EP3770259A1 - Modulation of angiopoietin-like 3 expression - Google Patents

Modulation of angiopoietin-like 3 expression Download PDF

Info

Publication number
EP3770259A1
EP3770259A1 EP20192739.9A EP20192739A EP3770259A1 EP 3770259 A1 EP3770259 A1 EP 3770259A1 EP 20192739 A EP20192739 A EP 20192739A EP 3770259 A1 EP3770259 A1 EP 3770259A1
Authority
EP
European Patent Office
Prior art keywords
certain embodiments
modified
antisense
nucleic acid
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP20192739.9A
Other languages
German (de)
English (en)
French (fr)
Inventor
Susan M. Freier
Mark J. Graham
Rosanne M. Crooke
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of EP3770259A1 publication Critical patent/EP3770259A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/53Methods for regulating/modulating their activity reducing unwanted side-effects

Definitions

  • TG circulating triglyceride
  • VLDL very low density lipoproteins
  • the ANGPTL3 specific inhibitor is a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 1140-1159 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • the ANGPTL3 specific inhibitor is a modified oligonucleotide represented by the following structure and the designation ISIS 563580. In certain embodiments, the ANGPTL3 specific inhibitor comprises the modified oligonucleotide ISIS 563580 represented by the following structure.
  • Certain embodiments disclosed herein provide compounds or compositions comprising a modified oligonucleotide 12 to 30 linked nucleosides in length targeted to ANGPTL3.
  • the ANGPTL target can have a sequence selected from any one of SEQ ID NOs: 1-2.
  • Certain embodiments disclosed herein provide compounds or compositions comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence complementary to nucleobases 1140 to 1159 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
  • Certain embodiments disclosed herein provide compounds or compositions comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, least 9, least 10, least 11, at least 12, least 13, at least 14, at least 15, or 16 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 110.
  • At least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.
  • each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • At least one nucleoside of the modified oligonucleotide comprises a modified sugar.
  • at least one modified sugar is a bicyclic sugar.
  • at least one modified sugar comprises a 2'-O-methoxyethyl, a constrained ethyl, a 3'-fluoro-HNA or a 4'-(CH 2 ) n -O-2' bridge, wherein n is 1 or 2.
  • the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of SEQ ID NO: 1-2, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein each nucleoside of each wing segment comprises a 2'-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide consists of 20 linked nucleosides with the nucleobase sequence of SEQ ID NO: 77 and comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein each nucleoside of each wing segment comprises a 2'-O-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotide comprises ISIS 563580 represented by the preceeding chemical structure.
  • the compounds or compositions disclosed herein comprise a modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 110, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein each wing segment comprises at least one 2'-O-methoxyethyl sugar and at least one cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine residue is a 5-methylcytosine.
  • the antisense compound comprising a modified oligonucleotide decreases ANGPTL3 by at least 85%. In a preferred embodiment, the antisense compound comprising a modified oligonucleotide decreases ANGPTL3 by at least 90%. In a preferred embodiment, the antisense compound comprising a modified oligonucleotide decreases ANGPTL3 by at least 95%.
  • Certain embodiments provide methods of using the compounds and compositions described herein for reducing one or more of triglycerides, LDL-cholesterol, non-HDL cholesterol, VLDL-cholesterol, total cholesterol, ApoB and ApoC-III.
  • the compounds or compositions reduce one or more of triglycerides, LDL-cholesterol, non-HDL cholesterol, VLDL-cholesterol, total cholesterol, ApoB and ApoC-III by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.
  • the compounds or compositions disclosed herein are efficacious by virtue of having a viscosity of less than 40 cP, less than 35 cP, less than 30 cP, less than 25 cP, less than 20 cP or less than 15 cP when measured by the parameters as described in Example 13.
  • the compounds or compositions disclosed herein are highly tolerable, as demonstrated by the in vivo tolerability measurements described in the examples.
  • the antisense compounds as described herein are highly tolerable, as demonstrated by having an increase in ALT and/or AST value of no more than 4 fold, 3 fold, 2 fold or 1.5 fold over saline treated animals.
  • the compounds or compositions disclosed herein comprise a salt of the modified oligonucleotide.
  • the compounds or compositions disclosed herein further comprise a pharmaceutically acceptable carrier or diluent.
  • the compounds or compositions disclosed herein are designated as a first agent and the methods or uses disclosed herein further comprise administering a second agent.
  • the first agent and the second agent are co-administered.
  • the first agent and the second agent are co-administered sequentially or concomitantly.
  • the second agent is a glucose-lowering agent.
  • the glucose lowering agent can include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof.
  • the glucose-lowering agent can include, but is not limited to metformin, sulfonylurea, rosiglitazone, meglitinide, thiazolidinedione, alpha-glucosidase inhibitor or a combination thereof.
  • the sulfonylurea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide.
  • the meglitinide can be nateglinide or repaglinide.
  • the thiazolidinedione can be pioglitazone or rosiglitazone.
  • the alpha-glucosidase can be acarbose or miglitol.
  • administration comprises parenteral administration.
  • administering a compound disclosed herein results in a reduction of lipid levels, including triglyceride levels, cholesterol levels, insulin resistance, glucose levels or a combination thereof.
  • lipid levels including triglyceride levels, cholesterol levels, insulin resistance, glucose levels or a combination thereof.
  • One or more of the levels can be independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.
  • Administering the compound can result in improved insulin sensitivity or hepatic insulin sensitivity.
  • Administering the compound disclosed herein can result in a reduction in atherosclerotic plaques, obesity, glucose, lipids, glucose resistance, cholesterol, or improvement in insulin sensitivity or any combination thereof.
  • Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing one or more of a metabolic disease or a cardiovascular disease.
  • kits for treating, preventing, or ameliorating one or more of a metabolic disease or a cardiovascular disease as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein.
  • the kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate one or more of a metabolic disease or a cardiovascular disease.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound can be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the additional nucleoside can be located at the 5', 3' end or central portion of the oligonucleotide.
  • the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5' end (5' addition), or alternatively to the 3' end (3' addition) or the central portion, of the oligonucleotide.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • the presence of the antisense compound hybridized with the target nucleic acid results in a modulation of antisense activity.
  • antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms.
  • antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.
  • Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2'-O-CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl).
  • nucleosides in the wings may include several modified sugar moieties, including, for example 2'-MOE and bicyclic sugar moieties such as constrained ethyl or LNA.
  • wings may include several modified and unmodified sugar moieties.
  • wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.
  • the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) m -(B) n -(J) p -(B) r -(A) t -(D) g -(A) v -(B) w -(J) x -(B) y -(J) z wherein:
  • antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • RNAi interfering RNA compounds
  • siRNA double-stranded RNA compounds
  • ssRNAi compounds single-stranded RNAi compounds
  • antisense compounds including those particularly suited for use as single-stranded RNAi compounds (ssRNA) comprise a modified 5'-terminal end.
  • the 5'-terminal end comprises a modified phosphate moiety.
  • such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5'-phosphate).
  • such 5'-terminal nucleosides stabilize the 5'-phosphorous moiety. Certain modified 5'-terminal nucleosides may be found in the art, for example in WO/2011/139702 .
  • A has one of the formulas: wherein: Q 1 and Q 2 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy or substituted C 1 -C 6 alkoxy.
  • Q 1 and Q 2 are each H.
  • Q 1 and Q 2 are each, independently, H or halogen.
  • Q 1 and Q 2 is H and the other of Q 1 and Q 2 is F, CH 3 or OCH 3 .
  • G is F, OCH 3 or O(CH 2 ) 2 -OCH 3 .
  • G is O(CH 2 ) 2 -OCH 3 .
  • the oligonucleotides comprise or consist of a region having uniform sugar modifications.
  • each nucleoside of the region comprises the same RNA-like sugar modification.
  • each nucleoside of the region is a 2'-F nucleoside.
  • each nucleoside of the region is a 2'-OMe nucleoside.
  • each nucleoside of the region is a 2'-MOE nucleoside.
  • each nucleoside of the region is a cEt nucleoside.
  • each nucleoside of the region is an LNA nucleoside.
  • the uniform region constitutes all or essentially all of the oligonucleotide.
  • the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.
  • the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB) x A y wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1).
  • one or more alternating regions in an alternating motif includes more than a single nucleoside of a type.
  • oligonucleotides may include one or more regions of any of the following nucleoside motifs:
  • oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif: -(A) 2 -(B) x -(A) 2 -(C) y -(A) 3 -
  • oligonucleosides have the following sugar motif: 5'-(Q)-(A) x -(D) z wherein:
  • A, B, C, and D in the above motifs are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt.
  • D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance).
  • the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.
  • antisense compounds comprising those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif.
  • oligonucleotides comprise a region having an alternating internucleoside linkage motif.
  • oligonucleotides comprise a region of uniformly modified internucleoside linkages.
  • the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages.
  • the oligonucleotide is uniformly linked by phosphorothioate internucleoside linkages.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
  • the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages.
  • the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.
  • Oligonucleotides having any of the various sugar motifs described herein may have any linkage motif.
  • the oligonucleotides including but not limited to those described above, may have a linkage motif selected from non-limiting the table below: 5' most linkage Central region 3'-region PS Alternating PO/PS 6 PS PS Alternating PO/PS 7 PS PS Alternating PO/PS 8 PS
  • compositions comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
  • compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway.
  • Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand.
  • each strand can be independently modified such that it is enhanced for its particular role.
