한 노출이 의심되는 개체(실험군) 및 대조군으로부터 분리된 RNA 시료로부터1)제 1항의 DNA 마이크로어레이 칩 상의 유전자를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계;2) 단계 1)의 유전자 산물을 대조군과 비교하여 3-메틸콜란트렌에 노출 여부를 측정하는 단계를 포함하는 3-메틸콜란트렌에 대한 노출 여부를 측정하는 방법.
- 제 1항의 DNA 마이크로어레이 칩 또는 상기 마이크로어레이 칩에 집적된 유전자에 상보적으로 결합하는, 하기 프라이머쌍 1 내지 24로 기재되는 서열로 구성된 군으로부터 선택되어지는 1개 이상의 프라이머쌍을 포함하는 3-메틸콜란트렌에 대한 노출 여부 진단용 키트:프라이머쌍 1 - 서열번호 3으로 기재된 센스 프라이머 및 서열번호 4로 기재된 안티센스 프라이머;프라이머쌍 2 - 서열번호 5로 기재된 센스 프라이머 및 서열번호 6으로 기재된 안티센스 프라이머;프라이머쌍 3 - 서열번호 7로 기재된 센스 프라이머 및 서열번호 8로 기재된 안티센스 프라이머;프라이머쌍 4 - 서열번호 9로 기재된 센스 프라이머 및 서열번호 10으로 기재된 안티센스 프라이머;프라이머쌍 5 - 서열번호 11로 기재된 센스 프라이머 및 서열번호 12로 기재된 안티센스 프라이머;프라이머쌍 6 - 서열번호 13으로 기재된 센스 프라이머 및 서열번호 14로 기재된 안티센스 프라이머;프라이머쌍 7 - 서열번호 15로 기재된 센스 프라이머 및 서열번호 16으로 기재된 안티센스 프라이머;프라이머쌍 8 - 서열번호 17로 기재된 센스 프라이머 및 서열번호 18로 기재된 안티센스 프라이머;프라이머쌍 9 - 서열번호 19로 기재된 센스 프라이머 및 서열번호 20으로 기재된 안티센스 프라이머;프라이머쌍 10 - 서열번호 21로 기재된 센스 프라이머 및 서열번호 22로 기재된 안티센스 프라이머;프라이머쌍 11 - 서열번호 23으로 기재된 센스 프라이머 및 서열번호 24로 기재된 안티센스 프라이머;프라이머쌍 12 - 서열번호 25로 기재된 센스 프라이머 및 서열번호 26으로 기재된 안티센스 프라이머;프라이머쌍 13 - 서열번호 27로 기재된 센스 프라이머 및 서열번호 28로 기재된 안티센스 프라이머;프라이머쌍 14 - 서열번호 29로 기재된 센스 프라이머 및 서열번호 30으로 기재된 안티센스 프라이머;프라이머쌍 15 - 서열번호 31로 기재된 센스 프라이머 및 서열번호 32로 기재된 안티센스 프라이머;프라이머쌍 16 - 서열번호 33으로 기재된 센스 프라이머 및 서열번호 34로 기재된 안티센스 프라이머;프라이머쌍 17 - 서열번호 35로 기재된 센스 프라이머 및 서열번호 36으로 기재된 안티센스 프라이머;프라이머쌍 18 - 서열번호 37로 기재된 센스 프라이머 및 서열번호 38로 기재된 안티센스 프라이머;프라이머쌍 19 - 서열번호 39로 기재된 센스 프라이머 및 서열번호 40으로 기재된 안티센스 프라이머;프라이머쌍 20 - 서열번호 41로 기재된 센스 프라이머 및 서열번호 42로 기재된 안티센스 프라이머;프라이머쌍 21 - 서열번호 43으로 기재된 센스 프라이머 및 서열번호 44로 기재된 안티센스 프라이머;프라이머쌍 22 - 서열번호 45로 기재된 센스 프라이머 및 서열번호 46으로 기재된 안티센스 프라이머;프라이머쌍 23 - 서열번호 47로 기재된 센스 프라이머 및 서열번호 48로 기재된 안티센스 프라이머; 및,프라이머쌍 24 - 서열번호 49로 기재된 센스 프라이머 및 서열번호 50으로 기재된 안티센스 프라이머.
- 서열번호 1 내지 50으로 기재되는 서열로 구성된 군으로부터 선택되어지는 1개 이상의 프라이머 쌍을 포함하는 3-메틸콜란트렌에 대한 노출 여부 진단용 키트.
