EP3252155A1 - Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien - Google Patents

Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien Download PDF

Info

Publication number
EP3252155A1
EP3252155A1 EP17181258.9A EP17181258A EP3252155A1 EP 3252155 A1 EP3252155 A1 EP 3252155A1 EP 17181258 A EP17181258 A EP 17181258A EP 3252155 A1 EP3252155 A1 EP 3252155A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
lysin
seq
bacteria
plyss2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP17181258.9A
Other languages
English (en)
French (fr)
Inventor
Vincent A Fischetti
Jonathan SCHMITZ
Daniel GILMER
Chad Euler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rockefeller University
Original Assignee
Rockefeller University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rockefeller University filed Critical Rockefeller University
Publication of EP3252155A1 publication Critical patent/EP3252155A1/de
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2462—Lysozyme (3.2.1.17)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/50—Hydrolases (3) acting on carbon-nitrogen bonds, other than peptide bonds (3.5), e.g. asparaginase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01017—Lysozyme (3.2.1.17)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates generally to methods, compositions and articles of manufacture useful for the prophylactic and therapeutic amelioration and treatment of gram-positive bacteria, including Streptococcus and Staphylococcus bacterial strains, including pathogenic and antibiotic-resistant bacteria, and related conditions.
  • the invention relates to compositions and articles of manufacture incorporating isolated Streptococcus suis bacteriophage lysins including PlySs2 and/or PlySs1 lytic enzymes and variants thereof, including truncations thereof, and to methods utilizing the lysin polypeptides and compositions.
  • Gram-positive bacteria are surrounded by a cell wall containing polypeptides and polysaccharide.
  • the gram-positive cell wall appears as a broad, dense wall that is 20-80 nm thick and consists of numerous interconnecting layers of peptidoglycan. Between 60% and 90% of the gram-positive cell wall is peptidoglycan, providing cell shape, a rigid structure, and resistance to osmotic shock.
  • Gram-positive bacteria include but are not limited to the genera Actinomyces, Bacillus, Listeria, Lactococcus, Staphylococcus, Streptococcus, Enterococcus, Mycobacterium, Corynebacterium, and Clostridium. Medically relevant species include Streptococcus pyogenes, Streptococcus pneumoniae, Staphylococcus aureus, and Enterococcus faecalis. Bacillus species, which are spore-forming, cause anthrax and gastroenteritis. Spore-forming Clostridium species are responsible for botulism, tetanus, gas gangrene and pseudomembranous colitis. Corynebacterium species cause diphtheria, and Listeria species cause meningitis.
  • Antibacterials that inhibit cell wall synthesis such as penicillins and cephalosporins, interfere with the linking of the interpeptides of peptidoglycan and weaken the cell wall of both gram positive and gram negative bacteria. Because the peptidoglycans of gram-positive bacteria are exposed, gram-positive bacteria are more susceptible to these antibiotics.
  • eukaryotic cells lack cell walls and are not susceptible to these drugs or other cell wall agents.
  • Novel antimicrobial therapy approaches include enzyme-based antibiotics ("enzybiotics”) such as bacteriophage lysins. Phages use these lysins to digest the cell wall of their bacterial hosts, releasing viral progeny through hypotonic lysis. A similar outcome results when purified, recombinant lysins are added externally to Gram-positive bacteria. The high lethal activity of lysins against Gram-positive pathogens makes them attractive candidates for development as therapeutics. Bacteriophage lysins were initially proposed for eradicating the nasopharyngeal carriage of pathogenic streptococci ( Loeffler, J. M. et al (2001) Science 294: 2170-2172 ; Nelson, D.
  • enzyme-based antibiotics such as bacteriophage lysins. Phages use these lysins to digest the cell wall of their bacterial hosts, releasing viral progeny through hypotonic lysis. A similar outcome results when purified, recombinant
  • Lysins are part of the lytic mechanism used by double stranded DNA (dsDNA) phage to coordinate host lysis with completion of viral assembly ( Wang, I. N. et al (2000) Annu Rev Microbiol 54:799-825 ). Phage encode both holins that open a pore in the bacterial membrane, and peptidoglycan hydrolases called lysins that break bonds in the bacterial wall [6]. Late in infection, lysin translocates into the cell wall matrix where it rapidly hydrolyzes covalent bonds essential for peptidoglycan integrity, causing bacterial lysis and concomitant progeny phage release.
  • dsDNA double stranded DNA
  • Lysin family members exhibit a modular design in which a catalytic domain is fused to a specificity or binding domain ( Lopez, R. et al (1997) Microb Drug Resist 3:199-211 ). Lysins can be cloned from viral prophage sequences within bacterial genomes and used for treatment ( Beres, S.B. et al (2007) PLoS ONE 2(8):1-14 ). When added externally, lysins are able to access the bonds of a Gram-positive cell wall ( FIGURE 1 ) ( Fischetti, V.A. (2008) Curr Opinion Microbiol 11:393-400 ).
  • Lysins have been shown to demonstrate a high lethal activity against numerous Gram-positive pathogens (especially the bacterium from which they were cloned), raising the possibility of their development as therapeutics ( Fischetti, V.A. (2008) Curr Opinion Microbiol 11:393-400 ; Nelson, D.L. et al (2001) Proc Natl Acad Sci USA 98:4107-4112 ).
  • Bacteriophage lytic enzymes have been established as useful in the assessment and specific treatment of various types of infection in subjects through various routes of administration.
  • U.S. Patent 5,604,109 (Fischetti et al. ) relates to the rapid detection of Group A streptococci in clinical specimens, through the enzymatic digestion by a semi-purified Group C streptococcal phage associated lysin enzyme. This enzyme work became the basis of additional research, leading to methods of treating diseases.
  • Fischetti and Loomis patents U.S.
  • Patents 5,985,271 , 6,017,528 and 6,056,955 disclose the use of a lysin enzyme produced by group C streptococcal bacteria infected with a C1 bacteriophage.
  • U.S. Patent 6,248,324 discloses a composition for dermatological infections by the use of a lytic enzyme in a carrier suitable for topical application to dermal tissues.
  • U.S. Patent 6,254,866 discloses a method for treatment of bacterial infections of the digestive tract which comprises administering a lytic enzyme specific for the infecting bacteria.
  • the carrier for delivering at least one lytic enzyme to the digestive tract is selected from the group consisting of suppository enemas, syrups, or enteric coated pills.
  • U.S. Patent 6,264,945 discloses a method and composition for the treatment of bacterial infections by the parenteral introduction (intramuscularly, subcutaneously, or intravenously) of at least one lytic enzyme produced by a bacteria infected with a bacteriophage specific for that bacteria and an appropriate carrier for delivering the lytic enzyme into a patient.
  • Phage associated lytic enzymes have been identified and cloned from various bacteriophages, each shown to be effective in killing specific bacterial strains.
  • U.S. Patent 7,402,309 , 7,638,600 and published PCT Application WO2008/018854 provides distinct phage-associated lytic enzymes useful as antibacterial agents for treatment or reduction of Bacillus anthracis infections.
  • U.S. Patent 7,569,223 describes lytic enzymes for Streptococcus pneumoniae. Lysin useful for Enterococcus ( E. faecalis and E. faecium , including vancomycin resistant strains) are described in U.S. Patent 7,582291 .
  • Streptococcus suis is a Gram-positive pathogen that infects pigs worldwide. Reports of zoonotic transmission from pigs to humans are increasing ( Sriskandan S. et al (2006) PLoS Medicine 3(5):585-567 ). S . suis may develop a consistent presence in human populations in years to come. Humans and pigs have been treated with penicillin or gentamicin, but S. suis isolates resistant to these antibiotics exist ( Cantin, M. et al (1992) J Vet Diagnostic Investig 4:170-174 ).
  • the present invention provides a lysin having broad killing activity against multiple bacteria, particularly gram-positive bacteria, including Staphylococcus, Streptococcus, Enterococcus and Listeria bacterial strains.
  • the invention provides a bacteriophage lysin capable of killing bacteria from distinct orders.
  • a lysin polypeptide is provided capable of killing one or more bacteria from distinct orders of Bacilli, particularly order Bacilalles and order Lactobacillales.
  • the present invention provides lysin polypeptide capable of and demonstrated to kill bacteria from two distinct orders, particularly Bacillales and Lactobacillales, in vitro and in vivo.
  • Lysin of the present invention is capable of killing Bacillales and Lactobacillales bacteria in mixed culture and in mixed infections in vivo.
  • the invention thus contemplates treatment, decolonization, and/or decontamination of bacteria, cultures or infections or in instances wherein more than one gram positive bacteria, particularly one or more of Staphylococcus, Streptococcus, Enterococcus and Listeria bacteria, is suspected or present.
  • the invention contemplates treatment, decolonization, and/or decontamination of bacteria, cultures or infections or in instances wherein more than one type of Bacilalles bacteria, more than one type of Lactobacillales bacteria, or at least one type of Bacillales and one type of Lactobacillales bacteria is suspected, present, or may be present.
  • bacteriophage lysins are provided which are derived from Streptococcus suis bacteria. Two exemplary distinct and unique lysins have been isolated and characterized, particularly PlySs1, including an active truncation thereof, and PlySs2.
  • the lysin polypeptides of the present invention are unique in demonstrating broad killing activity against multiple bacteria, particularly gram-positive bacteria, including Staphylococcus, Streptococcus, Enterococcus and Listeria bacterial strains.
  • the PlySs2 lysin is capable of killing Staphylococcus aureus strains and bacteria in animal models, as demonstrated herein in mice.
  • PlySs2 is effective against antibiotic-resistant Staphylococcus aureus such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin intermediate-sensitivity Staphylococcus aureus (VISA), and vancomycin resistant Staphylococcus aureus (VRSA).
  • MRSA methicillin-resistant Staphylococcus aureus
  • VISA vancomycin intermediate-sensitivity Staphylococcus aureus
  • VRSA vancomycin resistant Staphylococcus aureus
  • the invention includes compositions and articles of manufacture comprising the lysin polypeptides and methods of prevention and treatment of bacterial growth, colonization and infections.
  • a method is provided of killing gram-positive bacteria comprising the step of contacting the bacteria with a composition comprising an amount of an isolated lysin polypeptide effective to kill gram-positive bacteria, the isolated lysin polypeptide comprising the PlySs2 lysin polypeptide or variants thereof effective to kill gram-positive bacteria.
  • a method is provided of killing gram-positive bacteria comprising the step of contacting the bacteria with a composition comprising an amount of an isolated lysin polypeptide effective to kill the gram-positive bacteria, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity, 85% identity, 90% identity, 95% identity or 99% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria.
  • the composition further comprises an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • the invention provides a method of killing gram-positive bacteria comprising the step of contacting the bacteria with a composition comprising an amount of an isolated lysin polypeptide effective to kill gram-positive bacteria, the isolated lysin polypeptide comprising the PlySs1 lysin polypeptide or truncations or variants thereof effective to kill gram-positive bacteria.
  • the composition comprises an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated truncated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity, 85% identity, 90% identity, 95% identity or 99% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • the methods are performed in vitro or ex vivo so as to sterilize or decontaminate a solution, material or device, particularly intended for use by or in a human.
  • the invention provides a method for reducing a population of gram-positive bacteria comprising the step of contacting the bacteria with a composition comprising an amount of an isolated polypeptide effective to kill at least a portion of the gram-positive bacteria, the isolated polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria.
  • the composition further comprises an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • the invention further provides a method for reducing a population of gram-positive bacteria comprising the step of contacting the bacteria with a composition comprising an amount of an isolated polypeptide effective to kill at least a portion of the gram-positive bacteria, the isolated polypeptide comprising the PlySs1 lysin polypeptide or truncations or variants thereof effective to kill gram-positive bacteria.
  • the composition comprises an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • the methods are performed in vitro or ex vivo so as to sterilize or decontaminate a solution, material or device, particularly intended for use by or in a human.
  • the present invention further provides a method for treating an antibiotic-resistant Staphylococcus aureus infection in a human comprising the step of administering to a human having an antibiotic-resistant Staphylococcus aureus infection, an effective amount of a composition comprising an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:3 and effective to kill Staphylococcus aureus, whereby the number of Staphylococcus aureus in the human is reduced and the infection is controlled.
  • the composition may alternatively or may further comprise an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO: 1 or of SEQ ID NO:2 and effective to kill Staphylococcus aureus.
  • a method of the invention also includes a method for treating gram-positive bacterial infection caused by one or more of Staphylococcus, Streptococcus, Enterococcus or Listeria bacteria in a human comprising the step of administering to a subject having a bacterial infection, an effective amount of a composition comprising an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria, whereby the number of gram-positive bacteria in the human is reduced and the infection is controlled.
  • composition of use in the above method may alternatively or may further comprise an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:1 1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • the invention additionally includes a method for treating a human subject exposed to or at risk for exposure to a pathogenic gram-positive bacteria comprising the step of administering to the subject a composition comprising an amount of an isolated lysin polypeptide effective to kill the gram-positive bacteria, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria.
  • the subject is exposed to or at risk of one of or one or more of Staphylococcus (such as Staphylococcus aureus ), Streptococcus (such as Streptococcus pyogenes ), Listeria (such as L. monocytogenes ), or Enterococcus (such as E. faecalis ) bacteria.
  • Staphylococcus such as Staphylococcus aureus
  • Streptococcus such as Streptococcus pyogenes
  • Listeria such as L. monocytogenes
  • Enterococcus such as E. faecalis
  • the subject may be a human.
  • the subject may be a human adult, child, infant or fetus.
  • Variants of a lysin polypeptide of use in the compositions and methods of the invention may be substantially identical to one or more of the lysin polypeptide(s) exemplified herein, including to SEQ ID NO: 1, 2 or 3.
  • Variants of a lysin polypeptide of use in the compositions and methods of the invention may have at least 75% identity, at least 80% identity, at least 90% identity, at least 95% identity in amino acid sequence as compared to the lysin polypeptide(s) exemplified herein, including to SEQ ID NO: 1, 2 or 3.
  • the susceptible, killed or treated bacteria may be selected from Staphylococcus aureus, Listeria monocytogenes, Staphylococcus simulans, Streptococcus suis, Staphylococcus epidermidis, Streptococcus equi, Streptococcus equi zoo, Streptococcus agalactiae (GBS), Streptococcus pyogenes (GAS), Streptococcus sanguinis, Streptococcus gordonii, Streptococcus dysgalactiae, Group G Streptococcus, Group E Streptococcus, Enterococcus faecalis and Streptococcus pneumonia.
  • the susceptible bacteria or bacteria being treated or decolonized may be an antibiotic resistant bacteria.
  • the bacteria may be methicillin-resistant Staphylococcus aureus (MRSA), vancomycin intermediate-sensitivity Staphylococcus aureus (VISA), or vancomycin resistant Staphylococcus aureus (VRSA).
  • MRSA methicillin-resistant Staphylococcus aureus
  • VISA vancomycin intermediate-sensitivity Staphylococcus aureus
  • VRSA vancomycin resistant Staphylococcus aureus
  • the susceptible bacteria may be a clinically relevant or pathogenic bacteria, particularly for humans.
  • the lysin polypeptide(s) is effective to kill Staphylococcus, Streptococcus, Enterococcus and Listeria bacterial strains.
  • the composition thereof may further comprise a carrier, including a pharmaceutically acceptable carrier, additive or diluent.
  • the composition thereof may further comprise a suitable vehicle for delivery of the polypeptide to a site of infection.
  • the composition thereof may further comprise one or more antibiotic.
  • compositions including thereapeutic and pharmaceutical compositions comprising one or more lysin polypeptide of the invention.
  • the invention thus provides a pharmaceutical composition for killing gram-positive bacteria comprising the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria.
  • the pharmaceutical composition may alternatively or may further comprise an effective amount of the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • a pharmaceutical composition for killing gram-positive bacteria comprising at least two isolated lysin polypeptides wherein the first isolated polypeptide comprises the amino acid sequence of SEQ ID NO:3 or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:3 and effective to kill the gram-positive bacteria, and the second isolated polypeptide comprises the amino acid sequence of SEQ ID NO: 1, the isolated lysin polypeptide comprising the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:1 or of SEQ ID NO:2 and effective to kill the gram-positive bacteria.
  • a composition including a therapeutic or pharmaceutical composition, may comprise a truncated lysin having the amino acid sequence of SEQ ID NO: 2 with a modification whereby the truncated lysin comprises only one catalytic domain selected from the group consisting of an endopeptidase domain and a glucosaminidase domain.
  • the truncated lysin does not include the glucosaminidase domain of SEQ ID NO:1.
  • the truncated lysin may particularly have the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity to the polypeptide of SEQ ID NO:2 and effective to kill gram-positive bacteria.
  • the invention includes an article of manufacture comprising a vessel containing a composition comprising an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:3, or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:3 and effective to kill gram-positive bacteria, and instructions for use of the composition in treatment of a patient exposed to or exhibiting symptoms consistent with exposure to Staphylococcus, Streptococcus or Listeria bacteria, where the instructions for use of the composition indicate a method for using the composition, the method comprising the steps of:
  • the isolated polypeptide of the composition has the amino acid sequence of SEQ ID NO:3.
  • the composition alternatively or further comprises an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:1, the amino acid sequence of SEQ ID NO:2, or variants thereof having at least 80% identity, 85% identity, 90% identity or 95% identity to the polypeptide of SEQ ID NO:1 1 or of SEQ ID NO:2 and effective to kill gram-positive bacteria.
  • compositions of the invention may particularly demonstrate or have killing activity against one or more bacteria strains, particularly selected from the group consisting of Staphylococcus aureus, Listeria monocytogenes, Staphylococcus simulans, Streptococcus suis, Staphylococcus epidermidis, Streptococcus equi, Streptococcus equi zoo, Streptococcus agalactiae (GBS), Streptococcus pyogenes (GAS), Streptococcus sanguinis, Streptococcus gordonii, Streptococcus dysgalactiae, Group G Streptococcus, Group E Streptococcus, Enterococcus faecalis and Streptococcus pneumonia.
  • bacteria strains particularly selected from the group consisting of Staphylococcus aureus, Listeria monocytogenes, Staphylococcus simulans, Streptococcus suis, St
  • the present invention also provides nucleic acids encoding the lysin polypeptides of the invention.
  • nucleic acids are provided encoding S. suis lysins PlySs1, truncated or whole lysin, and PlySs2.
  • Exemplary nucleic acid sequences are provided in FIGURE 3 and in FIGURE 4 .
  • Nucleic acids capable of encoding a polypeptide of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, including variants thereof are provided herein.
  • the present invention also relates to a recombinant DNA molecule or cloned gene, or a degenerate variant thereof, which encodes an S. suis lysin or lysin polypeptide; preferably a nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding the PlySs1 lysin polypeptide, truncated or whole lysin, and/or the PlySs2 lysin polypeptide, has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 3 and in FIGURE 4 .
  • the full DNA sequence of the recombinant DNA molecule, cloned gene, or nucleic acid sequence encoding a lysin polypeptide hereof may be operatively linked to an expression control sequence which may be introduced into an appropriate host.
  • the invention accordingly extends to unicellular hosts, including bacterial hosts, transformed with the nucleic acid sequence, cloned gene or recombinant DNA molecule comprising a DNA sequence encoding the present lysin polypeptide(s), and more particularly, the complete DNA sequence determined from the sequences set forth above and in FIGURE 3 and FIGURE 4 .
  • the present invention naturally contemplates several means for preparation of the lysin polypeptide(s), including as illustrated herein known recombinant techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope.
  • the isolation of the DNA and amino acid sequences disclosed herein facilitates the reproduction of the lysin polypeptide(s) by such recombinant techniques, and accordingly, the invention extends to expression vectors prepared from the disclosed DNA sequences for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.
  • a recombinant expression system is provided to produce biologically active lysin polypeptide(s).
  • a process for preparation of the polypeptides, particularly one or more lysin polypeptide of the invention, is provided comprising culturing a host cell containing an expression vector encoding one or more lysin polypeptide(s) of the invention or capable of expressing a lysin polypeptide(s) of the invention, and recovering the polypeptide(s).
  • the diagnostic utility of the present invention extends to the use of the present lysin polypeptides in assays to screen for the presence of gram-positive bacteria, to screen for the presence of susceptible gram-positive bacteria, or to determine the susceptibility of bacteria to killing or lysing by a one or more lysin polypeptide(s) of the invention.
  • the present invention extends to the development of antibodies against the lysin polypeptide(s), or alternatively against the cleavage target of the lysin polypeptide, including naturally raised and recombinantly prepared antibodies.
  • Such antibodies could include both polyclonal and monoclonal antibodies prepared by known genetic techniques, as well as bi-specific (chimeric) antibodies, and antibodies including other functionalities suiting them for additional diagnostic use conjunctive with their capability of modulating lysin activity.
  • Lysin polypeptides which are modified and are chimeric or fusion proteins, or which are labeled, are contemplated and provided herein.
  • the lysin polypeptide(s) of the invention may be covalently attached to an entity which may provide additional function or enhance the use or application of the lysin polypeptide(s), including for instance a tag, label, targeting moiety or ligand, a cell binding or cell recognizing motif or agent, an antibacterial agent, an antibody, an antibiotic.
  • Exemplary labels include a radioactive label, such as the isotopes 3 H, 14 C, 32 P, 35 S, 36 Cl, 51 Cr, 57 Co, 51 Co, 59 Fe, 90 Y, 125 I, 131 I, and 186 Re.
  • the label may be an enzyme, and detection of the labeled lysin polypeptide may be accomplished by any of the presently utilized or accepted colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.
  • S. suis lysin(s) S. suis lysin(s)
  • PlySs lysin(s) PlySs1 lysin
  • PlySs1 wholele PlySs1
  • truncated PlySs1 ⁇ PlySs1
  • PlySs2 lysin PlySs2
  • any variants not specifically listed may be used herein interchangeably, and as used throughout the present application and claims refer to proteinaceous material including single or multiple proteins, and extends to those proteins having the amino acid sequence data described herein and presented in FIGURE 3 and in FIGURE 4 (SEQ ID NOS: 1, 2 and/or 3), and the profile of activities set forth herein and in the Claims.
  • proteins displaying substantially equivalent or altered activity are likewise contemplated.
  • modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits.
  • a “lytic enzyme” includes any bacterial cell wall lytic enzyme that kills one or more bacteria under suitable conditions and during a relevant time period.
  • Examples of lytic enzymes include, without limitation, various amidase cell wall lytic enzymes.
  • a "S. suis lytic enzyme” includes a lytic enzyme that is capable of killing at least one or more Streptococcus suis bacteria under suitable conditions and during a relevant time period.
  • a "bacteriophage lytic enzyme” refers to a lytic enzyme extracted or isolated from a bacteriophage or a synthesized lytic enzyme with a similar protein structure that maintains a lytic enzyme functionality.
  • a lytic enzyme is capable of specifically cleaving bonds that are present in the peptidoglycan of bacterial cells to disrupt the bacterial cell wall. It is also currently postulated that the bacterial cell wall peptidoglycan is highly conserved among most bacteria, and cleavage of only a few bonds to may disrupt the bacterial cell wall.
  • the bacteriophage lytic enzyme may be an amidase, although other types of enzymes are possible. Examples of lytic enzymes that cleave these bonds are various amidases such as muramidases, glucosaminidases, endopeptidases, or N-acetyl-muramoyl-L-alanine amidases.
  • coli T1 and T6 phage lytic enzymes are amidases as is the lytic enzyme from Listeria phage (ply) (Loessner et al, 1996). There are also other lytic enzymes known in the art that are capable of cleaving a bacterial cell wall.
  • a "lytic enzyme genetically coded for by a bacteriophage” includes a polypeptide capable of killing a host bacteria, for instance by having at least some cell wall lytic activity against the host bacteria.
  • the polypeptide may have a sequence that encompasses native sequence lytic enzyme and variants thereof.
  • the polypeptide may be isolated from a variety of sources, such as from a bacteriophage ("phage"), or prepared by recombinant or synthetic methods, such as those described by Garcia et al and also as provided herein.
  • the polypeptide may comprise a choline-binding portion at the carboxyl terminal side and may be characterized by an enzyme activity capable of cleaving cell wall peptidoglycan (such as amidase activity to act on amide bonds in the peptidoglycan) at the amino terminal side.
  • Lytic enzymes have been described which include multiple enzyme activities, for example two enzymatic domains, such as PlyGBS lysin.
  • a lytic enzyme may be between 25,000 and 35,000 daltons in molecular weight and comprise a single polypeptide chain; however, this can vary depending on the enzyme chain. The molecular weight most conveniently can be determined by assay on denaturing sodium dodecyl sulfate gel electrophoresis and comparison with molecular weight markers.
  • a native sequence phage associated lytic enzyme includes a polypeptide having the same amino acid sequence as an enzyme derived from a bacteria. Such native sequence enzyme can be isolated or can be produced by recombinant or synthetic means.
  • native sequence enzyme encompasses naturally occurring forms (e.g., alternatively spliced or altered forms) and naturally-occurring variants of the enzyme.
  • the native sequence enzyme is a mature or full-length polypeptide that is genetically coded for by a gene from a bacteriophage specific for Streptococcus suis.
  • a number of variants are possible and known, as acknowledged in publications such as Lopez et al., Microbial Drug Resistance 3: 199-211 (1997 ); Garcia et al., Gene 86: 81-88 (1990 ); Garcia et al., Proc. Natl. Acad. Sci.
  • a variant sequence lytic enzyme includes a lytic enzyme characterized by a polypeptide sequence that is different from that of a lytic enzyme, but retains functional activity.
  • the lytic enzyme can, in some embodiments, be genetically coded for by a bacteriophage specific for Streptococcus suis having a particular amino acid sequence identity with the lytic enzyme sequence(s) hereof, as provided in FIGURE 3 and FIGURE 4 or in any of SEQ ID NOS: 1, 2 or 3.
  • a functionally active lytic enzyme can kill Streptococcus suis bacteria, and other susceptible bacteria as provided herein, including as shown in TABLE 1 and in FIGURES 9 and 10 , by disrupting the cellular wall of the bacteria.
  • An active lytic enzyme may have a 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, 99 or 99.5% amino acid sequence identity with the lytic enzyme sequence(s) hereof, as provided in FIGURE 3 and FIGURE 4 or in any of SEQ ID NOS: 1, 2 or 3.
  • Such phage associated lytic enzyme variants include, for instance, lytic enzyme polypeptides wherein one or more amino acid residues are added, or deleted at the N or C terminus of the sequence of the lytic enzyme sequence(s) hereof, as provided in FIGURE 3 and FIGURE 4 or in any of SEQ ID NOS: 1, 2 or 3.
  • a phage associated lytic enzyme will have at least about 80% or 85% amino acid sequence identity with native phage associated lytic enzyme sequences, particularly at least about 90% (e.g. 90%) amino acid sequence identity. Most particularly a phage associated lytic enzyme variant will have at least about 95% (e.g. 95%) amino acid sequence identity with the native phage associated the lytic enzyme sequence(s) hereof, as provided in FIGURE 3 and FIGURE 4 or in any of SEQ ID NOS: 1, 2 or 3.
  • Percent amino acid sequence identity with respect to the phage associated lytic enzyme sequences identified is defined herein as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the phage associated lytic enzyme sequence, after aligning the sequences in the same reading frame and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Percent nucleic acid sequence identity with respect to the phage associated lytic enzyme sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the phage associated lytic enzyme sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of a first nucleotide sequence).
  • the nucleotides or amino acids at corresponding nucleotide or amino acid positions are then compared. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the determination of percent identity between two sequences may be accomplished using a mathematical algorithm.
  • a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993 ). Such an algorithm is incorporated into the NBLAST program which may be used to identify sequences having the desired identity to nucleotide sequences of the invention.
  • Gapped BLAST may be utilized as described in Altschul et al., Nucleic Acids Res, 25:3389-3402 (1997 ).
  • Polypeptide includes a polymer molecule comprised of multiple amino acids joined in a linear manner.
  • a polypeptide can, in some embodiments, correspond to molecules encoded by a polynucleotide sequence which is naturally occurring.
  • the polypeptide may include conservative substitutions where the naturally occurring amino acid is replaced by one having similar properties, where such conservative substitutions do not alter the function of the polypeptide (see, for example, Lewin “Genes V” Oxford University Press Chapter 1, pp. 9-13 1994 ).
  • altered lytic enzymes includes shuffled and/or chimeric lytic enzymes.
  • Phage lytic enzymes specific for bacteria infected with a specific phage have been found to effectively and efficiently break down the cell wall of the bacterium in question.
  • the lytic enzyme is believed to lack proteolytic enzymatic activity and is therefore non-destructive to mammalian proteins and tissues when present during the digestion of the bacterial cell wall.
  • Loeffler et al. "Rapid Killing of Streptococcus pneumoniae with a Bacteriophage Cell Wall Hydrolase," Science, 294: 2170-2172 (Dec.