  • the antisense strand can be modified at the 5'-end to enhance its role in one region of the RISC while the 3'-end can be modified differentially to enhance its role in a different region of the RISC.
  • the double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e.
  • the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
  • the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules lack 2'-hydroxy (2'-OH) containing nucleotides.
  • short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNA short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • sequence specific RNA interference such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level.
  • epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676 ; Pal-Bhadra et al., 2004, Science, 303, 669-672 ; Allshire, 2002, Science, 297, 1818-1819 ; Volpe et al., 2002, Science, 297, 1833-1837 ; Jenuwein, 2002, Science, 297, 2215-2218 ; and Hall et al., 2002, Science, 297, 2232-2237 ).
  • the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000 , or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999 .
  • the dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule.
  • a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides.
  • the dsRNA may include two different strands that have a region of complementarity to each other.
  • both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides.
  • the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence.
  • the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75,100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA.
  • the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin.
  • the dsRNA has one or more single stranded regions or overhangs.
  • RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
  • an antisense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid
  • RNA strand or region that is a sense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid
  • the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000 , or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999 .
  • a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell.
  • the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000 , or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999 .)
  • Exemplary circular nucleic acids include lariat structures in which the free 5' phosphoryl group of a nucleotide becomes linked to the 2' hydroxyl group of another nucleotide in a loop back fashion.
  • the dsRNA includes one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2' position contains a hydrogen or an hydroxyl group.
  • the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661 .
  • the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000 , or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999 .
  • antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway.
  • antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid.
  • the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region can encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for ANGPTL3 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region can encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the target region.
  • a target segment is a smaller, sub-portion of a target region within a nucleic acid.
  • a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted.
  • 5' target site or “5' start sites” refers to the 5'-most nucleotide of a target segment.
  • 3' target site or “3' stop site” refers to the 3 '-most nucleotide of a target segment.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • Suitable target segments can be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • ANGPTL3 mRNA levels are indicative of inhibition of ANGPTL3 protein expression.
  • Reductions in levels of an ANGPTL3 protein are also indicative of inhibition of target mRNA expression.
  • phenotypic changes such as a reduction of the level of cholesterol, LDL, triglyceride, or glucose, can be indicative of inhibition of ANGPTL3 mRNA and/or protein expression.
  • hybridization occurs between an antisense compound disclosed herein and an ANGPTL3 nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • the antisense compounds provided herein are specifically hybridizable with an ANGPTL3 nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as an ANGPTL3 nucleic acid).
  • An antisense compound can hybridize over one or more segments of an ANGPTL3 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an ANGPTL3 nucleic acid, a target region, target segment, or specified portion thereof.
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the sequence of one or more of SEQ ID NOs: 1-2. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound can be fully complementary to an ANGPTL3 nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an ANGPTL3 nucleic acid, or specified portion thereof.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • RNA and DNA The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to an ANGPTL3 nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R 1 )(R 2 ) (R, R 1 and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA)
  • BNA bicyclic nucleic acids
  • Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005 ) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl ( R or S ), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and 2'-O(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • BNAs bicyclic nucleic acids
  • examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH 2 )-O-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -O-2' (ENA); 4'-CH(CH 3 )-O-2' and 4'-CH(CH 2 OCH 3 )-O-2' (and analogs thereof see U.S.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226 ).
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • the bridge of a bicyclic sugar moiety is, -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R b )-O-N(R)-.
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2', 4'-(CH 2 ) 2 -O-2', 4'-CH 2 -O-N(R)-2' and 4'-CH 2 -N(R)-O-2'- wherein each R is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-(CH 2 )-O-2' bridge may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • ⁇ -L-methyleneoxy (4'-CH 2 -O-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity ( Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372 ).
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides have the formula: wherein:
  • bicyclic nucleosides include, but are not limited to, (A) ⁇ -L-methyleneoxy (4'-CH 2 -O-2') BNA, (B) ⁇ -D-methyleneoxy (4'-CH 2 -O-2') BNA, (C) ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA, (D) aminooxy (4'-CH 2 -O-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-O-2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH 3 )-O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylenethio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2
  • modified tetrahydropyran nucleoside or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate.
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854 ) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.
  • HNA hexitol nucleic acid
  • ANA anitol nucleic acid
  • MNA manitol nucleic acid
  • F-HNA fluoro HNA
  • sugar surrogates are selected having the formula: wherein:
  • q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl.
  • THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is fluoro and R 2 is H; R 1 is methoxy and R 2 is H, and R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510 ; and U.S. Patents 5,698,685 ; 5,166,315 ; 5,185,444 ; and 5,034,506 ).
  • morpholino means a sugar surrogate having the following formula:
  • Patent Application US2005-0130923, published on June 16, 2005 ) or alternatively 5'-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181 , published on 11/22/07 wherein a 4'-CH 2 -O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group).
  • PCT International Application WO 2007/134181 published on 11/22/07 wherein a 4'-CH 2 -O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described ( see, e.g. , Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379 ).
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010 , Robeyns et al., J. Am. Chem.
  • 2'-substituent groups can also be selected from: C 1 -C 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • 2'-modified or “2'-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-O-2') bridging group.
  • the (4'-CH(CH 3 )-O-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C ( Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278 ).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substit
  • Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • antisense compounds targeted to an ANGPTL3 nucleic acid comprise one or more modified nucleobases.
  • shortened or gap-widened antisense oligonucleotides targeted to an ANGPTL3 nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • Antisense compound targeted to an ANGPTL3 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an ANGPTL3 nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acids from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003 .
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, Huh7 (hepatocellular carcinoma) cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN• (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN• in OPTI-MEM• 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN• concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000• (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000• in OPTI-MEM• 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE• concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin• (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin• in OPTI-MEM• 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin• concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 ⁇ L of FuGENE 6 per 100 nM.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation ( Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001 ).
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000•, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art ( Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001 ). RNA is prepared using methods well known in the art, for example, using the TRIZOL• Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Inhibition of levels or expression of an ANGPTL3 nucleic acid can be assayed in a variety of ways known in the art ( Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001 ).
  • target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art.
  • Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM• 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the ABI PRISM• 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT and real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR can be normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A or GADPH or by quantifying total RNA using RIBOGREEN• (Life TechnologiesTM, Inc. Carlsbad, CA). Cyclophilin A or GADPH expression can be quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA can be quantified using RIBOGREEN• RNA quantification reagent. Methods of RNA quantification by RIBOGREEN• are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374 ). A CYTOFLUOR• 4000 instrument (PE Applied Biosystems) can be used to measure RIBOGREEN• fluorescence.
  • Probes and primers used in real-time PCR were designed to hybridize to ANGPTL3 specific sequences and are disclosed in the Examples below.
  • the target specific PCR probes can have FAM covalently linked to the 5' end and TAMRA or MGB covalently linked to the 3' end, where FAM is the fluorescent dye and TAMRA or MGB is the quencher dye.
  • Antisense inhibition of ANGPTL3 nucleic acids can be assessed by measuring ANGPTL3 protein levels. Protein levels of ANGPTL3 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) ( Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001 ). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
  • provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein.
  • the individual has a metabolic disease and/or cardiovascular disease.