- 삭제
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020070017534A KR100915898B1 (ko) | 2007-02-21 | 2007-02-21 | 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020070017534A KR100915898B1 (ko) | 2007-02-21 | 2007-02-21 | 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20080077834A KR20080077834A (ko) | 2008-08-26 |
KR100915898B1 true KR100915898B1 (ko) | 2009-09-07 |
Family
ID=39880254
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020070017534A KR100915898B1 (ko) | 2007-02-21 | 2007-02-21 | 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100915898B1 (ko) |
-
2007
- 2007-02-21 KR KR1020070017534A patent/KR100915898B1/ko not_active IP Right Cessation
Non-Patent Citations (3)
Title |
---|
Chem. Res. Toxicol., Vol.18(11), pp.1634-1641(2005)* |
NCBI Accession Number NM_000499(2007.01.21.)* |
Physiol. Genomics, Vol.5(4), pp.161-170(2001)* |
Also Published As
Publication number | Publication date |
---|---|
KR20080077834A (ko) | 2008-08-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR100985090B1 (ko) | 크라이센 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR101008385B1 (ko) | 다환 방향족 탄화수소류 노출 여부 확인용 바이오마커 및이를 이용한 확인 방법 | |
US20110190156A1 (en) | Molecular signatures for diagnosing scleroderma | |
KR101134029B1 (ko) | 인체 독성 유발 약물 탐색용 마커유전자 및 이를 이용한 탐색 방법 | |
KR100994996B1 (ko) | 페난트렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
Kinyamu et al. | Genome wide transcriptional profiling in breast cancer cells reveals distinct changes in hormone receptor target genes and chromatin modifying enzymes after proteasome inhibition | |
KR100968762B1 (ko) | 나프탈렌 노출 여부 확인용 바이오마커 및 이를 이용한확인 방법 | |
KR100961487B1 (ko) | 다이벤조에이에이취안트라센 노출 여부 확인용 바이오마커및 이를 이용한 확인 방법 | |
KR100967546B1 (ko) | 벤조에이안트라센 노출 여부 확인용 바이오마커 및 이를이용한 확인 방법 | |
CA2803677C (en) | Gene expression analyses for characterizing and identifying genotoxic compounds | |
KR100915898B1 (ko) | 3―메틸콜란트렌 노출 여부 진단용 바이오마커 및 이를이용한 진단 방법 | |
KR100958545B1 (ko) | 벤조케이플루오란텐 노출 여부 확인용 바이오마커 및 이를이용한 확인 방법 | |
KR101018788B1 (ko) | 클로르덴 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR101749566B1 (ko) | 디젤 배기 미립자(diesel exhaust particle) 노출에 따른 염증반응 관련 유전자 발현 여부 확인용 바이오마커 및 이를 이용한 확인 방법 | |
KR100901127B1 (ko) | 독소루비신 처리에 따른, 심장독성 유발 약물 검색용마커유전자 및 이를 이용한 심장독성 유발 약물 검색 방법 | |
KR100974228B1 (ko) | 최기형성 및 부작용 유발 약물 검색용 바이오마커 및 이를이용한 최기형성 및 부작용 유발 약물 검색 방법 | |
KR100936286B1 (ko) | 아미오다론 처리에 따른, 폐독성 유발 약물 검색용마커유전자 및 이를 이용한 검색 방법 | |
KR101138954B1 (ko) | 갑상선 과산화효소 활성 저해 화학물질 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR101011155B1 (ko) | 아미오다론 및 카르바마제핀 처리에 따른, 폐독성 유발약물 검색용 마커유전자 및 이를 이용한 검색 방법 | |
US20140066324A1 (en) | Gene expression signature in skin predicts response to mycophenolate mofetil | |
KR101386075B1 (ko) | 헥사클로로벤젠 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법 | |
KR20100005366A (ko) | 메토트렉세이트 처리에 따른, 최기형성 유발 약물 검색용바이오마커 및 이를 이용한 검색 방법 | |
Kuoa et al. | Supplementary Information for | |
KR20090019501A (ko) | 카르바마제핀 처리에 따른, 폐독성 유발 약물 검색용마커유전자 및 이를 이용한 검색 방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20120808 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20130731 Year of fee payment: 5 |
|
LAPS | Lapse due to unpaid annual fee |