  • a purified pneumococcal bacteriophage lytic enzyme such as Pal
  • Pal is able to kill various pneumococci.
  • Loeffler et al. have shown through these experiments that within seconds after contact, the lytic enzyme Pal is able to kill 15 clinical stains of S. pneumoniae, including the most frequently isolated serogroups and penicillin resistant stains, in vitro.
  • Treatment of mice with Pal was also able to eliminate or significantly reduce nasal carriage of serotype 14 in a dose-dependent manner.
  • lysin polypeptide of the present invention has a remarkably broad and clinically significant bacterial killing profile. As demonstrated herein, for example, the isolated S. suis lysin PlySs2, is effective in killing S.
  • the lysin of the present invention thus demonstrates a breadth of bacterial cell killing unlike any lysin previously reported or contemplated.
  • a lytic enzyme or polypeptide of the invention may be produced by the bacterial organism after being infected with a particular bacteriophage as either a prophylactic treatment for preventing those who have been exposed to others who have the symptoms of an infection from getting sick, or as a therapeutic treatment for those who have already become ill from the infection.
  • the lytic enzyme(s)/polypeptide(s) may be preferably produced via the isolated gene for the lytic enzyme from the phage genome, putting the gene into a transfer vector, and cloning said transfer vector into an expression system, using standard methods of the art, including as exemplified herein.
  • the lytic enzyme(s) or polypeptide(s) may be truncated, chimeric, shuffled or "natural," and may be in combination. Relevant U.S. Pat. No. 5,604,109 is incorporated herein in its entirety by reference.
  • An "altered" lytic enzyme can be produced in a number of ways.
  • a gene for the altered lytic enzyme from the phage genome is put into a transfer or movable vector, preferably a plasmid, and the plasmid is cloned into an expression vector or expression system.
  • the expression vector for producing a lysin polypeptide or enzyme of the invention may be suitable for E. coli, Bacillus, or a number of other suitable bacteria.
  • the vector system may also be a cell free expression system. All of these methods of expressing a gene or set of genes are known in the art.
  • the lytic enzyme may also be created by infecting Streptococcus suis with a bacteriophage specific for Streptococcus suis, wherein said at least one lytic enzyme exclusively lyses the cell wall of said Streptococcus suis having at most minimal effects on other, for example natural or commensal, bacterial flora present.
  • a "chimeric protein” or “fusion protein” comprises all or (preferably a biologically active) part of a polypeptide of the invention operably linked to a heterologous polypeptide.
  • Chimeric proteins or peptides are produced, for example, by combining two or more proteins having two or more active sites. Chimeric protein and peptides can act independently on the same or different molecules, and hence have a potential to treat two or more different bacterial infections at the same time. Chimeric proteins and peptides also may be used to treat a bacterial infection by cleaving the cell wall in more than one location, thus potentially providing more rapid or effective (or synergistic) killing from a single lysin molecule or chimeric peptide.
  • a "heterologous" region of a DNA construct or peptide construct is an identifiable segment of DNA within a larger DNA molecule or peptide within a larger peptide molecule that is not found in association with the larger molecule in nature.
  • the gene when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA or peptide as defined herein.
  • operably linked means that the polypeptide of the disclosure and the heterologous polypeptide are fused in-frame.
  • the heterologous polypeptide can be fused to the N-terminus or C-terminus of the polypeptide of the disclosure.
  • Chimeric proteins are produced enzymatically by chemical synthesis, or by recombinant DNA technology. A number of chimeric lytic enzymes have been produced and studied. Gene EL, a chimeric lysis constructed from bacteriophages phi X174 and MS2 lysis proteins E and L, respectively, was subjected to internal deletions to create a series of new E-L clones with altered lysis or killing properties.
  • a useful fusion protein is a GST fusion protein in which the polypeptide of the disclosure is fused to the C-terminus of a GST sequence. Such a chimeric protein can facilitate the purification of a recombinant polypeptide of the disclosure.
  • the chimeric protein or peptide contains a heterologous signal sequence at its N-terminus.
  • the native signal sequence of a polypeptide of the disclosure can be removed and replaced with a signal sequence from another protein.
  • the gp67 secretory sequence of the baculovirus envelope protein can be used as a heterologous signal sequence ( Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons, 1992 , incorporated herein by reference).
  • Other examples of eukaryotic heterologous signal sequences include the secretory sequences of melittin and human placental alkaline phosphatase (Stratagene; La Jolla, Calif.).
  • useful prokaryotic heterologous signal sequences include the phoA secretory signal (Sambrook et al., supra) and the protein A secretory signal (Pharmacia Biotech; Piscataway, N.J.).
  • the fusion protein may combine a lysin polypeptide with a protein or polypeptide of having a different capability, or providing an additional capability or added character to the lysin polypeptide.
  • the fusion protein may be an immunoglobulin fusion protein in which all or part of a polypeptide of the disclosure is fused to sequences derived from a member of the immunoglobulin protein family.
  • the immunoglobulin may be an antibody, for example an antibody directed to a surface protein or epitope of a susceptible or target bacteria.
  • An immunoglobulin fusion protein can be incorporated into a pharmaceutical composition and administered to a subject to inhibit an interaction between a ligand (soluble or membrane-bound) and a protein on the surface of a cell (receptor), to thereby suppress signal transduction in vivo.
  • the immunoglobulin fusion protein can alter bioavailability of a cognate ligand of a polypeptide of the disclosure. Inhibition of ligand/receptor interaction may be useful therapeutically, both for treating bacterial-associated diseases and disorders for modulating (i.e. promoting or inhibiting) cell survival.
  • an immunoglobulin fusion protein of the disclosure can be used as an immunogen to produce antibodies directed against a polypeptide of the disclosure in a subject, to purify ligands and in screening assays to identify molecules which inhibit the interaction of receptors with ligands.
  • Chimeric and fusion proteins and peptides of the disclosure can be produced by standard recombinant DNA techniques.
  • the fusion gene can be synthesized by conventional techniques, including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which subsequently can be annealed and reamplified to generate a chimeric gene sequence (see, i.e., Ausubel et al., supra). Moreover, many expression vectors are commercially available that already encode a fusion moiety (i.e., a GST polypeptide). A nucleic acid encoding a polypeptide of the invention can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the polypeptide of the invention.
  • shuffled proteins or peptides, gene products, or peptides for more than one related phage protein or protein peptide fragments have been randomly cleaved and reassembled into a more active or specific protein.
  • Shuffled oligonucleotides, peptides or peptide fragment molecules are selected or screened to identify a molecule having a desired functional property. This method is described, for example, in Stemmer, U.S. Pat. No. 6,132,970 .(Method of shuffling polynucleotides); Kauffman, U.S. Pat. No. 5,976,862 (Evolution via Condon-based Synthesis) and Huse, U.S. Pat. No.
  • Shuffling can be used to create a protein that is more active, for instance up to 10 to 100 fold more active than the template protein.
  • the template protein is selected among different varieties of lysin proteins.
  • the shuffled protein or peptides constitute, for example, one or more binding domains and one or more catalytic domains. Each binding or catalytic domain is derived from the same or a different phage or phage protein.
  • the shuffled domains are either oligonucleotide based molecules, as gene or gene products, that either alone or in combination with other genes or gene products are translatable into a peptide fragment, or they are peptide based molecules.
  • Gene fragments include any molecules of DNA, RNA, DNA-RNA hybrid, antisense RNA, Ribozymes, ESTs, SNIPs and other oligonucleotide-based molecules that either alone or in combination with other molecules produce an oligonucleotide molecule capable or incapable of translation into a peptide.
  • the modified or altered form of the protein or peptides and peptide fragments includes protein or peptides and peptide fragments that are chemically synthesized or prepared by recombinant DNA techniques, or both. These techniques include, for example, chimerization and shuffling.
  • the protein or peptide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest.
  • a signal sequence of a polypeptide can facilitate transmembrane movement of the protein and peptides and peptide fragments of the disclosure to and from mucous membranes, as well as by facilitating secretion and isolation of the secreted protein or other proteins of interest.
  • Signal sequences are typically characterized by a core of hydrophobic amino acids which are generally cleaved from the mature protein during secretion in one or more cleavage events.
  • Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway.
  • the disclosure can pertain to the described polypeptides having a signal sequence, as well as to the signal sequence itself and to the polypeptide in the absence of the signal sequence (i.e., the cleavage products).
  • a nucleic acid sequence encoding a signal sequence of the disclosure can be operably linked in an expression vector to a protein of interest, such as a protein which is ordinarily not secreted or is otherwise difficult to isolate.
  • the signal sequence directs secretion of the protein, such as from an eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved.
  • the protein can then be readily purified from the extracellular medium by art-recognized methods.
  • the signal sequence can be linked to a protein of interest using a sequence which facilitates purification, such as with a GST domain.
  • the present invention also pertains to other variants of the polypeptides of the invention.
  • variants may have an altered amino acid sequence which can function as either agonists (mimetics) or as antagonists.
  • Variants can be generated by mutagenesis, i.e., discrete point mutation or truncation.
  • An agonist can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of the protein.
  • An antagonist of a protein can inhibit one or more of the activities of the naturally occurring form of the protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the protein of interest.
  • specific biological effects can be elicited by treatment with a variant of limited function.
  • Variants of a protein of the disclosure which function as either agonists (mimetics) or as antagonists can be identified by screening combinatorial libraries of mutants, i.e., truncation mutants, of the protein of the disclosure for agonist or antagonist activity.
  • a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
  • a variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (i.e., for phage display).
  • methods which can be used to produce libraries of potential variants of the polypeptides of the disclosure from a degenerate oligonucleotide sequence. Methods for synthesizing degenerate oligonucleotides are known in the art (see, i.e., Narang (1983) Tetrahedron 39:3 ; Itakura et al.
  • libraries of fragments of the coding sequence of a polypeptide of the disclosure can be used to generate a variegated population of polypeptides for screening and subsequent selection of variants, active fragments or truncations.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the protein of interest.
  • Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property.
  • the most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected.
  • Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of a protein of the disclosure ( Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89:7811-7815 ; Delgrave et al. (1993) Protein Engineering 6(3):327-331 ) immunologically active portions of a protein or peptide fragment include regions that bind to antibodies that recognize the phage enzyme.
  • the smallest portion of a protein (or nucleic acid that encodes the protein) is an epitope that is recognizable as specific for the phage that makes the lysin protein.
  • the smallest polypeptide (and associated nucleic acid that encodes the polypeptide) that can be expected to bind a target or receptor, such as an antibody, and is useful for some embodiments may be 8, 9, 10, 11, 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 75, 85, or 100 amino acids long.
  • small sequences as short as 8, 9, 10, 11, 12 or 15 amino acids long reliably comprise enough structure to act as targets or epitopes, shorter sequences of 5, 6, or 7 amino acids long can exhibit target or epitopic structure in some conditions and have value in an embodiment.
  • Biologically active portions of a protein or peptide fragment of the embodiments include polypeptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the phage protein of the disclosure, which include fewer amino acids than the full length protein of the phage protein and exhibit at least one activity of the corresponding full-length protein.
  • biologically active portions comprise a domain or motif with at least one activity of the corresponding protein.
  • a biologically active portion of a protein or protein fragment of the disclosure can be a polypeptide which is, for example, 10, 25, 50, 100 less or more amino acids in length.
  • other biologically active portions, in which other regions of the protein are deleted, or added can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native form of a polypeptide of the embodiments.
  • Homologous proteins and nucleic acids can be prepared that share functionality with such small proteins and/or nucleic acids (or protein and/or nucleic acid regions of larger molecules) as will be appreciated by a skilled artisan.
  • Such small molecules and short regions of larger molecules that may be homologous specifically are intended as embodiments.
  • the homology of such valuable regions is at least 50%, 65%, 75%, 80%, 85%, and preferably at least 90%, 95%, 97%, 98%, or at least 99% compared to the lysin polypeptides provided herein, including as set out in FIGURES 3 and 4 and in SEQ ID NOS: 1, 2 and/or 3. These percent homology values do not include alterations due to conservative amino acid substitutions.
  • Two amino acid sequences are "substantially homologous" when at least about 70% of the amino acid residues (preferably at least about 80%, at least about 85%, and preferably at least about 90 or 95%) are identical, or represent conservative substitutions.
  • the sequences of comparable lysins such as comparable PlySs2 lysins, or comparable PlySs1 lysins, are substantially homologous when one or more, or several, or up to 10%, or up to 15%, or up to 20% of the amino acids of the lysin polypeptide are substituted with a similar or conservative amino acid substitution, and wherein the comparable lysins have the profile of activities, anti-bacterial effects, and/or bacterial specificities of a lysin, such as the PlySs2 and/or PlySs1 lysins, disclosed herein.
  • amino acid residues described herein are preferred to be in the "L" isomeric form.
  • residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as the desired fuctional property of immunoglobulin-binding is retained by the polypeptide.
  • NH 2 refers to the free amino group present at the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide.
  • amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino-terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues.
  • the above Table is presented to correlate the three-letter and one-letter notations which may appear alternately herein.
  • Mutations can be made in the amino acid sequences, or in the nucleic acid sequences encoding the polypeptides and lysins herein, including in the lysin sequences set out in Figure 3 or in Figure 4 , or in active fragments or truncations thereof, such that a particular codon is changed to a codon which codes for a different amino acid, an amino acid is substituted for another amino acid, or one or more amino acids are deleted.
  • Such a mutation is generally made by making the fewest amino acid or nucleotide changes possible.
  • a substitution mutation of this sort can be made to change an amino acid in the resulting protein in a non-conservative manner (for example, by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (for example, by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping).
  • a conservative change generally leads to less change in the structure and function of the resulting protein.
  • a non-conservative change is more likely to alter the structure, activity or function of the resulting protein.
  • the present invention should be considered to include sequences containing conservative changes which do not significantly alter the activity or binding characteristics of the resulting protein.
  • amino acid changes or substitutions in the lysin polypeptide sequence can be made to replace or substitute one or more, one or a few, one or several, one to five, one to ten, or such other number of amino acids in the sequence of the lysin(s) provided herein to generate mutants or variants thereof.
  • mutants or variants thereof may be predicted for function or tested for function or capability for killing bacteria, including Staphylococcal, Streptococcal, Listeria, or Enterococcal bacteria, and/or for having comparable activity to the lysin(s) provided herein.
  • changes can be made to the sequence of PlySs2, for example, by modifying the amino acid sequence as set out in Figure 4 hereof, and mutants or variants having a change in sequence can be tested using the assays and methods described and exemplified herein, including in the examples.
  • the PlySs2 polypeptide lysin represents a divergent class of prophage lytic enzyme
  • the lysin comprises an N-terminal CHAP domain (cysteine-histidine amidohydrolase/peptidase) and a C-terminal SH3-type 5 domain as depicted in FIGURE 4 .
  • the domains are depicted in the amino acid sequence in distinct shaded color regions, with the CHAP domain corresponding to the first shaded amino acid sequence region starting with LNN... and the SH3-type 5 domain corresponding to the second shaded region starting with RSY...
  • CHAP domains are included in several previously characterized streptococcal and staphylococcal phage lysins. Thus, one of skill in the art can reasonably make and test substitutions or replacements to the CHAP domain and/or the SH-3 domain of PlySs2. Sequence comparisons to the Genbank database can be made with either or both of the CHAP and/or SH-3 domain sequences or with the PlySs2 lysin full amino acid sequence, for instance, to identify amino acids for substitution. In FIGURE 30 , the CHAP domain of PlySs2 is aligned with that of the well-characterized streptococcal PlyC lysin, demonstrating conserved catalytic residues, but only a modest level of identity overall (28% sequence identity).
  • FIGURE 30 the conserved cysteine and histidine amino acid sequences in the CHAP domain are shown with an arrow. It is reasonable to predict, for example, that the conserved cysteine and histidine residues should be maintained in a mutant or variant of PlySs2 so as to maintain activity or capability. It is notable that a mutant or variant having an alanine replaced for valine at valine amino acid 19 in the PlySs2 sequence of Figure 4 and SEQ ID NO: 3 is active and capable of killing gram positive bacteria in a manner similar to and as effective as the Figure 4 and SEQ ID NO:3 lysin.
  • Another grouping may be those amino acids with phenyl groups:
  • Another grouping may be according to molecular weight (i.e., size of R groups): Glycine 75 Alanine 89 Serine 105 Proline 115 Valine 117 Threonine 119 Cysteine 121 Leucine 131 Isoleucine 131 Asparagine 132 Aspartic acid 133 Glutamine 146 Lysine 146 Glutamic acid 147 Methionine 149 Histidine (at pH 6.0) 155 Phenylalanine 165 Arginine 174 Tyrosine 181 Tryptophan 204
  • Exemplary and preferred conservative amino acid substitutions include any of:
  • Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduced a potential site for disulfide bridges with another Cys.
  • a His may be introduced as a particularly "catalytic" site (i.e ., His can act as an acid or base and is the most common amino acid in biochemical catalysis).
  • Pro may be introduced because of its particularly planar structure, which induces ⁇ -turns in the protein's structure.
  • a polypeptide or epitope as described herein may be used to generate an antibody and also can be used to detect binding to the lysin or to molecules that recognize the lysin protein.
  • Another embodiment is a molecule such as an antibody or other specific binder that may be created through use of an epitope such as by regular immunization or by a phase display approach where an epitope can be used to screen a library if potential binders.
  • Such molecules recognize one or more epitopes of lysin protein or a nucleic acid that encodes lysin protein.
  • An antibody that recognizes an epitope may be a monoclonal antibody, a humanized antibody, or a portion of an antibody protein.
  • the molecule that recognizes an epitope has a specific binding for that epitope which is at least 10 times as strong as the molecule has for serum albumin.
  • Specific binding can be measured as affinity (Km). More desirably the specific binding is at least 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , or even higher than that for serum albumin under the same conditions.
  • the antibody or antibody fragment is in a form useful for detecting the presence of the lysin protein or, alternatively detecting the presence of a bacteria susceptible to the lysin protein.
  • the antibody may be attached or otherwise associated with the lysin polypeptide of the invention, for example in a chimeric or fusion protein, and may serve to direct the lysin to a bacterial cell or strain of interest or target.
  • the lysin polypeptide may serve to direct the antibody or act in conjunction with the antibody, for example in lysing the bacterial cell wall fully or partially, so that the antibody may specifically bind to its epitope at the surface or under the surface on or in the bacteria.
  • a lysin of the invention may be attached to an anti-Streptococcal antibody and direct the antibody to its epitope.
  • the antibody may be conjugated (covalently complexed) with a reporter molecule or atom such as a fluor, an enzyme that creates an optical signal, a chemilumiphore, a microparticle, or a radioactive atom.
  • a reporter molecule or atom such as a fluor, an enzyme that creates an optical signal, a chemilumiphore, a microparticle, or a radioactive atom.
  • the antibody or antibody fragment may be synthesized in vivo, after immunization of an animal, for example, the antibody or antibody fragment may be synthesized via cell culture after genetic recombination.
  • the antibody or antibody fragment may be prepared by a combination of cell synthesis and chemical modification.
  • an “antibody” is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope.
  • the term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Patent Nos. 4,816,397 and 4,816,567 .
  • the term “antibody” describes an immunoglobulin whether natural or partly or wholly synthetically produced. The term also covers any polypeptide or protein having a binding domain which is, or is homologous to, an antibody binding domain. CDR grafted antibodies are also contemplated by this term.
  • An “antibody” is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope.
  • antibody(ies) includes a wild type immunoglobulin (Ig) molecule, generally comprising four full length polypeptide chains, two heavy (H) chains and two light (L) chains, or an equivalent Ig homologue thereof (e.g., a camelid nanobody, which comprises only a heavy chain); including full length functional mutants, variants, or derivatives thereof, which retain the essential epitope binding features of an Ig molecule, and including dual specific, bispecific, multispecific, and dual variable domain antibodies; Immunoglobulin molecules can be of any class (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), or subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2). Also included
  • an “antibody fragment” means a molecule comprising at least one polypeptide chain that is not full length, including (i) a Fab fragment, which is a monovalent fragment consisting of the variable light (VL), variable heavy (VH), constant light (CL) and constant heavy 1 (CH1) domains; (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a heavy chain portion of an Fab (Fd) fragment, which consists of the VH and CH1 domains; (iv) a variable fragment (Fv) fragment, which consists of the VL and VH domains of a single arm of an antibody, (v) a domain antibody (dAb) fragment, which comprises a single variable domain ( Ward, E.S.
  • antibody should be construed as covering any specific binding member or substance having a binding domain with the required specificity.
  • this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin-binding domain, whether natural or wholly or partially synthetic. Chimeric molecules comprising an immunoglobulin binding domain, or equivalent, fused to another polypeptide are therefore included. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023 and U.S. Patent Nos. 4,816,397 and 4,816,567 .
  • an “antibody combining site” is that structural portion of an antibody molecule comprised of light chain or heavy and light chain variable and hypervariable regions that specifically binds antigen.
  • antibody molecule in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule.
  • exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contains the paratope, including those portions known in the art as Fab, Fab', F(ab') 2 and F(v), which portions are preferred for use in the therapeutic methods described herein.
  • the phrase "monoclonal antibody” in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen.
  • a monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts.
  • a monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.
  • the term "specific” may be used to refer to the situation in which one member of a specific binding pair will not show significant binding to molecules other than its specific binding partner(s).
  • the term is also applicable where e.g. an antigen binding domain is specific for a particular epitope which is carried by a number of antigens, in which case the specific binding member carrying the antigen binding domain will be able to bind to the various antigens carrying the epitope.
  • consisting essentially of' refers to a product, particularly a peptide sequence, of a defined number of residues which is not covalently attached to a larger product.
  • peptide of the invention hereof those of skill in the art will appreciate that minor modifications to the N- or C- terminal of the peptide may however be contemplated, such as the chemical modification of the terminal to add a protecting group or the like, e.g. the amidation of the C-terminus.
  • isolated refers to the state in which the lysin polypeptide(s) of the invention, or nucleic acid encoding such polypeptides will be, in accordance with the present invention.
  • Polypeptides and nucleic acid will be free or substantially free of material with which they are naturally associated such as other polypeptides or nucleic acids with which they are found in their natural environment, or the environment in which they are prepared ( e.g . cell culture) when such preparation is by recombinant DNA technology practised in vitro or in vivo.
  • Polypeptides and nucleic acid may be formulated with diluents or adjuvants and still for practical purposes be isolated - for example the polypeptides will normally be mixed with polymers or mucoadhesives or other carriers, or will be mixed with pharmaceutically acceptable carriers or diluents, when used in diagnosis or therapy.
  • Nucleic acids capable of encoding the S. suis lysin polypeptide(s) of the invention are provided herein and constitute an aspect of the invention.
  • Representative nucleic acid sequences in this context are polynucleotide sequences coding for the polypeptide of any of FIGURES 3 and 4 , the polypeptides of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, and sequences that hybridize, under stringent conditions, with complementary sequences of the DNA of the FIGURE 3 or 4 sequence(s).
  • Further variants of these sequences and sequences of nucleic acids that hybridize with those shown in the figures also are contemplated for use in production of lysing enzymes according to the disclosure, including natural variants that may be obtained.
  • a large variety of isolated nucleic acid sequences or cDNA sequences that encode phage associated lysing enzymes and partial sequences that hybridize with such gene sequences are useful for recombinant production of the lysin enzyme(s) or polypeptide(s) of the invention.
  • a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo ; i.e., capable of replication under its own control.
  • a "vector” is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a "DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia , in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • An "origin of replication” refers to those DNA sequences that participate in DNA synthesis.
  • a DNA "coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences.
  • a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
  • An “expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • a "signal sequence” can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
  • oligonucleotide as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide.
  • primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH.
  • the primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent.
  • the exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
  • the primers herein are selected to be “substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.
  • restriction endonucleases and “restriction enzymes” refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
  • a cell has been "transformed” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • the transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA.
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a "cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra ; DNA Cloning, Vols. I & II , supra ; Nucleic Acid Hybridization, supra.
  • variant DNA molecules include those created by standard DNA mutagenesis techniques, such as M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (1989) In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y . (incorporated herein by reference). By the use of such techniques, variants may be created which differ in minor ways from those disclosed. DNA molecules and nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of nucleotides while still encoding a protein which possesses the functional characteristic of the lysin polypeptide(s) are contemplated by the disclosure. Also included are small DNA molecules which are derived from the disclosed DNA molecules.
  • Such small DNA molecules include oligonucleotides suitable for use as hybridization probes or polymerase chain reaction (PCR) primers.
  • these small DNA molecules will comprise at least a segment of a lytic enzyme genetically coded for by a bacteriophage of Staphylococcus suis and, for the purposes of PCR, will comprise at least a 10-15 nucleotide sequence and, more preferably, a 15-30 nucleotide sequence of the gene.
  • DNA molecules and nucleotide sequences which are derived from the disclosed DNA molecules as described above may also be defined as DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof.
  • Hybridization conditions corresponding to particular degrees of stringency vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the sodium ion concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (1989), In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., chapters 9 and 11 (herein incorporated by reference).
  • a hybridization experiment may be performed by hybridization of a DNA molecule (for example, a natural variation of the lytic enzyme genetically coded for by a bacteriophage specific for Bacillus anthracis) to a target DNA molecule.
  • a target DNA may be, for example, the corresponding cDNA which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting ( Southern (1975). J. Mol. Biol. 98:503 ), a technique well known in the art and described in Sambrook et al. (1989) In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y . (incorporated herein by reference).
  • Hybridization with a target probe labeled with isotopic P 32 labeled-dCTP is carried out in a solution of high ionic strength such as 6 times SSC at a temperature that is 20-25 degrees Celsius below the melting temperature, Tm (described infra).
  • Tm melting temperature