  • the individual has hypercholesterolemia (e.g., familial homozygous hypercholesterolemia (HoFH), familial heterozygous hypercholesterolemia (HeFH)), dyslipidemia, hypertriglyceridemia (e.g., heterozygous LPL deficiency, homozygous LPL deficiency), coronary artery disease (CAD), familial chylomicronemia syndrome (FCS), hyperlipoproteinemia Type IV), lipodystrophy, hyperlipidemia (e.g., combined hyperlipidemia, familial combined hyperlipidemia (FCHL)), metabolic syndrome, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), diabetes (e.g., Type 2 diabetes), vascular wall thickening, high blood pressure (e.g., pulmonary embolism, etc.
  • the compounds targeted to ANGPTL3 described herein modulate lipid and/or energy metabolism in an animal.
  • the compounds targeted to ANGPTL3 described herein modulate physiological markers or phenotypes of hypercholesterolemia, dyslipidemia, hypertriglyceridemia, metabolic syndrome, NAFLD, NASH and/or diabetes.
  • administration of the compounds to animals can modulate one or more of VLDL, non-esterified fatty acids (NEFA), LDL, cholesterol, triglyceride, glucose, insulin or ANGPTL3 levels.
  • the modulation of the physiological markers or phenotypes can be associated with inhibition of ANGPTL3 by the compounds.
  • the compounds targeted to ANGPTL3 described herein reduce and/or prevent one or more of hepatic TG accumulation (i.e. hepatic steatosis), atherosclerosis, vascular wall thinkening (e.g., arterial intima-media thickening), hypercholesterolemia (e.g., familial homozygous hypercholesterolemia (HoFH), familial heterozygous hypercholesterolemia (HeFH)), dyslipidemia, hypertriglyceridemia (e.g., heterozygous LPL deficiency, homozygous LPL deficiency, familial chylomicronemia syndrome (FCS), hyperlipoproteinemia Type IV), lipodystrophy, hyperlipidemia (e.g., combined hyperlipidemia, familial combined huperlipidemia (FCHL)), metabolic syndrome, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), diabetes (e.g., Type 2 diabetes), high blood
  • administering results in reduction of ANGPTL3 expression by about at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%, or a range defined by any two of these values.
  • administering results in reduction of one or more of triglycerides, LDL-cholesterol, non-HDL cholesterol, VLDL-cholesterol, total cholesterol, ApoB and ApoC-III by about at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to ANGPTL3 are used for the preparation of a medicament for treating a patient suffering from, or susceptible to, a metabolic disease or cardiovascular disease.
  • pharmaceutical compositions comprising an antisense compound targeted to ANGPTL3 are used in the preparation of a medicament for treating a patient suffering from, or susceptible to, one or more of hypercholesterolemia (e.g., familial homozygous hypercholesterolemia (HoFH), familial heterozygous hypercholesterolemia (HeFH)), dyslipidemia, hypertriglyceridemia (e.g., familial chylomicronemia syndrome (FCS), hyperlipoproteinemia Type IV), lipodystrophy, hyperlipidemia (e.g., combined hyperlipidemia, familial combined hyperlipidemia (FCHL)), metabolic syndrome, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), diabetes (e.g., Type 2 diabetes) vascular wall thicken
  • hypercholesterolemia
  • the compounds and compositions as described herein are administered parenterally.
  • parenteral administration is by infusion.
  • Infusion can be chronic or continuous or short or intermittent.
  • infused pharmaceutical agents are delivered with a pump.
  • parenteral administration is by injection.
  • the injection can be delivered with a syringe or a pump.
  • the injection is a bolus injection.
  • the injection is administered directly to a tissue or organ.
  • the injection is subcutaneous.
  • a first agent comprising the modified oligonucleotide disclosed herein is co-administered with one or more secondary agents.
  • such second agents are designed to treat the same disease, disorder or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • second agents are co-administered with the first agent to produce a combinational effect.
  • second agents are co-administered with the first agent to produce a synergistic effect.
  • second agents include, but are not limited to a glucose-lowering agent or a lipid-lowering agent.
  • the glucose lowering agent can include, but is not limited to, a therapeutic lifestyle change, PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof.
  • the HMG-CoA reductase inhibitor can be atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin, simvastatin and the like.
  • the cholesterol absorption inhibitor can be ezetimibe.
  • the fibrate can be fenofibrate, bezafibrate, ciprofibrate, clofibrate, gemfibrozil and the like.
  • the beneficial oil rich in omega-3 fatty acids can be krill, fish (e.g., Vascepa R ), flaxseed oil and the like.
  • the omega-3 fatty acid can be ALA, DHA, EPA and the like.
  • the antisense compounds described herein benefit from one or more improved properties relative to the antisense compounds described in WO 2011/085271 . These improved properties are demonstrated in the examples herein, and a non-exhaustive summary of the examples is provided below for ease of reference.
  • the twenty antisense compounds tested in the rats were also assessed for cross-reactivity to a rhesus monkey ANGPTL3 gene sequence (Example 15).
  • the antisense compounds in this study were tested in cynomolgus monkeys, the cynomolgus monkey ANGPTL3 sequence was not available for comparison to the sequences of the full-length compounds, therefore the sequences of the antisense compounds were compared to that of the closely related rhesus monkey.
  • the sequences of eight antisense compounds were found to have 0-2 mismatches with the rhesus ANGPTL3 gene sequence and were further studied in cynomolgus monkeys (Example 15).
  • the eight antisense compounds (ISIS 563580, ISIS 560400, ISIS 567320, ISIS 567321, ISIS 544199, ISIS 567233, ISIS 561011 and ISIS 559277) were tested for inhibition of ANGPTL3 mRNA and protein expression as well as tolerability in the monkeys.
  • body weights liver metabolic markers (ALT, AST and bilirubin), kidney metabolic markers (BUN and creatinine), hematology parameters (blood cell counts, hemoglobin and hematocrit), and pro-inflammatory markers (CRP and C3) were measured. Additionally, the full-length oligonucleotide concentration present in liver and kidney was measured and the ratio of full-length oligonucleotide in the kidney/liver was calculated.
  • antisense compounds with any one or more improved characteristics e.g., improved relative to the antisense compounds described in WO 2011/085271 .
  • antisense compounds comprising a modified oligonucleotide as described herein targeted to, or specifically hybridizable with, a region of nucleotides of any one of SEQ ID NOs: 1-2.
  • certain antisense compounds as described herein are efficacious by virtue of their potency in inhibiting ANGPTL3 expression.
  • the compounds or compositions inhibit ANGPTL3 by at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.
  • certain antisense compounds as described herein are efficacious by virtue of an in vitro IC 50 of less than 20 ⁇ M, less than 10 ⁇ M, less than 8 ⁇ M, less than 5 ⁇ M, less than 2 ⁇ M, less than 1 ⁇ M, less than 0.9 ⁇ M, less than 0.8 ⁇ M, less than 0.7 ⁇ M, less than 0.6 ⁇ M, or less than 0.5 ⁇ M when tested in human cells, for example, in the Hep3B cell line (as described in Examples 2-3 and 7-10).
  • preferred antisense compounds having an IC 50 ⁇ 1.0 ⁇ M include SEQ ID NOs: 15, 20, 24, 34, 35, 36, 37, 42, 43, 44, 47, 50, 51, 57, 58, 60, 77, 79, 82, 87, 88, 90, 91, 93, 94, 100, 101, 104, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 169, 170, 177, 188, 209, 210, 211, 212, 213,
  • preferred antisense compounds having an IC 50 ⁇ 0.9 ⁇ M include SEQ ID NOs: 15, 20, 35, 36, 42, 43, 44, 50, 57, 60, 77, 79, 87, 88, 90, 91, 93, 94, 101, 104, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 177, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224,
  • preferred antisense compounds having an IC 50 ⁇ 0.8 ⁇ M include SEQ ID NOs: 15, 20, 35, 36, 42, 43, 44, 50, 57, 60, 77, 79, 87, 88, 90, 91, 93, 94, 101, 104, 110, 111, 112, 113, 114, 115, 116, 117, 118, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 177, 209, 210, 211, 212, 213, 214, 215, 217, 218, 219, 220, 221, 222, 223, 224, 225, 228, 2
  • preferred antisense compounds having an IC 50 ⁇ 0.7 ⁇ M include SEQ ID NOs: 15, 20, 36, 42, 43, 57, 60, 114, 117, 127, 131, 177, 209, 210, 211, 212, 213, 214, 215, 217, 218, 219, 220, 221, 222, 223, 224, 225, 228, 229, 230, 231, and 232.
  • preferred antisense compounds having an IC 50 ⁇ 0.6 ⁇ M include SEQ ID NOs: 15, 20, 36, 42, 43, 57, 60, 114, 117, 127, 131, 177, 209, 210, 211, 212, 213, 215, 217, 218, 219, 220, 221, 222, 224, 225, 228, 229, 230, 231, and 232.
  • preferred antisense compounds having an IC 50 ⁇ 0.5 ⁇ M include SEQ ID NOs: 43, 114, 117, 127, 131, 177, 209, 210, 211, 212, 215, 217, 218, 219, 220, 221, 222, 229, 230, and 232.
  • certain antisense compounds as described herein are efficacious by virtue of having a viscosity of less than 40 cP, less than 35 cP, less than 30 cP, less than 25 cP, less than 20 cP, less than 15 cP, or less than 10 cP when measured by an assay (as described in Example 13). Oligonucleotides having a viscosity greater than 40 cP would have less than optimal viscosity.
  • preferred antisense compounds having a viscosity ⁇ 20 cP include SEQ ID NOs: 16, 18, 20, 34, 35, 36, 38, 49, 77, 90, 93, and 94.
  • preferred antisense compounds having a viscosity ⁇ 15 cP include SEQ ID NOs: 16, 18, 20, 34, 35, 38, 49, 90, 93, and 94.
  • preferred antisense compounds having a viscosity ⁇ 10 cP include SEQ ID NOs: 18, 34, 35, 49, 90, 93, and 94.
  • certain antisense compounds as described herein are highly tolerable, as demonstrated by the in vivo tolerability measurements described in the examples. In certain embodiments, the certain antisense compounds as described herein are highly tolerable, as demonstrated by having an increase in ALT and/or AST value of no more than 3 fold, 2 fold or 1.5 fold over saline treated animals.
  • certain antisense compounds as described herein are efficacious by virtue of having one or more of an inhibition potency of greater than 50%, an in vitro IC 50 of less than 1 ⁇ M, a viscosity of less than 20 cP, and no more than a 3 fold increase in ALT and/or AST.
  • ISIS 563580 (SEQ ID NO: 77) is preferred. This compound was found to be a potent inhibitor in ANGPTL3 transgenic mice and the most tolerable antisense compound. It had an acceptable viscosity of about 16.83 cP and an IC 50 value of ⁇ 0.8 ⁇ M in vitro. In mice it had no more than a 3 fold increase in ALT and/or AST levels over saline treated animals. Also, in monkeys, it was among the most tolerable and potent compounds in inhibiting ANGPTL3 and had the best ratio of full-length oligonucleotide concentration.
  • ISIS 544199 (SEQ ID NO: 20) is preferred. This compound was found to be a potent and tolerable antisense compound. It had an acceptable viscosity of 1.7 cP and an IC 50 value of ⁇ 0.5 ⁇ M in vitro. In mice it had no more than a 3 fold increase in ALT and/or AST levels over saline treated animals. Also, in monkeys, it was among the most potent compounds in inhibiting ANGPTL3 and had a good ratio of full-length oligonucleotide concentration.
  • Example 1 Antisense inhibition of human Angiopoietin-like 3 in Hep3B cells by MOE gapmers
  • Antisense oligonucleotides were designed targeting an Angiopoietin-like 3 (ANGPTL3) nucleic acid and were tested for their effects on ANGPTL3 mRNA in vitro.
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • Cultured Hep3B cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and ANGPTL3mRNA levels were measured by quantitative real-time PCR.
  • Human primer probe set RTS3492_MGB (forward sequence CCGTGGAAGACCAATATAAACAATT, designated herein as SEQ ID NO: 4; AGTCCTTCTGAGCTGATTTTCTATTTCT; reverse sequence, designated herein as SEQ ID NO: 5; probe sequence AACCAACAGCATAGTCAAATA, designated herein as SEQ ID NO: 6) was used to measure mRNA levels.
  • ANGPTL3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN•. Results are presented as percent inhibition of ANGPTL3, relative to untreated control cells.
  • the newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers.
  • the 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification.
  • “Start site” indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3'-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in the Tables below is targeted to either the human ANGPTL3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_014495.2) or the human ANGPTL3 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_032977.9 truncated from nucleotides 33032001 to 33046000).
  • IC 50 half maximal inhibitory concentration
  • Table 15 ISIS No 0.75 ⁇ M 1.50 ⁇ M 3.00 ⁇ M 6.00 ⁇ M 12.00 ⁇ M IC 50 ( ⁇ M) SEQ ID NO 233717 23 45 13 33 40 >12 14 544120 45 65 76 88 91 0.7 15 544145 38 42 61 82 84 1.6 16 544156 31 42 63 78 84 1.8 17 544162 35 43 71 76 82 1.6 18 544166 30 47 60 76 84 1.8 19 544199 54 61 73 83 84 0.5 20 544355 45 46 69 77 83 1.2 21 544368 12 37 63 74 81 2.6 22 544373 1 27 40 29 28 >12 23 544376 26 53 61 63 59 2.4 24 544380 16 33 41 64
  • IC 50 half maximal inhibitory concentration
  • Table 16 ISIS No 0.813 ⁇ M 1.625 ⁇ M 3.25 ⁇ M 6.50 ⁇ M 13.00 ⁇ M IC 50 ( ⁇ M) SEQ ID NO 337487 17 37 58 72 92 2.7 28 337492 0 0 0 5 58 >13 29 544120 23 40 65 81 91 2.2 15 560236 39 22 46 9 60 >13 30 560265 38 48 58 64 73 2.0 31 560268 37 57 60 71 83 1.5 32 560285 5 29 48 68 78 3.8 33 560306 45 64 67 81 86 0.9 34 560400 48 63 75 87 88 0.7 35 560401 49 75 79 89 88 0.5 36 560402 42 67 70 85 90 0.9 37 560469 43 55 70 74 74
  • Additional antisense oligonucleotides were designed targeting an ANGPTL3 nucleic acid and were tested for their effects on ANGPTL3 mRNA in vitro.
  • Cultured Hep3B cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM of antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and ANGPTL3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3492_MGB was used to measure mRNA levels.
  • ANGPTL3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ⁇ . Results are presented as percent inhibition of ANGPTL3, relative to untreated control cells.
  • each antisense oligonucleotide is described as 'eek-d10-kke', where 'k' indicates a (S)-cEt sugar modification; 'd' indicates deoxyribose; the number indicates the number of deoxyribose sugars residues; and 'e' indicates a MOE sugar modification.
  • “Stop site” indicates the 3'-most nucleoside to which the oligonucleotide is targeted human gene sequence.
  • Each oligonucleotide listed in the Tables below is targeted to either the human ANGPTL3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_014495.2) or the human ANGPTL3 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_032977.9 truncated from nucleotides 33032001 to 33046000).
  • 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.
  • the newly designed chimeric antisense oligonucleotides in the Tables below were designed as deoxy, MOE, and (S)-cEt oligonucleotides or 5-10-5 MOE gapmers.
  • the deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy sugar residue.
  • each antisense oligonucleotide is described as 'eek-d10-kke', where 'k' indicates an (S)-cEt sugar modification; 'd' indicates deoxyribose; the number indicates the number of deoxyribose sugars residues; and 'e' indicates a MOE modification.
  • the 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each.
  • NT_032977.9 truncated from nucleotides 33032001 to 33046000). 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.
  • Table 26 Inhibition of ANGPTL3 mRNA by oligonucleotides targeting SEQ ID NO: 1 and 2 ISIS NO SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site Sequence Chemistry % inhibition SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site SEQ ID NO 561671 N/A N/A TCTTAACTCTATATAT Deoxy, MOE, and cEt 12 3076 3091 3370 561672 N/A N/A CTTCTTAACTCTATAT Deoxy, MOE, and cEt 12 3078 3093 3371 561673 N/A N/A GACTTCTTAACTCTAT Deoxy, MOE, and cEt 18 3080 3095 3372 561674 N/A N/A T
  • Additional antisense oligonucleotides were designed targeting an ANGPTL3 nucleic acid and were tested for their effects on ANGPTL3 mRNA in vitro.
  • Cultured Hep3B cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and ANGPTL3mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3492_MGB was used to measure mRNA levels.
  • ANGPTL3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ⁇ . Results are presented as percent inhibition of ANGPTL3, relative to untreated control cells.
  • the newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE or 3-10-4 MOE gapmers.
  • the 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each.
  • the 3-10-4 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and four nucleosides respectively.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification.
  • Start site indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3'-most nucleoside to which the gapmer is targeted human gene sequence.
  • each gapmer listed in the Tables below is targeted to either the human ANGPTL3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_014495.2) or the human ANGPTL3 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT_032977.9 truncated from nucleotides 33032001 to 33046000). 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.
  • IC 50 half maximal inhibitory concentration
  • Table 32 ISIS No 0.813 ⁇ M 1.625 ⁇ M 3.25 ⁇ M 6.50 ⁇ M 13.00 ⁇ M IC 50 ( ⁇ M) SEQ ID NO 233717 0 27 43 66 79 4.4 14 337487 26 49 63 85 94 2.0 28 559277 54 68 70 82 91 ⁇ 0.8 110 560990 36 61 74 90 96 1.2 111 560992 60 67 76 81 93 ⁇ 0.8 112 561010 71 77 82 86 94 ⁇ 0.8 113 561011 80 87 91 95 97 ⁇ 0.8 114 561022 75 79 84 89 93 ⁇ 0.8 115 561025 68 82 81 91 96 ⁇ 0.8 116 561026 72 85 85 89 90 ⁇
  • Example 8 Dose-dependent antisense inhibition of human ANGPTL3 in Hep3B cells
  • IC 50 half maximal inhibitory concentration
  • Table 36 ISIS No 0.160 ⁇ M 0.481 ⁇ M 1.444 ⁇ M 4.333 ⁇ M 13.00 ⁇ M IC 50 ( ⁇ M) SEQ ID NO 337487 0 18 24 49 73 4.1 28 560990 2 27 39 59 80 2.0 111 561076 20 33 59 73 89 1.1 159 561079 24 39 51 72 84 1.0 160 561084 7 17 46 66 87 1.9 161 561085 21 35 55 69 86 1.2 162 561123 20 39 52 72 87 1.1 163 561241 13 22 41 68 86 2.0 164 561256 12 22 35 54 82 2.6 165 561260 22 16 34 54 82 2.6 166 561277 21 21 37 59 69 2.9 167 561288 6 8 23 36
  • MOE gapmers from the Examples above exhibiting significant in vitro inhibition of ANGPTL3 mRNA were selected and tested at various doses in Hep3B cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.160 ⁇ M, 0.481 ⁇ M, 1.444 ⁇ M, 4.333 ⁇ M and 13.00 ⁇ M concentrations of antisense oligonucleotide, as specified in the Table below.
  • RNA was isolated from the cells and ANGPTL3 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3492_MGB was used to measure mRNA levels.
  • ANGPTL3 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of ANGPTL3, relative to untreated control cells.
  • Antisense oligonucleotides described in the studies above were further evaluated for their ability to reduce human ANGPTL3 mRNA transcript in C57B1/6 mice with the human ANGPTL3 transgene (Tg mice).
  • mice Female Tg mice were maintained on a 12-hour light/dark cycle. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in buffered saline (PBS) and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.
  • ASOs Antisense oligonucleotides
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers at a dose of 50 mg/kg once per week for 2 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 10, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers at a dose of 50 mg/kg once per week for 2 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected groups served as the control groups to which the corresponding oligonucleotide-treated groups were compared.
  • ANGPTL3 protein levels were quantified using a commercially available ELISA kit (Catalog #DANL30 by R&D Systems, Minneapolis, MN) with transgenic plasma samples diluted 1:20,000 using the manufacturer described protocol. The results are presented in the Table below. The results indicate that treatment with ISIS oligonucleotides resulted in reduced ANGPTL3 protein levels.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 8, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers at a dose of 2.5 mg/kg, 12.5 mg/kg, or 25 mg/kg once per week for 3 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected groups served as the control groups to which the corresponding oligonucleotide-treated groups were compared.
  • Human ANGPTL3 protein levels were quantified using a commercially available ELISA kit (Catalog #DANL30 by R&D Systems, Minneapolis, MN) with transgenic plasma samples diluted 1:20,000 using the manufacturer described protocol. The results are presented in the Table below. The results indicate that treatment with ISIS oligonucleotides resulted in reduced ANGPTL3 protein levels. 'n.d.' indicates that the ED 50 could not be determined.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 17, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers at a dose of 25 mg/kg once per week for 2 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers or deoxy, MOE, and cEt gapmers at a dose of 25 mg/kg once per week for 2 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 9, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of deoxy, MOE, and cEt oligonucleotides at a dose of 25 mg/kg once per week for 2 weeks.
  • ISIS 233710 a 5-10-5 MOE gapmer, was also included as a benchmark.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ANGPTL3 protein levels were quantified using a commercially available ELISA kit (Catalog #DANL30 by R&D Systems, Minneapolis, MN) with transgenic plasma samples diluted 1:20,000 using the manufacturer described protocol. The results are presented in the Table below. The results indicate that treatment with several of the ISIS oligonucleotides resulted in reduced ANGPTL3 protein levels.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 10, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of deoxy, MOE, and cEt oligonucleotides at a dose of 25 mg/kg once per week for 2 weeks.
  • ISIS 233710 a 5-10-5 MOE gapmer, was also included as a benchmark.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 9, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of deoxy, MOE, and cEt oligonucleotides at a dose of 25 mg/kg once per week for 2 weeks.
  • ISIS 233710 a 5-10-5 MOE gapmer, was also included as a benchmark.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ANGPTL3 protein levels were quantified using a commercially available ELISA kit (Catalog #DANL30 by R&D Systems, Minneapolis, MN) with transgenic plasma samples diluted 1:20,000 using the manufacturer described protocol. The results are presented in the Table below. The results indicate that treatment with the ISIS oligonucleotides resulted in reduced ANGPTL3 levels.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 8, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 9, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ASOs Antisense oligonucleotides
  • PBS buffered saline
  • mice received intraperitoneal injections of 5-10-5 MOE gapmers or deoxy, MOE and cEt oligonucleotides at a dose of 5 mg/kg, 12.5 mg/kg, or 25 mg/kg once per week for 2 weeks.
  • One group of mice received subcutaneous injections of PBS once weekly for 2 weeks.
  • the PBS-injected group served as the control group to which the corresponding oligonucleotide-treated groups were compared.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on day 8, plasma levels of transaminases (ALT and AST) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • Example 12 Tolerability of antisense oligonucleotides targeting human ANGPTL3 in CD1 mice
  • mice Male CD1 mice (one animal per treatment group) were injected intraperitoneally with a single dose of 200 mg/kg of deoxy, MOE, and cEt oligonucleotide. One male CD1 mouse was injected subcutaneously with a single dose of PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