  • hybridization is carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe (of specific activity equal to 109 CPM/mug or greater).
  • the nitrocellulose filter is washed to remove background hybridization. The washing conditions are as stringent as possible to remove background hybridization while retaining a specific hybridization signal.
  • Tm represents the temperature above which, under the prevailing ionic conditions, the radiolabeled probe molecule will not hybridize to its target DNA molecule.
  • stringent conditions may be defined as those under which DNA molecules with more than 25% sequence variation (also termed "mismatch") will not hybridize.
  • stringent conditions are those under which DNA molecules with more than 15% mismatch will not hybridize, and more preferably still, stringent conditions are those under which DNA sequences with more than 10% mismatch will not hybridize.
  • stringent conditions are those under which DNA sequences with more than 6% mismatch will not hybridize.
  • the degeneracy of the genetic code further widens the scope of the embodiments as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein.
  • a representative amino acid residue is alanine.
  • This may be encoded in the cDNA by the nucleotide codon triplet GCT.
  • three other nucleotide codon triplets--GCT, GCC and GCA-- also code for alanine.
  • the nucleotide sequence of the gene could be changed at this position to any of these three codons without affecting the amino acid composition of the encoded protein or the characteristics of the protein.
  • variant DNA molecules may be derived from the cDNA molecules disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences which do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are herein comprehended by this disclosure.
  • DNA sequences encoding a lysin of the present invention including PlySs2 and PlySs1, which sequences code for a polypeptide having the same amino acid sequence as provided in FIGURE 3 or 4 or in SEQ ID NO:1, 2 or 3, but which are degenerate thereto or are degenerate to the exemplary nucleic acids sequences provided in FIGURE 3 or 4 .
  • degenerate to is meant that a different three-letter codon is used to specify a particular amino acid. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid:
  • codons specified above are for RNA sequences.
  • the corresponding codons for DNA have a T substituted for U.
  • DNA mutagenesis techniques described here and known in the art can produce a wide variety of DNA molecules that code for a bacteriophage lysin of Streptococcus suis yet that maintain the essential characteristics of the lytic polypeptides described and provided herein.
  • Newly derived proteins may also be selected in order to obtain variations on the characteristic of the lytic polypeptide(s), as will be more fully described below.
  • Such derivatives include those with variations in amino acid sequence including minor deletions, additions and substitutions.
  • the site for introducing an amino acid sequence variation may be predetermined, the mutation per se does not need to be predetermined.
  • random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity.
  • Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.
  • Amino acid substitutions are typically of single residues, or can be of one or more, one or a few, one, two, three, four, five, six or seven residues; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions may be in single form, but preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure ( EP 75,444A ).
  • Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions may be made so as to generate no significant effect on the protein characteristics or when it is desired to finely modulate the characteristics of the protein. Amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions are described above and will be recognized by one of skill in the art.
  • Substantial changes in function or immunological identity may be made by selecting substitutions that are less conservative, for example by selecting residues that differ more significantly in their effect on maintaining: (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation; (b) the charge or hydrophobicity of the molecule at the target site; or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in protein properties will be those in which: (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.
  • a hydrophilic residue e.
  • the effects of these amino acid substitutions or deletions or additions may be assessed for derivatives or variants of the lytic polypeptide(s) by analyzing the ability of the derivative or variant proteins to lyse or kill susceptible bacteria, or to complement the sensitivity to DNA cross-linking agents exhibited by phages in infected bacteria hosts. These assays may be performed by transfecting DNA molecules encoding the derivative or variant proteins into the bacteria as described above or by incubating bacteria with expressed proteins from hosts transfected with the DNA molecules encoding the derivative or variant proteins.
  • the mutation per se does not need to be predetermined.
  • random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity.
  • Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.
  • DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
  • operative linking of a DNA sequence of this invention to an expression control sequence includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E. coli plasmids colE1, pCR1, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g., the numerous derivatives of phage ⁇ , e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • E. coli plasmids colE1, pCR1, pBR322, pMB9 and their derivatives,
  • useful expression control sequences include, for example, the early or late promoters of SV40, CMV, vaccinia, polyoma or adenovirus, the lac system, the trp system, the TAC system, the TRC system, the LTR system, the major operator and promoter regions of phage ⁇ , the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., Pho5), the promoters of the yeast ⁇ -mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • a wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention.
  • These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas , Bacillus , Streptomyces , fungi such as yeasts, and animal cells, such as CHO, R1.1, B-W and L-M cells, African Green Monkey kidney cells (e.g., COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue culture.
  • Libraries of fragments of the coding sequence of a polypeptide can be used to generate a variegated population of polypeptides for screening and subsequent selection of variants.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal and internal fragments of various sizes of the protein of interest.
  • Therapeutic or pharmaceutical compositions comprising the lytic enzyme(s)/polypeptide(s) of the invention are provided in accordance with the invention, as well as related methods of use and methods of manufacture.
  • Therapeutic or pharmaceutical compositions may comprise one or more lytic polypeptide(s), and optionally include natural, truncated, chimeric or shuffled lytic enzymes, optionally combined with other components such as a carrier, vehicle, polypeptide, polynucleotide, holin protein(s), one or more antibiotics or suitable excipients, carriers or vehicles.
  • the invention provides therapeutic compositions or pharmaceutical compositions of the lysins of the invention, including PlySs2 and/or PlySs1 (particularly ⁇ PlySs1), for use in the killing, alleviation, decolonization, prophylaxis or treatment of gram-positive bacteria, including bacterial infections or related conditions.
  • the invention provides therapeutic compositions or pharmaceutical compositions of the lysins of the invention, including PlySs2 and/or PlySs1 (particularly ⁇ PlySs1), for use in treating, reducing or controlling contamination and/or infections by gram positive bacteria, particularly including Streptococcus suis , including in contamination or infection of or via an external surface such as skin.
  • compositions are thereby contemplated and provided for topical or dermatological applications and general administration to the exterior, including the skin or other external surface.
  • Compositions comprising PlySs2 or PlySs1 lysin, including truncations or variants thereof, are provided herein for use in the killing, alleviation, decolonization, prophylaxis or treatment of gram-positive bacteria, including bacterial infections or related conditions, particularly of Streptococcus , Staphylococcus , Enterococcus or Listeria, including Streptococcus pyogenes and antibiotic resistant Staphylococcus aureus.
  • the enzyme(s) or polypeptide(s) included in the therapeutic compositions may be one or more or any combination of unaltered phage associated lytic enzyme(s), truncated lytic polypeptides, variant lytic polypeptide(s), and chimeric and/or shuffled lytic enzymes. Additionally, different lytic polypeptide(s) genetically coded for by different phage for treatment of the same bacteria may be used. These lytic enzymes may also be any combination of "unaltered” lytic enzymes or polypeptides, truncated lytic polypeptide(s), variant lytic polypeptide(s), and chimeric and shuffled lytic enzymes.
  • the lytic enzyme(s)/polypeptide(s) in a therapeutic or pharmaceutical composition for gram-positive bacteria may be used alone or in combination with antibiotics or, if there are other invasive bacterial organisms to be treated, in combination with other phage associated lytic enzymes specific for other bacteria being targeted.
  • the lytic enzyme, truncated enzyme, variant enzyme, chimeric enzyme, and/or shuffled lytic enzyme may be used in conjunction with a holin protein. The amount of the holin protein may also be varied.
  • Various antibiotics may be optionally included in the therapeutic composition with the enzyme(s) or polypeptide(s) and with or without the presence of lysostaphin. More than one lytic enzyme or polypeptide may be included in the therapeutic composition.
  • the pharmaceutical composition can also include one or more altered lytic enzymes, including isozymes, analogs, or variants thereof, produced by chemical synthesis or DNA recombinant techniques.
  • altered lytic protein can be produced by amino acid substitution, deletion, truncation, chimerization, shuffling, or combinations thereof.
  • the pharmaceutical composition may contain a combination of one or more natural lytic protein and one or more truncated, variant, chimeric or shuffled lytic protein.
  • the pharmaceutical composition may also contain a peptide or a peptide fragment of at least one lytic protein derived from the same or different bacteria species, with an optional addition of one or more complementary agent, and a pharmaceutically acceptable carrier or diluent.
  • the present invention provides to bacterial lysins comprising a PlySs lysin polypeptide variant having bacterial killing activity.
  • the invention describes PlySs lysin truncation mutants that contain only one catalytic or enzymatic domain and retains gram positive antibacterial activity.
  • the invention describes, for example, exemplary PlySs lysin truncation mutant that contain only one domain selected from the predicted alanine-amidase domain and the predicted glucosaminidase domain.
  • the C terminal glucosaminidase domain is deleted, so that the truncated lysin comprises and contains an N-terminal enzymatic domain and a cell-wall binding domain.
  • the ⁇ PlySS1 truncation has the N-terminal 254 amino acids, whereas the full length PlySs1 lysin has 452 amino acids.
  • the invention provides S suis lysin mutants, particularly PlySs1 lysin mutants which are truncated mutants containing only one catalytic domain and which retain killing activity against S.
  • a composition comprising a PlySs mutant lysin, including a PlySS1 mutant lysin, having equal or greater killing activity against Streptococcus cells, including Streptococcus suis compared with the full length PlySs lysin protein, including the full length PlySs1 lysin protein, the PlySs mutant lysin having a polypeptide variant of the amino acid sequence of SEQ ID NO:1 with a modification selected from the group consisting of: a) the PlySs mutant is a truncated mutant lysin containing only one catalytic domain selected from the group consisting of an endopeptidase domain and a glucosaminidase domain; b) the PlySs mutant is a truncated mutant lysin without a C-termin
  • the therapeutic composition may also comprise a holin protein.
  • Holin proteins are proteins which produce holes in the cell membrane. Holin proteins may form lethal membrane lesions that terminate cellular respiration in a bacteria. Like the lytic proteins, holin proteins are coded for and carried by a phage. In fact, it is quite common for the genetic code of the holin protein to be next to or even within the code for the phage lytic protein. Most holin protein sequences are short, and overall, hydrophobic in nature, with a highly hydrophilic carboxy-terminal domain. In many cases, the putative holin protein is encoded on a different reading frame within the enzymatically active domain of the phage.
  • holin protein is encoded on the DNA next or close to the DNA coding for the cell wall lytic protein.
  • Holin proteins are frequently synthesized during the late stage of phage infection and found in the cytoplasmic membrane where they cause membrane lesions.
  • Holins can be grouped into two general classes based on primary structure analysis. Class I holins are usually 95 residues or longer and may have three potential transmembrane domains. Class II holins are usually smaller, at approximately 65-95 residues, with the distribution of charged and hydrophobic residues indicating two TM domains ( Young, et al. Trends in Microbiology v. 8, No. 4, March 2000 ).
  • the dual-component lysis system may not be universal. Although the presence of holins has been shown or suggested for several phages, no genes have yet been found encoding putative holins for all phages.
  • Holins have been shown to be present in several bacteria, including, for example, lactococcal bacteriophage Tuc2009, lactococcal NLC3, pneumococcal bacteriophage EJ-1, Lactobacillus gasseri bacteriophage Nadh, Staphylococcus aureus bacteriophage Twort, Listeria monocytogenes bacteriophages, pneumococcal phage Cp-1, Bacillus subtillis phage M29, Lactobacillus delbrueckki bacteriophage LL-H lysin, and bacteriophage N 11 of Staphyloccous aureus. ( Loessner, et al., Journal of Bacteriology, August 1999, p. 4452-4460 ).
  • holin proteins can be used in conjunction with the lytic enzymes to accelerate the speed and efficiency at which the bacteria are killed.
  • Holin proteins may also be in the form of chimeric and/or shuffled enzymes.
  • Holin proteins may also be used alone in the treatment of bacterial infections according to some embodiments.
  • the pharmaceutical composition can contain a complementary agent, including one or more antimicrobial agent and/or one or more conventional antibiotics.
  • the therapeutic agent may further include at least one complementary agent which can also potentiate the bactericidal activity of the lytic enzyme.
  • Antimicrobials act largely by interfering with the structure or function of a bacterial cell by inhibition of cell wall synthesis, inhibition of cell-membrane function and/or inhibition of metabolic functions, including protein and DNA synthesis.
  • Antibiotics can be subgrouped broadly into those affecting cell wall peptidoglycan biosynthesis and those affecting DNA or protein synthesis in gram positive bacteria.
  • Cell wall synthesis inhibitors including penicillin and antibiotics like it, disrupt the rigid outer cell wall so that the relatively unsupported cell swells and eventually ruptures.
  • Antibiotics affecting cell wall peptidoglycan biosynthesis include: Glycopeptides, which inhibit peptidoglycan synthesis by preventing the incorporation of N-acetylmuramic acid (NAM) and N-acetylglucosamine (NAG) peptide subunits into the peptidoglycan matrix.
  • Available glycopeptides include vancomycin and teicoplanin.
  • Penicillins which act by inhibiting the formation of peptidoglycan cross-links.
  • penicillins the ⁇ -lactam moiety
  • DD-transpeptidase that links the peptidoglycan molecules in bacteria.
  • Hydrolytic enzymes continue to break down the cell wall, causing cytolysis or death due to osmotic pressure.
  • Common penicillins include oxacillin, ampicillin and cloxacillin; and Polypeptides, which interfere with the dephosphorylation of the C 55 -isoprenyl pyrophosphate, a molecule that carries peptidoglycan building-blocks outside of the plasma membrane.
  • a cell wall-impacting polypeptide is bacitracin.
  • the complementary agent may be an antibiotic, such as erythromycin, clarithromycin, azithromycin, roxithromycin, other members of the macrolide family, penicilins, cephalosporins, and any combinations thereof in amounts which are effective to synergistically enhance the therapeutic effect of the lytic enzyme.
  • an antibiotic such as erythromycin, clarithromycin, azithromycin, roxithromycin, other members of the macrolide family, penicilins, cephalosporins, and any combinations thereof in amounts which are effective to synergistically enhance the therapeutic effect of the lytic enzyme.
  • Virtually any other antibiotic may be used with the altered and/or unaltered lytic enzyme.
  • other lytic enzymes may be included in the carrier to treat other bacterial infections.
  • Antibiotic supplements may be used in virtually all uses of the enzyme when treating different diseases.
  • the pharmaceutical composition can also contain a peptide or a peptide fragment of at least one lytic protein, one holin protein, or at least one holin and one lytic protein, which lytic and holin proteins are each derived from the same or different bacteria species, with an optional addition of a complementary agents, and a suitable carrier or diluent.
  • compositions containing nucleic acid molecules that, either alone or in combination with other nucleic acid molecules, are capable of expressing an effective amount of a lytic polypeptide(s) or a peptide fragment of a lytic polypeptide(s) in vivo.
  • Cell cultures containing these nucleic acid molecules, polynucleotides, and vectors carrying and expressing these molecules in vitro or in vivo are also provided.
  • Therapeutic or pharmaceutical compositions may comprise lytic polypeptide(s) combined with a variety of carriers to treat the illnesses caused by the susceptible gram-positive bacteria.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine; amino acids such as glutamic acid, aspartic acid, histidine, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, trehalose, or dex
  • Glycerin or glycerol (1,2,3-propanetriol) is commercially available for pharmaceutical use. It may be diluted in sterile water for injection, or sodium chloride injection, or other pharmaceutically acceptable aqueous injection fluid, and used in concentrations of 0.1 to 100% (v/v), preferably 1.0 to 50% more preferably about 20%.
  • DMSO is an aprotic solvent with a remarkable ability to enhance penetration of many locally applied drugs. DMSO may be diluted in sterile water for injection, or sodium chloride injection, or other pharmaceutically acceptable aqueous injection fluid, and used in concentrations of 0.1 to 100% (v/v).
  • the carrier vehicle may also include Ringer's solution, a buffered solution, and dextrose solution, particularly when an intravenous solution is prepared.
  • any of the carriers for the lytic polypeptide(s) may be manufactured by conventional means. However, it is preferred that any mouthwash or similar type products not contain alcohol to prevent denaturing of the polyeptide/enzyme. Similarly, when the lytic polypeptide(s) is being placed in a cough drop, gum, candy or lozenge during the manufacturing process, such placement should be made prior to the hardening of the lozenge or candy but after the cough drop or candy has cooled somewhat, to avoid heat denaturation of the enzyme.
  • a lytic polypeptide(s) may be added to these substances in a liquid form or in a lyophilized state, whereupon it will be solubilized when it meets body fluids such as saliva.
  • the polypeptide(s)/enzyme may also be in a micelle or liposome.
  • the effective dosage rates or amounts of an altered or unaltered lytic enzyme/ polypeptide(s) to treat the infection will depend in part on whether the lytic enzyme/ polypeptide(s) will be used therapeutically or prophylactically, the duration of exposure of the recipient to the infectious bacteria, the size and weight of the individual, etc.
  • the duration for use of the composition containing the enzyme/ polypeptide(s) also depends on whether the use is for prophylactic purposes, wherein the use may be hourly, daily or weekly, for a short time period, or whether the use will be for therapeutic purposes wherein a more intensive regimen of the use of the composition may be needed, such that usage may last for hours, days or weeks, and/or on a daily basis, or at timed intervals during the day.
  • any dosage form employed should provide for a minimum number of units for a minimum amount of time.
  • concentration of the active units of enzyme believed to provide for an effective amount or dosage of enzyme may be in the range of about 100 units/ml to about 500,000 units/ml of fluid in the wet or damp environment of the nasal and oral passages, and possibly in the range of about 100 units/ml to about 50,000 units/ml. More specifically, time exposure to the active enzyme/ polypeptide(s) units may influence the desired concentration of active enzyme units per ml.
  • Carriers that are classified as "long” or “slow” release carriers could possess or provide a lower concentration of active (enzyme) units per ml, but over a longer period of time, whereas a "short” or “fast” release carrier (such as, for example, a gargle) could possess or provide a high concentration of active (enzyme) units per ml, but over a shorter period of time.
  • the amount of active units per ml and the duration of time of exposure depend on the nature of infection, whether treatment is to be prophylactic or therapeutic, and other variables. There are situations where it may be necessary to have a much higher unit/ml dosage or a lower unit/ml dosage.
  • the lytic enzyme/polypeptide(s) should be in an environment having a pH which allows for activity of the lytic enzyme/polypeptide(s). For example if a human individual has been exposed to another human with a bacterial upper respiratory disorder, the lytic enzyme/polypeptide(s) will reside in the mucosal lining and prevent any colonization of the infecting bacteria. Prior to, or at the time the altered lytic enzyme is put in the carrier system or oral delivery mode, it is preferred that the enzyme be in a stabilizing buffer environment for maintaining a pH range between about 4.0 and about 9.0, more preferably between about 5.5 and about 7.5.
  • a stabilizing buffer may allow for the optimum activity of the lysin enzyme/ polypeptide(s).
  • the buffer may contain a reducing reagent, such as dithiothreitol.
  • the stabilizing buffer may also be or include a metal chelating reagent, such as ethylenediaminetetracetic acid disodium salt, or it may also contain a phosphate or citrate-phosphate buffer, or any other buffer.
  • the DNA coding of these phages and other phages may be altered to allow a recombinant enzyme to attack one cell wall at more than two locations, to allow the recombinant enzyme to cleave the cell wall of more than one species of bacteria, to allow the recombinant enzyme to attack other bacteria, or any combinations thereof.
  • the type and number of alterations to a recombinant bacteriophage produced enzyme are incalculable.
  • a mild surfactant can be included in a therapeutic or pharmaceutical composition in an amount effective to potentiate the therapeutic effect of the lytic enzyme/ polypeptide(s) may be used in a composition.
  • Suitable mild surfactants include, inter alia, esters of polyoxyethylene sorbitan and fatty acids (Tween series), octylphenoxy polyethoxy ethanol (Triton-X series), n-Octyl-.beta.-D-glucopyranoside, n-Octyl-.beta.-D-thioglucopyranoside, n-Decyl-.beta.-D-glucopyranoside, n-Dodecyl-.beta.-D-glucopyranoside, and biologically occurring surfactants, e.g., fatty acids, glycerides, monoglycerides, deoxycholate and esters of deoxycholate.
  • Preservatives may also be used in this invention and preferably comprise about 0.05% to 0.5% by weight of the total composition.
  • the use of preservatives assures that if the product is microbially contaminated, the formulation will prevent or diminish microorganism growth.
  • Some preservatives useful in this invention include methylparaben, propylparaben, butylparaben, chloroxylenol, sodium benzoate, DMDM Hydantoin, 3-Iodo-2-Propylbutyl carbamate, potassium sorbate, chlorhexidine digluconate, or a combination thereof.
  • Pharmaceuticals for use in all embodiments of the invention include antimicrobial agents, anti-inflammatory agents, antiviral agents, local anesthetic agents, corticosteroids, destructive therapy agents, antifungals, and antiandrogens.
  • active pharmaceuticals that may be used include antimicrobial agents, especially those having anti-inflammatory properties such as dapsone, erythromycin, minocycline, tetracycline, clindamycin, and other antimicrobials.
  • the preferred weight percentages for the antimicrobials are 0.5% to 10%.
  • Local anesthetics include tetracaine, tetracaine hydrochloride, lidocaine, lidocaine hydrochloride, dyclonine, dyclonine hydrochloride, dimethisoquin hydrochloride, dibucaine, dibucaine hydrochloride, butambenpicrate, and pramoxine hydrochloride.
  • a preferred concentration for local anesthetics is about 0.025% to 5% by weight of the total composition.
  • Anesthetics such as benzocaine may also be used at a preferred concentration of about 2% to 25% by weight.
  • Corticosteroids that may be used include betamethasone dipropionate, fluocinolone actinide, betamethasone valerate, triamcinolone actinide, clobetasol propionate, desoximetasone, diflorasone diacetate, amcinonide, flurandrenolide, hydrocortisone valerate, hydrocortisone butyrate, and desonide are recommended at concentrations of about 0.01% to 1.0% by weight.
  • Preferred concentrations for corticosteroids such as hydrocortisone or methylprednisolone acetate are from about 0.2% to about 5.0% by weight.
  • the therapeutic composition may further comprise other enzymes, such as the enzyme lysostaphin for the treatment of any Staphylococcus aureus bacteria present along with the susceptible gram-positive bacteria.
  • Mucolytic peptides such as lysostaphin
  • Lysostaphin a gene product of Staphylococcus simulans , exerts a bacteriostatic and bactericidal effect upon S. aureus by enzymatically degrading the polyglycine crosslinks of the cell wall ( Browder et al., Res.
  • U.S. Pat. No. 3,278,378 describes fermentation methods for producing lysostaphin from culture media of S. staphylolyticus, later renamed S. simulans. Other methods for producing lysostaphin are further described in U.S. Pat. Nos. 3,398,056 and 3,594,284 . The gene for lysostaphin has subsequently been cloned and sequenced ( Recsei et al., Proc. Natl. Acad. Sci. USA, 84: 1127-1131 (1987 )).
  • the recombinant mucolytic bactericidal protein such as r-lysostaphin
  • r-lysostaphin can potentially circumvent problems associated with current antibiotic therapy because of its targeted specificity, low toxicity and possible reduction of biologically active residues.
  • lysostaphin is also active against non-dividing cells, while most antibiotics require actively dividing cells to mediate their effects ( Dixon et al., Yale J. Biology and Medicine, 41: 62-68 (1968 )).
  • Lysostaphin in combination with the altered lytic enzyme, can be used in the presence or absence of antibiotics. There is a degree of added importance in using both lysostaphin and the lysin enzyme in the same therapeutic agent.
  • a therapeutic composition may also include mutanolysin, and lysozyme.
  • Means of application of the therapeutic composition comprising a lytic enzyme/polypeptide(s) include, but are not limited to direct, indirect, carrier and special means or any combination of means.
  • Direct application of the lytic enzyme/ polypeptide(s) may be by any suitable means to directly bring the polypeptide in contact with the site of infection or bacterial colonization, such as to the nasal area (for example nasal sprays), dermal or skin applications (for example topical ointments or formulations), suppositories, tampon applications, etc.
  • Nasal applications include for instance nasal sprays, nasal drops, nasal ointments, nasal washes, nasal injections, nasal packings, bronchial sprays and inhalers, or indirectly through use of throat lozenges, mouthwashes or gargles, or through the use of ointments applied to the nasal nares, or the face or any combination of these and similar methods of application.
  • the forms in which the lytic enzyme may be administered include but are not limited to lozenges, troches, candies, injectants, chewing gums, tablets, powders, sprays, liquids, ointments, and aerosols.
  • the enzyme When the natural and/or altered lytic enzyme(s)/ polypeptide(s) is introduced directly by use of sprays, drops, ointments, washes, injections, packing and inhalers, the enzyme is preferably in a liquid or gel environment, with the liquid acting as the carrier.
  • a dry anhydrous version of the altered enzyme may be administered by the inhaler and bronchial spray, although a liquid form of delivery is preferred.
  • compositions for treating topical infections or contaminations comprise an effective amount of at least one lytic enzyme, including PlySs1 and/or PlySs2, according to the invention and a carrier for delivering at least one lytic enzyme to the infected or contaminated skin, coat, or external surface of a companion animal or livestock.
  • the mode of application for the lytic enzyme includes a number of different types and combinations of carriers which include, but are not limited to an aqueous liquid, an alcohol base liquid, a water soluble gel, a lotion, an ointment, a nonaqueous liquid base, a mineral oil base, a blend of mineral oil and petrolatum, lanolin, liposomes, protein carriers such as serum albumin or gelatin, powdered cellulose carmel, and combinations thereof.
  • a mode of delivery of the carrier containing the therapeutic agent includes, but is not limited to a smear, spray, a time-release patch, a liquid absorbed wipe, and combinations thereof.
  • the lytic enzyme may be applied to a bandage either directly or in one of the other carriers.
  • the bandages may be sold damp or dry, wherein the enzyme is in a lyophilized form on the bandage. This method of application is most effective for the treatment of infected skin.
  • the carriers of topical compositions may comprise semi-solid and gel-like vehicles that include a polymer thickener, water, preservatives, active surfactants or emulsifiers, antioxidants, sun screens, and a solvent or mixed solvent system.
  • U.S. Pat. No. 5,863,560 discusses a number of different carrier combinations which can aid in the exposure of the skin to a medicament.
  • Polymer thickeners that may be used include those known to one skilled in the art, such as hydrophilic and hydroalcoholic gelling agents frequently used in the cosmetic and pharmaceutical industries.
  • CARBOPOL R TM is one of numerous cross-linked acrylic acid polymers that are given the general adopted name carbomer. These polymers dissolve in water and form a clear or slightly hazy gel upon neutralization with a caustic material such as sodium hydroxide, potassium hydroxide, triethanolamine, or other amine bases.
  • KLUCEL R TM is a cellulose polymer that is dispersed in water and forms a uniform gel upon complete hydration.
  • Other preferred gelling polymers include hydroxyethylcellulose, cellulose gum, MVE/MA decadiene crosspolymer, PVM/MA copolymer, or a combination thereof.
  • a composition comprising a lytic enzyme/ polypeptide(s) can be administered in the form of a candy, chewing gum, lozenge, troche, tablet, a powder, an aerosol, a liquid, a liquid spray, or toothpaste for the prevention or treatment of bacterial infections associated with upper respiratory tract illnesses.
  • the lozenge, tablet, or gum into which the lytic enzyme/polypeptide(s) is added may contain sugar, corn syrup, a variety of dyes, non-sugar sweeteners, flavorings, any binders, or combinations thereof.
  • any gum-based products may contain acacia, carnauba wax, citric acid, cornstarch, food colorings, flavorings, non-sugar sweeteners, gelatin, glucose, glycerin, gum base, shellac, sodium saccharin, sugar, water, white wax, cellulose, other binders, and combinations thereof.
  • Lozenges may further contain sucrose, cornstarch, acacia, gum tragacanth, anethole, linseed, oleoresin, mineral oil, and cellulose, other binders, and combinations thereof.
  • Sugar substitutes can also be used in place of dextrose, sucrose, or other sugars.
  • compositions comprising lytic enzymes, or their peptide fragments can be directed to the mucosal lining, where, in residence, they kill colonizing disease bacteria.
  • the mucosal lining includes, for example, the upper and lower respiratory tract, eye, buccal cavity, nose, rectum, vagina, periodontal pocket, intestines and colon. Due to natural eliminating or cleansing mechanisms of mucosal tissues, conventional dosage forms are not retained at the application site for any significant length of time.
  • the bioadhesive is a water swellable, but water insoluble fibrous, crosslinked, carboxy functional polymer containing (a) a plurality of repeating units of which at least about 80 percent contain at least one carboxyl functionality, and (b) about 0.05 to about 1.5 percent crosslinking agent substantially free from polyalkenyl polyether.
  • the polymers of Robinson are water swellable but insoluble, they are crosslinked, not thermoplastic, and are not as easy to formulate with active agents, and into the various dosage forms, as the copolymer systems of the present application. Micelles and multilamillar micelles may also be used to control the release of enzyme.
  • Orahesive.RTM. from E.R. Squibb & Co is an adhesive which is a combination of pectin, gelatin, and sodium carboxymethyl cellulose in a tacky hydrocarbon polymer, for adhering to the oral mucosa.
  • adhesive which is a combination of pectin, gelatin, and sodium carboxymethyl cellulose in a tacky hydrocarbon polymer, for adhering to the oral mucosa.
  • such physical mixtures of hydrophilic and hydrophobic components eventually fall apart.
  • the hydrophilic and hydrophobic domains in this application produce an insoluble copolymer.
  • U.S. Pat. No. 4,948,580 also incorporated by reference, describes a bioadhesive oral drug delivery system.
  • the composition includes a freeze-dried polymer mixture formed of the copolymer poly(methyl vinyl ether/maleic anhydride) and gelatin, dispersed in an ointment base, such as mineral oil containing dispersed polyethylene.
  • an ointment base such as mineral oil containing dispersed polyethylene.
  • U.S. Pat. No. 5,413,792 discloses paste-like preparations comprising (A) a paste-like base comprising a polyorganosiloxane and a water soluble polymeric material which are preferably present in a ratio by weight from 3:6 to 6:3, and (B) an active ingredient.
  • 5,554,380 claims a solid or semisolid bioadherent orally ingestible drug delivery system containing a water-in-oil system having at least two phases.
  • One phase comprises from about 25% to about 75% by volume of an internal hydrophilic phase and the other phase comprises from about 23% to about 75% by volume of an external hydrophobic phase, wherein the external hydrophobic phase is comprised of three components: (a) an emulsifier, (b) a glyceride ester, and (c) a wax material.
  • U.S. Pat. No. 5,942,243 describes some representative release materials useful for administering antibacterial agents, which are incorporated by reference.
  • Therapeutic or pharmaceutical compositions can also contain polymeric mucoadhesives including a graft copolymer comprising a hydrophilic main chain and hydrophobic graft chains for controlled release of biologically active agents.
  • the graft copolymer is a reaction product of (1) a polystyrene macromonomer having an ethylenically unsaturated functional group, and (2) at least one hydrophilic acidic monomer having an ethylenically unsaturated functional group.
  • the graft chains consist essentially of polystyrene, and the main polymer chain of hydrophilic monomeric moieties, some of which have acidic functionality.
  • the weight percent of the polystyrene macromonomer in the graft copolymer is between about 1 and about 20% and the weight percent of the total hydrophilic monomer in the graft copolymer is between 80 and 99%, and wherein at least 10% of said total hydrophilic monomer is acidic, said graft copolymer when fully hydrated having an equilibrium water content of at least 90%.
  • Compositions containing the copolymers gradually hydrate by sorption of tissue fluids at the application site to yield a very soft jelly like mass exhibiting adhesion to the mucosal surface. During the period of time the composition is adhering to the mucosal surface, it provides sustained release of the pharmacologically active agent, which is absorbed by the mucosal tissue.
  • compositions of this application may optionally contain other polymeric materials, such as poly(acrylic acid), poly,-(vinyl pyrrolidone), and sodium carboxymethyl cellulose plasticizers, and other pharmaceutically acceptable excipients in amounts that do not cause deleterious effect upon mucoadhesivity of the composition.
  • polymeric materials such as poly(acrylic acid), poly,-(vinyl pyrrolidone), and sodium carboxymethyl cellulose plasticizers, and other pharmaceutically acceptable excipients in amounts that do not cause deleterious effect upon mucoadhesivity of the composition.
  • the dosage forms of the compositions of this invention can be prepared by conventional methods.
  • an isotonic formulation is preferably used.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • isotonic solutions such as phosphate buffered saline are preferred.
  • Stabilizers include gelatin and albumin.
  • a vasoconstriction agent can be added to the formulation.
  • the pharmaceutical preparations according to this application are provided sterile and pyrogen free.
  • a lytic enzyme/polypeptide(s) of the invention may also be administered by any pharmaceutically applicable or acceptable means including topically, orally or parenterally.
  • the lytic enzyme/polypeptide(s) can be administered intramuscularly, intrathecally, subdermally, subcutaneously, or intravenously to treat infections by gram-positive bacteria.
  • an isotonic formulation is preferably used.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • isotonic solutions such as phosphate buffered saline are preferred.
  • Stabilizers include gelatin and albumin.
  • a vasoconstriction agent can be added to the formulation.
  • the pharmaceutical preparations according to this application are provided sterile and pyrogen free.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • the exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, age, weight and gender of the patient; diet, desired duration of treatment, method of administration, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.
  • the effective dosage rates or amounts of the lytic enzyme/polypeptide(s) to be administered parenterally, and the duration of treatment will depend in part on the seriousness of the infection, the weight of the patient, particularly human, the duration of exposure of the recipient to the infectious bacteria, the number of square centimeters of skin or tissue which are infected, the depth of the infection, the seriousness of the infection, and a variety of a number of other variables.
  • the composition may be applied anywhere from once to several times a day, and may be applied for a short or long term period. The usage may last for days or weeks. Any dosage form employed should provide for a minimum number of units for a minimum amount of time.
  • the concentration of the active units of enzymes believed to provide for an effective amount or dosage of enzymes may be selected as appropriate.
  • the amount of active units per ml and the duration of time of exposure depend on the nature of infection, and the amount of contact the carrier allows the lytic enzyme(s)/polypeptide(s) to have.
  • the bacterial killing capability, and indeed the significantly broad range of bacterial killing, exhibited by the lysin polypeptide(s) of the invention provides for various methods based on the antibacterial effectiveness of the polypeptide(s) of the invention.
  • the present invention contemplates antibacterial methods, including methods for killing of gram-positive bacteria, for reducing a population of gram-positive bacteria, for treating or alleviating a bacterial infection, for treating a human subject exposed to a pathogenic bacteria, and for treating a human subject at risk for such exposure.
  • the susceptible bacteria are demonstrated herein to include the bacteria from which the phage enzyme(s) of the invention are originally derived, Streptococcus suis, as well as various other Streptococcal, Staphylococcal, Enterococcal and Listeria bacterial strains.
  • Methods of treating various conditions are also provided, including methods of prophylactic treatment of Streptococcal , Staphylococcal, Enterococcal or Listeria infections, treatment of Streptococcal , Staphylococcal , Enterococcal or Listeria infections, reducing Streptococcal, Staphylococcal, Enterococcal or Listeria population or carriage, treating lower respiratory infection, treating ear infection, treating ottis media, treating endocarditis, and treating or preventing other local or systemic infections or conditions.
  • the lysin(s) of the present invention demonstrate remarkable capability to kill and effectiveness against bacteria from various species such as multiple Streptococcal or Staphylococcal species, bacteria across distinct species groups such as bacteria from each of Streptococcal, Staphylococcal, Enterococcal and/or Listeria, and bacterial from distinct orders.
  • the bacterial taxonomic class of Bacilli includes two orders, Bacillales and Lactobacillales.
  • the Bacillales order includes Staphylococcus, Listeria and also Bacillus.
  • the Lactobacillales order includes Streptococcus, Enterococcus, Lactobacillus and Lactococcus.
  • the lysin(s) of the present invention demonstrate anti-bacterial activity and the capability to kill bacteria from distinct orders of bacteria, particularly from distinct orders of Bacilli bacteria.
  • the lysin(s) provided herein are capable of killing bacteria from order Bacillales and also from order Lactobacillales.
  • the PlySs2 lysin is demonstrated herein to kill bacteria from two distinct orders, particularly Bacillales and Lactobacillales, in vitro and in vivo.
  • Lysin of the present invention is capable of killing Bacillales and Lactobacillales bacteria in mixed culture and in mixed infections in vivo.
  • the invention thus contemplates treatment, decolonization, and/or decontamination of bacteria, cultures or infections or in instances wherein more than one gram positive bacteria is suspected or present.
  • the invention contemplates treatment, decolonization, and/or decontamination of bacteria, cultures or infections or in instances wherein more than one type of Bacilalles bacteria, more than one type of Lactobacillales bacteria, or at least one type of Bacillales and one type of Lactobacillales bacteria is suspected, present, or may be present.
  • This invention may also be used to treat septicemia, particularly in a human.
  • a septicemic infection such as for pneumoniae, or bacterial meningitis
  • concentration of the enzymes for the treatment of septicemia is dependent upon the bacterial count in the blood and the blood volume.
  • a method for treating Streptococcal, Staphylococcal, Enterococcal or Listeria infection, carriage or populations comprises treating the infection with a therapeutic agent comprising an effective amount of at least one lytic enzyme(s)/polypeptide(s) of the invention, particularly PlySs2 and/or PlySs1, particularly PlySs2. More specifically, lytic enzyme/polypeptide capable of lysing the cell wall of Streptococcal, Staphylococcal, Enterococcal or Listeria bacterial strains is produced from genetic material from a bacteriophage specific for Streptococcus suis.
  • the lysin polypeptide(s) of the present invention are useful and capable in prophylactic and treatment methods directed against gram-positive bacteria, particularly Streptococcal , Staphylococcal , Enterococcal or Listeria infections or bacterial colonization.
  • Bacterial strains susceptible and relevant as targets in the methods of the invention include and may be selected from Staphylococcus aureus , Listeria monocytogenes , Staphylococcus simulans, Streptococcus suis , Staphylococcus epidermidis , Streptococcus equi, Streptococcus equi zoo, Streptococcus agalactiae (GBS), Streptococcus pyogenes (GAS), Streptococcus sanguinis, Streptococcus gordonii, Streptococcus dysgalactiae, Group G Streptococcus, Group E Streptococcus, Enterococcus faecalis and Streptococcus pneumonia.
  • the invention includes methods of treating or alleviating Streptococcal, including S. pyogenes, and/or Staphylococcal, including S. aureus, related infections or conditions, including antibiotic-resistant Staphylococcus aureus, particularly including MRSA, wherein the bacteria or a human subject infected by or exposed to the particular bacteria, or suspected of being exposed or at risk, is contacted with or administered an amount of isolated lysin polypeptide(s) of the invention effective to kill the particular bacteria.
  • Streptococcal including S. pyogenes
  • Staphylococcal including S. aureus
  • related infections or conditions including antibiotic-resistant Staphylococcus aureus, particularly including MRSA
  • PlySs2 and/or PlySs1 including truncations or variants thereof, including such polypeptides as provided herein in FIGURE 3 and 4 and in SEQ ID NOS: 1, 2 or 3, is contacted or administered so as to be effective to kill the relevant bacteria or otherwise alleviate or treat the bacterial infection.
  • agent means any molecule, including polypeptides, antibodies, polynucleotides, chemical compounds and small molecules.
  • agent includes compounds such as test compounds, added additional compound(s), or lysin enzyme compounds.
  • 'agonist' refers to a ligand that stimulates the receptor the ligand binds to in the broadest sense.
  • a 'assay' means any process used to measure a specific property of a compound.
  • a 'screening assay' means a process used to characterize or select compounds based upon their activity from a collection of compounds.
  • the term 'preventing' or 'prevention' refers to a reduction in risk of acquiring or developing a disease or disorder (i.e., causing at least one of the clinical symptoms of the disease not to develop) in a subject that may be exposed to a disease-causing agent, or predisposed to the disease in advance of disease onset.
  • 'prophylaxis' is related to and encompassed in the term 'prevention', and refers to a measure or procedure the purpose of which is to prevent, rather than to treat or cure a disease.
  • prophylactic measures may include the administration of vaccines; the administration of low molecular weight heparin to hospital patients at risk for thrombosis due, for example, to immobilization; and the administration of an anti-malarial agent such as chloroquine, in advance of a visit to a geographical region where malaria is endemic or the risk of contracting malaria is high.
  • 'Therapeutically effective amount means that amount of a drug, compound, antimicrobial, antibody, polypeptide, or pharmaceutical agent that will elicit the biological or medical response of a subject that is being sought by a medical doctor or other clinician.
  • the term "effective amount" is intended to include an effective amount of a compound or agent that will bring about a biologically meaningful decrease in the amount of or extent of infection of gram-positive bacteria, including having a bacteriocidal and/or bacteriostatic effect.
  • terapéuticaally effective amount is used herein to mean an amount sufficient to prevent, and preferably reduce by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in the growth or amount of infectious bacteria, or other feature of pathology such as for example, elevated fever or white cell count as may attend its presence and activity.
  • 'treating' or 'treatment' of any disease or infection refers, in one embodiment, to ameliorating the disease or infection (i.e., arresting the disease or growth of the infectious agent or bacteria or reducing the manifestation, extent or severity of at least one of the clinical symptoms thereof).
  • 'treating' or 'treatment' refers to ameliorating at least one physical parameter, which may not be discernible by the subject.
  • 'treating' or 'treatment' refers to modulating the disease or infection, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
  • 'treating' or 'treatment' relates to slowing the progression of a disease or reducing an infection.
  • phrases “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • Gram-positive bacteria Gram-positive bacteria
  • Gram-positive bacteria Gram-positive bacteria which are known and/or can be identified by the presence of certain cell wall and/or cell membrane characteristics and/or by staining with Gram stain.
  • Gram positive bacteria are known and can readily be identified and may be selected from but are not limited to the genera Listeria, Staphylococcus, Streptococcus, Enterococcus, Mycobacterium, Corynebacterium, and Clostridium, and include any and all recognized or unrecognized species or strains thereof.
  • the PlyS lysin sensitive gram-positive bacteria include bacteria selected from one or more of Listeria, Staphylococcus, Streptococcus, and Enterococcus.
  • Bacteriocidal refers to capable of killing bacterial cells.
  • bacteriostatic refers to capable of inhibiting bacterial growth, including inhibiting growing bacterial cells.
  • phrases “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • terapéuticaally effective amount is used herein to mean an amount sufficient to prevent, and preferably reduce by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant change in the S phase activity of a target cellular mass, or other feature of pathology such as for example, elevated blood pressure, fever or white cell count as may attend its presence and activity.
  • One method for treating systemic or tissue bacterial infections caused by Streptococcus or Staphylococcus bacteria comprises parenterally treating the infection with a therapeutic agent comprising an effective amount of one or more lysin polypeptide(s) of the invention, particularly PlySs2 and/or PlySs1, including truncations or variants thereof, including such polypeptides as provided herein in FIGURE 3 and 4 and in SEQ ID NOS: 1, 2 or 3and an appropriate carrier.
  • a number of other different methods may be used to introduce the lytic enzyme(s)/polypeptide(s). These methods include introducing the lytic enzyme(s)/polypeptide(s) intravenously, intramuscularly, subcutaneously, intrathecally, and subdermally.
  • One skilled in the art including medical personnel, will be capable of evaluating and recognizing the most appropriate mode or means of administration, given the nature and extent of the bacterial condition and the strain or type of bacteria involved or suspected. For instance, intrathecal use and administration of one or more lytic polypeptide(s) would be most beneficial for treatment of bacterial meningitis.
  • Infections may be also be treated by injecting into the infected tissue of the human patient a therapeutic agent comprising the appropriate lytic enzyme(s)/polypeptide(s) and a carrier for the enzyme.
  • the carrier may be comprised of distilled water, a saline solution, albumin, a serum, or any combinations thereof. More specifically, solutions for infusion or injection may be prepared in a conventional manner, e.g. with the addition of preservatives such as p-hydroxybenzoates or stabilizers such as alkali metal salts of ethylenediamine tetraacetic acid, which may then be transferred into fusion vessels, injection vials or ampules.
  • the compound for injection may be lyophilized either with or without the other ingredients and be solubilized in a buffered solution or distilled water, as appropriate, at the time of use.
  • Non-aqueous vehicles such as fixed oils, liposomes, and ethyl oleate are also useful herein.
  • Other phage associated lytic enzymes, along with a holin protein, may be included in the composition.
  • a lytic enzyme/polypeptide(s) such as PlySs2 and PlySS1 as exemplified herein, as a prophylactic treatment for eliminating or reducing the carriage of susceptible bacteria, preventing those humans who have been exposed to others who have the symptoms of an infection from getting sick, or as a therapeutic treatment for those who have already become ill from the infection.
  • the lytic enzyme(s)/polypeptide(s) can be used to treat, for example, lower respiratory tract illnesses, particularly by the use of bronchial sprays or intravenous administration of the enzyme.
  • a lytic enzyme can be used for the prophylactic and therapeutic treatment of eye infections, such as conjunctivitis.
  • the method of treatment comprises administering eye drops or an eye wash which comprise an effective amount of at least one lytic polypeptide(s) of the invention and a carrier capable of being safely applied to an eye, with the carrier containing the lytic enzymes.
  • the eye drops or eye wash are preferably in the form of an isotonic solution.
  • the pH of the solution should be adjusted so that there is no irritation of the eye, which in turn would lead to possible infection by other organisms, and possible to damage to the eye. While the pH range should be in the same range as for other lytic enzymes, the most optimal pH will be in the range as demonstrated and provided herein. Similarly, buffers of the sort described above for the other lytic enzymes should also be used.
  • antibiotics which are suitable for use in eye drops may be added to the composition containing the enzymes.
  • Bactericides and bacteriostatic compounds may also be added.
  • the concentration of the enzyme(s) in the solution can be in the range of from about 100 units/ml to about 500,000 units/ml, with a more preferred range of about 100 to about 5,000 units/mil, and about 100 to about 50,000 units/ml. Concentrations can be higher or lower than the ranges provided.
  • the lytic polypeptide(s) of the invention may also be used in a contact lens solution, for the soaking and cleaning of contact lenses.
  • This solution which is normally an isotonic solution, may contain, in addition to the enzyme, sodium chloride, mannitol and other sugar alcohols, borates, preservatives, and the like.
  • a lytic enzyme/polypeptide of the invention may also be administered to the ear of a patient.
  • a lytic polypeptide(s) of the invention may be used to treat ear infections, for example caused by Streptococcus pneumoniae.
  • Otitis media is an inflammation of the middle ear characterized by symptoms such as otalgia, hearing loss and fever.
  • One of the primary causes of these symptoms is a build up of fluid (effusion) in the middle ear.
  • Complications include permanent hearing loss, perforation of the tympanic membrane, acquired cholesteatoma, mastoiditis, and adhesive otitis.
  • Children who develop otitis media in the first years of life are at risk for recurrent acute or chronic disease.
  • One of the primary causes of otitis media is Streptococcus pneumoniae.
  • the lytic enzyme(s)/polypeptide(s) may be applied to an infected ear by delivering the enzyme(s) in an appropriate carrier to the canal of the ear.
  • the carrier may comprise sterile aqueous or oily solutions or suspensions.
  • the lytic enzyme(s) may be added to the carrier, which may also contain suitable preservatives, and preferably a surface-active agent.
  • Bactericidal and fungicidal agents preferably included in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%).
  • Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol. Additionally, any number of other eardrop carriers may be used.
  • the concentrations and preservatives used for the treatment of otitis media and other similar ear infections are the same as discussed for eye infections, and the carrier into which the enzyme goes is similar or identical to the carriers for treatment of eye infections.
  • the carrier may typically includes vitamins, minerals, carbohydrates, sugars, amino acids, proteinaceous materials, fatty acids, phospholipids, antioxidants, phenolic compounds, isotonic solutions, oil based solutions, oil based suspension
  • polypeptides of the invention may be used to eliminate, characterize, or identify the relevant and susceptible bacteria.
  • a diagnostic method of the present invention may comprise examining a cellular sample or medium for the purpose of determining whether it contains susceptible bacteria, or whether the bacteria in the sample or medium are susceptible by means of an assay including an effective amount of one or more lysin polypeptide(s) and a means for characterizing one or more cell in the sample, or for determining whether or not cell lysis has occurred or is occurring.
  • Patients capable of benefiting from this method include those suffering from an undetermined infection, a recognized bacterial infection, or suspected of being exposed to or carrying a particular bacteria.
  • a fluid, food, medical device, composition or other such sample which will come in contact with a subject or patient may be examined for susceptible bacteria or may be eliminated of relevant bacteria.
  • a fluid, food, medical device, composition or other such sample may be sterilized or otherwise treated to eliminate or remove any potential relevant bacteria by incubation with or exposure to one or more lytic polypeptide(s) of the invention.
  • the lytic polypeptide(s) of the invention complex(es) with or otherwise binds or associates with relevant or susceptible bacteria in a sample and one member of the complex is labeled with a detectable label.
  • a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels.
  • the labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others.A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.
  • the radioactive label can be detected by any of the currently available counting procedures.
  • the preferred isotope may be selected from 3 H, 14 C, 32 P, 35 S, 36 Cl, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, 125 I, 131 I, and 186 Re.
  • Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques.
  • the enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized.
  • the preferred are peroxidase, ⁇ -glucuronidase, ⁇ -D-glucosidase, ⁇ -D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase.
  • U.S. Patent Nos. 3,654,090 ; 3,850,752 ; and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
  • Streptococcus suis is a Gram-positive pathogen that infects pigs worldwide. Reports of zoonotic transmission from pigs to humans are increasing ( Sriskandan S. et al (2006) PLoS Medicine 3(5):585-567 ). S. suis may develop a consistent presence in human populations in years to come. Humans and pigs have been treated with penicillin or gentamicin, but S. suis isolates resistant to these antibiotics exist ( Cantin, M. et al (1992) J Vet Diagnostic Investig 4:170-174 ).
  • PlySs1 was isolated and cloned via a functional genomic screen using S. suis prophage genomic DNA and PlySs2 was identified by sequence analysis of the S. suis prophage genome sequence and then isolated and cloned.
  • the PlySs1 lysin was cloned through functional shotgun screening of the genome of S. suis 7711, a serotype 7 strain.
  • Microgram quantities of genomic DNA gDNA
  • Tsp509I Nockayne syndrome
  • Fragments 1.5 - 4 kb in length were isolated via agarose-gel electrophoresis and ligated into EcoRI-linearized pBAD24 plasmid.
  • This plasmid confers ampicillin resistance and allows for arabinose induction of the recombinant insert.
  • libraries were subject to a novel screening technique that relies upon the toxicity of adjacently-encoded holin proteins ( Schmitz J.E. et al (2010) Adv Environ Microbiol 76(21):7181-7187 ). Briefly, E. coli TOP10 transformants were plated onto LB-agar supplemented with ampicillin and sheep's blood. Following proliferation to macroscopic colonies, the plates were exposed to a mist of arabinose to induce recombinant transcription. Toxic clones were revealed by the development of a surrounding zone of hemolysis.
  • primers were designed for synthesizing a truncated constructed (hereafter referred to as PlySs1) with an inserted stop codon preceding the C-terminal glucosaminidase domain.
  • PlySs1 truncated constructed
  • the nucleic acid and amino acid sequences of the full length PlySs1 lysin and the amino acid sequence of a truncated enzyme are provided in FIGURE 3 .
  • S. suis lysins As described above, two S. suis lysins have been identified and cloned through a combination of functional recombinant screening and computational analysis of published S. suis genomes. These lysins have been cloned and named PlySs1 and PlySs2. Like other lysins, the S. suis lysins, particularly PlySs2, have an N-terminal catalytic domain and C-terminal cell-binding domain (SH-3 Type 5 binding domain in PlySs2) ( FIGURE 2 ). In fact, the natural structure of PlySs1 as cloned from S. suis strain 7711 contained an additional secondary catalytic domain downstream of the binding domain (an atypical lysin arrangement), however this domain was recombinantly eliminated (as described above) to conform to standard architecture.
  • the lysin-encoding gene PlySs2 was found within an integrated prophage genome along the sequenced genome of S. suis serotype 2 strain 89/1591 (NCBI Genome Project #12417, GenBank accession ZP_03625529) ( Lucas, S. et al, US DOE Joint Genome Institute, direct submission ). PlySs2 was PCR-cloned from genomic DNA from strain 89/1591 with the following primers: AATGCTAGCCTGATACACAGTTAGAGACC-fwd (SEQ ID NO:9) and CCTAAGCTTCTTTTCACAAATCATAATCCCCAG-rev (SEQ ID NO: 10).
  • the primers include restriction sites (NheI and HindIII) for cloning into pBAD24.
  • the forward primer corresponds to a position ⁇ 60 bp upstream of the gene starting point, because several in-frame ATG triplets are situated near one another at the 5'-end. This enables the native ribosomal binding site (instead of the engineered RBS of pBAD24) to guide transcription.
  • PlySs2 was cloned out of a prophage genome in S. suis into a pBAD24 vector (pBAD24_PlySs2, FIGURE 5 ) and transformed it into Escherichia coli Top 10 cells.
  • pBAD24 encodes ⁇ -lactamase, enables tight transcriptional control, and is induced by inexpensive arabinose.
  • the vector-transformed E. coli were grown on opaque plate containing Pseudomonas peptidoglycan halos suspended in soft agar ( Wang, Y et al (2009) Curr Microbiol 58(6):609-615 ). Clearing zones appeared around the E. coli colonies indicating expression of active PlySs2, which hydrolyzed the peptidoglycan within the soft agar.
  • the structure of PlySs2 is quite unlike that of LySMP.
  • N-terminal sequencing confirmed the start as "MTTVNEA".
  • E. coli containing the pBAD24_PlySs2 plasmid were grown at 37°C in 10 L of LB AMP100 and induced for overnight expression with 0.2% arabinose at an OD 600 ⁇ 0.8.
  • the cultures were spun at 10,722 rcf for 20 mins.
  • the pellets were resuspended in 100 mL of 15 mM Na 3 PO 4 , pH 7.4 and mixed with protease inhibitor cocktail tablets. This mixture was homogenized, and the homogenate was centrifuged at 1,723 rcf for 20 mins. The supernatant was ultra-centrifuged at 30,000 rpm for 1 hr. Enough 15 mM Na 3 PO 4 , pH 8.0 was added to the supernatant to bring the pH to 7.4.
  • the protein was run over an anionic HiTrap Fast Flow DEAE column (15mM Na 3 PO 4 (PB), pH 7.4) without PlySs2 binding ( FIGURE 6A ). Ammonium sulphate was added to the flow through to a 40% concentration. The precipitate was centrifuged and resuspended in 200 mL 15 mM Na 3 PO 4 , pH 6.7. The protein was dialyzed overnight in 15 mM Na 3 PO 4 , pH 6.7 with 20 ⁇ m tubing.
  • the dialysate was run over a cationic HiTrap Fast Flow CM column with PlySs2 eluting cleanly in the shoulder of the flow through as well as at 70 mM NaCl, 15 mM Na 3 PO 4 , pH 6.7 ( FIGURE 6B ). All fractions showing pure PlySs2 were pooled ( FIGURE 6C ). It is notable that there are three start codons in frame proceeding PlySs2 : " ATGATG CGTGGAAAGGAGAAGCCT ATG ACAACAGTAAATGAAGCATTA" (corresponding to: "MMRGKEKPMT TVNEAL."). A pure sample of the protein was submitted for protein sequencing to confirm c the start to be "MTTVNEAL".
  • the clone was grown in Power Broth + LB-Booster (Athena Enzyme System) to OD 600 ⁇ 1.0 and induced with 0.2% arabinose. The culture was shaken for 4 hr at 37°C (inclusion bodies would form at longer times). The expressing cells were pelleted, resuspended in 15 mM phosphate buffer pH 6.2, and lysed by three passages through an EmulsiFlex C-5 homogenizer. Residual debris was removed by centrifugation (1 hr, 35,000 X G), and ammonium sulfate was added at 225 g/L (40% saturation).
  • Power Broth + LB-Booster Aligna Enzyme System
  • the precipitated protein was pelleted and resolubilized in 15 mM phosphate pH 7.4, and dialyzed against this buffer overnight.
  • the dialysate was next passed through a DEAE anion-exchange column equilibrated against the same buffer (fast flow resin, General Electric).
  • the latter product was: dialyzed (into 5 mM PB, 15 mM NaCl); lyophilized; reconstituted (at 10% of the original volume); centrifuged; and filter-sterilized (to remove any insoluble material).
  • PlySs2 can be produced more efficiently, and at a higher concentration, than many published lysins ( Daniel A et al (2010) Antimicrob Agents Chemother 54(4):1602-1612 ; Wang, Y. et al (2009) Curr Microbiol 58(6):609-615 ; Nelson, D et al (2006) Proc Natl Acad Sci USA 103(28):10765-10770 ).
  • the S. suis lysins were further characterized and tested to determine biochemical conditions including optimal pH, optimal salinity, temperature stability, and the effect of EDTA.
  • the activity was determined by the degree of S. suis 7997 turbidity reduction (OD 600 ) following the addition of PlySs2 at 32 ⁇ g/ml. Briefly, a 5 mL brain heart infusion (BHI) S. suis 7997 overnight culture was inoculated into 45 mL BHI and grown at 37°C for 2 hours. The 50 mL culture was spun at 1,789 rcf for 10 min. A 50 mL culture of S. suis 7997 was centrifuged.
  • BHI brain heart infusion
  • the pellet was washed with 50 mL double-distilled H 2 O (ddH 2 O) for the pH test, or 25 mL 15 mM Na 3 PO 4 , pH 8.0 for the other tests and centrifuged again. The pellet was then resuspended in enough dd H 2 O or 15 mM Na 3 PO 4 , pH 8.0 to bring the final OD 600 to ⁇ 1.0 for each test condition. In all controls, PB replaced PlySs2. Spectrophotometric readings were taken of each sample at OD 600 every minute over an hour. The overall results for optimal pH, optimal salinity, temperature stability and effect of EDTA are depicted in FIGURE 7A-7D .