  • ISIS oligonucleotides that caused changes in the levels of any of these liver function markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ISIS oligonucleotide Body weights were measured one day after the single dose of ISIS oligonucleotide, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • Body weights were measured on day 5 after the single dose of ISIS oligonucleotide, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • mice Male CD1 mice (four animals per treatment group) were injected intraperitoneally with 100 mg/kg of 5-10-5 MOE gapmers given once a week for 6 weeks. One group of 4 male CD1 mice was injected intraperitoneally with PBS given once a week for 6 weeks. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides, plasma levels of various liver and kidney function markers were measured on day 45 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • Body weights were measured on day 43, and are presented in the Table below. Kidney, liver and spleen weights were measured at the end of the study on day 45. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • mice Male CD1 mice (four animals per treatment group) were injected intraperitoneally with 50 mg/kg or 100 mg/kg of 5-10-5 MOE gapmers or deoxy, MOE and cEt oligonucleotides given once a week for 6 weeks.
  • One group of 4 male CD1 mice was injected intraperitoneally with PBS given once a week for 6 weeks. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides, plasma levels of various liver and kidney function markers were measured on day 46 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • mice Male CD1 mice (four animals per treatment group) were injected intraperitoneally with 50 mg/kg of deoxy, MOE and cEt oligonucleotides given once a week for 6 weeks. One group of 4 male CD1 mice was injected intraperitoneally with PBS given once a week for 6 weeks. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides, plasma levels of various liver and kidney function markers were measured on day 43 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of these markers outside the expected range for antisense oligonucleotides were excluded in further studies.
  • Body weights were measured on day 41, and are presented in the Table below. Kidney, liver and spleen weights were measured at the end of the study on day 43. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • Example 13 Measurement of viscosity of ISIS antisense oligonucleotides targeting human ANGPTL3
  • ISIS oligonucleotides 32-35 mg were weighed into a glass vial, 120 ⁇ L of water was added and the antisense oligonucleotide was dissolved into solution by heating the vial at 50°C.
  • Part (75 ⁇ L) of the pre-heated sample was pipetted to a micro-viscometer (Cambridge). The temperature of the micro-viscometer was set to 25°C and the viscosity of the sample was measured.
  • Another part (20 ⁇ L) of the pre-heated sample was pipetted into 10 mL of water for UV reading at 260 nM at 85°C (Cary UV instrument).
  • Viscosity (cP) SEQ ID NO 233710 14.65 233 337478 13.34 235 544145 11.97 16 544162 8.50 18 544199 11.70 20 560306 5.67 34 560400 9.26 35 560401 18.11 36 560402 90.67 37 560469 12.04 38 560735 7.49 49 567320 9.05 93 567321 9.62 94 567233 6.72 90 563580 16.83 77 561010 26.32 113 561011 43.15 114
  • Example 14 Tolerability of antisense oligonucleotides targeting human ANGPTL3 in Sprague-Dawley rats
  • Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations.
  • the rats were treated with ISIS antisense oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured on day 45 and the results are presented in the Table below expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies. Total urine protein and urine creatinine levels were measured, and the ratio of total urine protein to creatinine was evaluated. The results are presented in the Table below.
  • Kidney function plasma markers (mg/dL) in Sprague-Dawley rats BUN Creatinine SEQ ID NO PBS 16 0.27 ISIS 544145 53 0.26 16 ISIS 544199 24 0.34 20 ISIS 560400 28 0.31 35 ISIS 560401 29 0.28 36 ISIS 560469 23 0.32 38 ISIS 567320 26 0.35 93 ISIS 567321 24 0.37 94
  • Body weights were measured on day 42 and presented in the Table below.
  • Liver, spleen and kidney weights were measured at the end of the study on day 45, and are presented in the Table below.
  • ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured on day 44 and the results are presented in the Table below expressed in IU/L. Plasma levels of bilirubin were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies.
  • Body weights were measured on day 42 and presented in the Table below.
  • Liver, spleen and kidney weights were measured at the end of the study on day 44, and are presented in the Table below.
  • ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured on day 44 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies. Total urine protein and urine creatinine levels were measured, and the ratio of total urine protein to creatinine was evaluated. The results are presented in the Table below.
  • Body weights were measured on day 42 and presented in the table below.
  • Liver, spleen and kidney weights were measured at the end of the study on day 44, and are presented in the Table below.
  • ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.
  • Cynomolgus monkeys were treated with ISIS antisense oligonucleotides selected from studies described in the Examples above. Antisense oligonucleotide efficacy and tolerability, as well as their pharmacokinetic profile in the liver and kidney, were evaluated.
  • the human antisense oligonucleotides tested are cross-reactive with the rhesus genomic sequence (GENBANK Accession No. NW_001108682.1 truncated from nucleotides 3049001 to 3062000, designated herein as SEQ ID NO: 3).
  • SEQ ID NO: 3 The greater the complementarity between the human oligonucleotide and the rhesus monkey sequence, the more likely the human oligonucleotide can cross-react with the rhesus monkey sequence.
  • the start and stop sites of each oligonucleotide to SEQ ID NO: 3 is presented in the Table below. "Start site” indicates the 5'-most nucleotide to which the gapmer is targeted in the rhesus monkey gene sequence.
  • the monkeys Prior to the study, the monkeys were kept in quarantine for at least a 30 day period, during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed between 2 and 4 kg.
  • Nine groups of 5 randomly assigned male cynomolgus monkeys each were injected subcutaneously with ISIS oligonucleotide or PBS at four sites on the back in a clockwise rotation (i.e. left, top, right, and bottom), one site per dose.
  • the monkeys were observed twice daily for signs of illness or distress. Any animal experiencing more than momentary or slight pain or distress due to the treatment, injury or illness was treated by the veterinary staff with approved analgesics or agents to relieve the pain after consultation with the Study Director. Any animal in poor health or in a possible moribund condition was identified for further monitoring and possible euthanasia. For example, one animal in the ISIS 567321 treatment group was found moribund on day 45 and was terminated. Scheduled euthanasia of the animals was conducted on day 86 (approximately 48 hours after the final dose) by exsanguination after ketamine/xylazine-induced anesthesia and administration of sodium pentobarbital. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).
  • IACUC Institutional Animal Care and Use Committee
  • ANGPTL3 protein levels were quantified using a commercially available ELISA kit (Catalog #DANL30 by R&D Systems, Minneapolis, MN) with transgenic plasma samples diluted 1:20,000 using the manufacturer described protocol. The results are presented in the Table below. Analysis of plasman ANGPTL3 revealed that ISIS 563580, 544199 and ISIS 559277 reduced protein levels in a sustained manner. Other ISIS oligonucleotides were also able to reduce ANGPTL3 levels.
  • ISIS oligonucleotides were collected from all the study groups.
  • the blood samples were collected from the cephalic, saphenous, or femoral veins, 48 hours post-dosing. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged (approximately 3,000 rpm for 10 min) to obtain serum.
  • Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of ALT and AST were measured and the results are presented in the Table below, expressed in IU/L.
  • Bilirubin a liver function marker
  • ISIS 563580 ISIS 563580
  • the concentration of the full-length oligonucleotide was measured.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 13
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • Study Drug ISIS 563580 a Phase 1, blinded, randomized, placebo-controlled, dose-escalation study was performed on healthy volunteers with a normal lipid profile. The study evaluated the safety, tolerability, pharmacokinetics, effect on plasma levels of ANGPLT3 and the lipoprotein profile of the study subjects after single and multiple doses of the Study Drug ISIS 563580.
  • the study population was healthy males or females aged 18-65 inclusive. Exclusion criteria included clinically significant abnormalities in the medical history and in the screening laboratory values of any of the subjects. Subjects were randomized 3:1 to receive ISIS 563580 or placebo within each single-dose and multiple-dose cohort. Subjects were administered the study drug or placebo subcutaneously (SC).
  • SC subcutaneously
  • ISIS 563580 Blood and urine samples were collected regularly throughout the study for safety, pharmacokinetic, and pharmacodynamics analyses. The safety and tolerability of ISIS 563580 was assessed by determining the incidence, severity, and dose-relationship of adverse events, vital signs, and clinical laboratory parameters. Safety results in subjects dosed with ISIS 563580 were compared with those in subjects dosed with placebo.
  • the length of each subject's participation was approximately 8 weeks, including a 4-week screening period, a single dose, and a 4-week post-treatment evaluation period. Subjects had follow-up visits at the Study Center on Days 2, 4, 8, 15, and a telephone contact on Day 30. The effect of the study drug is being assessed.
  • Subcutaneous injection volumes were 0.5, 1.0, 1.5, and 2.0 mL for cohorts AA, BB, CC, and DD, respectively, with the 2.0 mL volume given as 2 non-contiguous 1.0 mL injections.
  • Dosing of the first cohort began after at least 4 subjects in the single-dose cohort (Cohort D) had completed dosing and Day 4 safety evaluations demonstrated an acceptable safety profile.
  • Subjects received 3 subcutaneous doses of the Study Drug during week 1 on alternative days (Days 1, 3, and 5) followed by once-weekly SC administrations during the next 5 weeks (Days 8, 15, 22, 29, and 36) for a total of 8 doses.
  • the length of each subject's participation was approximately 5.5 months, including a 4-week screening period, a 6-week treatment period, and a 13-week post-treatment evaluation period.
  • Subjects had follow-up visits at the Study Center on Days 37, 43, 50, 64, 78, 92, 106, and 127.
  • the results of the lipid profiles of the subjects on Day 36 are presented in the Table below. The asterisks indicate statistically significant changes (p ⁇ 0.05).
  • Treatment with ISIS 563580 generally produced dose-dependent reductions in plasma ANGPTL3, triglycerides, LDL-cholesterol, non-HDL cholesterol, VLDL-cholesterol, total cholesterol, ApoB and ApoC-III at day 36.
  • the magnitude of the reductions was associated with baseline lipid levels, with larger reductions observed in subjects with higher baselines.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
EP20192739.9A 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression Withdrawn EP3770259A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201361920652P 2013-12-24 2013-12-24
EP14874081.4A EP3087183B1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression
PCT/US2014/072303 WO2015100394A1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
EP14874081.4A Division EP3087183B1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression

Publications (1)

Publication Number Publication Date
EP3770259A1 true EP3770259A1 (en) 2021-01-27

Family

ID=53479686

Family Applications (2)

Application Number Title Priority Date Filing Date
EP20192739.9A Withdrawn EP3770259A1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression
EP14874081.4A Active EP3087183B1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP14874081.4A Active EP3087183B1 (en) 2013-12-24 2014-12-24 Modulation of angiopoietin-like 3 expression

Country Status (19)

Country Link
US (3) US20170037409A1 (cg-RX-API-DMAC7.html)
EP (2) EP3770259A1 (cg-RX-API-DMAC7.html)
JP (2) JP6643996B2 (cg-RX-API-DMAC7.html)
KR (2) KR102198082B1 (cg-RX-API-DMAC7.html)
CN (3) CN111440795A (cg-RX-API-DMAC7.html)
AU (2) AU2014369900B2 (cg-RX-API-DMAC7.html)
BR (1) BR112016013473A2 (cg-RX-API-DMAC7.html)
CA (1) CA2931510A1 (cg-RX-API-DMAC7.html)
DK (1) DK3087183T3 (cg-RX-API-DMAC7.html)
ES (1) ES2830257T3 (cg-RX-API-DMAC7.html)
HU (1) HUE052243T2 (cg-RX-API-DMAC7.html)
IL (2) IL245707B (cg-RX-API-DMAC7.html)
MX (1) MX383753B (cg-RX-API-DMAC7.html)
NZ (1) NZ720286A (cg-RX-API-DMAC7.html)
PL (1) PL3087183T3 (cg-RX-API-DMAC7.html)
PT (1) PT3087183T (cg-RX-API-DMAC7.html)
RU (1) RU2706964C2 (cg-RX-API-DMAC7.html)
SI (1) SI3087183T1 (cg-RX-API-DMAC7.html)
WO (1) WO2015100394A1 (cg-RX-API-DMAC7.html)

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR087329A1 (es) 2011-06-17 2014-03-19 Regeneron Pharma Anticuerpos humanos contra proteina 3 de tipo angiopoietina humana
DK3087183T3 (da) 2013-12-24 2020-09-14 Ionis Pharmaceuticals Inc Modulation af angiopoietin-3-lignende ekspression
TWI862799B (zh) 2015-04-13 2024-11-21 美商阿尼拉製藥公司 類血管生成素3(ANGPTL3)iRNA組成物及其用途方法
SMT202300219T1 (it) * 2016-02-17 2023-09-06 Regeneron Pharma Metodi per il trattamento o la prevenzione dell’aterosclerosi mediante somministrazione di un inibitore di angptl3
JP7541810B2 (ja) 2016-03-03 2024-08-29 リジェネロン・ファーマシューティカルズ・インコーポレイテッド Angptl3阻害剤と組み合わせてpcsk9阻害剤を投与することにより高脂血症を有する患者を処置するための方法
LT3448426T (lt) * 2016-04-28 2025-07-10 Regeneron Pharmaceuticals, Inc. Pacientų, sergančių šeimine hipercholesterolemija, gydymo būdai
JP2019535839A (ja) 2016-11-29 2019-12-12 ピュアテック ヘルス エルエルシー 治療剤の送達のためのエクソソーム
US10225273B2 (en) * 2017-01-27 2019-03-05 International Business Machines Corporation Secured event monitoring leveraging blockchain
CN110662838B (zh) 2017-02-22 2024-05-28 克里斯珀医疗股份公司 用于基因编辑的组合物和方法
MX2020001912A (es) 2017-09-14 2020-03-24 Arrowhead Pharmaceuticals Inc Agentes de iarn y composiciones para inhibir la expresion de la angiopoyetina tipo 3 (angptl3) y metodos de uso.
US11414661B2 (en) 2017-12-01 2022-08-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
JP7273417B2 (ja) 2017-12-01 2023-05-15 スーチョウ リボ ライフ サイエンス カンパニー、リミテッド 核酸、当該核酸を含む組成物および複合体ならびに調製方法と使用
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
JP7365052B2 (ja) 2017-12-01 2023-10-19 スーチョウ リボ ライフ サイエンス カンパニー、リミテッド 核酸、当該核酸を含む組成物及び複合体ならびに調製方法と使用
JP7727308B2 (ja) 2017-12-01 2025-08-21 スーチョウ リボ ライフ サイエンス カンパニー、リミテッド 二本鎖オリゴヌクレオチド、二本鎖オリゴヌクレオチドを含む組成物および複合体ならびに調製方法と使用
DK3732185T3 (da) 2017-12-29 2025-03-31 Suzhou Ribo Life Science Co Ltd Konjugater og fremstilling og anvendelse heraf
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
CN111655297A (zh) 2018-09-30 2020-09-11 苏州瑞博生物技术有限公司 一种siRNA缀合物及其制备方法和用途
WO2020099525A2 (en) * 2018-11-13 2020-05-22 Lipigon Pharmaceuticals Ab Oligonucleotides influencing the regulation of the fatty acid metabolism
WO2020099482A2 (en) * 2018-11-13 2020-05-22 Lipigon Pharmaceuticals Ab Angptl 3 oligonucleotides influencing the regulation of the fatty acid metabolism
EP3903830A4 (en) 2018-12-28 2023-04-26 Suzhou Ribo Life Science Co., Ltd. NUCLEIC ACID, COMPOSITION AND CONJUGATE WITH NUCLEIC ACID, PROCESS FOR THEIR PREPARATION AND ITS USE
AU2020280438B2 (en) 2019-05-22 2025-03-06 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
CN111973617A (zh) * 2019-05-23 2020-11-24 苏州瑞博生物技术股份有限公司 核酸、药物组合物与缀合物及制备方法和用途
AU2021236674B2 (en) * 2020-03-18 2025-03-06 Dicerna Pharmaceuticals, Inc. Compositions and methods for inhibiting ANGPTL3 expression
WO2021207710A2 (en) 2020-04-09 2021-10-14 Verve Therapeutics, Inc. Base editing of angptl3 and methods of using same for treatment of disease
EP4229200A1 (en) * 2020-10-16 2023-08-23 Sanofi Novel rna compositions and methods for inhibiting angptl3
CN113956345B (zh) * 2021-09-10 2024-04-23 北京大学 Angpt4蛋白及其编码基因在调控心脏损伤后的修复与再生能力中的应用
MX2024007900A (es) 2021-12-22 2024-07-10 Regeneron Pharma Tratamiento de enfermedades renales con inhibidores de la angiopoyetina tipo 3 (angptl3).
WO2023134705A1 (zh) * 2022-01-11 2023-07-20 上海金中锘美生物医药科技有限公司 抑制angptl3表达的rna干扰剂及其用途
EP4486890A1 (en) 2022-03-01 2025-01-08 CRISPR Therapeutics AG Methods and compositions for treating angiopoietin-like 3 (angptl3) related conditions
CN120112639A (zh) * 2022-08-22 2025-06-06 箭头药业股份有限公司 Angptl3相关疾病和病症的治疗方法
AU2023375521A1 (en) 2022-11-10 2025-05-15 Regeneron Pharmaceuticals, Inc. Treatment of kidney diseases with a combination of angiopoietin like 3 (angptl3) inhibitors and solute carrier family 5 member 2 (slc5a2) inhibitors

Citations (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US101207A (en) 1870-03-29 Improvement in screw and screw-driver
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
WO1994014226A1 (en) 1992-12-14 1994-06-23 Honeywell Inc. Motor system with individually controlled redundant windings
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5698685A (en) 1985-03-15 1997-12-16 Antivirals Inc. Morpholino-subunit combinatorial library and method
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6673661B1 (en) 2002-12-20 2004-01-06 Taiwan Semiconductor Manufacturing Co., Ltd. Self-aligned method for forming dual gate thin film transistor (TFT) device
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
WO2004072046A2 (en) * 2003-02-12 2004-08-26 Carex S.A. Quinoline derivatives and their use for modulation of lxr activity
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (ja) 2003-08-28 2005-03-10 Gene Design, Inc. N−0結合性架橋構造型新規人工核酸
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2010036696A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Cyclohexenyl nucleic acid analogs
WO2011085271A2 (en) 2010-01-08 2011-07-14 Isis Pharmaceuticals, Inc. Modulation of angiopoietin-like 3 expression
US20110243948A1 (en) * 2006-12-08 2011-10-06 Lexicon Pharmaceuticals, Inc. Monoclonal Antibodies Against ANGPTL3
WO2011139702A2 (en) 2010-04-28 2011-11-10 Isis Pharmaceuticals, Inc. Modified nucleosides and oligomeric compounds prepared therefrom
WO2012177784A2 (en) * 2011-06-21 2012-12-27 Alnylam Pharmaceuticals Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof
WO2013142571A2 (en) * 2012-03-20 2013-09-26 Cornell University Assays for the identification of compounds that modulate lipid homeostasis