  • PlySs2 was shown to have acute activity up to a pH of 9.7.
  • BTP lysis was maximal at the highest pH, 9.7, but this is not a suitable buffer for living cells. Lysis also occurred in BTP, pH 7.0-8.0; at commensurate pH-values, however, the magnitude of the OD-drop was much more pronounced in citrate/phosphate (a more physiological buffer for the growth of test cultures).
  • To determine the optimal salt concentration in 195 ⁇ l of cells, 5 ⁇ l lysin were added to 50 ⁇ l of various NaCl concentrations ( FIGURE 7B ). PlySs2 had the greatest activity in 0 mM NaCl.
  • the cells are more susceptible to lysis within a more hypotonic solution. Salt did not enhance PlySs2-induced lysis. At constant enzyme concentrations, bacteriolysis decreased from 0 - 1000 mM NaCl. Therefore, 0 mM NaCl is optimal, because cells are more susceptible to lysis within a more hypotonic solution.
  • lysin To determine the temperature stability of lysin, it was incubated for 30 minutes at various temperatures, cooled and then added to 245 ⁇ l cells suspended in 15 mM Na 3 PO 4 , pH 8.0 ( FIGURE 7C ). Exposure of PlySs2 to an excess of DTT had no impact (either positive or negative) on activity (data not shown). Treatment with EDTA impeded PlySs2-induced lysis of S. suis. Lysin was added to cells suspended in 15 mM Na 3 PO 4 , pH 8.0 along with various concentrations of ethylenediaminetetraacetate (EDTA) to determine if it requires a cofactor. In controls, dd H 2 O replaced lysine (PlySs2) for all tests.
  • EDTA ethylenediaminetetraacetate
  • PlySs2 The stability of PlySs2 was tested when incubated at: different temperatures for 30 minutes; 37°C for hours; 4°C for days; and -80°C for months.
  • the activity of each aliquot (at 32 ⁇ g/ml) against S. suis 7997 was spectrophotometrically determined as outlined above.
  • PlySs2 was also tested after one to ten consecutive room temperature to -80°C freeze-thaws. When incubated at 22°C - 85°C for 30 min, PlySs2 activity was principally unaffected through a significant temperature range, including 55°C; at 60°C, PlySs2 activity was completely abolished.
  • PlySs2 After incubation at 37°C for 24 hours, PlySs2 retained full activity; but after a 48-hour 37°C incubation, PlySs2 showed diminished activity. There was no observable decrease in activity after 15 days of 4°C incubation. In addition, PlySs2 lasted over 7 months at -80°C without a reduction in activity. The lysin can endure 10 consecutive room temperature to -80°C freeze-thaws without any observable effect on its activity. The stability of purified PlySs2 lysin was determined upon maintenance at 37° C for up to 48 hours in buffer. Killing effectiveness was determined against S. suis strain 7997 periodically, as shown in FIGURE 9 .
  • the PlySs2 lysin is >90% stable up to 24 hours and maintains at least 50% activity after 48 hours Stability of the PlySS2 lysin was evaluated on freezer storage at -80°C.
  • the PlySs2 lysin retains essentially 100% activity on storage in buffer for up to at least 7 months at -80°C ( FIGURE 10 ).
  • PlySs2 was incubated with purified S. suis peptidoglycan stripped of lipotechoic acid and carbohydrates overnight at 37°C and the product submitted for mass spectroscopy. Data suggest that the cleavage is an N-acetylmuramoyl,-L-alanine amidase.
  • a prophage lytic enzyme was cloned from a functional genomic screen of S. suis strain 7711, a serotype 7 isolate originating from the Netherlands1.
  • the complete PlySs1 lysin gene encodes a 452-residue protein: Pfam analysis predicts a type 5 alanine-amidase domain (PF05832) at the N-terminus, followed by a double CPL-7 cell-wall binding domain (PF08230) in the central region, and a secondary glucosaminidase domain (PF01832) at the C-terminus.
  • PF05832 type 5 alanine-amidase domain
  • PF08230 double CPL-7 cell-wall binding domain
  • PF01832 secondary glucosaminidase domain
  • Gram-positive lysins typically consist of an N-terminal enzymatic domain and a C-terminal binding domain. While occasionally lysins are seen with two N-terminal lytic domains, it is rare for a second enzymatic functionally to be encoded after the binding domain.
  • lysins typically consist of an N-terminal enzymatic domain and a C-terminal binding domain. While occasionally lysins are seen with two N-terminal lytic domains, it is rare for a second enzymatic functionally to be encoded after the binding domain.
  • LambdaSa2 lysin of S. agalactiae Pritchard DG et al (2007) Appl Environ Microbiol 73(22):7150-7154 ).
  • FIGURE 14A When held at 35°C - 60°C for 30 min, lysin activity was virtually unaffected until 50°C, at which point it was completely abolished ( FIGURE 14A ). For the 6-hr incubation, a partial decrease in activity was observed at 45°C, while the 40°C sample was unaffected ( FIGURE14B ). The latter corresponds to typical porcine body temperature.
  • PlySs1 possesses gamma-endopeptidase activity, cleaving the peptidoglycan stem between D-Gln and L-Lys as characteristic of a ⁇ -D-glutaminyl-L-lysine endopeptidase.
  • a mass spectrum was taken of undigested cell wall, the above two peaks were absent.
  • FIGURE 15A This activity test was first determined for the pathogenic S. suis strain 7997 with various concentrations of PlySs2 ( FIGURE 15A ). Specific activity of purified PlySs2 lysin was also assessed in vitro against S. suis strain S735 ( FIGURE 15B ). This test was then performed using 32 ug/mL PlySs2 to determine PlySs2 activity against other species of bacteria (it was found that based on lytic assay this was a good concentration for killing studies in vitro against other organisms) ( FIGURE 16A through 16D ). Further strain killing results are shown in FIGURE 17A and 17B . Additional results are tabulated below in TABLE 1.
  • the PlySs2 lysin enzyme has broad activity killing not only against S. suis, but other pathogens particularly including S. aureus, S. pyogenes, Listeria and Group B streptococci.
  • MRSA methicillin resistant Staphylococcus aureus strains
  • PlySs2 is additionally and similarly effective against vancomycin intermediate sensitivity Staphylococcus aureus (VISA) and vancomycin resistant Staphylococcus aureus (VRSA) strains ( FIGURE 18 ).
  • This S. suis lysin is similar to previously identified and characterized lysins in its ability to kill pathogenic bacteria quickly. However, it is unusual and remarkable in its broad activity against major pathogens. It is also notable that the lysin can be produced and purified readily, as shown above, and is stable in various relevant temperatures, pH and salinity, making it an attractive candidate therapeutic enzyme.
  • CFU analysis was conducted on S. suis strains S735, 7997, and 7711 after 1 hr treatment (optimal buffering conditions). In each experiment, the percentage-decrease in CFUs was determined for the treated sample versus the untreated. The range of the values observed (across 3 independent experiments) is reported here for each strain. The serotype of each strain is indicated in parentheses.
  • ⁇ PlySs1 was further tested against a panel of 19 other S. suis strains of diverse serotypes, as well as other species of Gram-positive bacteria. The same lysin concentrations were used as above. For each dosage, the observed lysis values after 1 hr are listed in TABLE 3 and TABLE 4, and the information is summarized graphically in FIGURE 21 . TABLE 3 Analysis of Other S.
  • ⁇ PlySs1 were exposed (at optimal buffering conditions) to ⁇ PlySs1 at the above concentrations.
  • the majority of these bacteria are unnamed clinical isolates of the indicated serotype (e.g. ST1, ST2, etc).
  • the serotype is given in parentheses.
  • the 1-hour treated/untreated OD 600 - ratio is given for each ⁇ PlySs1 concentration (representing a single experiment), and the strains are listed in the order of decreasing sensitivity.
  • strain ST12 it was not possible to conduct OD analysis.
  • ⁇ PlySs1 all above concentrations
  • the cells would rapidly self-adhere and fall out of suspension. This phenomenon was not observed for untreated ST12-cells.
  • aureus RN4220 0.89 0.78 0.55 0.31 0.10 S. salivarius 9222 0.80 0.76 0.56 0.53 0.37
  • subtilis SL4 1.07 1.05 1.04 1.03 0.96
  • CFU's colony forming units
  • pyogenes 5005 strain were grown in the presence of PlySs2.
  • concentration of PlySs2 doubled daily from 1/32 nd of PlySs2's minimally inhibitory concentration (MIC) against each strain to 4 ⁇ its MIC over an 8-day period.
  • MIC minimally inhibitory concentration
  • bacterial cells at 5 ⁇ 10 8 CFU/ml were grown overnight in the presence of 1/32 ⁇ MIC PlySs2 in MHB at 37°C. These cells were centrifuged for 10 min at 900 rcf and divided into two aliquots.
  • the MICs were determined by detection of pellet formation in the bottom of rounded polysterene plate wells. Each day, 1.0 ⁇ L sample from each culture was spread on selective plates containing the MIC of the respective drug to which each culture was being exposed. The MIC of PlySs2 or mupirocin was tested for 4 colonies per culture every day by microdilution for each serial passage as described above ( Wiegard, I et al (2008) Nat Protoc 3(2):163-175 ) to determine if a resistant (defined as a 4-fold increase in MIC) clone had emerged. The procedure was repeated with mupirocin and each strain as a positive control.
  • PlySs2 lysin activity against S. aureus has been further evaluated in an MRSA mouse sepsis model.
  • susceptible mice FVB/NJ mice, weight range 15-20g
  • IP intraperitoneally
  • all of the mice are bacteremic with MRSA in their organs (including spleen, liver, kidney, and heart/blood).
  • 500 ⁇ L PlySs2 at 2 mg/mL was injected IP 3 hours after injecting MRSA.
  • the S. suis lysin was tested in an MRSA wound infection model in rats.
  • a 3 centimeter incision is created along the dorsal side of the rat.
  • a 1 cm long, 1 cm deep incision is cut into the spinotrapezius muscle.
  • 50 ⁇ L of MRSA at 1 ⁇ 10 8 CFU's/mL 5 ⁇ 10 6 CFU's total
  • the test rats are treated with 500 ⁇ L of PlySs2 at 10 mg/mL.
  • the wound is stapled shut and 100 ⁇ L of PlySs2 added at 10 mg/mL to the outside of the wound.
  • Carriage of both MSSA and MRSA in the human anterior nares is the major reservoir for S . aureus infection.
  • assessment of nasal colonization is being instituted on admission to critical care settings in hospitals in the U.S. Elimination of nasal carriage in the community or in the hospital setting thus could possibly reduce the risk of infection and slow the spread of drug resistant S. aureus.
  • S. aureus To study the ability of S.
  • mice C57BL/6J mice are intranasally inoculated with -2 ⁇ 10 7 of a spontaneously streptomycin resistant strain of MRSA (191-SMR). Twenty-four hours post-infection mice are administered three doses (1mg) hourly of either phosphate buffered saline (control), or PlySs lysin into the nasal passages. One hour after the last treatment, mice are sacrificed and bacteria colonies enumerated on Spectra MRSA agar (a selective chromogenic medium developed to diagnostically detect MRSA nasal colonization) and Columbia blood agar. Three independent experiments are performed to evaluate at least 10 mice for each treatment group. Significantly reduction in the mean CFU on the nasal mucosa on treatment with S. suis lysin is determined.
  • Bacteriophage Lysin PlySs2 with Broad Lytic Activity Protects against Mixed Methicillin-Resistant Staphyloccocus aureus and Streptococcus pyogenes Infection
  • phage novel bacteriophage
  • PlySs2 pyogenes, Streptococcus sanguinis, group G streptococci, group E streptococci, and S. pneumoniae. This phage lysin from S. suis was termed PlySs2. Consistent with previous exogenous lysins, PlySs2 did not display activity against any Gram-negative bacteria (eg. Escherichia, Bacillus, or Pseudomonas ) . PlySs2 has an N-terminal cysteine histidine aminopeptidase (CHAP) domain, and a C-terminal SH3b binding domain.
  • CHAP N-terminal cysteine histidine aminopeptidase
  • PlySs2 is stable at 50°C for 30 min, 37°C for 24 hours, 4°C for 15 days, and -80°C for > 8 months. It maintains full activity after 10 freeze-thaws. At 128 ⁇ g/ml, PlySs2 was able to reduce colony forming units (CFUs) of MRSA and S. pyogenes by 5-logs and 3-logs, respectively. The minimum inhibitory concentration (MIC) of PlySs2 was 16 ⁇ g/ml for MRSA. A single 2 mg dose of PlySs2 protected 22 of 24 mice in a mouse septicemia model of a mixed MRSA and S. pyogenes infection. After serially increasing exposure to PlySs2, neither MRSA nor S.
  • PlySs2 is a promising therapeutic for MRSA, S. pyogenes, and many other pathogens without incidence of resistance.
  • S. pyogenes (group A streptococci - GrAS), annually infects over 750 million people [2-4]. Each year, there is a 25% mortality rate among the ⁇ 650,000 cases that progress to severe infection [2]. S. pyogenes causes pharyngitis in the upper respiratory tract, and impetigo within the skin of human hosts [5]. Scarlet fever, erysipelas, cellulitis, necrotizing fasciitis, and toxic-shock syndrome and other illnesses that emerge from S.
  • Rheumatic fever, acute glomerulonephritis, and forms of obsessive-compulsive disorder are non-suppurative sequelae associated with a S. pyogenes [7].
  • Rheumatic fever outbreaks have seen a rise worldwide since the 1980's [8]. Though rare, rheumatic fever can progress to severe illness if it enters deep into soft tissue [4].
  • Staphylococcus aureus is a Gram-positive facultative anaerobe that causes most Staphylococcus infections in man.
  • Human anterior nares (nostrils) are typically the primary sites of S. aureus colonization, along with other moist openings on the body serving as additional sites for entry [9-12].
  • S. aureus often causes severe secondary infections in immunocompromised individuals, as well as causing disease in otherwise healthy individuals.
  • SSTIs skin and soft tissue infections
  • it can cause sepsis, toxic shock syndrome, and necrotizing pneumonia, necrotizing fasciitis, and pyomyositis, endocarditis, and impetigo. These infections are usually treated with methicillin, mupirocin, or vancomycin.
  • MRSA methicillin-resistant S. aureus
  • VRSA vancomycin-resistant S. aureus
  • CA-MRSA community-associated MRSA
  • a beta-hemolytic Gram-positive streptococcus, Streptococcus agalactiae (Group B streptococci - GBS) contains an antiphagocytic capsule as its primary virulence factor [28, 29].
  • S. agalactiae can exist in the human gastrointestinal system, occasionally colonizing secondary sites like the vagina in over 33% of women [30, 31]. The colonizing S. agalactiae can infect a neonate during birth resulting in bacterial septicemia, making early-onset S. agalactiae the primary cause of death in newborns for over 4 decades [32-34],[35].
  • the current standard of practice exposes the mother to antibiotics that further the likelihood of resistance.
  • a recent Gram-positive pathogen outbreak involves Listeria, and has killed 29 in the United States as from July to November 2011 - the most deadly food-borne illness outbreak in the US since the 1970's [36]. Most individuals contract listeriosis after consumption of contaminated food, facing a mortality rate of 20-30%, even with antibiotic therapy [37, 38]. Listeria survives well in food processing systems and the human gastrointestinal tract, readily adjusting to swift changes in pH, salinity, and temperature [37, 39, 40].
  • Streptococcus sanguinis dental plaque and caries
  • S. sanguinis endocarditis
  • Group G Streptococcus Group E Streptococcus
  • S. pneumococcus pneumonia, otitis media, meningitis, bacteremia, sepsis, endocarditis, peritonitis, and cellulitis
  • Zoonotic Gram-positive pathogens include: Streptococcus equi (strangles - an upper respiratory tract infection - in equines, eg. horses); and Streptococcus suis (sepsis and meningitis in pigs and humans).
  • the pathogenic S. suis serotype 9 strain 7997 has been associated with increasing reports of zoonotic transmission from pigs to humans [41]. Humans and pigs have been treated with penicillin or gentamicin, but S. suis isolates resistant to these antibiotics exist [42]. S. suis may develop a consistent presence in human populations in years to come.
  • Novel antimicrobial sources include enzyme-based antibiotics ("enzybiotics”) such as phage lytic enzymes (also known as endolysins or "lysins").
  • Lysins have garnered much attention recently as novel antibacterial agents (reviewed in [18, 43, 44]). After bacteriophage viruses replicate inside of a host, their progeny must escape. Phage encode both holins that open a pore in the bacterial membrane, and peptidoglycan hydrolases called lysins that break bonds in the bacterial wall [45]. Since Gram-positive bacteria are hypotonic to their surroundings, disruption of the cell wall leads to osmotic lysis of the bacteria and release of viral progeny [18]. These peptidoglycan hydrolases (catalyzing a variety of specific bonds) are encoded by virtually all double-stranded DNA phages.
  • Lysins can be cloned from viral prophage sequences within bacterial genomes, recombinantly expressed in Escherichia coli, purified, and used for treatment [46]. When applied exogenously, these proteins are able to access the bonds of a Gram-positive bacterium's cell wall, as the peptidoglycan of these species is continuous with the extracellular space [18]. Lysins kill bacteria quicker than any known non-chemical agent biological compounds [47-49].
  • Lysins have been shown to demonstrate a high lethal activity against numerous Gram-positive pathogens - generally, species that the encoding phage infects or closely-related organisms [18, 47]. Having been proposed as potential enzybiotic agents, lysins are notable for the potency and specificity they demonstrate toward particular bacteria [47, 48, 50, 51]. As such, they should have a less dramatic affect on the normal nonpathogenic flora in the host than broader-acting antibiotics [18]. To date, no lysin has shown broad in vivo activity against multiple species of bacterial pathogens.
  • Lysins have been developed against MRSA, including ClyS (a staphylococcal-specific chimeric lysin previously developed in our lab) [50]. Lysins have been evolved by viruses in an evolutionary struggle to infect bacteria for billions of years. Therefore, there is selective pressure for them to chose a feature that is essential to normal bacterial function - and thus, unlikely to be altered.
  • Bacterial strains All strains were stored at -80°C (TABLE 6). Staphylococcus, Streptococcus, Listeria, Enterococcus, Pseudomonas, Bacillus spp. strains were cultivated in brain heart infusion (BHI) medium. Escherichia coli was grown in Luria Bertain (LB) medium. All media were acquired from Becton, Dickinson, and Company (Sparks, MD), unless otherwise stated. Bacteria were maintained at 37°C. Overnight cultures were grown at 37°C, and shaken at 200 rpm, if necessary.
  • BHI brain heart infusion
  • LB Luria Bertain
  • All media were acquired from Becton, Dickinson, and Company (Sparks, MD), unless otherwise stated. Bacteria were maintained at 37°C. Overnight cultures were grown at 37°C, and shaken at 200 rpm, if necessary.
  • Bacterial suspensions contained ⁇ 5 ⁇ 10 5 CFU/ml of MW2, a PVL toxin-encoding MRSA strain, ⁇ 1 ⁇ 10 7 of MGAS5005, an M1 serotype of Streptococcus pyogenes that is virulent in humans and mice (Musser), or a combination of both bacteria simultaneously at the above concentrations for the mix infection experiments.
  • Actual bacterial inoculation titers were calculated by serial dilution and plating to Columbia blood agar plates for each experiment. Mice became bacteremic within one to three hours and contained MRSA and/or S. pyogenes in their organs (including spleen, liver, kidney, and heart/blood) ([50], and unpublished observations).
  • the animals were divided into 4 to 5 treatment groups and were intraperitoneally administered 0.5 ml of either 20 mM phosphate buffer, 2 mg/ml of the streptococcal lysin PlyC [59], 2 mg/ml of ClyS [50], 2-4 mg/ml PlySs2, or a combination of 2 mg/ml PlyC and 2 mg/ml of ClyS.
  • the survival rate for each experimental group was monitored every 12 hours for the first 24 hours then every 24 hours up to 10 days post-infection.
  • the data were statistically analyzed by Kaplan Meier Survival curves and a Logrank test performed for 95% confidence intervals using the Prism computer program (GraphPad Software; La Jolla, CA).
  • PlySs2 had activity against S. equi zoo, S. equi, S. agalactiae Type II (encapsulated), and S. agalactiae 090R.
  • PlySs2 also had activity against all strains of S. pyogenes. This included serotypes M1, M3, M4, M6, M18, M49, and a variant without M protein. Unencapsulated, capsulated, and mucoid strains S. pyogenes all displayed comparable susceptibility to PlySs2.
  • PlySs2 The activity of PlySs2 was compared to that of ClyS in a simultaneous, side-by-side test using the same batch of cells (data not shown). The activity of each was comparable, but PlySs2 is far more tractable; we continued to pursue PlySs2 as a therapeutic against MRSA.
  • a phage lysin demonstrates a marked decrease in activity against specimens outside of its host species. Here, however, a broad range of susceptibility was seen among non- S . suis bacteria, with some demonstrating more sensitivity than S. suis.
  • PlySs2 displayed significant activity reducing the number of L. monocytogenes, S. agalactiae, S. aureus, and S. pyogenes ( FIGURE 26 ). It reduced all tested strains of S. agalactiae and L. monocytogenes more than S. pyogenes 5005. The negative control E. coli was not reduced in number after PlySs2 treatment.
  • the MIC of PlySs2 was relatively low for L. monocytogenes and S. aureus ( FIGURE 27 ). S. pyogenes and S. agalactiae registered similar MICs of PlySs2. The MIC for the negative control E. coli was too high to calculate.
  • Murine mixed MRSA and S. pyogenes septicemia model Murine mixed MRSA and S. pyogenes septicemia model.
  • FVB/NJ mice were intraperitoneally injected with ⁇ 5x10 5 CFU of MRSA strain MW2, ⁇ 1x10 7 of S. pyogenes strain MGAS5005 and/or both bacteria simultaneously at the concentrations above.
  • mice Three hours later mice were divided into 5 treatment groups and injected IP with either 20mM phosphate buffer, 1mg of the control staphylococcal lysin; ClyS, 1 mg of control streptococcal lysin; PlyC, 1 mg of ClyS + 1 mg of PlyC, or PlySs2 (1 mg for MRSA infections or 2 mg for streptococcal and mixed infections, respectively). Mice were then monitored for survival over ten days. The results from 4 independent experiments were combined and mouse survival data plotted with a Kaplan Meier Survival curve ( FIGURE 28 ).
  • MRSA strains (Strain 245, 223, 926 and 932), which all demonstrate similar MIC values (approx 32 ⁇ g/ml) for PlySs2, were tested for log kill by direct comparison between PlySs2 and vancomycin antibiotic (1 ⁇ g/ml).
  • Cultures of about 5x10 5 bacteria are grown in MHB media in 50 ml conical tubes at 37°C shaking 225 rpms for up to 6 hours in combination with PlySs2 alone, vanvomycin alone, or no additive. At various time points (15 min, 30 min, 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs and 6 hrs) aliquot samples (approx 300 ⁇ l) are removed.
  • the lytic enzyme or antibiotic are inactivated by addition of a charcoal solution to all aliquot samples. Samples are diluted and plated on agar plates to determin viable bacterial cell counts. The Log reduction in CFU is depicted in FIGURE 29 . PlySs2 provides rapid and effective kill with enhanced activity versus standard-of-care antibiotic vancomycin on all MRSA strains tested and depicted.
  • the novel, native S. suis lysin, PlySs2 is demonstrated herein to display broad lytic activity against multiple Gram-positive pathogens including S. pyogenes and S. aureus in vivo.
  • This lysin is the first to display such promiscuous activity; all previously characterized lysins display activity against a narrow spectrum of species [48, 50, 61-64].
  • ClyS has been shown to clear septicemic MRSA infections [50], however, to date, no lysin has been shown to clear more than one septicemic infection, and none has cleared a mixed infection of any kind.
  • the ability of PlySs2 to clear a mixed infection of staphylococci and streptococci comes from its broad lytic activity.
  • a strength of many lysins is their specificity. Antibiotics act nonspecifically, killing commensal microbes along with the target pathogen. This results in many negative side effects (eg. diarrhea) and antibiotics can enable opportunistic pathogens (eg. Clostridium difficile ) to cause entirely new infections. Lysins can be used to treat a single pathogen without disrupting the entire bacterial flora [18]. The specificity of many previously described lysins can also be a limitation in that multiple lysins would be needed to treat multiple pathogens. Our findings provide a single lysin that can be used to treat many pathogens while retaining a degree of specificity. PlySs2 is active against various Gram-positive pathogens leaving the Gram-negatives unaffected.
  • PlySs2 can serve as a viable treatment for infections caused by S. aureus and/or S. pyogenes such as: scarlet fever; erysipelas; cellulitis; necrotizing fasciitis; endocarditis; bacteremia/sepsis; a variety of abscess and non-abscess forming SSTIs; and impetigo.
  • Treatment against neonatal septicemia and food-borne illness is also applicable, because it displays more in vitro activity against S. agalactiae and L. monocytogenes than it does against S. pyogenes 5005 ( FIGURE 25-27 ).
  • PlySs2 As a lysin, PlySs2 rapidly kills its target, far quicker than antibiotics ( FIGURE 29 ). PlySs2 only has to contact the bonds of the external cell wall to mediate its effect; conventional antibiotics must remain at high concentrations for an extended period, resulting in a multitude of side effects. This feature has enabled phage lysins to treat systemic infections in the past [48, 61]. As demonstrated herein, PlySs2 was able to clear septicemic MRSA and S. pyogenes infections from a high percentage of mice using a single dose of PlySs2. In addition, mixed septicemic MRSA and S. pyogenes infections were cleared from ⁇ 92% of mice with a single dose of PlySs2 compared to ⁇ 4% clearance for controls. Further enhanced kill or clearance may arise from increased or repeated dosage.
  • PlySs2 is more tractable and stable than previously developed lysins. PlySs2 preparation is straightforward, yielding large quantities in few steps. In addition, a highly soluble lysin is essential, because it allows for ready use at high concentrations. Remarkably, PlySs2 remains soluble in concentrations exceeding 20 mg/ml (data not shown) which is orders of magnitude more concentrated than needed to produce log-fold killing of target organisms in a matter of minutes. PlySs2 also behaves well in a variety of in vitro assays developed to evaluate lysins. It can be subjected to high or low temperatures for prolonged periods with little affect on its activity even when repeatedly freeze-thawed. PlySs2's stability is highly suitable for production and distribution as a therapeutic.
  • PlySs2 represents a divergent class of prophage lytic enzyme structure. CHAP domains are included in several previously characterized streptococcal [59, 67] and staphylococcal [50, 68] phage lysins. On a primary sequence level, however, the CHAP domain of PlySs2 is rather divergent from other database CHAP domains (all pairwise E-values > 10 -15 ).
  • CHAP domains are catalytically diverse and can possess either alanine-amidase [47] or cross-bridge endopeptidase activity [50], depending on the particular lysin. Further, the molecular nature of the peptidoglycan cross-bridge in S. suis can vary between strains [69].
  • the CHAP domain mediates the catalytic activity of PlySs2, but may not fully confer specificity. It has been thought that the phage lysin binding domains determine lysin specificity [70, 71]. Lysostaphin contains an SH3-like binding domain that presumably binds the cross-bridges in the bacterial cell wall peptidoglycan [71].
  • SH3 domains are commonly seen in viral and bacterial cell wall-binding proteins, although the exact molecular target remains unknown [72].
  • SH3b bacterial homologues of SH3 domains
  • An SH3b domain of a B. cereus endopeptidase has been shown to bind the free amine group of the N-terminal alanine in the peptidoglycan stem [75] and this amine group is possible substrate for the PlySs2 SH3b domain.
  • the cross-bridge varies greatly across all PlySs2-susceptible specimens, so it is an unlikely target for the PlySs2 SH3 binding domain.
  • These cross-bridges can acquire variations leading to lysostaphin resistance, however PlySs2 notably displayed activity against both lysostaphin-sensitive and lysostaphin-resistant (LyrA) S. aureus strains.
  • PlySs2 has activity against two, distinct phylogenetic orders: Bacillales ( Staphylococcus, Listeria, et al.) and Lactobacillales ( Streptococcus, Enterococcus, et al.).
  • the peptidoglycan stems are similar between these two orders, but their cross-bridges vary widely in composition and length [76, 77].
  • Phage lysins have not previously displayed activity on different families or genera (and rarely on different species) [50].
  • Native phage lysins usually show species specificity toward the species the native phage infects [48, 61]. All S.
  • aureus strains tested including strains resistant to methicillin (MRSA), vancomycin (VISA), mupirocin, daptomycin, and lysostaphin were susceptible to PlySs2-induced lysis.
  • PlySs2 lysed the pathogenic S. suis 7997 with similar efficacy. Lysing only 2 of 6 strains tested, PlySs2 activity against Listeria was less determinate. The activity of PlySs2 against Staphylococus simulans, Streptococcus equi zooepidemicus, and Staphylococcus equi provides further evidence that the substrate for the binding domain exists outside of the cross-bridge.
  • S. agalactiae enhances its virulence.
  • Type II S. agalactiae has a thicker capsule than most, and has a correspondingly higher level of virulence [28].
  • S. agalactiae strains with a thinner capsule are less virulent [29, 78].
  • PlySs2 has comparable activity against those with and without a capsule: S. agalactiae_ Type II, S. agalactiae 090R.
  • M types for S. pyogenes There are greater than 200 M types for S. pyogenes [4].
  • PlySs2 has activity against all of the M-types we tested it against.
  • PlySs2 activity against S. sanguinis indicates its potential to treat dental plaque.
  • PlySs2 displays activity against S . gordonii, it displays less activity against the commensals S. oralis, and S. mutans. There is a moderate amount of activity against group G Streptococcus, group E Streptococcus, E.rioselis, S. pneumoniae, S. rattus, and S. sobrinus. Other strains of S. pneumoniae were less susceptible.
  • the activity of PlySs2 against an array of multidrug-resistant MRSA, heavily capsulated S. pyogenes, and numerous other virulent pathogens make it a critical therapeutic candidate.
  • PlySs2 was able to reduce the CFU's of various strains that varied in drug resistance, capsulation, and biofilm creation. PlySs2's activity against the mucoid S. pyogenes M4 was stronger than was observed for any other S. pyogenes tested. Further, PlySs2 had a greater activity against S. agalactiae and L. monocytogenes than S. pyogenes (from which it was able to protect septicemic mice). Given the efficacy of PlySs2 against S. pyogenes, PlySs2 can serve as a therapeutic agent against any of these other pathogens. The MIC results confirmed the CFU findings.
  • S. pyogenes infections are not easily treated with antibiotics [82]. In some cases, they require surgical procedures [82].
  • the M1 serotype used in our septicemic model is one of the leading clinical isolates found causing streptococcal pharyngitis and invasive disease worldwide [83, 84].
  • S. pyogenes is able to traverse epithelial surfaces producing invasive bacteremia [83]. This and other severe internal infections result in death in less than a week in 19% of the cases [85]. In many cases, one does not know whether S. aureus or S. pyogenes is the causative pathogen behind SSTIs or impetigo.
  • PlySs2 can be used to prophylactically clear human mucous membrane reservoirs of pathogenic bacteria resistant to antibiotics.
  • Penicillin can be used to treat S. pyogenes, which remains acutely sensitive; but if the impetigo is caused by MRSA, penicillin may be ineffective.
  • PlySs2 may treat primary infections and prophylactically decrease the likelihood of secondary infections.
  • PlySs2 would target the pathogens, without harming Gram-negatives.
  • This novel capability lies in the divergent CHAP domain, and unique SH3 binding domain. Antibiotics kill many species in addition to the target pathogen.
  • lysins could only be used against one pathogenic species.
  • PlySs2 occupies a vital space in the spectrum between the rigid lysin specificity, and unselective antibiotic activity. Ideally, a therapeutic has activity against all the major pathogens without affecting the commensals; PlySs2 is the first to indicate that a lysin could serve that function.
  • PlySs2 is a lysin with broad lytic activity against MRSA, VISA, S. suis, Listeria, S.
  • PlySs2 is easy to produce, tractable, and very stable. PlySs2 protects septicemic mice from a mixed infection of MRSA and S. pyogenes and neither of these pathogens were able to establish resistance to PlySs2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
EP17181258.9A 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien Pending EP3252155A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161477836P 2011-04-21 2011-04-21
EP12773653.6A EP2699253B1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
EP12773653.6A Division-Into EP2699253B1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien
EP12773653.6A Division EP2699253B1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien

Publications (1)

Publication Number Publication Date
EP3252155A1 true EP3252155A1 (de) 2017-12-06

Family

ID=47042182

Family Applications (2)

Application Number Title Priority Date Filing Date
EP17181258.9A Pending EP3252155A1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien
EP12773653.6A Active EP2699253B1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP12773653.6A Active EP2699253B1 (de) 2011-04-21 2012-04-20 Streptococcus-bakteriophagen-lysine zur erkennung und behandlung gram-positiver bakterien

Country Status (12)

Country Link
US (7) US9034322B2 (de)
EP (2) EP3252155A1 (de)
JP (4) JP6139509B2 (de)
CN (4) CN108578685A (de)
AU (3) AU2012245357B2 (de)
CA (1) CA2833409A1 (de)
DK (1) DK2699253T3 (de)
ES (1) ES2682670T3 (de)
HK (2) HK1244503A1 (de)
IL (4) IL228869B (de)
MX (3) MX336427B (de)
WO (1) WO2012145630A2 (de)

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2663579B1 (de) 2011-01-14 2017-04-26 The Regents of the University of California Therapeutische antikörper gegen das protein ror-1 und verfahren zu ihrer verwendung
JP2014519485A (ja) * 2011-04-21 2014-08-14 ユニベルシタイト ユトレヒト ホールディング ベーフェー コンパニオン動物および家畜におけるグラム陽性細菌を処置するためのＳｔｒｅｐｔｏｃｏｃｃｕｓバクテリオファージリシン
NL2007038C2 (en) * 2011-07-04 2013-01-07 Vereniging Voor Christelijk Hoger Onderwijs System and method for predicting the viability of a body tissue in a patient, and measuring device used therein.
IL235527B2 (en) * 2012-05-09 2023-10-01 Contrafect Corp Combinations of bacteriophage lysine and antibiotics against gram-positive bacteria
CA3187222A1 (en) * 2012-05-09 2013-11-14 Contrafect Corporation Biofilm prevention, disruption and treatment with bacteriophage lysin
CN104073478A (zh) * 2014-06-13 2014-10-01 上海交通大学 杀灭革兰氏阳性菌的酶抗生素及其制备、用途
GB2543453A (en) 2014-06-26 2017-04-19 Univ Rockefeller Acinetobacter lysins
CN104726439B (zh) * 2015-04-13 2017-11-14 武汉菲吉乐科生物科技有限公司 一种广谱的链球菌裂解酶及其应用
CN104805066B (zh) * 2015-05-18 2018-04-24 武汉菲吉乐科生物科技有限公司 一种葡萄球菌裂解酶及其应用
WO2017023680A1 (en) * 2015-07-31 2017-02-09 The Regents Of The University Of California Mycobacterium lysterase: a novel treatment for acne
WO2017044989A1 (en) * 2015-09-13 2017-03-16 The Rockefeller University Clostridium difficile BACTERIOPHAGE LYSINS FOR DETECTION AND TREATMENT OF Clostridium difficile BACTERIA INFECTION
MX2018003101A (es) 2015-09-17 2018-12-17 Contrafect Corp Activo de polipeptidos de lisina contra bacterias gram-negativas.
CA3023730A1 (en) 2016-05-12 2017-11-16 Contrafect Corporation Broth microdilution method for evaluating and determining minimal inhibitory concentration of antibacterial polypeptides
CN111295183A (zh) * 2017-07-10 2020-06-16 康特拉费克特公司 裂解蛋白抗菌活性的血液组分强化及其方法和用途
AU2019205388A1 (en) * 2018-01-05 2020-07-23 Azitra Inc Auxotrophic strains of Staphylococcus bacterium
CN112118861A (zh) * 2018-02-26 2020-12-22 康特拉费克特公司 修饰的PlySs2溶素及其用途
KR102073094B1 (ko) * 2018-06-04 2020-02-04 (주)인트론바이오테크놀로지 신규한 스트렙토코커스 수이스 박테리오파지 Str-SUP-3 및 이의 스트렙토코커스 수이스 균 증식 억제 용도
KR102073086B1 (ko) * 2018-06-04 2020-02-04 (주)인트론바이오테크놀로지 신규한 스트렙토코커스 수이스 박테리오파지 Str-SUP-1 및 이의 스트렙토코커스 수이스 균 증식 억제 용도
KR102073088B1 (ko) * 2018-06-04 2020-02-04 (주)인트론바이오테크놀로지 신규한 스트렙토코커스 수이스 박테리오파지 Str-SUP-2 및 이의 스트렙토코커스 수이스 균 증식 억제 용도
WO2020037031A1 (en) * 2018-08-17 2020-02-20 Becton, Dickinson And Company Antimicrobial susceptibility testing using microdroplets
WO2020077286A1 (en) 2018-10-12 2020-04-16 Quidel Corporation Extraction reagent for use in an assay for detection of group a streptococcus
WO2020198073A1 (en) * 2019-03-22 2020-10-01 Contrafect Corporation Method of treating infective endocarditis
CA3136126A1 (en) * 2019-04-05 2020-10-08 Contrafect Corporation Lysins and derivatives thereof with bactericidal activity against pseudomonas aeruginosa, in the presence of human serum
JP2022526624A (ja) * 2019-04-11 2022-05-25 コントラフェクト コーポレイション 骨及び関節の感染を治療及び予防する方法
IL297953A (en) * 2020-05-19 2023-01-01 Contrafect Corp Modified plyss2 lysines and antibiotic combinations for use against gram-positive bacteria
US20220087266A1 (en) * 2020-09-22 2022-03-24 Mars, Incorporated Compositions and methods for controlling mycotoxin production
CN114480299B (zh) * 2020-10-27 2023-08-29 暨南大学 一种蜡样芽胞杆菌噬菌体及其应用
CN112760312B (zh) * 2021-01-20 2022-06-17 华中农业大学 一种裂解革兰氏阳性菌的裂解酶plyssX609及其应用
WO2023049747A1 (en) * 2021-09-22 2023-03-30 Elanco Us Inc. Streptococcus suis lytic enzyme compositions and methods of use thereof
KR20240015755A (ko) * 2022-07-26 2024-02-06 주식회사 인트론바이오테크놀로지 연쇄상구균에 대하여 용균 활성을 갖는 항균단백질
WO2024059184A1 (en) * 2022-09-16 2024-03-21 The Johns Hopkins University Machine learning systems and related aspects for the detection of disease states
CN116640754B (zh) * 2023-07-21 2023-10-10 临沂大学 一种链球菌前噬菌体裂解酶lys224及应用
CN117051043B (zh) * 2023-10-11 2024-01-30 圆因(北京)生物科技有限公司 一种基于环状rna编码耐甲氧西林金黄色葡萄球菌内溶素及其应用

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3278378A (en) 1962-04-19 1966-10-11 Schindler Charles Alvin Staphylococcus-derived antibiotic
US3398056A (en) 1964-07-10 1968-08-20 Mead Johnson & Co Process for producing lysostaphin by fermentation
US3594284A (en) 1968-06-04 1971-07-20 Mead Johnson & Co Lysostaphin fermentation with accelerated time cycle
US3654090A (en) 1968-09-24 1972-04-04 Organon Method for the determination of antigens and antibodies
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US4016043A (en) 1975-09-04 1977-04-05 Akzona Incorporated Enzymatic immunological method for the determination of antigens and antibodies
EP0075444A2 (de) 1981-09-18 1983-03-30 Genentech, Inc. Verfahren und Produkte zur leichten mikrobiologischen Expression von DNS-Sequenzen
EP0120694A2 (de) 1983-03-25 1984-10-03 Celltech Limited Verfahren zur Herstellung vielkettige Polypeptide oder Proteine
EP0125023A1 (de) 1983-04-08 1984-11-14 Genentech, Inc. Rekombinante Immunoglobulin-Präparate, Verfahren zu ihrer Herstellung, DNA-Sequenzen, Expressionsvektoren und rekombinante Wirkzellen hierfür
US4615697A (en) 1983-11-14 1986-10-07 Bio-Mimetics, Inc. Bioadhesive compositions and methods of treatment therewith
US4948580A (en) 1988-12-08 1990-08-14 E. R. Squibb & Sons, Inc. Muco-bioadhesive composition
WO1994013804A1 (en) 1992-12-04 1994-06-23 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5413792A (en) 1989-03-31 1995-05-09 Dow Corning K.K. Mucoadhesive polysiloxane paste-like base and preparation
US5554380A (en) 1994-08-04 1996-09-10 Kv Pharmaceutical Company Bioadhesive pharmaceutical delivery system
US5604109A (en) 1986-10-08 1997-02-18 New Horizons Diagnostics Corporation Method for exposing Group A streptococcal antigens and an improved diagnostic test for the identification of Group A streptococci
US5808022A (en) 1990-08-24 1998-09-15 Ixsys Incorporated Oligonucleotides having random riplets
US5863560A (en) 1996-09-11 1999-01-26 Virotex Corporation Compositions and methods for topical application of therapeutic agents
US5942243A (en) 1996-11-12 1999-08-24 Polytherapeutics, Inc. Mucoadhesive compositions for administration of biologically active agents to animal tissue
US5976862A (en) 1985-03-30 1999-11-02 Ixsys Corporation Process for obtaining DNA, RNA, peptides, polypeptides, or proteins, by recombinant DNA technique
US5985271A (en) 1997-10-31 1999-11-16 New Horizons Diagnostics Corp. Prophylactic and theraputic treatment of group A streptococcal infection
US6017528A (en) 1997-10-31 2000-01-25 New Horizons Diagnostics Therapeutic treatment of group A streptococcal infections
US6056955A (en) 1999-09-14 2000-05-02 Fischetti; Vincent Topical treatment of streptococcal infections
US6132970A (en) 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
US6248324B1 (en) 1997-10-31 2001-06-19 Vincent Fischetti Bacterial phage associated lysing enzymes for treating dermatological infections
US6254866B1 (en) 1997-10-31 2001-07-03 New Horizons Diagnostics Corporation Use of phage associated lytic enzymes for treating bacterial infections of the digestive tract
US6264945B1 (en) 1997-10-31 2001-07-24 Vincent A Fischetti Parenteral use of bacterial phage associated lysing enzymes for the therapeutic treatment of bacterial infections
WO2008018854A2 (en) 2005-06-06 2008-02-14 The Rockefeller University Bactiophage lysins for bacillus anthracis
US7402309B2 (en) 2002-05-17 2008-07-22 The Rockefeller University Phage-associated lytic enzymes for treatment of Bacillus anthracis and related conditions
US20080221035A1 (en) 2005-08-24 2008-09-11 Fischetti Vincent A Ply-Gbs Mutant Lysins
US7569223B2 (en) 2004-03-22 2009-08-04 The Rockefeller University Phage-associated lytic enzymes for treatment of Streptococcus pneumoniae and related conditions
US7582291B2 (en) 2005-06-30 2009-09-01 The Rockefeller University Bacteriophage lysins for Enterococcus faecalis, Enterococcus faecium and other bacteria
US7638600B2 (en) 2004-03-24 2009-12-29 The Rockefeller University Lytic enzymes and spore surface antigen for detection and treatment of Bacillus anthracis bacteria and spores
WO2010002959A2 (en) 2008-07-03 2010-01-07 The Rockefeller University A chimeric bacteriophage lysin with activity against staphylococci bacteria

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060292135A1 (en) * 1997-10-31 2006-12-28 Lawrence Loomis Use of bacterial phage-associated lysing proteins for preventing and treating bacterial infections in humans, animals and fowl
CN1352567A (zh) * 1999-02-25 2002-06-05 新眼界诊断公司 预防性和治疗性治疗链球菌感染的方法
US8326388B2 (en) 2002-10-31 2012-12-04 Toshiba Medical Systems Corporation Method and apparatus for non-invasive measurement of living body characteristics by photoacoustics
CA2504938C (en) * 2002-11-07 2011-10-11 Synergy America, Inc. Compositions and methods for treating or preventing pneumococcal infection
US7582729B2 (en) * 2003-05-15 2009-09-01 The Rockefeller University Nucleic acids and polypeptides of C1 bacteriophage and uses thereof
GB0410220D0 (en) * 2004-05-07 2004-06-09 Kirkham Lea Ann Mutant pneumolysin proteins
IE20060488A1 (en) 2006-06-29 2008-01-09 Teagasc Agric Food Dev Authori Recombinant staphylococcal phage lysin as an antibacterial agent
DE102006061002A1 (de) * 2006-12-22 2008-06-26 Profos Ag Verfahren und Mittel zur Anreicherung, Entfernung und zum Nachweis von gram-positiven Bakterien
CA2706600A1 (en) * 2007-11-26 2009-06-04 Plant Bioscience Limited Novel polypeptides having endolysin activity and uses thereof
EP2103308A1 (de) * 2008-03-20 2009-09-23 PhytoLine GmbH Verfahren zur Herstellung eines Gemisches von Bakteriophagen und deren Verwendung für die Therapie von Antibiotika-resistenten Staphylococcen
WO2010011960A2 (en) * 2008-07-24 2010-01-28 The United State Of America, As Represented By The Secretary Of Agriculture Triple acting antimicrobials that are refractory to resistance development
GB0815484D0 (en) * 2008-08-26 2008-10-01 Univ Leuven Kath Antibacterial agents
KR101016918B1 (ko) * 2009-01-08 2011-02-25 주식회사 인트론바이오테크놀로지 박테리아 특이적 넓은 항균 활성을 갖는 신규한 리신 단백질
WO2011091412A1 (en) * 2010-01-25 2011-07-28 Alere Scarborough, Inc. A25 bacteriophage lysin
JP2014519485A (ja) * 2011-04-21 2014-08-14 ユニベルシタイト ユトレヒト ホールディング ベーフェー コンパニオン動物および家畜におけるグラム陽性細菌を処置するためのＳｔｒｅｐｔｏｃｏｃｃｕｓバクテリオファージリシン

Patent Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3278378A (en) 1962-04-19 1966-10-11 Schindler Charles Alvin Staphylococcus-derived antibiotic
US3398056A (en) 1964-07-10 1968-08-20 Mead Johnson & Co Process for producing lysostaphin by fermentation
US3594284A (en) 1968-06-04 1971-07-20 Mead Johnson & Co Lysostaphin fermentation with accelerated time cycle
US3654090A (en) 1968-09-24 1972-04-04 Organon Method for the determination of antigens and antibodies
US3654090B1 (de) 1968-09-24 1982-07-20
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US4016043A (en) 1975-09-04 1977-04-05 Akzona Incorporated Enzymatic immunological method for the determination of antigens and antibodies
EP0075444A2 (de) 1981-09-18 1983-03-30 Genentech, Inc. Verfahren und Produkte zur leichten mikrobiologischen Expression von DNS-Sequenzen
EP0120694A2 (de) 1983-03-25 1984-10-03 Celltech Limited Verfahren zur Herstellung vielkettige Polypeptide oder Proteine
US4816397A (en) 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
EP0125023A1 (de) 1983-04-08 1984-11-14 Genentech, Inc. Rekombinante Immunoglobulin-Präparate, Verfahren zu ihrer Herstellung, DNA-Sequenzen, Expressionsvektoren und rekombinante Wirkzellen hierfür
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4615697A (en) 1983-11-14 1986-10-07 Bio-Mimetics, Inc. Bioadhesive compositions and methods of treatment therewith
US5976862A (en) 1985-03-30 1999-11-02 Ixsys Corporation Process for obtaining DNA, RNA, peptides, polypeptides, or proteins, by recombinant DNA technique
US5604109A (en) 1986-10-08 1997-02-18 New Horizons Diagnostics Corporation Method for exposing Group A streptococcal antigens and an improved diagnostic test for the identification of Group A streptococci
US4948580A (en) 1988-12-08 1990-08-14 E. R. Squibb & Sons, Inc. Muco-bioadhesive composition
US5413792A (en) 1989-03-31 1995-05-09 Dow Corning K.K. Mucoadhesive polysiloxane paste-like base and preparation
US5808022A (en) 1990-08-24 1998-09-15 Ixsys Incorporated Oligonucleotides having random riplets
WO1994013804A1 (en) 1992-12-04 1994-06-23 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US6132970A (en) 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
US5554380A (en) 1994-08-04 1996-09-10 Kv Pharmaceutical Company Bioadhesive pharmaceutical delivery system
US5863560A (en) 1996-09-11 1999-01-26 Virotex Corporation Compositions and methods for topical application of therapeutic agents
US5942243A (en) 1996-11-12 1999-08-24 Polytherapeutics, Inc. Mucoadhesive compositions for administration of biologically active agents to animal tissue
US6248324B1 (en) 1997-10-31 2001-06-19 Vincent Fischetti Bacterial phage associated lysing enzymes for treating dermatological infections
US6017528A (en) 1997-10-31 2000-01-25 New Horizons Diagnostics Therapeutic treatment of group A streptococcal infections
US5985271A (en) 1997-10-31 1999-11-16 New Horizons Diagnostics Corp. Prophylactic and theraputic treatment of group A streptococcal infection
US6254866B1 (en) 1997-10-31 2001-07-03 New Horizons Diagnostics Corporation Use of phage associated lytic enzymes for treating bacterial infections of the digestive tract
US6264945B1 (en) 1997-10-31 2001-07-24 Vincent A Fischetti Parenteral use of bacterial phage associated lysing enzymes for the therapeutic treatment of bacterial infections
US6056955A (en) 1999-09-14 2000-05-02 Fischetti; Vincent Topical treatment of streptococcal infections
US7402309B2 (en) 2002-05-17 2008-07-22 The Rockefeller University Phage-associated lytic enzymes for treatment of Bacillus anthracis and related conditions
US7569223B2 (en) 2004-03-22 2009-08-04 The Rockefeller University Phage-associated lytic enzymes for treatment of Streptococcus pneumoniae and related conditions
US7638600B2 (en) 2004-03-24 2009-12-29 The Rockefeller University Lytic enzymes and spore surface antigen for detection and treatment of Bacillus anthracis bacteria and spores
WO2008018854A2 (en) 2005-06-06 2008-02-14 The Rockefeller University Bactiophage lysins for bacillus anthracis
US7582291B2 (en) 2005-06-30 2009-09-01 The Rockefeller University Bacteriophage lysins for Enterococcus faecalis, Enterococcus faecium and other bacteria
US20080221035A1 (en) 2005-08-24 2008-09-11 Fischetti Vincent A Ply-Gbs Mutant Lysins
WO2010002959A2 (en) 2008-07-03 2010-01-07 The Rockefeller University A chimeric bacteriophage lysin with activity against staphylococci bacteria

Non-Patent Citations (176)