Family Cites Families (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US337498A (en) 1886-03-09 Alexander horne
US337508A (en) 1886-03-09 James j
US337505A (en) 1886-03-09 Chaeles la dow
US337506A (en) 1886-03-09 lagosse
US337492A (en) 1886-03-09 Hadesty
US337490A (en) 1886-03-09 Haebiette a
US233676A (en) 1880-10-26 Combined cane-top and match-safe
US337488A (en) 1886-03-09 Johannes evees
US337474A (en) 1886-03-09 Leander l
US337497A (en) 1886-03-09 Giles j
US337460A (en) 1886-03-09 Fifth-wheel
US337491A (en) 1886-03-09 William h
US337526A (en) 1886-03-09 serg-eant
US337513A (en) 1886-03-09 Method or process of making wire cables
US233721A (en) 1880-10-26 Mechanical musical instrument
US337478A (en) 1886-03-09 Calendar
US337516A (en) 1886-03-09 Apparatus for burning gaseous fuel
US337528A (en) 1886-03-09 Waterproofing cloth
US337479A (en) 1886-03-09 Steering-propeller
US337477A (en) 1886-03-09 Hoeatio j
US337459A (en) 1886-03-09 Apparatus for cleaning oil
US337520A (en) 1886-03-09 Feancis h
US337484A (en) 1886-03-09 Solomon paul davis
US337481A (en) 1886-03-09 Michael clune
US233710A (en) 1880-10-26 theqdor steinway
US233722A (en) 1880-10-26 One-wheel plow
US337525A (en) 1886-03-09 Agricultural implement
US337521A (en) 1886-03-09 scaeeitt
US233690A (en) 1880-10-26 Water-conductor and joint
US337487A (en) 1886-03-09 Cutter-head
US337503A (en) 1886-03-09 Tablet
US233717A (en) 1880-10-26 Lrrhogftapher
US337514A (en) 1886-03-09 William m
US2699808A (en) 1944-10-06 1955-01-18 Mark W Lowe Apparatus for peeling tomatoes
US2699508A (en) 1951-12-21 1955-01-11 Selectronics Inc Method of mounting and construction of mounting for low frequency piezoelectric crystals
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5656408A (en) 1996-04-29 1997-08-12 Xerox Corporation Coated carrier particles
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
EP1210363A2 (en) 1999-07-16 2002-06-05 Hyseq, Inc. Novel angiopoietin materials and methods
CA2390676A1 (en) 1999-12-09 2001-06-14 Sankyo Company, Limited Method of testing remedy or preventive for hyperlipemia
WO2002101039A1 (fr) 2001-06-08 2002-12-19 Sankyo Company, Limited Procede de test de medicament destine a traiter ou a prevenir des maladies telles que l'hyperlipemie
CA2464542C (en) 2001-11-16 2015-01-20 Genentech, Inc. Composition comprising and method of using angiopoietin-like protein 3 angptl3
JP2005527220A (ja) 2002-05-28 2005-09-15 ユー.エス. ジェノミクス, インコーポレイテッド 単一のポリマー分析を使用する方法および装置
JP2006500012A (ja) 2002-07-31 2006-01-05 ヌクレオニクス インコーポレーティッド 二本鎖rnaの構造および構築物、並びにその作製法および使用法
AU2003284323A1 (en) 2002-10-18 2004-05-04 Alnylam Pharmaceuticals Inc Double-stranded rna structures and constructs, and methods for generating and using the same
US7511131B2 (en) 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
EP2314691A3 (en) 2002-11-14 2012-01-18 Dharmacon, Inc. Fuctional and hyperfunctional siRNA
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
US7598227B2 (en) * 2003-04-16 2009-10-06 Isis Pharmaceuticals Inc. Modulation of apolipoprotein C-III expression
CA2536324A1 (en) 2003-08-22 2005-03-10 Nihon University Hepatocellular cancer-associated gene
CN101052717A (zh) 2004-05-11 2007-10-10 α基因株式会社 诱发rna干扰的多核苷酸以及使用该多核苷酸的基因表达抑制方法
AU2005269758B2 (en) 2004-07-20 2011-11-03 Genentech, Inc. Compositions and methods of using angiopoietin-like 4 protein
EP1771474B1 (en) 2004-07-20 2010-01-27 Genentech, Inc. Inhibitors of angiopoietin-like 4 protein, combinations, and their use
CA2580504C (en) 2004-09-17 2013-10-29 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
UY30097A1 (es) * 2006-01-20 2007-08-31 Atugen Ag Usos terapeuticos de inhibidores de rtp801
EP2015758B1 (en) 2006-05-05 2014-04-02 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression apob
CN105837690A (zh) * 2006-06-12 2016-08-10 新兴产品开发西雅图有限公司 具有效应功能的单链多价结合蛋白
CA2660052A1 (en) 2006-08-04 2008-02-07 Isis Pharmaceuticals, Inc. Compositions and methods for the modulation of jnk proteins
US8093222B2 (en) 2006-11-27 2012-01-10 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
CA2717618A1 (en) 2008-03-07 2009-09-11 National University Corporation University Of Toyama Homologous recombination method, cloning method, and kit
EP2146210A1 (en) * 2008-04-07 2010-01-20 Arena Pharmaceuticals, Inc. Methods of using A G protein-coupled receptor to identify peptide YY (PYY) secretagogues and compounds useful in the treatment of conditions modulated by PYY
US8501805B2 (en) 2008-09-24 2013-08-06 Isis Pharmaceuticals, Inc. Substituted alpha-L-bicyclic nucleosides
US9984408B1 (en) 2012-05-30 2018-05-29 Amazon Technologies, Inc. Method, medium, and system for live video cooperative shopping
DK3087183T3 (da) 2013-12-24 2020-09-14 Ionis Pharmaceuticals Inc Modulation af angiopoietin-3-lignende ekspression
US9382540B2 (en) * 2014-05-01 2016-07-05 Isis Pharmaceuticals, Inc Compositions and methods for modulating angiopoietin-like 3 expression

Patent Citations (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US101207A (en) 1870-03-29 Improvement in screw and screw-driver
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4981957A (en) 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5698685A (en) 1985-03-15 1997-12-16 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5792847A (en) 1989-10-24 1998-08-11 Gilead Sciences, Inc. 2' Modified Oligonucleotides
US5466786A (en) 1989-10-24 1995-11-14 Gilead Sciences 2'modified nucleoside and nucleotide compounds
US5466786B1 (en) 1989-10-24 1998-04-07 Gilead Sciences 2' Modified nucleoside and nucleotide compounds
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5567811A (en) 1990-05-03 1996-10-22 Amersham International Plc Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5393878A (en) 1991-10-17 1995-02-28 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5319080A (en) 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5639873A (en) 1992-02-05 1997-06-17 Centre National De La Recherche Scientifique (Cnrs) Oligothionucleotides
US5610300A (en) 1992-07-01 1997-03-11 Ciba-Geigy Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5700920A (en) 1992-07-01 1997-12-23 Novartis Corporation Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
WO1994014226A1 (en) 1992-12-14 1994-06-23 Honeywell Inc. Motor system with individually controlled redundant windings
US5576427A (en) 1993-03-30 1996-11-19 Sterling Winthrop, Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5446137A (en) 1993-12-09 1995-08-29 Syntex (U.S.A.) Inc. Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7034133B2 (en) 1997-09-12 2006-04-25 Exiqon A/S Oligonucleotide analogues
US6600032B1 (en) 1998-08-07 2003-07-29 Isis Pharmaceuticals, Inc. 2′-O-aminoethyloxyethyl-modified oligonucleotides
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
WO2001049687A2 (en) 1999-12-30 2001-07-12 K. U. Leuven Research & Development Cyclohexene nucleic acids
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US6673661B1 (en) 2002-12-20 2004-01-06 Taiwan Semiconductor Manufacturing Co., Ltd. Self-aligned method for forming dual gate thin film transistor (TFT) device
WO2004072046A2 (en) * 2003-02-12 2004-08-26 Carex S.A. Quinoline derivatives and their use for modulation of lxr activity
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (ja) 2003-08-28 2005-03-10 Gene Design, Inc. N−0結合性架橋構造型新規人工核酸
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
WO2005121371A2 (en) 2004-06-03 2005-12-22 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20070287831A1 (en) 2006-05-11 2007-12-13 Isis Pharmaceuticals, Inc 5'-modified bicyclic nucleic acid analogs
US20110243948A1 (en) * 2006-12-08 2011-10-06 Lexicon Pharmaceuticals, Inc. Monoclonal Antibodies Against ANGPTL3
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2010036696A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Cyclohexenyl nucleic acid analogs
WO2011085271A2 (en) 2010-01-08 2011-07-14 Isis Pharmaceuticals, Inc. Modulation of angiopoietin-like 3 expression
US20130023579A1 (en) * 2010-01-08 2013-01-24 Isis Pharmaceuticals, Inc. Modulation of angiopoietin-like 3 expression
WO2011139702A2 (en) 2010-04-28 2011-11-10 Isis Pharmaceuticals, Inc. Modified nucleosides and oligomeric compounds prepared therefrom
WO2012177784A2 (en) * 2011-06-21 2012-12-27 Alnylam Pharmaceuticals Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof
WO2013142571A2 (en) * 2012-03-20 2013-09-26 Cornell University Assays for the identification of compounds that modulate lipid homeostasis

Non-Patent Citations (66)

* Cited by examiner, † Cited by third party
Title
"Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278
"GENBANK", Database accession no. NW 001108682.1
ALBAEK ET AL., J. ORG. CHEM., vol. 71, 2006, pages 7731 - 7740
ALTMANN ET AL., BIOCHEM. SOC. TRANS., vol. 24, 1996, pages 630 - 637
ALTMANN ET AL., CHIMIA, vol. 50, 1996, pages 168 - 176
ALTMANN ET AL., NUCLEOSIDES NUCLEOTIDES, vol. 16, 1997, pages 917 - 926
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 410
ARCH. INT. MED., vol. 148, 1988, pages 36 - 39
BAKER ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 11944 - 12000
BRAASCH ET AL., BIOCHEMISTRY, vol. 41, 2002, pages 4503 - 4510
BRAASCH ET AL., CHEM. BIOL., vol. 8, 2001, pages 1 - 7
BROWNINGHORTON, J CLIN INVEST, vol. 114, 2004, pages 147 - 152
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
ELAYADI ET AL., CURR. OPINION INVENS. DRUGS, vol. 2, 2001, pages 558 - 561
FRIEDEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 21, 2003, pages 6365 - 6372
FRIER ET AL., NUCLEIC ACIDS RESEARCH, vol. 25, no. 22, 1997, pages 4429 - 4443
GAO X ET AL: "Angiopoietin-like protein 3 regulates the motility and permeability of podocytes by altering nephrin expression in vitro", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ELSEVIER, AMSTERDAM, NL, vol. 399, no. 1, 13 August 2010 (2010-08-13), pages 31 - 36, XP027207740, ISSN: 0006-291X, [retrieved on 20100713], DOI: 10.1016/J.BBRC.2010.07.027 *
GAUTSCHI ET AL., J. NATL. CANCER INST., vol. 93, March 2001 (2001-03-01), pages 463 - 471
GIUSEPPE DANILO NORATA ET AL: "Gene silencing approaches for the management of dyslipidaemia", TRENDS IN PHARMACOLOGICAL SCIENCES., vol. 34, no. 4, 1 April 2013 (2013-04-01), GB, pages 198 - 205, XP055382603, ISSN: 0165-6147, DOI: 10.1016/j.tips.2013.01.010 *
GU ET AL., NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 24, no. 5-7, 2005, pages 993 - 998
GU ET AL., OLIGONUCLEOTIDES, vol. 13, no. 6, 2003, pages 479 - 489
GU ET AL., TETRAHEDRON, vol. 60, no. 9, 2004, pages 2111 - 2123
HORVATH ET AL., TETRAHEDRON LETTERS, vol. 48, 2007, pages 3621 - 3623
JAMA, vol. 285, 2001, pages 2486 - 2497
JONES, L.J. ET AL., ANALYTICAL BIOCHEMISTRY, vol. 265, 1998, pages 368 - 374
KAPLAN ET AL., J. LIPID RES., vol. 44, 2003, pages 136 - 143
KOSHKIN ET AL., TETRAHEDRON, vol. 54, 1998, pages 3607 - 3630
KUMAR ET AL., BIOORG. MED. CHEM. LETT., vol. 8, 1998, pages 2219 - 2222
LEUMANN, BIOORG. MED. CHEM., vol. 10, 2002, pages 841 - 854
LEUMANN, CHRISTIAN J., BIOORG. & MED. CHEM., vol. 10, 2002, pages 841 - 854
MAHERDOLNICK, NUC. ACID. RES., vol. 16, 1988, pages 3341 - 3358
MARK J. GRAHAM ET AL: "Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides SUPPLEMENTARY APPENDIX", NEW ENGLAND JOURNAL OF MEDICINE, 1 January 2017 (2017-01-01), US, XP055381234, ISSN: 0028-4793, DOI: 10.1056/NEJMoa1701329 *
MARK J. GRAHAM ET AL: "Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides", NEW ENGLAND JOURNAL OF MEDICINE, THE - NEJM -, 6 June 2017 (2017-06-06), XP055381213, ISSN: 0028-4793, DOI: 10.1056/NEJMoa1701329 *
MARTIN, HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MARTIN-CAMPOS ET AL., CLIN CHIM ACTA, vol. 413, 2012, pages 552 - 555
MINICOCCI ET AL., J CLIN ENDOCRINOL METAB, vol. 97, 2012, pages el266 - 1275
MINICOCCI ET AL., J OF LIPID RESEARCH, vol. 54, 2013, pages 3481 - 3490
MUSUNURU ET AL., N ENGL J MED, vol. 363, 2010, pages 2220 - 2227
NAUWELAERTS ET AL., J. AM. CHEM. SOC., vol. 129, no. 30, 2007, pages 9340 - 9348
NAUWELAERTS ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 8, 2005, pages 2452 - 2463
NOTO ET AL., ARTERIOSCLER THROMB VASC BIOL, vol. 32, 2012, pages 805 - 809
ORUM ET AL., CURR. OPINION MOL. THER., vol. 3, 2001, pages 239 - 243
PAL-BHADRA ET AL., SCIENCE, vol. 303, 2004, pages 669 - 672
PISCIOTTA ET AL., CIRCULATION CARDIOVASC GENET, vol. 5, 2012, pages 42 - 50
ROBEYNS ET AL., ACTA CRYSTALLOGRAPHICA, SECTION F: STRUCTURAL BIOLOGY AND CRYSTALLIZATION COMMUNICATIONS, vol. F61, no. 6, 2005, pages 585 - 586
ROBEYNS ET AL., J. AM. CHEM. SOC., vol. 130, no. 6, 2008, pages 1979 - 1984
ROMEO ET AL., J CLIN INVEST, vol. 119, no. 1, 2009, pages 70 - 79
SEHGAL ALFICA ET AL: "Liver as a target for oligonucleotide therapeutics", JOURNAL OF HEPATOLOGY, vol. 59, no. 6, 1 December 2013 (2013-12-01), pages 1354 - 1359, XP028775443, ISSN: 0168-8278, DOI: 10.1016/J.JHEP.2013.05.045 *
SHIMAMURA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 322, 2004, pages 1080 - 1085
SINDELKA ET AL., PHYSIOL RES., vol. 51, 2002, pages 85 - 91
SINGH ET AL., CHEM. COMMUN., vol. 4, 1998, pages 455 - 456
SINGH ET AL., J. ORG. CHEM., vol. 63, 1998, pages 10035 - 10039
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 489
VALDIVIELSO ET AL., ATHEROSCLEROSIS, 2009
VERBEURE ET AL., NUCLEIC ACIDS RESEARCH, vol. 29, no. 24, 2001, pages 4941 - 4947
VOLPE ET AL., SCIENCE, vol. 297, 2002, pages 2232 - 2237
WAHLESTEDT ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 97, 2000, pages 5633 - 5638
WANG ET AL., J. AM. CHEM., vol. 122, 2000, pages 8595 - 8602
WANG ET AL., J. ORG. CHEM., vol. 66, 2001, pages 8478 - 82
WANG ET AL., J. ORG. CHEM., vol. 68, 2003, pages 4499 - 4505
WANG ET AL., NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 20, no. 4-7, 2001, pages 785 - 788
WILLER ET AL., NATURE GENETICS, vol. 40, no. 2, 2008, pages 161 - 169
WOOLF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7305 - 7309
YU HAIBO ET AL: "Effects of ANGPTL3 antisense oligodeoxynucleotides transfection on the cell growths and invasion of human hepatocellular carcinoma cells.", HEPATO-GASTROENTEROLOGY, vol. 58, no. 110-111, 1 September 2011 (2011-09-01), DE, pages 1742 - 1746, XP055131821, ISSN: 0172-6390, DOI: 10.5754/hge10647 *
ZHANG ET AL., CIRC RES., vol. 102, no. 2, 2008, pages 250 - 6
ZHANGMADDEN, GENOME RES., vol. 7, 1997, pages 649 656

Also Published As

Publication number Publication date
NZ720286A (en) 2022-12-23
RU2016129725A (ru) 2018-01-30
CN105814204B (zh) 2020-04-28
RU2706964C2 (ru) 2019-11-21
PL3087183T3 (pl) 2021-01-11
KR20210013730A (ko) 2021-02-05
MX2016008462A (es) 2016-10-12
AU2021202684A1 (en) 2021-05-27
MX383753B (es) 2025-03-14
WO2015100394A1 (en) 2015-07-02
RU2016129725A3 (cg-RX-API-DMAC7.html) 2018-08-13
IL272208B (en) 2021-08-31
KR102298476B1 (ko) 2021-09-03
US11118183B2 (en) 2021-09-14
EP3087183A4 (en) 2017-08-16
JP2017505116A (ja) 2017-02-16
JP2020072713A (ja) 2020-05-14
ES2830257T3 (es) 2021-06-03
IL245707A0 (en) 2016-07-31
AU2014369900A1 (en) 2016-06-09
EP3087183A1 (en) 2016-11-02
EP3087183B1 (en) 2020-08-26
AU2014369900B2 (en) 2021-05-20
US20220403393A1 (en) 2022-12-22
BR112016013473A2 (pt) 2017-10-03
KR102198082B1 (ko) 2021-01-05
JP6643996B2 (ja) 2020-02-12
CN111394355A (zh) 2020-07-10
US20190062755A1 (en) 2019-02-28
SI3087183T1 (sl) 2020-12-31
IL272208A (en) 2020-03-31
CN105814204A (zh) 2016-07-27
PT3087183T (pt) 2020-10-08
CA2931510A1 (en) 2015-07-02
HUE052243T2 (hu) 2021-04-28
CN111440795A (zh) 2020-07-24
IL245707B (en) 2021-01-31
DK3087183T3 (da) 2020-09-14
US20170037409A1 (en) 2017-02-09
KR20160101923A (ko) 2016-08-26

Similar Documents

Publication Publication Date Title
US11118183B2 (en) Modulation of angiopoietin-like 3 expression
US8901098B2 (en) Antisense modulation of GCCR expression
AU2017235886B2 (en) Antisense modulation of gcgr expression
EP2855500B1 (en) Methods and compositions for modulating apolipoprotein(a) expression
USRE48060E1 (en) Antisense modulation of PTP1B expression
US10364433B2 (en) Modulation of AGPAT5 expression
HK1230644B (en) Modulation of angiopoietin-like 3 expression
HK1230644A1 (en) Modulation of angiopoietin-like 3 expression
HK40033664A (en) Modulation of angiopoietin-like 3 expression
HK1201070B (en) Antisense modulation of gcgr expression
HK1195074B (en) Antisense modulation of ptp1b expression
HK1195074A (en) Antisense modulation of ptp1b expression

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN PUBLISHED

AC Divisional application: reference to earlier application

Ref document number: 3087183

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210726

RBV Designated contracting states (corrected)

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20230701