* Cited by examiner, † Cited by third party
Title
"Bacterial coinfections in lung tissue specimens from fatal cases of 2009 pandemic influenza A (HINI) - United States, May-August 2009", MMWR MORB MORTAL WKLY REP, vol. 58, no. 38, 2009, pages 1071 - 4
"From the Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus--Minnesota and North Dakota, 1997-1999", JAMA, vol. 282, no. 12, 1999, pages 1123 - 5
"Immobilized Cells And Enzymes", 1986, IRL PRESS
ADEM, P.V. ET AL.: "Staphylococcus aureus sepsis and the Waterhouse-Friderichsen syndrome in children", N ENGL J MED, vol. 353, no. 12, 2005, pages 1245 - 51
ALTSCHUL ET AL., NUCLEIC ACIDS RES, vol. 25, 1997, pages 3389 - 3402
ARKIN; YOURVAN, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7811 - 7815
AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1992, JOHN WILEY & SONS
AUSUBEL, R. M.,: "Current Protocols in Molecular Biology", vol. I-III, 1994
B. PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
B.D. HAMES & S.J. HIGGINS,: "Transcription And Translation", 1984
B.D. HAMES & S.J. HIGGINS: "Nucleic Acid Hybridization", 1985
BAERTLEIN, L.: "Death toll from listeria outbreak rises to 29", 2011
BAKER, J.R. ET AL.: "Endopeptidase and glycosidase activities of the bacteriophage B30 lysin", APPL ENVIRON MICROBIOL, vol. 72, no. 10, 2006, pages 6825 - 8
BECKER, S.C. ET AL.: "LysK CHAP endopeptidase domain is required for lysis of live staphylococcal cells.", FEMS MICROBIOL LETT, vol. 294, no. 1, 2009, pages 52 - 60, XP002582774
BERES, S.B. ET AL., PLOS ONE, vol. 2, no. 8, 2007, pages 1 - 14
BERES, S.B.; J.M. MUSSER: "Contribution of Exogenous Genetic Elements to the Group A Streptococcus Metagenome", PLOS ONE, vol. 2, no. 8, 2007, pages 1 - 14
BERES, S.B.; J.M. MUSSER: "Contribution of exogenous genetic elements to the group A Streptococcus metagenome.", PLOS ONE, vol. 2, no. 8, 2007, pages e800
BESSEN, D.E. ET AL.: "Whole Genome Association Study on Tissue Tropism Phenotypes in Group A Streptococcus", JOURNAL OF BACTERIOLOGY, 2011
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BISNO, A.L.; M.O. BRITO; C.M. COLLINS: "Molecular basis of group A streptococcal virulence", LANCET INFECT DIS, vol. 3, no. 4, 2003, pages 191 - 200, XP004810824, DOI: doi:10.1016/S1473-3099(03)00576-0
BOLTON; MCCARTHY, PROC. NATL. ACAD. SCI. USA, vol. 48, 1962, pages 1390
BOYER, K.M. ET AL.: "Selective intrapartum chemoprophylaxis of neonatal group B streptococcal early-onset disease. II. Predictive value of prenatal cultures", JOURNAL OF INFECTIOUS DISEASES, vol. 148, no. 5, 1983, pages 802
BROWDER ET AL., RES. COMM., vol. 19, 1965, pages 393 - 400
BRUNDAGE, J.F.; G.D. SHANKS: "What really happened during the 1918 influenza pandemic? The importance of bacterial secondary infections.", JINFECT DIS, vol. 196, no. 11, 2007, pages 1717 - 8,1718-9, XP055304577, DOI: doi:10.1086/522355
CANTIN, M. ET AL., J VET DIAGNOSTIC INVESTIG, vol. 4, 1992, pages 170 - 174
CANTIN, M. ET AL.: "Antimicrobial resistance patterns and plasmid profiles of Streptococcus suis isolates", J VET DIAGN INVEST, vol. 4, no. 2, 1992, pages 170 - 4
CANTIN, M.; J. HAREL; R. HIGGINS; M. GOTTSCHALK: "Antimicrobial resistance patterns and plasmid profiles of Streptococcus suis isolates", JOURNAL OF VETERINARY DIAGNOSTIC INVESTIGATION, vol. 4, 1992, pages 170 - 174
CARAPETIS, J.R. ET AL.: "The global burden of group A streptococcal diseases", THE LANCET INFECTIOUS DISEASES, vol. 5, no. 11, 2005, pages 685 - 694, XP005135621, DOI: doi:10.1016/S1473-3099(05)70267-X
CHEN, C. ET AL.: "A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates", PLOS ONE, vol. 2, no. 3, 2007, pages e315, XP008117430, DOI: doi:10.1371/journal.pone.0000315
CHENG, Q. ET AL.: "Removal of group B streptococci colonizing the vagina and oropharynx of mice with a bacteriophage lytic enzyme.", ANTIMICROB AGENTS CHEMOTHER, vol. 49, no. 1, 2005, pages 111 - 7, XP002503533, DOI: doi:10.1128/AAC.49.1.111-117.2005
COATES, T.; R. BAX; A. COATES: "Nasal decolonization of Staphylococcus aureus with mupirocin: strengths, weaknesses and future prospects", J ANTIMICROB CHEMOTHER, vol. 64, no. 1, 2009, pages 9 - 15
COLE, J.N. ET AL.: "Molecular insight into invasive group A streptococcal disease", NAT REV MICROBIOL, vol. 9, no. 10, 2011, pages 724 - 36, XP055231473, DOI: doi:10.1038/nrmicro2648
COLIGAN, J. E.,: "Current Protocols in Immunology", vol. I-III, 1994
CUNHA, B.A.: "Sepsis and septic shock: selection of empiric antimicrobial therapy.", CRIT CARE CLIN, vol. 24, no. 2, 2008, pages 313 - 34
CUNNINGHAM, M.W.: "Pathogenesis of group A streptococcal infections", CLIN MICROBIOL REV, vol. 13, no. 3, 2000, pages 470 - 511, XP002233700, DOI: doi:10.1128/CMR.13.3.470-511.2000
D. B. GILMER ET AL: "Novel Bacteriophage Lysin with Broad Lytic Activity Protects against Mixed Infection by Streptococcus pyogenes and Methicillin-Resistant Staphylococcus aureus", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 57, no. 6, 9 April 2013 (2013-04-09), pages 2743 - 2750, XP055190339, ISSN: 0066-4804, DOI: 10.1128/AAC.02526-12 *
DANIEL A ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 54, no. 4, 2010, pages 1602 - 1612
DANIEL, A. ET AL.: "Synergism between a novel chimeric lysin and oxacillin protects against infection by methicillin-resistant Staphylococcus aureus.", ANTIMICROB AGENTS CHEMOTHER, vol. 54, no. 4, 2010, pages 1603 - 12, XP055019034, DOI: doi:10.1128/AAC.01625-09
DELEO, F.R. ET AL.: "Community-associated meticillin-resistant Staphylococcus aureus", LANCET, vol. 375, no. 9725, 2010, pages 1557 - 68, XP027035661, DOI: doi:10.1016/S0140-6736(09)61999-1
DELGRAVE ET AL., PROTEIN ENGINEERING, vol. 6, no. 3, 1993, pages 327 - 331
DELGRAVE ET AL., PROTEIN ENGINEERING, vol. 6, no. 3, pages 327 - 331
DELLINGER, R.P ET AL.: "Surviving Sepsis Campaign guidelines for management of severe sepsis and septic shock.", CRIT CARE MED, vol. 32, no. 3, 2004, pages 858 - 73
DIETERICH, G. ET AL.: "LEGER: knowledge database and visualization tool for comparative genomics of pathogenic and non-pathogenic Listeria species", NUCLEIC ACIDS RESEARCH, vol. 34, no. 1, 2006, pages D402
DIXON ET AL., YALE J. BIOLOGY AND MEDICINE, vol. 41, 1968, pages 62 - 68
DONOVAN DM; FOSTER-FREY J, FEMS MICROBIOL LETT, vol. 287, no. 1, 2008, pages 22 - 33
FEMS MICROBIOL. LETT., vol. 164, no. 1, 1998, pages 159 - 67
FISCHETTI, V.A., CURR OPINION MICROBIOL, vol. 11, 2008, pages 393 - 400
FISCHETTI, V.A.: "Bacteriophage lysins as effective antibacterials", CURRENT OPINION IN MICROBIOLOGY, vol. 11, 2008, pages 393 - 400, XP025744750, DOI: doi:10.1016/j.mib.2008.09.012
FISCHETTI, V.A.: "Bacteriophage lytic enzymes: novel anti-infectives.", TRENDS MICROBIOL, vol. 13, no. 10, 2005, pages 491 - 6, XP005115077, DOI: doi:10.1016/j.tim.2005.08.007
FISCHETTI, V.A: "Bacteriophage lysins as effective antibacterials", CURR OPIN MICROBIOL, vol. 11, no. 5, 2008, pages 393 - 400, XP025744750, DOI: doi:10.1016/j.mib.2008.09.012
FRY, R.M.: "Prevention and Control of Puerperal Sepsis: Bacteriological Aspects", BR MED J, vol. 2, no. 4049, 1938, pages 340 - 2
GARCIA ET AL., GENE, vol. 86, 1990, pages 81 - 88
GARCIA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 914 - 918
GARCIA ET AL.: "Streptococcal Genetics", 1987
GARGIS, S.R. ET AL.: "Inhibition of the activity of both domains of lysostaphin through peptidoglycan modification by the lysostaphin immunity protein.", APPL ENVIRON MICROBIOL, vol. 76, no. 20, 2010, pages 6944 - 6
GONZALEZ VILLA, T.; P. VEIGA-CRESPO: "Enzybiotics : antibiotic enzymes as drugs and therapeutics201 0", JOHN WILEY & SONS, pages: 284
GRANDGIRARD, D. ET AL.: "Phage lytic enzyme Cpl-1 for antibacterial therapy in experimental pneumococcal meningitis", J INFECT DIS, vol. 197, no. 11, 2008, pages 1519 - 22, XP055187634, DOI: doi:10.1086/587942
GRUNDLING, A.; O. SCHNEEWIND: "Cross-linked peptidoglycan mediates lysostaphin binding to the cell wall envelope of Staphylococcus aureus", JOURNAL OF BACTERIOLOGY, vol. 188, no. 7, 2006, pages 2463 - 72, XP055091076, DOI: doi:10.1128/JB.188.7.2463-2472.2006
HARE, R.; L. COLEBROOK: "The biochemical reactions of hEmolytic streptococci from the vagina of febeile and afebeile parturient women", THE JOURNAL OF PATHOLOGY AND BACTERIOLOGY, vol. 39, no. 2, 1934, pages 429 - 442
HAREL, J. ET AL.: "Identification of an inducible bacteriophage in a virulent strain of Streptococcus suis serotype 2.", INFECT IMMUN, vol. 71, no. 10, 2003, pages 6104 - 8
HEIMAN F. L. WERTHEIM ET AL: "Streptococcus suis: An Emerging Human Pathogen", CLINICAL INFECTIOUS DISEASES, vol. 48, no. 5, 28 January 2009 (2009-01-28), US, pages 617 - 625, XP055419029, ISSN: 1058-4838, DOI: 10.1086/596763 *
HERMOSO, J.A. ET AL.: "Structural basis for selective recognition of pneumococcal cell wall by modular endolysin from phage Cp-1", STRUCTURE, vol. 11, no. 10, 2003, pages 1239 - 49, XP055189611, DOI: doi:10.1016/j.str.2003.09.005
HEROLD, B.C. ET AL.: "Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk", . JAMA: THE JOURNAL OF THE AMERICAN MEDICAL ASSOCIATION, vol. 279, no. 8, 1998, pages 593 - 598
HOF, H.; K. SZABO; B. BECKER: "Epidemiology of listeriosis in Germany: a changing but ignored pattern].", DEUTSCHE MEDIZINISCHE WOCHENSCHRIFT, vol. 132, no. 24, 1946, pages 1343
HOLDEN, M.T. ET AL.: "Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis.", PLOS ONE, vol. 4, no. 7, 2009, pages e6072, XP002729857, DOI: doi:10.1371/journal.pone.0006072
HOWDEN, B.P. ET AL.: "Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications.", CLIN MICROBIOL REV, vol. 23, no. 1, 2010, pages 99 - 139
HUANG, Y.T. ET AL.: "Bacteremia and infective endocarditis caused by a non-daptomycin-susceptible, vancomycin-intermediate, and methicillin-resistant Staphylococcus aureus strain in Taiwan", J CLIN MICROBIOL, vol. 46, no. 3, 2008, pages 1132 - 6
HUDSON, I.R.: "The efficacy of intranasal mupirocin in the prevention of staphylococcal infections: a review of recent experience.", J HOSP INFECT, vol. 27, no. 2, 1994, pages 81 - 98, XP023271961, DOI: doi:10.1016/0195-6701(94)90001-9
HUSTON ET AL., PNAS USA, vol. 85, 1988, pages 5879 - 5883
IKE ET AL., NUCLEIC ACID RES., vol. 11, 1983, pages 477
ITAKURA ET AL., ANNU. REV. BIOCHEM., vol. 53, 1984, pages 323
ITAKURA ET AL., SCIENCE, vol. 198, 1984, pages 1056
J. BIOL. CHEM., vol. 243, 1969, pages 3552 - 59
J. E. CELIS,: "Cell Biology: A Laboratory Handbook", vol. I-III, 1994
JADO, I. ET AL.: "Phage lytic enzymes as therapy for antibiotic-resistant Streptococcus pneumoniae infection in a murine sepsis model.", J ANTIMICROB CHEMOTHER, vol. 52, no. 6, 2003, pages 967 - 73, XP002597152, DOI: doi:10.1093/jac/dkg485
KARLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877
KAVEY, R.; E.L. KAPLAN: "Resurgence of acute rheumatic fever", PEDIATRICS, vol. 84, no. 3, 1989, pages 585
KILPPERBALZ, R.; K.H. SCHLEIFER: "Streptococcus-Suis Sp-Nov, Nom-Rev", INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, vol. 37, no. 2, 1987, pages 160 - 162
KLEIN, E.; D.L. SMITH; R. LAXMINARAYAN: "Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005", EMERG INFECT DIS, vol. 13, no. 12, 2007, pages 1840 - 6
KLUYTMANS, J.; A. VAN BELKUM, CLIN MICROBIOL REV, vol. 10, no. 3, 1997, pages 505 - 520
KLUYTMANS, J.; A. VAN BELKUM; H. VERBRUGH: "Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks", CLIN MICROBIOL REV, vol. 10, no. 3, 1997, pages 505 - 20
LAMAGNI, T.L. ET AL.: "Epidemiology of severe Streptococcus pyogenes disease in Europe", J CLIN MICROBIOL, vol. 46, no. 7, 2008, pages 2359 - 67
LANCEFIELD, R.C.; R. HARE: "The serological differentiation of pathogenic and non-pathogenic strains of hemolytic streptococci from parturient women", THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 61, no. 3, 1935, pages 335
LAUPLAND, K.B.; T. ROSS; D.B. GREGSON: "Staphylococcus aureus bloodstream infections: risk factors, outcomes, and the influence of methicillin resistance in Calgary, Canada, 2000n2006", JOURNAL OF INFECTIOUS DISEASES, vol. 198, no. 3, 2008, pages 336
LEWIN: "Genes V", 1994, OXFORD UNIVERSITY PRESS, article "Chapter 1,", pages: 9 - 13
LI, M. ET AL.: "Evolution of virulence in epidemic community-associated methicillin-resistant Staphylococcus aureus", PROC NATL ACAD SCI USA, vol. 106, no. 14, 2009, pages 5883 - 8
LOEFFLER ET AL.: "Rapid Killing of Streptococcus pneumoniae with a Bacteriophage Cell Wall Hydrolase", SCIENCE, vol. 294, 7 December 2001 (2001-12-07), pages 2170 - 2172, XP002392510, DOI: doi:10.1126/science.1066869
LOEFFLER, J. M. ET AL., SCIENCE, vol. 294, 2001, pages 2170 - 2172
LOEFFLER, J.M.; D. NELSON; V.A. FISCHETTI: "Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase", SCIENCE, vol. 294, no. 5549, 2001, pages 2170 - 2, XP002392510, DOI: doi:10.1126/science.1066869
LOEFFLER, J.M.; S. DJURKOVIC; V.A. FISCHETTI: "Phage lytic enzyme Cpl-1 as a novel antimicrobial for pneumococcal bacteremia.", INFECT IMMUN, vol. 71, no. 11, 2003, pages 6199 - 204
LOESSNER ET AL., JOURNAL OF BACTERIOLOGY, August 1999 (1999-08-01), pages 4452 - 4460
LOESSNER, M.J. ET AL.: "C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates", MOL MICROBIOL, vol. 44, no. 2, 2002, pages 335 - 49, XP002291418, DOI: doi:10.1046/j.1365-2958.2002.02889.x
LOESSNER, M.J. ET AL.: "Three Bacillus cereus bacteriophage endolysins are unrelated but reveal high homology to cell wall hydrolases from different bacilli", J BACTERIOL, vol. 179, no. 9, 1997, pages 2845 - 51, XP002185395
LOPEZ ET AL., FEMS MICROBIOL. LETT., vol. 100, 1992, pages 439 - 448
LOPEZ ET AL., MICROBIAL DRUG RESISTANCE, vol. 3, 1997, pages 199 - 211
LOPEZ, R. ET AL., MICROB DRUG RESIST, vol. 3, 1997, pages 199 - 211
LUCAS, S.; A. COPELAND; A. LAPIDUS ET AL., SEQUENCING OF THE DRAFT GENOME AND ASSEMBLY OF STREPTOCOCCUS SUIS 89/1591, 2004
M. J. LOESSNER; G. WENDLINGER; S. SCHERER, MOL MICROBIOL, vol. 16, 1995, pages 1231 - 41
M.J. GAIT: "Oligonucleotide Synthesis", 1984
MA, Y.L.; C.P. LU: "Isolation and identification of a bacteriophage capable of infecting Streptococcus suis type 2 strains", VET MICROBIOL, vol. 132, no. 3-4, 2008, pages 340 - 7, XP025533401, DOI: doi:10.1016/j.vetmic.2008.05.013
MANDELL, G.L. ET AL.: "Mandell, Douglas, and Bennett's principles and practice of infectious diseases; 6th", 2005
MARK FENTON: "Recombinant bacteriophage lysins as antibacterials", BIOENGINEERED BUGS, 1 January 2010 (2010-01-01), pages 9 - 16, XP055194564, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3035150/pdf/bbug0101_0009.pdf> [retrieved on 20150609], DOI: 10.4161/bbug.1.1.9818 *
MEYN, L.A.; M.A. KROHN; S.L. HILLIER: "Rectal colonization by group B Streptococcus as a predictor of vaginal colonization", AMERICAN JOURNAL OF OBSTETRICS AND GYNECOLOGY, vol. 201, no. 1, 2009, pages 76, XP026250104, DOI: doi:10.1016/j.ajog.2009.02.011
MILLER, L.G. ET AL.: "Necrotizing fasciitis caused by community-associated methicillin-resistant Staphylococcus aureus in Los Angeles", N ENGL J MED, vol. 352, no. 14, 2005, pages 1445 - 53
MORENS, D.M.; J.K. TAUBENBERGER; A.S. FAUCI: "The persistent legacy of the 1918 influenza virus", N ENGL J MED, vol. 361, no. 3, 2009, pages 225 - 9
NARANG, TETRAHEDRON, vol. 39, 1983, pages 3
NELSON, D ET AL., PROC NATL ACAD SCI USA, vol. 103, no. 28, 2006, pages 10765 - 10770
NELSON, D. ET AL., PROC NATL ACAD SCI USA, vol. 98, 2001, pages 4107 - 4112
NELSON, D. ET AL.: "PlyC: a multimeric bacteriophage lysin", PROC NATL ACAD SCI USA, vol. 103, no. 28, 2006, pages 10765 - 70, XP008136538, DOI: doi:10.1073/pnas.0604521103
NELSON, D.; L. LOOMIS; V.A. FISCHETTI: "Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 98, 2001, pages 4107 - 4112, XP002165225, DOI: doi:10.1073/pnas.061038398
NELSON, D.L. ET AL., PROC NATL ACAD SCI USA, vol. 98, 2001, pages 4107 - 4112
NELSON, D; L. LOOMIS; V.A. FISCHETTI: "Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme", PROC NATL ACAD SCI U S A, vol. 98, no. 7, 2001, pages 4107 - 12, XP002165225, DOI: doi:10.1073/pnas.061038398
O'FLAHERTY, S. ET AL.: "The recombinant phage lysin LysK has a broad spectrum of lytic activity against clinically relevant staphylococci, including methicillin-resistant Staphylococcus aureus", JOURNAL OF BACTERIOLOGY, vol. 187, no. 20, 2005, pages 7161 - 4, XP002449937, DOI: doi:10.1128/JB.187.20.7161-7164.2005
O'FLAHERTY, S.; R.P. ROSS; A. COFFEY: "Bacteriophage and their lysins for elimination of infectious bacteria", FEMS MICROBIOL REV, vol. 33, no. 4, 2009, pages 801 - 19, XP002534655, DOI: doi:10.1111/J.1574-6976.2009.00176.X
P. HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
PARKER, M.T.; A.J. TOMLINSON; R.E. WILLIAMS: "Impetigo contagiosa; the association of certain types of Staphylococcus aureus and of Streptococcus pyogenes with superficial skin infections.", J HYG (LOND, vol. 53, no. 4, 1955, pages 458 - 73
PASTAGIA M ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 55, no. 2, 2011, pages 738 - 44
POHL, E.; R.K. HOLMES; W.G. HOL: "Crystal structure of a cobalt-activated diphtheria toxin repressor-DNA complex reveals a metal-binding SH3-like domain.", J MOL BIOL, vol. 292, no. 3, 1999, pages 653 - 67, XP004466262, DOI: doi:10.1006/jmbi.1999.3073
POWER; HUDSON, J IMMUNOL. METHODS, vol. 242, no. 9, 2000, pages 193 - 204
PRITCHARD DG ET AL., APPL ENVIRON MICROBIOL, vol. 73, no. 22, 2007, pages 7150 - 7154
R.I. FRESHNEY,: "Animal Cell Culture", 1986
RAMASWAMY, V. ET AL.: "Listeria--review of epidemiology and pathogenesis", J MICROBIOL IMMUNOL INFECT, vol. 40, no. 1, 2007, pages 4 - 13
RASHEL, M. ET AL.: "Efficient elimination of multidrug-resistant Staphylococcus aureus by cloned lysin derived from bacteriophage phi MR11", J INFECT DIS, vol. 196, no. 8, 2007, pages 1237 - 47, XP009100811, DOI: doi:10.1086/521305
RECSEI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 1127 - 1131
ROBINSON, J.M.; J.K. HARDMAN; G.L. SLOAN: "Relationship between lysostaphin endopeptidase production and cell wall composition in Staphylococcus staphylolyticus.", J BACTERIOL, vol. 137, no. 3, 1979, pages 1158 - 64
ROMERO ET AL., J. BACTERIOL, vol. 172, 1990, pages 5064 - 5070
RONDA ET AL., EUR. J. BIOCHEM., vol. 164, 1987, pages 621 - 624
ROUSE, M.S. ET AL., ANTIMICROB AGENTS CHEMOTHER, vol. 49, no. 8, 2005, pages 3187 - 3191
ROUSE, M.S. ET AL.: "In vitro and in vivo evaluations of the activities of lauric acid monoester formulations against Staphylococcus aureus", ANTIMICROB AGENTS CHEMOTHER, vol. 49, no. 8, 2005, pages 3187 - 91
RUBENS, C. ET AL.: "Transposon mutagenesis of type III group B Streptococcus: correlation of capsule expression with virulence", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 84, no. 20, 1987, pages 7208
S LUCAS ET AL: "UNIPROT:B9WWF8", UNIPROT, 14 April 2009 (2009-04-14), XP055150805, Retrieved from the Internet <URL:http://ibis/exam/dbfetch.jsp?id=UNIPROT:B9WWF8> [retrieved on 20141104] *
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR, article "chapters 9 and 11"
SANCHEZ ET AL., GENE, vol. 61, 1987, pages 13 - 19
SCHAFFNER ET AL., YALE J. BIOL. & MED., vol. 39, 1967, pages 230
SCHLEIFER, K.H.; O. KANDLER: "Peptidoglycan types of bacterial cell walls and their taxonomic implications.", BACTERIOL REV, vol. 36, no. 4, 1972, pages 407 - 77, XP009098452
SCHMITZ J.E. ET AL., ADV ENVIRON MICROBIOL, vol. 76, no. 21, 2010, pages 7181 - 7187
SCHUCH, R.; D. NELSON; V.A. FISCHETTI: "A bacteriolytic agent that detects and kills Bacillus anthracis", NATURE, vol. 418, no. 6900, 2002, pages 884 - 9, XP002903133, DOI: doi:10.1038/nature01026
SCHUPPLER, M.; M.J. LOESSNER: "The Opportunistic Pathogen Listeria monocytogenes: Pathogenicity and Interaction with the Mucosal Immune System", INT J INFLAM, 2010, pages 704321
SOUTHERN, J. MOL. BIOL., vol. 98, 1975, pages 503
SRISKANDAN S. ET AL., PLOS MEDICINE, vol. 3, no. 5, 2006, pages 585 - 567
SRISKANDAN, S.; J.D. SLATER: "Invasive disease and toxic shock due to zoonotic Streptococcus suis: an emerging infection in the East?", PLOS MED, vol. 3, no. 5, 2006, pages e187
SRISKANDAN, S.; J.D. SLATER: "Invasive Disease and Toxic Shock due to Zoonotic Streptococcus suis: An Emerging Infection in the East?", PLOS MEDICINE, vol. 3, no. 5, 2006, pages 585 - 587
STEER, A.C. ET AL.: "Global emm type distribution of group A streptococci: systematic review and implications for vaccine development", LANCET INFECT DIS, vol. 9, no. 10, 2009, pages 611 - 6, XP026640176, DOI: doi:10.1016/S1473-3099(09)70178-1
SWEDO, S.E. ET AL.: "Identification of children with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections by a marker associated with rheumatic fever.", AM J PSYCHIATRY, vol. 154, no. 1, 1997, pages 110 - 2
TIEMERSMA, E.W. ET AL.: "Methicillin-resistant Staphylococcus aureus in Europe, 7PPPM2002", EMERG INFECT DIS, vol. 10, no. 9, 2004, pages 1627 - 34
TRISTAN, A. ET AL.: "Global distribution of Panton-Valentine leukocidin--positive methicillin-resistant Staphylococcus aureus, 2006", EMERG INFECT DIS, vol. 13, no. 4, 2007, pages 594 - 600
VANDENESCH, F. ET AL.: "Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence.", EMERG INFECT DIS, vol. 9, no. 8, 2003, pages 978 - 84
VOLLMER, W.; D. BLANOT; M.A. DE PEDRO: "Peptidoglycan structure and architecture", FEMS MICROBIOL REV, vol. 32, no. 2, 2008, pages 149 - 67
VON EIFF, C. ET AL.: "Nasal carriage as a source of Staphylococcus aureus bacteremia", NEW ENGLAND JOURNAL OF MEDICINE, vol. 344, no. 1, 2001, pages 11 - 16
VOYICH, J.M. ET AL.: "Insights into mechanisms used by Staphylococcus aureus to avoid destruction by human neutrophils", . J IMMUNOL, vol. 175, no. 6, 2005, pages 3907 - 19
WANG, I. N. ET AL., ANNU REV MICROBIOL, vol. 54, 2000, pages 799 - 825
WANG, I.N.; D.L. SMITH; R. YOUNG: "Holins: the protein clocks of bacteriophage infections", ANNU REV MICROBIOL, vol. 54, 2000, pages 799 - 825, XP002639898
WANG, I.N.; D.L. SMITH; R. YOUNG: "Holins: the protein clocks of bacteriophage infections", ANNUAL REVIEW OF MICROBIOLOGY, vol. 54, 2000, pages 799 - 825, XP002639898
WANG, Y ET AL., CURR MICROBIOL, vol. 58, no. 6, 2009, pages 609 - 615
WANG, Y. ET AL., CURR MICROBIOL, vol. 58, no. 6, 2009, pages 609 - 615
WANG, Y.; J.H. SUN; C.P. LU: "Purified recombinant phage lysin LySMP: an extensive spectrum of lytic activity for swine streptococci.", CURR MICROBIOL, vol. 58, no. 6, 2009, pages 609 - 15, XP019708382
WARD, E.S. ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WERTHEIM, H.F.L. ET AL.: "The role of nasal carriage in Staphylococcus aureus infections", LANCET INFECTIOUS DISEASES, vol. 5, no. 12, 2005, pages 751 - 762, XP005180556, DOI: doi:10.1016/S1473-3099(05)70295-4
WESSELS, M.R. ET AL.: "Definition of a bacterial virulence factor: sialylation of the group B streptococcal capsule", PROC NATL ACAD SCI USA, vol. 86, no. 22, 1989, pages 8983 - 7
WHITE, A.; J. SMITH: "Nasal Reservoir as the Source of Extranasal Staphylococci", ANTIMICROB AGENTS CHEMOTHER (BETHESDA, vol. 161, 1963, pages 679 - 83
WIEGAND, I.; K. HILPERT; R.E. HANCOCK: "Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances", NAT PROTOC, vol. 3, no. 2, 2008, pages 163 - 75
WIEGARD, I ET AL., NAT PROTOC, vol. 3, no. 2, 2008, pages 163 - 175
WILSON, P. ET AL.: "Linezolid resistance in clinical isolates of Staphylococcus aureus", J ANTIMICROB CHEMOTHER, vol. 51, no. 1, 2003, pages 186 - 8
WITZENRATH, M. ET AL.: "Systemic use of the endolysin Cpl-1 rescues mice with fatal pneumococcal pneumonia.", CRIT CARE MED, vol. 37, no. 2, 2009, pages 642 - 9, XP008176236, DOI: doi:10.1097/CCM.0b013e31819586a6
WYLIE, G.P. ET AL.: "Prolylpeptide binding by the prokaryotic SH3-like domain of the diphtheria toxin repressor: a regulatory switch", BIOCHEMISTRY, vol. 44, no. 1, 2005, pages 40 - 51
XU, Q ET AL.: "Structural basis of murein peptide specificity of a gamma-D-glutamyl-l-diamino acid endopeptidase", STRUCTURE, vol. 17, no. 2, 2009, pages 303 - 13
XU, Q. ET AL.: "Structure of the gamma-D-glutamyl-L-diamino acid endopeptidase YkfC from Bacillus cereus in complex with L-Ala-gamma-D-Glu: insights into substrate recognition by NlpC/P60 cysteine peptidases.", ACTA CRYSTALLOGR SECT F STRUCT BIOL CRYST COMMUN, vol. 66, 2010, pages 1354 - 64
YEUNG, M.; S. MATTINGLY: "Biosynthetic capacity for type-specific antigen synthesis determines the virulence of serotype III strains of group B streptococci", INFECTION AND IMMUNITY, vol. 44, no. 2, 1984, pages 217
YOONG, P. ET AL.: "Identification of a broadly active phage lytic enzyme with lethal activity against antibiotic-resistant Enterococcus faecalis and Enterococcus faecium", J BACTERIOL, vol. 186, no. 14, 2004, pages 4808 - 12, XP009136845
YOONG, P. ET AL.: "PlyPH, a bacteriolytic enzyme with a broad pH range of activity and lytic action against Bacillus anthracis", J BACTERIOL, vol. 188, no. 7, 2006, pages 2711 - 4, XP002508817, DOI: doi:10.1128/JB.188.7.2711-2714.2006
YOUNG ET AL., TRENDS IN MICROBIOLOGY, vol. 8, no. 4, March 2000 (2000-03-01)
YOUNG, M.H.; D.M. ARONOFF; N.C. ENGLEBERG: "Necrotizing fasciitis: pathogenesis and treatment.", EXPERT REV ANTI INFECT THER, vol. 3, no. 2, 2005, pages 279 - 94
ZANGWILL, K.; A. SCHUCHAT; J. WENGER: "Group B streptococcal disease in the United States, 1990: report from a multistate active surveillance system", MMWR. CDC SURVEILLANCE SUMMARIES: MORBIDITY AND MORTALITY WEEKLY REPORT. CDC SURVEILLANCE SUMMARIES/CENTERS FOR DISEASE CONTROL, vol. 41, no. 6, 1992, pages 25
ZHANG,A.; YANG,M.; HU,P.; WU,J.; CHEN,B.; HUA,Y.; YU,J.; CHEN,H.; XIAO,J.; JIN,M.: "Comparative genomic analysis of Streptococcus suis reveals significant genomic diversity among different serotype", BMC GENOMICS, vol. 12, 2011, pages 523, XP021111573, DOI: doi:10.1186/1471-2164-12-523
ZIMMER, M. ET AL.: "The murein hydrolase of the bacteriophage phi3626 dual lysis system is active against all tested Clostridium perfringens strains", APPL ENVIRON MICROBIOL, vol. 68, no. 11, 2002, pages 5311 - 7, XP002246439, DOI: doi:10.1128/AEM.68.7.3293-3299.2002

Also Published As

Publication number Publication date
WO2012145630A3 (en) 2014-05-01
AU2017202728A1 (en) 2017-05-18
AU2012245357A1 (en) 2013-11-14
IL271300B (en) 2021-12-01
IL287530A (en) 2021-12-01
CN108578685A (zh) 2018-09-28
AU2012245357B2 (en) 2017-06-08
IL271300A (en) 2020-01-30
IL228869A0 (en) 2013-12-31
US9034322B2 (en) 2015-05-19
NZ616945A (en) 2015-11-27
US20200149025A1 (en) 2020-05-14
IL266476A (en) 2019-06-30
WO2012145630A2 (en) 2012-10-26
US10544407B2 (en) 2020-01-28
MX336427B (es) 2016-01-18
MX2013012241A (es) 2014-05-07
MX370442B (es) 2019-12-13
US11111484B2 (en) 2021-09-07
JP6735796B2 (ja) 2020-08-05
ES2682670T3 (es) 2018-09-21
CA2833409A1 (en) 2012-10-26
JP6284976B2 (ja) 2018-02-28
CN115887627A (zh) 2023-04-04
JP2014518849A (ja) 2014-08-07
US11155799B2 (en) 2021-10-26
NZ713076A (en) 2017-05-26
US20150267185A1 (en) 2015-09-24
AU2017202728B2 (en) 2019-04-04
JP6587655B2 (ja) 2019-10-09
DK2699253T3 (en) 2018-07-16
US9914915B2 (en) 2018-03-13
IL228869B (en) 2019-05-30
US20200002694A1 (en) 2020-01-02
US20220064615A1 (en) 2022-03-03
EP2699253A2 (de) 2014-02-26
CN103857410A (zh) 2014-06-11
US20140072549A1 (en) 2014-03-13
HK1244503A1 (zh) 2018-08-10
EP2699253B1 (de) 2018-03-28
NZ731111A (en) 2019-06-28
US20230167427A9 (en) 2023-06-01
EP2699253A4 (de) 2015-07-01
JP2016147903A (ja) 2016-08-18
CN107189997A (zh) 2017-09-22
JP6139509B2 (ja) 2017-05-31
AU2019204660B2 (en) 2021-01-28
HK1247956A1 (zh) 2018-10-05
MX2021007008A (es) 2022-06-02
US20220127590A1 (en) 2022-04-28
JP2019022504A (ja) 2019-02-14
AU2019204660A1 (en) 2019-07-18
US20170298334A1 (en) 2017-10-19
JP2017171686A (ja) 2017-09-28
IL266476B (en) 2020-01-30

Similar Documents

Publication Publication Date Title
US11111484B2 (en) Streptococcus bacteriophage lysins for detection and treatment of gram positive bacteria
US20140179594A1 (en) Streptococcus bacteriophage lysins for treatment of gram positive bacteria in companion animals and livestock
AU2018203076B2 (en) Dimeric bacteriophage lysins
NZ616945B2 (en) Streptococcus bacteriophage lysins for detection and treatment of gram positive bacteria
NZ713076B2 (en) Streptococcus bacteriophage lysins for detection and treatment of gram positive bacteria
NZ731111B2 (en) Streptococcus bacteriophage lysins for detection and treatment of gram positive bacteria

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN PUBLISHED

AC Divisional application: reference to earlier application

Ref document number: 2699253

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SCHMITZ, JONATHAN

Inventor name: GILMER, DANIEL

Inventor name: FISCHETTI, VINCENT, A

Inventor name: EULER, CHAD

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20180605

RBV Designated contracting states (corrected)

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1247956

Country of ref document: HK

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20181130

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230526

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20240123

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN