EP2893025A1 - Plateforme d'intégration de transgène génétiquement modifié (etip) pour le ciblage génique et l'empilement de caractères - Google Patents

Plateforme d'intégration de transgène génétiquement modifié (etip) pour le ciblage génique et l'empilement de caractères

Info

Publication number
EP2893025A1
EP2893025A1 EP13835965.8A EP13835965A EP2893025A1 EP 2893025 A1 EP2893025 A1 EP 2893025A1 EP 13835965 A EP13835965 A EP 13835965A EP 2893025 A1 EP2893025 A1 EP 2893025A1
Authority
EP
European Patent Office
Prior art keywords
seq
nucleic acid
acid molecule
dna
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP13835965.8A
Other languages
German (de)
English (en)
Other versions
EP2893025B1 (fr
EP2893025A4 (fr
Inventor
Noel COGAN
John Forster
Matthew Hayden
Tim SAWBRIDGE
German Spangenberg
Steven R. Webb
Manju Gupta
W. Mike AINLEY
Matthew J. Henry
John Mason
Sandeep Kumar
Stephen Novak
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Corteva Agriscience LLC
Original Assignee
Dow AgroSciences LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dow AgroSciences LLC filed Critical Dow AgroSciences LLC
Publication of EP2893025A1 publication Critical patent/EP2893025A1/fr
Publication of EP2893025A4 publication Critical patent/EP2893025A4/fr
Application granted granted Critical
Publication of EP2893025B1 publication Critical patent/EP2893025B1/fr
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination

Definitions

  • the disclosure relates to the field of plant precision transformation, gene targeting, targeted genomic integration and protein expression in plants.
  • the disclosure describes an Engineered Transgene Integration Platform (ETIP) that can be inserted randomly or at targeted locations in plant genomes.
  • EIP Engineered Transgene Integration Platform
  • Precision gene modification overcomes the logistical challenges of conventional practices in plant systems and has been a long-standing goal of basic plant researchers and agricultural biotechnologists.
  • gene targeting via positive-negative drug selection in rice, or the use of pre- engineered restriction sites, targeted genome modification in all plant species, both model and crop, has until recently proven elusive.
  • Terada et al. (2002) Nat Biotechnol 20(10): 1030; Terada et al. (2007) Plant Physiol 144(2):846; D'Halluin et al. (2008) Plant Biotechnology J. 6(1):93.
  • targeted cleavage events can be used, for example, to induce targeted mutagenesis or targeted deletions of cellular DNA sequences, or facilitate targeted recombination at a predetermined chromosomal locus. See, e.g., United States Patent Publications 2003/0232410, 2005/0208489, 2005/0026157, 2005/0064474 and 2006/0188987, and International Publication WO 2007/014275.
  • U.S. Patent Publication No. 2008/0182332 discloses the use of non-canonical zinc finger nucleases (ZFNs) for targeted modification of plant genomes.
  • ZFNs non-canonical zinc finger nucleases
  • U.S. Patent Application No. 12/284,888 describes ZFN-mediated targeted integration into a plant EPSPS locus.
  • the need for finding compositions and methods for identification, selection and rapid advancement of stable, targeted integration into precise locations within a plant genome still remains.
  • An embodiment of the subject disclosure relates to a method for producing a transgenic plant cell.
  • a plant cell having genomic DNA comprising a targetable nucleic acid molecule is provided. Further embodiments include the targetable nucleic acid molecule comprising: at least one site specific nuclease recognition site; a first fragment of a first marker gene; and, a second fragment of a second marker gene.
  • the plant cell is transformed with a donor nucleic acid molecule and a site specific nuclease nucleic acid molecule.
  • the genomic DNA of the plant cell is cleaved with the at least one site specific nuclease recognition site.
  • An additional embodiment includes the integration of the donor nucleic acid molecule into the targetable nucleic acid molecule, wherein the integration within the targetable nucleic acid molecule comprises at least one functional marker gene, to produce the transgenic plant cell, the transgenic plant cell comprising the targetable nucleic acid molecule and integrated donor nucleic acid molecule comprising at least one functional marker gene.
  • the subject disclosure relates to a Brassica napus chromosomal target site selected from the group consisting of nucleotides 1-579 of SEQ ID NO: 431 to nucleotide 166-732 of SEQ ID NO:432, nucleotides 1-550 of SEQ ID NO:433 to nucleotides 190-653 of SEQ ID NO:434, nucleotides 1-298 of SEQ ID NO:435 to 51-644 of SEQ ID NO:436, nucleotides 1-536 of SEQ ID NO:437 to nucleotides 146-545 of SEQ ID NO:438, nucleotides, nucleotides 1-431 of SEQ ID NO:439 to nucleotides 167-685 of SEQ ID NO:440, nucleotides 1-599 of SEQ ID NO:441 to nucleotides 116-521 of SEQ ID NO:442, nucleotides 1-298 of SEQ ID NO:443 to nucleotides
  • the subject disclosure relates to a method for producing a transgenic plant cell.
  • Further embodiments include the targetable nucleic acid molecule comprising: at least one site specific nuclease recognition site; a first fragment of a first marker gene; and, a second fragment of a second non- coding polynucleotide sequence.
  • the plant cell is transformed with a donor nucleic acid molecule and a site specific nuclease nucleic acid molecule.
  • the genomic DNA of the plant cell is cleaved with the at least one site specific nuclease recognition site.
  • An additional embodiment includes the integration of the donor nucleic acid molecule into the targetable nucleic acid molecule, wherein the integration within the targetable nucleic acid molecule comprises at least one functional marker gene, to produce the transgenic plant cell, the transgenic plant cell comprising the targetable nucleic acid molecule and integrated donor nucleic acid molecule comprising at least one functional marker gene.
  • Figure 1A-1E Shows a sequence alignment of FAD2 gene sequences, generated using AlignX®.
  • Figure 2 Shows a phylogenetic tree of FAD2 gene sequences generated using JalviewTM v2.3 based on neighbor joining distances.
  • Figure 3A-3M' Shows a sequence alignment of FAD3 gene sequences, generated using AlignX®.
  • Figure 4 Shows a phylogenetic tree of FAD3 gene sequences generated using JalviewTM v2.3 based on neighbour joining distances.
  • the labeled sequences correspond as follows: FAD3A7A" is described throughout this application as FAD3A'; Haplotype2 is described throughout the application as FAD3C; Haplotype 1 is described throughout the application as FAD3C"; and, Haplotype 3 is described throughout the application as FAD3A".
  • FIG. 5 Shows a plasmid map of pDAB104010 and presents a representative Zinc Finger Nuclease (ZFN) expression cassette. The lay-out of this construct was similar for the other ZFN expression cassettes, wherein the Zinc Finger domains, 24828 and 24829, were exchanged with alternative Zinc Finger domains that are described below.
  • ZFN Zinc Finger Nuclease
  • Figure 6 is an example multiple line graph showing number of sequence reads per 10,000 sequence reads with deletions at the target ZFN site.
  • the X axis on the graph denotes number of bases deleted
  • the Y axis denotes number of sequence reads
  • the Z axis denotes colour-coded sample identity as described to the right of the graph. Specific example shown is for locus 1 of the FAD2 gene family that contains 3 target ZFN sites, A, B and C with the four gene family members and two control transfections assessed as control samples A and B.
  • Figure 7 (A) The figure displays data from ZFN targeting locus 4 of the FAD2 gene family. The locus contains two ZFN sites and two requisite control transfections.
  • Figure 8 Shows a plasmid map of pDAS000130.
  • Figure 9 Shows a plasmid map of pDAS000271.
  • Figure 10 Shows a plasmid map of pDAS000272.
  • Figure 1 1 Shows a plasmid map of pDAS000273.
  • Figure 12 Shows a plasmid map of pDAS000274.
  • Figure 13 Shows a plasmid map of pDAS000275.
  • Figure 14 Shows a plasmid map of pDAS000031.
  • Figure 15 Shows a plasmid map of pDAS000036.
  • Figure 16 Shows a plasmid map of pDAS000037.
  • Figure 17 Illustrates an ETIP and payload nucleic acid configuration, as well as the product of the targeted Payload at the ETIP site in the plant cell genome.
  • Figure 18 Illustrates transformation of protoplast cells followed by FACS selection of targeted Payload DNA at the ETIP in the host line using reconstruction of truncated scorable and selectable markers at both the 3' and 5' ends.
  • Figure 19A-B Illustrates the homology directed repair of the ETIP canola event which results from the double stranded DNA cleavage of the genomic locus by the Zinc Finger Nuclease (pDAS000074 or pDAS000075) and the subsequent integration of the Ds-red donor (pDAS000068, pDAS000070, or pDAS000072) into the ETIP locus of the canola chromosome.
  • the integration of the donor into the genomic locus results in a fully functional, highly expressing Ds-red transgene.
  • Figure 20 Shows the FACS sorting of canola protoplasts and the calculated transfection efficiency of canola protoplasts that were transfected with pDAS000031 ('pDAS31 '). In addition, the FACS sorting results of untransformed canola protoplasts are provided as a negative control.
  • Figure 21 Shows the FACS sorting of canola protoplasts and the calculated transfection efficiency of canola ETIP protoplast events which were transfected with pDAS000064 / pDAS000074 (top graph) and pDAS000064 / pDAS000075 (bottom graph).
  • Figure 22 Shows the FACS sorting of canola protoplasts and the calculated transfection efficiency of canola ETIP protoplast events which were transformed with pDAS000068 / pDAS000074 (top graph) and pDAS000068 / pDAS000075 (bottom graph).
  • Figure 23 Shows the FACS sorting of canola protoplasts and the calculated transfection efficiency of canola ETIP protoplast events which were transformed with pDAS000070 / pDAS000074 (top graph) and pDAS000070 / pDAS000075 (bottom graph).
  • Figure 24 Shows the FACS sorting of canola protoplasts and the calculated transfection efficiency of canola ETIP protoplast events which were transformed with pDAS000072 / pDAS000074 (top graph) and pDAS000072 / pDAS000075 (bottom graph).
  • Figure 25 Shows a plasmid map of pDAS000074.
  • Figure 26 Shows a plasmid map of pDAS000075.
  • Figure 27 Shows a plasmid map of pDAS000064.
  • Figure 28 Shows a plasmid map of pDAS000068.
  • Figure 29 Shows a plasmid map of pDAS000070.
  • Figure 30 Shows a plasmid map of pDAS000072.
  • Figure 31 Is a schematic showing binding sites of transgene target primers and probe for transgene copy number estimation assay.
  • Figure 32 Shows a Sequencher file showing FAD2A ZFN DNA recognition domain (bcl2075 Fad2a-r272a2 and bcl2075_Fad2a-278a2), and binding sites of ZFN specific primers (FAD2A.UnE.Fl and FAD2A.UnE.Rl) and endogenous primers (FAD2A/2C.RB.UnE.Fl and FAD2A/2C.RB.UnE.Rl).
  • Figure 33 Shows a schematic showing binding sites of endogenous and transgene target primers used in the detection of transgene integration at FAD2A via perfect HDR.
  • Figure 34 Is a schematic showing where Kpnl restriction endonuclease sites would occur in a perfectly edited FAD2A locus, and where FAD2a 5', hph and FAD2A 3 ' Southern probes bind.
  • Figure 35 Shows representative data output from copy number estimation qPCR.
  • the left hand column represents data obtained from a known To transgenic plant with a single random transgene insert and is used as the calibrator sample to which all other samples are 'normalized' against.
  • the right hand column is a known To transgenic plant with 5 transgene integrations. The insert copy numbers for both plants was determined using Southern analysis. The remaining columns provide copy number estimates for the putative transgenic plants.
  • the columns are labeled from left to rightffigur as; 1 copy control, 310420, 311819, 311821, 31 1822, 31 1823, 31 1824, 31 1827, 312524, 312525, 312526, 312527, 312529, 312530, 312532, 313810, 31381 1 , 313905, 313941 , 313942, 313944, and 5 copy control.
  • the columns can be used to determine the estimated copy number for each transgenic plant.
  • wildtype plants, non-transformed control plants, and plasmid only controls do not result in a copy number as they do not possess a Cq for both the hph and HMG I/Y target.
  • Figure 36 Shows a plasmid map of pDAB 105855 containing target DNA sequence comprising; RB7 MAR sequence/eZFN4 Binding site vl , OsUbi3 promoter/ Phi YFP/ ZmPer5 3 'UTR v2/eZFNl binding site/ELPl HR2 v2, ZmUbil promoter v8/ Cry34Abl v2/StPinII 3' UTR v2, TaPer promoter v3/Cry35Abl v5/StPinII 3' UTR v2, SCBVv2/AAD-lv3/ZmLip 3' UTR vl between T-DNA borders.
  • Figure 37 Shows a plasmid map of pDAB105941 comprising a ZFN1 coding sequence under the expression of maize Ubiquitin 1 promoter with intronl (ZmUbil promoter v2) and ZmPer5 3 'UTR v2.
  • Figure 38 Shows a plasmid map of pDABl 12366 containing promoterless intron (rubi3 intron) of Rice Ubiquitin 3 (OsUbi3) promoter followed by a herbicide tolerance gene (phosphinothricin acetyl transferase (PAT); and ZmLip 3 'UTR.
  • Figure 39 Provides a schematic for using an ET1P site integrated within the genome for targeting of a donor polynucleotide comprising a gene expression cassette.
  • the donor is capable of expression of the transgene if integration occurs within the ETIP locus. Random integration of the donor does not result in expression of the transgene, as there are typically no promoter elements that can drive expression.
  • ETIP Engineered Transgene Integration Platform
  • a targetable nucleic acid molecule that is stably integrated into the genome of a plant cell and serves as the host germplasm for transformation and integration of a donor nucleic acid molecule.
  • the disclosure relates to the field of plant precision transformation, gene targeting, targeted genomic integration and protein expression in plants.
  • an ETIP can be inserted randomly or at targeted locations in plant genomes to facilitate the rapid selection and detection of one or more genes of interest (GOI) that have been targeted (both the 3' and 5' ends) at the ETIP genomic location.
  • GOI genes of interest
  • specific double-stranded breaks may be introduced within the ETIP.
  • a method for selection and enrichment of targeted, isolated cells or protoplasts, followed by the regeneration of fertile plants using flow cytometry and FACS is described.
  • Particular methods include producing a transgenic plant cell having a stable, heritable genetic modification in the plant and its progeny, as well as the composition of the transgenic plant.
  • an ETIP is described for use in a precision plant transformation system, wherein the ETIP comprising an integration nucleic acid is stably integrated into the host germplasm.
  • Other embodiments relate to methods for producing a transgenic plant cell such that the plant cell genomic DNA includes at least one stably-integrated functional marker gene.
  • the method comprises using a targetable nucleic acid molecule containing one or more targeting site specific nuclease recognition sites, a first fragment of a first marker gene, and a second fragment of a second marker gene.
  • the donor nucleic acid molecule comprises a nucleotide sequence of interest and two nucleic acid sequences flanking the nucleic acid sequence of interest.
  • the two nucleic acid sequences flanking the nucleic acid sequence of interest are a first and second homology arm nucleic acid sequence.
  • the donor nucleic acid molecule is used to transform the plant cell.
  • the homology arm nucleic acid sequences may be homologous with regions of the ETIP or the targetable nucleic acid molecule sequence and may be homologous to the first and second fragment of the first and second marker genes of the targetable nucleic acid molecule.
  • compositions of, and methods for producing, transgenic plants wherein the donor nucleic acid molecule expresses one or more products of an exogenous nucleic acid sequence (e.g., a protein or a RNA molecule) that has been stably-integrated into an ETIP or the targetable nucleic acid molecule in a plant cell.
  • an ETIP or the targetable nucleic acid molecule uses zinc finger nuclease binding sites or a site specific nuclease comprising a protein expressing zinc finger nuclease activity.
  • a site specific nuclease is comprised of other additional targeting technologies such as meganucleases, TALs, RNA-guided CRISPR-Cas9, or leucine zippers.
  • the ETIP is a targetable nucleic acid molecule that facilitates the testing of gene candidates and plant expression vector designs of the early development phases of the transgenic plant development process.
  • a transgenic plant cell includes an integration nucleic acid molecule having a polynucleotide sequence with one or more targeting site specific nuclease recognition sites and a first and second fragment of a first and second marker gene. It is understood that the marker gene fragments may not encode a functional marker gene expression product.
  • the marker genes may comprise an intron nucleic acid sequence as an embodiment. In other embodiments, the marker genes may comprise a homology arm nucleic acid sequence.
  • one or two or more regions of the donor nucleic acid molecule lacks sequence homology with plant genomic DNA (exogenous).
  • the donor nucleic acid molecule may comprise homology arm nucleic acid sequence.
  • the homology arm nucleic acid sequences of the donor nucleic acid molecule may be integrated into the regions flanking the site specific nuclease restriction site of the targetable nucleic acid molecule.
  • the homology arm sequences may be from 50 bp to 3 kb in length.
  • the donor nucleic acid molecule may comprise exogenous nucleic acid sequences which enable targeting to the ETIP targetable nucleic acid molecule and selection at the 5' and 3' ends for precisely targeted events.
  • Products of an exogenous nucleic acid sequences can comprise, for example, one or more genes or cDNA molecules, or any type of coding or non-coding nucleotide sequence, as well as one or more regulatory gene elements (e.g., promoters).
  • the design of the donor nucleic acid molecule enables excision of coding and non-coding DNA, including but not limited to selectable markers, following selected integration of donor DNA into the ETIP .
  • the ETIP targetable nucleic acid molecule may include a first fragment of a first marker gene and a second fragment of and second marker gene, and the donor nucleic acid molecule containing a corresponding second fragment of the first marker gene and a first fragment of the second marker gene.
  • the first fragment of the first marker gene may be located at the 5' end of the targetable nucleic acid molecule, with the second fragment of the second marker gene located at the 3' end of the targetable nucleic acid molecule, such that stably integrating the donor nucleic acid molecule, comprising the second fragment of the first marker gene and the first fragment of the second marker gene, into the plant cell's genome generates a functional first marker gene and second marker gene.
  • these marker genes may be used to select for stable integration of the ETIP.
  • suitable marker genes may include PMI, Xyl(A), YFP, DSR, GFP, GUS, NPTII, AAD-1 , AAD-12, DGT-28, AHAS, PAT, DSM-2, HYG, BAR, and fluorescent proteins.
  • the marker gene is a visually screenable marker gene, the presence of which can be determined by monitoring a cell for a change in color.
  • the marker gene is a selectable marker gene (e.g., encoding a herbicide or antibiotic resistance gene) the presence of which is selected for using a herbicide or antibiotic that reduces cell growth.
  • the marker gene is a positive selectable marker gene.
  • reporter genes can be incorporated into a chosen expression vector to allow for identification and selectable of transformed plants ("transformants").
  • Many methods are available to confirm expression of selectable markers in transformed plants, including for example DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for detection of a protein expressed from the vector, e g., precipitated protein that mediates phosphinothncin resistance, or visual observation of other proteins such as reporter genes encoding ⁇ -glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), DsRed, ⁇ -galactosidase, chloramphenicol acetyltransferase (CAT), alkaline phosphatase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, N.Y., 2001).
  • Selectable marker genes are utilized for selection of transformed cells or tissues.
  • Selectable marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT) as well as genes conferring resistance to herbicidal compounds.
  • Herbicide resistance genes generally code for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, resistance to glyphosate has been obtained by using genes coding for mutant target enzymes, 5- enolpyravylshikimate-3 -phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known, and further described below.
  • glufosinate ammonium, bromoxynil, and 2,4-dichlorophenoxyacetate (2,4-D) have been obtained by using bacterial genes encoding pat or DSM-2, a nitrilase, an aad- ⁇ , or an aad- 12 gene, which detoxifies the respective herbicides.
  • herbicides can inhibit the growing point or meristem, including imidazolinone or sulfonylurea, and genes for resistance/tolerance of acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS) for these herbicides are well known.
  • Glyphosate resistance genes include mutant 5- enolpyruvylshikimate-3-phosphate synthase (EPSPs) and dgt-28 genes (via the introduction of recombinant nucleic acids and/or various forms of in vivo mutagenesis of native EPSPs genes), aroA genes and glyphosate acetyl transferase (GAT) genes, respectively).
  • Resistance genes for other phosphono compounds include bar genes from Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes, and pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase inhibitor-encoding genes).
  • Exemplary genes conferring resistance to cyclohexanediones and/or aryloxyphenoxypropanoic acid include genes of acetyl coenzyme A carboxylase (ACCase)— Accl -SI, Accl-S2 and Accl-S3.
  • herbicides can inhibit photosynthesis, including triazine (psbA and 1 s+ genes) or benzonitrile (nitrilase gene).
  • selectable marker genes include, but are not limited to genes encoding: neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; dihydrodipicolinate synthase and desensitized aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2- dichloropropionic acid dehalogenase; acetohydroxyacid synthase; 5-enol
  • An embodiment also includes genes encoding resistance to: chloramphenicol; methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin.
  • selectable marker genes are not meant to be limiting. Any reporter or selectable marker gene are encompassed by the present invention.
  • the ETIP targetable polynucleotide molecule is integrated into a genomic locus.
  • the FAD2, FAD3, and IP 1 genomic loci may be selected as targets for ETIP integration and subsequent integration of a donor polynucleotide donor molecule.
  • Disruption of the FAD2 and FAD3 endogenous genes has been shown to have no adverse impact on the agronomic or quality properties of the plant cell. Accordingly, no agronomic or quality penalties associated with plant or plant product performance (canola, soybean, corn, etc.), and bundling of traits associated with specific oil quality characteristics accelerates introgression and new germplasm development are observed when the FAD2 and FAD3 sites are disrupted.
  • the donor nucleotide sequence molecule may be linked to a regulatory element such as a promoter, intron, 5'UTR or 3'UTR.
  • the integration of the donor nucleic acid molecule into an ETIP may be facilitated by targeted double-strand cleavage of a site specific nuclease.
  • the site specific nuclease may be located within the ETIP targetable nucleic acid molecule.
  • site specific nuclease may be located within the ETIP targetable nucleic acid molecule comprising an Engineered Landing Pad (ELP), see US Patent No. 20110191899.
  • ELP Engineered Landing Pad
  • the site specific nuclease may be located within or in proximity to an ELP within the selected ETIP.
  • Cleavage may be targeted to an ETIP through the use of fusion proteins comprising a DNA-binding domain, such as a meganuclease DNA-binding domain, RNA-guided CRISPR-Cas9 DNA-binding domain, a leucine zipper DNA-binding domain, a TAL DNA-binding domain, a zinc finger protein (ZFP), zinc finger nuclease, or chimeric combinations of the aforementioned, which are designed to bind an engineered sequence within the selected ETIP.
  • a DNA-binding domain such as a meganuclease DNA-binding domain, RNA-guided CRISPR-Cas9 DNA-binding domain, a leucine zipper DNA-binding domain, a TAL DNA-binding domain, a zinc finger protein (ZFP), zinc finger nuclease, or chimeric combinations of the aforementioned, which are designed to bind an engineered sequence within the selected ETIP.
  • ZFP zinc finger protein
  • Integration of donor nucleic acid molecules using the disclosed methods can proceed through both homology-dependent and homology-independent mechanisms, with the selection of targeted events achieved through screening for novel selectable and or scorable markers which are functional in targeted events at both the 3' and 5' regions of the ETIP.
  • the present disclosure demonstrates the use of novel Engineered Zinc Finger Binding Sites and ZFNs to achieve selected double-strand breaks at the ETIP.
  • novel engineered DNA-binding domains bind to one or more target sites in an ETIP that do not exist within the native plant cell genome.
  • the DNA-binding domain(s) can include, for example, any of the engineered zinc finger DNA binding domains comprising the recognition helices, such as those described in U.S. Application No: 12/931,096.
  • any of the DNA binding domains described herein may further comprise a functional domain, for example a cleavage domain or cleavage half-domain.
  • the cleavage half-domain can be from a Type IIS restriction endonuclease such as Fokl or Stsl.
  • Further embodiments of the cleavage domain can comprise a homing endonuclease, such as, for example, a homing endonuclease with a modified DNA-binding domain.
  • Embodiments of the subject disclosure include use of a zinc finger DNA binding protein.
  • a zinc finger DNA binding protein, "ZFP,” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • Zinc finger binding domains may be "engineered” to bind to a predetermined nucleotide sequence.
  • Non-limiting examples of methods for engineering zinc finger proteins are design and selection.
  • a designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria.
  • Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; 6,534,261; and 6,785,613; see, also WO 98153058; WO 98153059; WO 98153060; WO 021016536 and WO 031016496; and U.S. Patents 6,746,838; 6,866,997; and 7,030,215.
  • a zinc finger nuclease may be employed.
  • a ZFN may be any zinc finger nuclease that can be delivered to a plant cell according to the subject disclosure.
  • ZFNs may comprise fusion proteins comprising a cleavage domain (or a cleavage half-domain) and a zinc finger binding domain, polynucleotides encoding these proteins and combinations of polypeptides and polypeptide-encoding polynucleotides.
  • a zinc finger binding domain may comprise one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers), and may be engineered to bind to any region of interest.
  • a fusion protein or proteins
  • the presence of such a fusion protein (or proteins) in a cell will result in binding of the fusion protein(s) to its (their) binding site(s) and cleavage within or near said region of interest.
  • homologous recombination occurs at a high rate between the double strand break nucleotide sequence and the exogenous polynucleotide.
  • homologous recombination refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms.
  • This process requires nucleotide sequence homology, uses a "donor” molecule to template repair of a "target” molecule (i.e., the one that experienced the double-strand break), and is variously known as “non-crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic infonnation from the donor to the target.
  • transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or "synthesis-dependent strand annealing,” in which the donor is used to resynthesize genetic information that will become part of the target, and/or related processes.
  • Such specialized homologous recombination often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
  • one or more targeted site specific nucleases as described herein create a double-stranded break in the target sequence (e.g., cellular chromatin) at a predetermined site, and a "donor" polynucleotide, having homology to the nucleotide sequence in the region of the break, can be introduced into the cell.
  • the presence of the double-stranded break has been shown to facilitate integration of the donor sequence.
  • the donor sequence may be physically integrated or, alternatively, the donor polynucleotide is used as a template for repair of the break via homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the donor into the cellular chromatin.
  • a first sequence in cellular chromatin can be altered and, in certain embodiments, can be converted into a sequence present in a donor polynucleotide.
  • the use of the tenns "replace” or “replacement” can be understood to represent replacement of one nucleotide sequence by another, (i.e., replacement of a sequence in the informational sense), and does not necessarily require physical or chemical replacement of one polynucleotide by another.
  • site-specific integration may be accomplished by utilizing factors that are capable of recognizing and binding to particular nucleotide sequences, for example, in the genome of a host organism.
  • factors that are capable of recognizing and binding to particular nucleotide sequences, for example, in the genome of a host organism.
  • many proteins comprise polypeptide domains that are capable of recognizing and binding to DNA in a site-specific manner.
  • a DNA sequence that is recognized by a DNA-binding polypeptide may be referred to as a "target" sequence.
  • Polypeptide domains that are capable of recognizing and binding to DNA in a site-specific manner generally fold correctly and function independently to bind DNA in a site-specific manner, even when expressed in a polypeptide other than the protein from which the domain was originally isolated.
  • target sequences for recognition and binding by DNA-binding polypeptides are generally able to be recognized and bound by such polypeptides, even when present in large DNA structures (e.g., a chromosome), particularly when the site where the target sequence is located is one known to be accessible to soluble cellular proteins (e.g., a gene).
  • DNA-binding polypeptides identified from proteins that exist in nature typically bind to a discrete nucleotide sequence or motif (e.g., a consensus recognition sequence), methods exist and are known in the art for modifying many such DNA- binding polypeptides to recognize a different nucleotide sequence or motif.
  • DNA- binding polypeptides include, for example and without limitation: zinc finger DNA- binding domains; leucine zippers; UPA DNA-binding domains; GAL4; TAL; LexA; RNA-guided CRISPR-Cas9; a Tet repressor; LacR; and a steroid hormone receptor.
  • a DNA-binding polypeptide is a zinc finger.
  • Individual zinc finger motifs can be designed to target and bind specifically to any of a large range of DNA sites.
  • Canonical Cys 2 His 2 (as well as non-canonical Cys 3 His) zinc finger polypeptides bind DNA by inserting an a-helix into the major groove of the target DNA double helix.
  • Recognition of DNA by a zinc finger is modular; each finger contacts primarily three consecutive base pairs in the target, and a few key residues in the polypeptide mediate recognition.
  • the DNA-binding specificity of the targeting endonuclease may be further increased (and hence the specificity of any gene regulatory effects conferred thereby may also be increased). See, e.g., Urnov et al. (2005) Nature 435:646-51.
  • one or more zinc finger DNA-binding polypeptides may be engineered and utilized such that a targeting endonuclease introduced into a host cell interacts with a DNA sequence that is unique within the genome of the host cell.
  • the zinc finger protein is non-naturally occurring in that it is engineered to bind to a target site of choice. See, for example, Beerli et al. (2002)
  • An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein.
  • Engineering methods include, but are not limited to, rational design and various types of selection.
  • Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Patents 6,453,242 and 6,534,261.
  • Exemplary selection methods including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186; WO 98/53057; WO 00/27878; WO 01/88197 and GB 2,338,237.
  • enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned WO 02/077227.
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • a DNA-binding polypeptide is a DNA-binding domain from GAL4.
  • GAL4 is a modular transactivator in Saccharomyces cerevisiae, but it also operates as a transactivator in many other organisms. See, e.g., Sadowski et al. (1988) Nature 335:563-4. In this regulatory system, the expression of genes encoding enzymes of the galactose metabolic pathway in S. cerevisiae is stringently regulated by the available carbon source. Johnston (1987) Microbiol. Rev. 51 :458-76. Transcriptional control of these metabolic enzymes is mediated by the interaction between the positive regulatory protein, GAL4, and a 17 bp symmetrical DNA sequence to which GAL4 specifically binds (the UAS).
  • Native GAL4 consists of 881 amino acid residues, with a molecular weight of 99 kDa. GAL4 comprises functionally autonomous domains, the combined activities of which account for activity of GAL4 in vivo. Ma and Ptashne (1987) Cell 48:847- 53); Brent and Ptashne (1985) Cell 43(3 Pt 2):729-36. The N-terminal 65 amino acids of GAL4 comprise the GAL4 DNA-binding domain. Keegan et al. (1986) Science 231 :699-704; Johnston (1987) Nature 328:353-5. Sequence-specific binding requires the presence of a divalent cation coordinated by 6 Cys residues present in the DNA binding domain.
  • the coordinated cation-containing domain interacts with and recognizes a conserved CCG triplet at each end of the 17 bp UAS via direct contacts with the major groove of the DNA helix.
  • the DNA-binding function of the protein positions C-terminal transcriptional activating domains in the vicinity of the promoter, such that the activating domains can direct transcription.
  • Additional DNA-binding polypeptides that may be utilized in certain embodiments include, for example and without limitation, a binding sequence from a AVRBS3 -inducible gene; a consensus binding sequence from a AVRB S3 -inducible gene or synthetic binding sequence engineered therefrom (e.g., UP A DNA-binding domain); TAL; LexA (see, e.g., Brent & Ptashne (1985), supra); LacR (see, e.g., Labow et al. (1990) Mol. Cell. Biol. 10:3343-56; Bairn et al. (1991) Proc. Natl. Acad. Sci.
  • the DNA-binding domain of one or more of the nucleases used in the methods and compositions described herein comprises a naturally occurring or engineered (non-naturally occurring) TAL effector DNA binding domain.
  • TAL effector DNA binding domain e.g., U.S. Patent Publication No. 20110301073.
  • the plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. Pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system which injects more than 25 different effector proteins into the plant cell.
  • TAL transcription activator-like effectors
  • AvrBs3 from Xanthomonas campestgris pv. Vesicatoria (see Bonas et al (1989) Mol Gen Genet 218: 127-136 and WO2010079430).
  • TAL-effectors contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA binding specificity of these proteins.
  • Ralstonia solanacearum two genes, designated brgl 1 and hpxl7 have been found that are homologous to the AvrBs3 family of Xanthomonas in the R. solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain RS1000 (See Heuer et al (2007) Appl and Envir Micro 73(13): 4379-4384).
  • genes are 98.9% identical in nucleotide sequence to each other but differ by a deletion of 1,575 bp in the repeat domain of hpxl7.
  • both gene products have less than 40% sequence identity with AvrBs3 family proteins of Xanthomonas. See, e.g., U.S. Patent No ' s., 8,420,782 and 8,440,431 and U.S. Patent Publication No. 201 10301073.
  • the nuclease comprises a CRISPR/Cas system.
  • the CRISPR (clustered regularly interspaced short palindromic repeats) locus which encodes RNA components of the system
  • the cas (CRISPR-associated) locus which encodes proteins (Jansen et al., 2002. Mol. Microbiol. 43: 1565-1575; Makarova et al, 2002. Nucleic Acids Res. 30: 482-496; Makarova et al., 2006. Biol. Direct 1 : 7; Haft et al, 2005. PLoS Comput. Biol. 1 : e60) make up the gene sequences of the CRISPR/Cas nuclease system.
  • CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage.
  • the Type II CRISPR is one of the most well characterized systems and carries out targeted DNA double-strand break in four sequential steps.
  • Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Wastson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition.
  • PAM protospacer adjacent motif
  • Activity of the CRISPR/Cas system comprises of three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks, in a process called 'adaptation', (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA -mediated interference with the alien nucleic acid.
  • 'Cas' proteins are involved with the natural function of the CRISPR/Cas system and serve roles in functions such as insertion of the alien DNA etc.
  • Cas protein may be a "functional derivative” of a naturally occurring Cas protein.
  • a “functional derivative” of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide.
  • “Functional derivatives” include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide.
  • a biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments.
  • the term “derivative” encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof.
  • Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof.
  • Cas protein which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures.
  • the cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas.
  • the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.
  • repairing the double strand breaks may comprise removing the material between the double strand breaks and rejoining the ends of the nucleotide sequence so as to excise the sequences between the double strand breaks.
  • the excised sequences may, without limitation, comprise sequences encoding all or a portion of a nucleotide sequence encoding a highly, more highly, very highly, or most highly expressed protein.
  • the excised sequences may, without limitation, comprise regulatory sequences effecting the expression of a highly, more highly, very highly, or most highly expressed protein. In such embodiments, the expression of the highly, more highly, very highly, or most highly expressed protein is decreased relative to levels of expression prior to cleaving.
  • repairing the double strand breaks may comprise removing the material between the double strand breaks, replacing it with a donor sequence so as to substitute the sequences between the double strand breaks with the donor sequence.
  • the removed sequences may, without limitation, comprise sequences encoding all or a portion of a nucleotide sequence encoding a highly, more highly, very highly, or most highly expressed protein.
  • the removed sequences may, without limitation, comprise regulatory sequences effecting the expression of a highly, more highly, very highly, or most highly expressed protein. In such embodiments, the expression of the highly, more highly, very highly, or most highly expressed protein is decreased relative to levels of expression prior to cleaving.
  • repairing the double strand break may comprise inserting a donor sequence into or across the double strand break.
  • the donor sequence may be inserted into the coding sequence of a highly, more highly, very highly, or most highly expressed protein.
  • the insertion of such sequence may disrupt the transcription of the coding sequence of a highly, more highly, very highly, or most highly expressed protein through, by way of non-limiting example, the presence of an in-frame stop codon.
  • the donor may, without limitation, disrupt the function of regulatory sequences effecting the expression of a highly, more highly, very highly, or most highly expressed protein.
  • the expression of a highly, more highly, very highly, or most highly expressed protein is decreased relative to levels of expression prior to cleaving.
  • the donor sequence may encode a protein of interest.
  • expression of the protein of interest from the donor sequence may be controlled, regulated by, or operatively linked to regulatory sequences present in the donor sequence and/or regulatory sequences present in the sequence into which the donor sequence was inserted.
  • a nucleic acid sequence encoding a protein of interest may be provided to the cell separate to or in conjunction with the donor sequence.
  • the donor sequence may be contained within the same nucleic acid molecule as the sequence encoding a protein of interest.
  • the nucleotide sequence encoding a highly, more highly, very highly, or most highly expressed protein nucleotide sequence encoding a highly, more highly, very highly, or most highly expressed protein may be located in, by way of non-limiting example, a genome, a plasmid, a cosmid, artificial chromosome, episome, or other nucleotide structure in the cell.
  • the donor nucleotides include an exogenous sequence (transgene) to be integrated into the endogenous locus and contains at least one target site for a nuclease.
  • the donor nucleotides can include regions of homology (e.g., homology arms) flanking the transgene sequence. Chromosomal homology present in the donor sequence can be in the nuclease binding site.
  • the nuclease used to cleave the donor is not the same as the nuclease used to cleave the chromosome and it is possible for there to be no homology between the chromosome and the donor sequence.
  • the donor molecules are integrated into the endogenous locus via homology-independent mechanisms (e.g., NHEJ).
  • the double-stranded donor comprises a transgene of at least 1 kb in length and nuclease target site(s) 3' and/or 5' of the transgene for in vivo cleavage.
  • the donor molecule may be, for example, a plasmid.
  • the donor is integrated following nuclease-mediated cleavage of the endogenous locus.
  • the one or more of the nucleases used to cleave the donor may be the same as one or more of the nucleases used to cleave the endogenous locus.
  • one or more of the nucleases used to cleave the donor may be different from one or more of the nucleases used to cleave the endogenous locus.
  • the donor is contained on a plasmid.
  • the donor may be integrated following nuclease-mediated cleavage where the donor is flanked in the plasmid by at least two nuclease cleavage sites.
  • the sequence of the nuclease cleavage sites in the donor plasmid is the same as the sequence of the nuclease cleavage site in the chromosomal locus containing an ETIP to be targeted.
  • the nuclease cleavage sites flanking the donor on the donor- containing plasmid are different from the cleavage site in the ETIP of the chromosome.
  • the nuclease cleavage sites flanking the donor in the donor- containing plasmid may not be the same, and also may be different from the nuclease cleavage site in the chromosome.
  • the donor may be contained on a plasmid flanked by at least two nuclease cleavage sites and may be integrated into a deletion in the ETIP of the chromosome created by the action of two nucleases.
  • the nuclease cleavage sites flanking the donor on the plasmid and the nuclease cleavage sites of the ETIP in the chromosome may either be the same or may be different.
  • the donor is a plasmid containing only a single nuclease cleavage site and the nuclease cleavage site of the ETIP in the chromosome may either be the same or may be different.
  • the sequence of interest of the donor molecule may comprise one or more sequences encoding a functional polypeptide (e.g., a cDNA), with or without a promoter.
  • the nucleic acid sequence comprises a sequence encoding an antibody, an antigen, an enzyme, a growth factor, a receptor (cell surface or nuclear), a hormone, a lymphokine, a cytokine, a reporter, functional fragments of any of the above and combinations of the above.
  • the functional polypeptide encoding sequences are promoterless, expression of the integrated sequence is then ensured by transcription driven by an endogenous promoter or other control element in the region of interest.
  • a tandem cassette can be integrated into the selected site in this manner, the first component of the cassette comprising a promoterless sequence as described above, followed by a transcription termination sequence, and a second sequence, encoding an autonomous expression cassette. Additional sequences (coding or non-coding sequences) can be included in the donor molecule between the homology arms.
  • the donor nucleic acid comprises sequences encoding functional RNAs for example, miRNAs or shRNAs.
  • Targeted cleavage may be used to induce mutations in a genomic sequence.
  • Targeted cleavage may also be used to create gene knock-outs or gene knock-downs (e.g., functional genomics or target validation) and to facilitate targeted insertion of a sequence into a genome (i.e., sequence knock- in). Insertion may be by means of replacement of chromosomal sequences through, by way of non-limiting example, homologous recombination or by targeted integration, in which a new sequence (i. e., a sequence not present in the region of interest) is inserted at a predetermined target site.
  • such new sequences may be flanked by sequences homologous to the region of interest in the chromosome.
  • the same methods may also be used to replace a wild-type sequence with a mutant sequence or to convert one allele to a different allele.
  • the disclosed methods for targeted recombination production of a protein of interest may be used to replace any genomic sequence with a non-identical sequence.
  • a mutant genomic sequence may be replaced by its wild-type counterpart, thereby providing methods for treatment of plant diseases; provide resistance to plant pathogens; increase crop yields, etc.
  • one allele of a gene may be replaced by a different allele using the methods of targeted recombination disclosed herein.
  • a region of interest comprises a mutation
  • the donor polynucleotide comprises the corresponding wild-type sequence.
  • a wild- type genomic sequence may be replaced by a mutant sequence, if such is desirable.
  • overexpression of an oncogene may be reversed either by mutating the gene or by replacing its control sequences with sequences that support a lower, non- pathologic level of expression.
  • any pathology dependent upon a particular genomic sequence, in any fashion may be corrected or alleviated using the methods and compositions disclosed herein.
  • Targeted cleavage, insertion, excision, and/or recombination may also be used to alter noncoding sequences (e.g., regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites) to alter the levels of expression of a gene product.
  • noncoding sequences e.g., regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites
  • Such methods may be used, for example, for therapeutic purposes, functional genomics and/or target validation studies.
  • Targeted modification of chromatin structure may be used to facilitate the binding of fusion proteins to cellular chromatin.
  • one or more fusions between a zinc finger binding domain and a recombinase (or functional fragment thereof) may be used, in addition to or instead of the zinc finger-cleavage domain fusions disclosed herein, to facilitate targeted recombination. See, for example, co-owned US patent No. 6,534,261 and Akopian et al. (2003) Proc. Natl. Acad. Sci. USA 100:8688-8691.
  • fusion polypeptide comprises a zinc finger binding domain and a functional domain monomer (e.g., a monomer from a dimeric transcriptional activation or repression domain). Binding of two such fusion polypeptides to properly situated target sites allows dimerization so as to reconstitute a functional transcription activation or repression domain.
  • the methods and compositions set forth herein may be used for targeted integration of exogenous sequences into a region of interest in the genome of a cell, for example in which cleavage enhances insertion via homology- dependent mechanisms (e.g., insertion of a donor sequence comprising an exogenous sequence together with one or more sequences that are either identical, or homologous but non-identical, with a predetermined genomic sequence (i.e., a target site).
  • the donor sequence may contain sufficient homology in the regions flanking the exogenous sequence to support homology-directed repair (HDR) of a double-strand break in a genomic sequence, thereby inserting the exogenous sequence at the genomic target site.
  • HDR homology-directed repair
  • the donor nucleic acid may be of any size sufficient to support integration of the exogenous sequence by homology-dependent repair mechanisms (e.g., homologous recombination).
  • homology-dependent repair mechanisms e.g., homologous recombination
  • the regions of homology flanking the exogenous sequence are thought to provide the broken chromosome ends with a template for re-synthesis of the genetic information at the site of the double-stranded break.
  • two of the identical sequences or two of the homologous but non-identical sequences (or one of each) are present, flanking the exogenous sequence.
  • An exogenous sequence is one that contains a nucleotide sequence that is not normally present in the region of interest.
  • a construct carrying a ZFN gene under the control of an inducible promoter along with its corresponding recognition sequence can be stably integrated into Arabidopsis and shown to introduce targeted mutations resulting from non-homologous end joining at the recognition site.
  • a method for precision insertion of transgenes is described via ZFN-mediated homologous recombination.
  • the ZFN protein can be expressed and purified outside the target organism and then delivered into target plant cells, surgically specific mutation/gene knock-out may be induced via non-homologous end joining (NHEJ).
  • NHEJ non-homologous end joining
  • Targeted gene addition is typically performed by transfection of a selectable marker gene flanked by a substantial amount of DNA homologous to the target locus.
  • Spontaneous double stranded breaks are formed at the target locus, likely from stalled DNA replication forks.
  • HDR homology- directed repair
  • HDR can instead use the homologous donor DNA to heal the break.
  • an additional DNA sequence is inserted between the two regions of homology in the donor plasmid, the cellular DNA repair machinery unwittingly copies this genetic information into the chromosome.
  • this homology-based targeting relies on the capture of very rare DSBs within the region of donor homology, extensive homology to the target locus is needed to obtain targeted integration at a useful frequency.
  • similar gene addition capability can be provided to cell types lacking efficient homology-based DNA repair via NHEJ. Such an approach might prove particularly useful for gene addition in primary, non-dividing cells which preferentially use the NHEJ DNA repair pathway.
  • Gene addition via NHEJ can also be useful for unsequenced genomes as donor construction without a genome sequence that requires arduous preliminary cloning and sequencing. It is understood that non-specific DNA can be captured at the site of NHEJ-mediated DSB repair.
  • the information present in the single-stranded overhangs created by ZFN cleavage can be used to perform targeted DNA integration using the NHEJ DNA repair machinery.
  • gene addition capability can be provided by both efficient homology-based DNA repair via NHEJ and via homology directed repair.
  • one end of a donor sequence is integrated within a chromosomal target via NHEJ and the other end of the donor sequence is integrated within the chromosomal target via homology directed repair.
  • Certain embodiments include methods for production of a donor or payload DNA that expresses one or more products of an exogenous nucleic acid sequence (i.e. a protein or a RNA molecule) that has been stably integrated into an ETIP in a plant cell ( Figure 17).
  • an exogenous nucleic acid sequence i.e. a protein or a RNA molecule
  • Alternative embodiments of the disclosure include the integration of marker genes and subsequent expression of the marker protein which have been incorporated into the ETIP targetable nucleic acid molecule.
  • methods for the selection of targeted donor DNA into ETIP locus use cell sorting and selection for expression of marker genes incorporated at one or both the 5' and 3' ends of the ETIP ( Figure 18).
  • the integration of the ETIP at or near the FAD2, FAD3 or IPK2 locus or the integration of the ETIP within random locations in the plant genome do not appear to impair the ability of the host plant to regenerate, flower, produce seed and enables the selection, regeneration and heritable transmission of subsequent exogenous nucleic acid sequence products delivered by the donor polynucleotide molecule which are targeted to the ETIP over generations.
  • the ETIP can be used to reduce the number of transgenic events that need to be produced in traditional event introgression experiments, because the candidate genes and plant expression vector designs are integrated within the same endogenous plant genome location.
  • the ETIP technology can be deployed across all plant species, including crops and model species including corn, soybean, rice, canola, wheat, barley, sunflower, tomato, Arabidopsis, cotton, potato, sorghum, forage grasses, brassica species (including, but not limited to, B. napus, B. rapa, B. oleracea, B. nigra, B. juncea, B. carrinata), sugarcane sugar beets, Brachypodium, and alfalfa).
  • a transgenic plant cell includes a nucleic acid molecule that has a nucleotide sequence (which may be genomic) containing at least one targetable nucleic acid molecule, wherein the targetable nucleic acid molecule comprises a site specific nuclease recognition site and a fragment of at least one marker gene, where the fragment does not encode a functional marker gene expression product.
  • the targetable nucleic acid molecule may include a first fragment of a first marker gene and a second fragment of a second marker gene.
  • Other embodiments of the targetable nucleic acid molecule may include one or more gene expression cassettes.
  • the first and second fragments may flank the site specific nuclease recognition site.
  • the donor nucleotide sequence may be operably linked to a regulatory element, such as a promoter, a 5' UTR, a 3' UTR, an intron, or a MAR.
  • a regulatory element such as a promoter, a 5' UTR, a 3' UTR, an intron, or a MAR.
  • the nucleotide sequence may comprise fragments of two marker genes.
  • the ETIP system represents a platform technology which enables rapid selection of targeted integration of a donor sequence into plant genomes.
  • the ETIP technology may be used in plant cell cultures, as well as algae, moss, fungal systems, and mammalian cell cultures, such as NK-1, CHO, etc.
  • the ETIP system forms the basis for the development of precision plant transformation system in different crop species to enable high through put gene and construct testing at throughout the trait development process.
  • EXAMPLE 1 IDENTIFICATION OF PARALOGOUS FAD2 AND FAD3 TARGET SEQUENCES FROM A BACTERIAL ARTIFICIAL CHROMOSOME LIBRARY BAC CONSTRUCTION
  • BAC Bacterial Artificial Chromosome
  • the BAC library consisted of 1 10,592 BAC clones containing high molecular weight genomic DNA (gDNA) fragments isolated from Brassica napus L. var. DH10275.
  • the gDNA was digested with either the BamHI or HinDIII restriction enzyme. Isolated gDNA fragments of about 135 Kbp were ligated into the pCClBAC vector (Epicentre, Madison, WI) and transformed into Escherichia coli str. DH10B (Invitrogen).
  • the BAC library was made up of an even number of BAC clones that were constructed using the two different restriction enzymes.
  • the Hind III constructed BAC library consisted of 144 individual 384-well plates.
  • the BamHI constructed BAC library consisted of 144 individual 384-well plates.
  • a total of 110,592 BAC clones were isolated and arrayed into 288 individual 384-well plates.
  • Each of the 288 individual 384 well plates were provided by the vendor as a single DNA extraction for rapid PCR based screening.
  • the resulting BAC library covers approximately 15 Gbp of gDNA, which corresponds to a 12-fold genome coverage of Brassica napus L. var. DH10275genome (estimate of the Brassica napus L. genome is ca. 1.132 Gbp as described in Johnston et al. (2005) Annals of Botany 95:229-235).
  • the constructed BAC library was used to isolate FAD2 gene coding sequences. Sequencing experiments were conducted to identify the specific gene sequences of four FAD2 gene paralogs from Brassica napus L. var. DH 10275.
  • the FAD2 gene sequence was initially identified within the model species Arabidopsis thaliana.
  • the gene sequence is listed in Genbank as Locus Tag: At3gl2120. Comparative genomic relationships between the model plant species Arabidopsis thaliana and the diploid Brassica rapa, one of the progenitors of the tetraploid Brassica napus, have been previously described. (Schranz et al. (2006) Trends in Plant Science 11(11):535-542). With specific relation to the FAD2 gene the comparative analysis predicted that 3-4 copies of the gene may occur within the diploid Brassica genome. Additional genetic mapping studies were completed by Scheffler et al. (1997) Theoretical and Applied Genetics 94; 583-591. The results of these genetic mapping studies indicated that four copies of the FAD2 gene were present in Brassica napus.
  • Sequencing analysis of the BAC library which was constructed from B. napus L. var. DH12075 resulted in the isolation of four BAC sequences (SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4) from which the coding sequences for the FAD2A (SEQ ID NO:5), FAD2-1 (SEQ ID NO:6), FAD2-2 (SEQ ID NO:7), and FAD2-3(SEQ ID NO:8) genes were determined.
  • the FAD2A, FAD2-1, FAD2-2, and FAD2-3 gene sequences were identified and genetically mapped. Sequence analysis of the four FAD2 genes was conducted using a sequence alignment program and a neighbor-joining tree using percentage of identity.
  • AlignX ® uses a modified Clustal W algorithm to generate multiple sequence alignments of either protein or nucleic acid sequences for similarity comparisons and for annotation.
  • the neighbour- joining tree was created with Jalview v2.3® software and is shown in Figure 2. (Waterhouse et al. (2009) Bioinformatics 25 (9) 1189-1191).
  • Figure 2 the analysis of the isolated sequences indicated that the FAD2A and FAD2-3 sequences shared high levels of sequence similarity and that, likewise, FAD2-1 and FAD2-2 shared high levels of sequence similarity.
  • the four sequences can be categorized in two clades, wherein FAD2A and FAD2-3 comprise a first clade, and FAD2-1 and FAD2-2 comprise a second clade.
  • This sequence analysis identified specific, annotated gene sequences from Brassica rapa and Brassica oleracea which shared the highest sequence similarity to the newly discovered Brassica napus FAD2 sequences.
  • Table 1 lists the newly identified FAD2 coding sequence and the corresponding progenitor reference sequence accession number and source organism.
  • Table 1 FAD2 sequences from Brassica napus and the corresponding progenitor organism and related FAD sequence accession number.
  • the FAD2 genes exist in the Brassica napus genome as two copies of each gene per sub-genome. One copy of each gene is located on the A sub-genome, and likewise one copy of each gene is located on the C sub-genome. New naming conventions are described to indicate which sub-genome that each gene is located on.
  • FAD2-3 is a duplicate of the FAD2 sequence from the C sub-genome and could be relabeled as FAD2C
  • FAD2-1 is a duplicate of the FAD2 sequence from the A sub-genome and could therefore be labeled as FAD2A'
  • FAD2-2 is a second copy that was duplicated from the FAD2 sequence of the C sub-genome and could be labeled as FAD2C.
  • the constructed BAC library was used to isolate FAD3 gene coding sequences.
  • the FAD3 gene sequence was initially identified within the model species Arabidopsis thaliana.
  • the gene sequence is listed in Genbank as Locus Tag: At2g29980. Comparative genomic relationships between the model plant species Arabidopsis thaliana and the diploid Brassica rapa, one of the progenitors of the tetraploid Brassica napus, have been previously described. (Schranz et al. (2006) Trends in Plant Science 11(1 1):535-542). With specific relation to the FAD gene the comparative analysis predicted that 3-4 copies of the gene may occur within the diploid Brassica genome. Additional genetic mapping studies were completed by Scheffler et al. (1997) Theoretical and Applied Genetics 94; 583-591. The results of these genetic mapping studies indicated that six copies of the FAD3 gene were present in Brassica napus.
  • exon 1 The divergence of the FAD3 sequence in exon 1 was identified as an opportunity which could be utilized for the design of gene/allele specific PCR primers.
  • exons were identified that were either minimally differentiated between haplotypes (e.g., exons 5, 6, 7 and 8 had 1-3 bp that varied between FAD3A and FAD3C) or that were devoid of sequence variation (e.g., exons 2 and 3).
  • Sequencing analysis of the BAC library which was constructed from B. napus L. var. DH12075 resulted in the isolation of six BAC sequences (SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l 1 , SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14) from which the coding sequences for the FAD3A (SEQ ID NO: 15), FAD3A' (SEQ ID NO:16), FAD3A" (SEQ ID NO: 17), FAD3C (SEQ ID NO: 18), FAD3C" (SEQ ID NO:19), and FAD3C' (SEQ ID NO:20) genes were determined.
  • the FAD3A, FAD3A', FAD3A", FAD3C, FAD3C", and FAD3C gene sequences were identified and genetically mapped.
  • Sequence analysis of the six FAD3 genes was conducted using a sequence alignment program and a neighbor-joining tree using percentage of identity.
  • the sequence alignment was made via the AlignX ® program from the Vector NTI Advance 11.0 computer program (Life Technologies, Carlsbad, CA) and is shown in Figure 3.
  • AlignX ® uses a modified Clustal W algorithm to generate multiple sequence alignments of either protein or nucleic acid sequences for similarity comparisons and for annotation.
  • the neighbour-joining tree was created with Jalview v2.3® software and is shown in Figure 4. (Waterhouse et al. (2009) Bioinformatics 25 (9) 1189-1191).
  • the contigs identified as containing FAD3 genes were used as BLASTn queries against a database of Arabidopsis thaliana genes.
  • each of the 6 contigs containing the FAD3 gene was identified through comparison to the Arabidopsis thaliana FAD3 gene (Genbank Accession No: At2g29980).
  • the FAD3 contigs were then orientated such that all FAD3 genes were in the 5' to 3' orientation.
  • FAD3 contigs were trimmed to contain as many as 2 upstream (5') and 1 downstream (3') Arabidopsis thaliana genes where possible.
  • Once orientated the complete coding region of the FAD3 genes were extracted from each contig and used to generate a Neighbour joining tree to display the relationship between the different FAD3 gene family members.
  • the 6 FAD3 family members were aligned into 3 pairs of FAD3 genes ( Figure 4).
  • a cohort of PCR primers were design to screen the aforementioned BAC library.
  • the primers were designed as either universal primers, which would amplify all members of the gene family, or as gene specific primers for targeted allele amplification.
  • the PCR primers were designed to be 20bp long (+/- lbp) and contain a G/C content of 50% (+/- 8%).
  • Table 2 and Table 3 lists the primers which were designed and synthesized.
  • the clones of the BAC library were pooled and screened via the Polymerase Chain Reaction (PCR).
  • Table 2 Primer sequences used for PCR amplification of FAD3 sequences.
  • Table 3 PCR primer sequences designed for BAC library screening for
  • PCR polymerase chain reactions
  • the first series of PCR reactions contained: I X PCR buffer (containing dNTPs); 1.5 mM MgCl 2 ; 200 ⁇ of 0.25 U Immolase® DNA polymerase (Bioline, London, UK); 250 nM of each primer; and, about 5-10 ng template DNA.
  • a second series of PCR reactions were developed for the amplification of genomic DNA and contained: 5-10 ng of genomic DNA, IX PCR buffer, 2 mM dNTPs, 0.4 ⁇ forward and reverse primer, and 0.25 U Immolase® DNA polymerase (Bioline, London, UK).
  • Amplifications were pooled into a final volume of 13 and amplified using an MJ PTC200® thermocycler (BioRad, Hercules, CA) or an ABI 9700 Gene Amp System® (Life Technologies, Carlsbad, CA).
  • PCR based screening of specific plates was conducted using a 4 dimension screening approach based on the screening system described by Bryan et al (Scottish Crops Research Institute annual report: 2001 - 2002) with the above described PCR conditions.
  • the amplified PCR product was sequenced using a direct Sanger sequencing method.
  • amplified products were purified with ethanol, sodium acetate and EDTA following the BigDye® v3.1 protocol (Applied Biosystems) and electrophoresis was performed on an ABI3730xl® automated capillary electrophoresis platform.
  • Table 5 Identification of the BAC clone plates that provided positive reaction with the detailed PCR primer combinations, along with two plate identities that were taken forward for clone identification within the plate.
  • the DNA was isolated for the BAC clone and was prepared for sequencing using a Large Construct kit® (Qiagen, Valencia, CA) following the manufacturer's instructions.
  • the extracted BAC DNA was prepared for sequencing using GS-FLX Titanium Technology® (Roche, Indianapolis, IN) following manufacturer's instructions. Sequencing reactions were performed using a physically sectored GS-FLX TI Pico-titer plate® with the BACs pooled in pairs for optimal data output.
  • the BACs were combined in pairs where the FAD2 gene was paired with a FAD3 gene.
  • EXAMPLE 2 DESIGN OF ZINC FINGER BINDING DOMAINS SPECIFIC TO FAD2 GENES
  • Zinc finger proteins directed against DNA sequences encoding various functional sequences of the FAD2 gene locus were designed as previously described. See, e.g., Urnov et al. (2005) Nature 435:646-651. Exemplary target sequence and recognition helices are shown in Table 6 and Table 7(recognition helix regions designs) and Table 8 and Table 9 (target sites). In Table 8 and Table 9, nucleotides in the target site that are contacted by the ZFP recognition helices are indicated in uppercase letters; non-contacted nucleotides indicated in lowercase. Zinc Finger Nuclease (ZFN) target sites were designed to bind five target sites of FAD2A, and seven target sites of FAD3.
  • ZFN Zinc Finger Nuclease
  • the FAD2 and FAD3 zinc finger designs were incorporated into zinc finger expression vectors encoding a protein having at least one finger with a CCHC structure. See, U.S. Patent Publication No. 2008/0182332. In particular, the last finger in each protein had a CCHC backbone for the recognition helix.
  • the non-canonical zinc finger-encoding sequences were fused to the nuclease domain of the type IIS restriction enzyme Fokl (amino acids 384-579 of the sequence of Wah et al, (1998) Proc. Natl. Acad. Sci.
  • fusion proteins were driven by a relatively strong constitutive promoter such as a promoter derived from the Cassava Vein Mosaic Virus (CsVMV) promoter and flanked by the Agrobacterium tumefaciens ORF23 3'UnTranslated Region (AtuORF23 3'UTR vl).
  • CsVMV Cassava Vein Mosaic Virus
  • Zinc fingers for the various functional domains were selected for in-vivo use.
  • ZFNs were designed, produced and tested to bind to the putative FAD genomic polynucleotide target sites, a ZFNs were identified as having in vivo activity at high levels, and selected for further experimentation. These ZFNs were characterized as being capable of efficiently binding and cleaving the unique FAD2 genomic polynucleotide target sites in planta.
  • NO.-287) NO:288) NO.-289) NO:290) NO:291 )
  • NO:367 NO:368) NO-.369) NO:370) NO:371 )
  • NO:408 NO:409) NO:410) N0:41 1 ) NO:412)
  • EXAMPLE 3 EVALUATION OF ZINC FINGER NUCLEASE CLEAVAGE OF FAD2 GENES
  • Plasmid vectors containing ZFN expression constructs of the exemplary zinc finger nucleases which were identified using the yeast assay, as described in Example 2, were designed and completed using skills and techniques commonly known in the art. Each zinc finger-encoding sequence was fused to a sequence encoding an opaque-2 nuclear localization signal (Maddaloni et al. (1989) Nuc. Acids Res. 17(18):7532), that was positioned upstream of the zinc finger nuclease.
  • each construct consisted of a single open reading frame comprised of two opaque-2 nuclear localization signal: :zinc finger nuclease fusion sequences separated by the 2A sequence from Thosea asigna virus (Mattion et al. (1996) J. Virol. 70:8124-8127).
  • a relatively strong constitutive promoter such as a promoter derived from the Cassava Vein Mosaic Virus (CsVMV) promoter and flanked by the Agrobacterhim tumefaciens ORF23 3'UnTranslated Region (AtuORF23 3'UTR).
  • CsVMV Cassava Vein Mosaic Virus
  • Plasmid preparations were performed using NUCLEOSPIN ® Plasmid Kit (Macherey-Nagel Inc., Bethlehem, PA) or the Plasmid Midi Kit (Qiagen) following the instructions of the suppliers. DNA fragments were isolated using QIAquick Gel Extraction KitTM (Qiagen) after agarose Tris-acetate gel electrophoresis. Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA.
  • Plasmid DNA of selected clones was sequenced by a commercial sequencing vendor (Eurofins MWG Operon, Huntsville, AL). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, MI). Before delivery to B. napus protoplasts, Plasmid DNA was prepared from cultures of E. coli using the Pure Yield Plasmid Maxiprep System® (Promega Corporation, Madison, WI) or Plasmid Maxi Kit® (Qiagen, Valencia, CA) following the instructions of the suppliers.
  • ZFN24845 and ZFN24844 construct pDAB 104009 (containing the ZFN24820 and ZFN24821 construct), pDAB104010 (containing the ZFN24828 and ZFN24829 construct) ( Figure 5), pDAB 104003 (containing the ZFN24810 and ZFN24811 construct), pDAB104011 (containing the ZFN24832 and ZFN24833 construct), pDAB 104002 (containing the ZFN24794 and ZFN24795 construct), pDAB 104006 (containing the ZFN24796 and ZFN24797 construct), pDAB 104004 (containing the ZFN24814 and ZFN24815 construct), pDAB 104001 (containing the ZFN24800 and ZFN24801 construct), pDAB104005 (containing the ZFN24818 and ZFN24819 construct), and pDAB 104007 (containing the ZFN24836 and ZFN24837 construct) were confirmed via restriction enzyme digestion and via
  • Table 10 lists the different constructs and the specific FAD sequence which each ZFN was designed to cleave and bind.
  • the resulting plasmid constructs pDAB 107824 (ZFNs 28025-2A-28026), pDAB107815 (ZFNs 27961 -2A-27962), pDAB107816 (ZFNs 27969-2A-27970), pDAB107817 (ZFNs 27973-2A-27974), pDAB 107825 (ZFNs 28035-2A-28036), pDAB 107826 (ZFNs 28039-2A-28040), pDAB107818 (ZFNs 27987-2A-27988), pDAB 107827 (ZFNs 28051-2A-28052), pDAB 107821 (ZFNs 28004-2A-28005), pDAB107819 (ZFNs 27989-2A-27990), pDAB 107828 (ZFNs 28053-2A-28054
  • Table 10 lists the Zinc Finger protein binding motif and the corresponding construct number. Each Zinc Finger was designed to bind and cleave the FAD2A which is described in the table.
  • Plasmid DNA of the above described vectors was sterilized by precipitation and washing in 100% (v/v) ethanol and dried in a laminar flow hood.
  • the DNA pellet was suspended in 30 of sterile double-distilled water at a final concentration of 0.7 ⁇ g/ ⁇ l for transfection into protoplast cells as described below.
  • the preparation of the plasmid DNA was undertaken to result in supercoiled plasmid DNA for transient transfection and linearized plasmid DNA for stable transfection.
  • carrier DNA e.g. fish-sperm DNA
  • Brassica napus L. var. DH 10275 was completed as described in Spangenberg et al., (1986) Plant Physiology 66: 1-8, the media formulations are described in Spangenberg G. and Protrykus I. (1995) Polyethylene Glycol-Mediated Direct Gene Transfer in Tobacco Protoplasts. In: Gene Transfer to Plants. (Protrykus I. and Spangenberg G. Eds.) Springer- Verlag, Berlin. Brassica napus seeds were surface sterilized in 70% ethanol. The seeds were immersed in 12 mL of the 70% ethanol solution and mixed by gently rocking the cocktail for 10 minutes.
  • the 70% ethanol solution was removed by decanting the solution and exchanged with a seed sterilization solution consisting of 1% w/v calcium hypochlorite and 0.1% v/v Tween-20.
  • the seeds were immersed in the seed sterilization solution and mixed by gently rocking the cocktail for 25 minutes.
  • the seed sterilization solution was decanted and the sterilized seeds were rinsed three times in 50 mL of sterile water.
  • the seeds were transferred to a sterile 80 mm Whatman filter paper disc® (Fisher-Scientific, St. Louis, MO) that had been laid within a Petri dish and the seeds were lightly saturated with sterile water.
  • the Petri dish was sealed with Parafilm® (Fisher-Scientific, St.
  • the plates were incubated at 25°C under complete darkness for one to two days. After signs of seedling emergence were observed from the seeds, the seedlings were transferred to Petri dish containing solidified GEM medium to encourage further seed germination. The seedlings were incubated on the GEM medium at 25°C for four to five days.
  • a volume of liquid PS medium (about 10 mL) was decanted into a sterile
  • hypocotyl segments in lengths of 20-40 mm were determined to produce the highest population of small, cytoplasmic-rich protoplasts.
  • the hypocotyl segments were aseptically excised and transferred to liquid PS medium.
  • the excised hypocotyl segments were grouped together and cut transversely into 5-10 mm segments.
  • the hypocotyl segments were transferred to fresh PS medium and incubated at room temperature for 1 hour.
  • the plasmolysed hypocotyls were transferred to a Petri dish containing enzyme solution. Care was taken to immerse all of the hypocotyl segments into the solution.
  • the Petri dishes were sealed with Parafilm® and incubated overnight for sixteen to eighteen hours at 20 - 22°C with gentle rocking.
  • Protoplast cells were released from the hypocotyl segments.
  • the overnight hypocotyl digests were gently agitated to release protoplasts into the enzyme solution.
  • the Petri dish was angled slightly to aid the transfer of the digesting suspension which consisted of enzyme solution and plant debris.
  • the digesting suspension was transferred to a sterilized protoplast filtration (a filter of 100 micron mesh) unit to further separate the protoplasts from the plant debris.
  • the filtration unit was tapped gently to release the excess liquid that had been caught in the sieve.
  • the protoplast suspension about 8 to 9 mL, was gently mixed and distributed into 14 mL sterile plastic round-bottomed centrifuge tubes. Each suspension was overlaid with 1.5 mL of W5 solution.
  • the W5 solution was carefully dispensed over the protoplast suspension at an angle and dispensed drop- by-drop with minimal agitation.
  • the addition of the W5 solution to the protoplast suspension resulted in the production of a protoplast rich interface.
  • This interface was collected using a pipette.
  • the collected protoplasts were transferred into a new 14 mL centrifuge tube, and gently mixed.
  • the yield or obtained protoplasts were determined using a haemocytometer to determine the number of protoplasts per milliliter. The method was repeated, wherein leaf tissue was digested to produce mesophyll protoplasts.
  • the plasmid DNA consisted of the Zinc Finger Nuclease constructs described above (e.g., pDABl 04010).
  • 300 iL of pre- warmed PEG 4000 solution was added to the protoplast suspension and the tubes were gently tapped.
  • the protoplast suspensions and transformation mixture was allowed to incubate at room temperature for fifteen minutes without any agitation.
  • An additional 10 mL of W5 solution was added to each tube in sequential aliquots of 1 mL, 1 mL, 1 mL, 2 mL, 2 mL, and 3 mL with gentle inversion of the tubes between each addition of W5 solution.
  • the protoplasts were pelleted by spinning in a centrifuge at 70g. All of the W5 solution was removed leaving a pure protoplast suspension.
  • Transfected protoplasts were supplied in individual 1.5 or 2.0 mL microfuge tubes.
  • the cells were pelleted at the base of the tube in a buffer solution.
  • DNA extraction was carried out by snap freezing the cells in liquid nitrogen followed by freeze drying the cells, for about 48 hours in a Labconco Freezone 4.5® (Labconco, Kansas City, MO) at -40°C and about 133 x 10 "3 mBar pressure.
  • the lyophilized cells were subjected to DNA extraction using the DNeasy® (QIAGEN, Carlsbad, CA) plant kit following manufactures instructions, with the exception that tissue disruption was not required and the protoplast cells were added directly to the lysis buffer.
  • the design of the ZFN target sites for the FAD2A and FAD3 gene loci were clustered, so that multiple pairs of ZFN were design to overlap the target sites.
  • the clustering of ZFN target sites enabled PCR primers to be designed that would amplify the surrounding genomic sequence from all FAD2A and FAD3 gene family members within a 100 bp window as to encapsulate all of the overlapping ZFN target sites.
  • the Illumina short read sequence technology could be used to assess the integrity of the target ZFN site of the transfected protoplasts.
  • the PCR primers designed needed to include specific nucleotide bases that would attribute sequence reads to the specific gene member of the FAD2A and FAD3 family.
  • NHEJ non-homologous end joining
  • Primers were designed to bind to all of the ZFN target loci for the FAD2A and FAD3 gene families (Table 1 1) and were empirically tested for amplification of all gene family members through Sanger based sequencing of PCR amplification products. In several instances primers could not be developed that would distinguish all gene family members (Table 12 and Table 13), however in all instances the target gene sequences of FAD2A and FAD3, could be distinguished. Following PCR primer design custom DNA barcode sequences were incorporated into the PCR primers that were used to distinguish the different ZFN target loci and identify specific sequence reads to a transfection and ZFN (Tables 1 1 , 12 and 13). Table 1 1 : Primer sequences designed for FAD2 and FAD3 ZFN assessment of activity. Primers include custom barcodes, along with both requisite lllumina adaptor sequences for construction of lllumina library for sequencing-by-synthesis analysis. Purchased primer was the sum of all three columns presented.
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTC 1 F NO:88 GGGCCCTCTCYCYTA CYTCGCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCT 1 F2A NO:89 ACGTACCCTCTCYCYTA CYTCGCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTC 1 F2B NO:90 GTACCCCTCTCYCYTA CYTCGCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCT 1 F2C NO:91 GTACGCCCTCTCYCYTACYTCGCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTT 2 FID NO:92 ACGT GTCATAGCCCACGAGTGCGGC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTC 2 FIE NO:93 TG AC GTCA TAGCCCA CGA GTGCGGC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTT 3 F2F NO:94 GACTGTCGGCCTCA TCTTCCA CTCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3 F2G NO:95 G ACTG GrCG GCCTCA TCTTCCA CTCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3 F2H NO:96 ACTG AGTCGGCCTCA TCTTCCA CTCC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCT 4 F1J NO:97 GCTAGCAGACATCAAGTGGTACGGC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTC 4 F1K NO:98 TAGCC AG A CA TCAAGTGGTA CGGC
  • FAD2 ZFN Locus SEQ ID ACACTCTTTCCCTACACGACGCTCTTCCGATCTT 5 F1L NO:99 AGCYATCTCCGACGCTGGCATCCTC
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 1 R1A NO: 100 ATCT 'ACGT ACTGGTAGTCGCTGAAGGCGT
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 1 RIB NO: 101 ATCTCGT ACCTGGTAGTCGCTGAAGGCGT
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 1 R1 C NO: 102 ATCTGT ACG C7G GTA GTCGCTGAA GG CG T
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 2 RID NO: 103 AI UACGIGGACGAGGAGGAAGGAGTGGA
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 2 R1E NO: 104 ATCTCTG AC GGA CGA GGAGGAA GGAGTGGA
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 3 R1F NO: 105 ATCTTG ACT AGTGTTGGAATGGTGGCGTCG
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 3 RIG NO: 106 ATCTG ACT&4 GTGTTGGAA TGGTGGCGTCG
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 3 R1H NO: 107 Aid ACTG AAGTGTTGGAATGGTGGCGTCG
  • FAD2_ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 4 R1J NO: 108 ATCTG CT AG CCCGA GA CGTTGAA GGCTAA G
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 4 R1 NO: 109 ATCTCTAGC CCCGA GA CGTTGAA GGCTAAG
  • FAD2 ZFN Locus SEQ ID CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG 5 R1L NO: 1 10 ATCTTAGCTG ⁇ GGvi TGCGTGTGCTGCAA G
  • FAD3 (ZFN_Locu CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCG
  • Table 12 Amplification performance of the designed PCR primers on the FAD2 gene families.
  • An “X” indicates gene copy detection specificity, grey shading and an “+” indicates that at the specific locus in question the sequence reads designed by the two primers were unable to be distinguished and an “N/A” indicates that the locus was unable to be amplified from those specific gene copies.
  • Table 13 Amplification performance of the designed PCR primers on the FAD3 gene families.
  • An “X” indicates gene copy detection specificity, grey shading and an “+” indicates that at the specific locus in question the sequence reads designed by the two primers were unable to be distinguished and an “N/A” indicates that the locus was unable to be amplified from those specific gene copies.
  • PCR amplification of the target ZFN loci was performed to generate the requisite loci specific DNA molecules in the correct format for Illumina based sequencing by synthesis technology.
  • Each assay was optimised to work on 25 ng starting DNA (about 12,500 cell equivalents of the Brassica napus genome). Multiple reactions were performed, per sample to provide the coverage required to assess NHEJ efficiency and specificity at the appropriate level, about sixteen PCR reactions equivalent to 200,000 copies of the Brassica napus genome taken from individual protoplasts.
  • PCR amplification master-mixes were made for all samples to be tested with the same assay and one reaction, performed in triplicate, was assayed using a quantitative PCR method that was used to determine the optimal number of cycles to perform on the target tissue, to ensure that PCR amplification had not become reagent limited and was still in an exponential amplification stage.
  • the experimentation with the necessary negative control reactions was performed in 96 well format using a MX3000P thermocycler® (Stratagene, LaJolla, CA).
  • paired end primers were required to be attached by amplification onto the generated fragments. This was achieved by PCR amplification using primers that would be, in part complementary to the sequence added in the first round of amplification, but also contain the paired end sequence required. The optimal number of PCR cycles to perform, that would add the paired end sequences without over amplifying common fragments to the template was again determined using a sample pass through a quantitative PCR cycle analysis, as described previously. Following PCR amplification, the generated product was cleaned using a MinElute column® (Qiagen) following manufacturer's instructions and was resolved on a 2.5% agarose gel.
  • MinElute column® Qiagen
  • DNA fragments visualised using Syber® Safe (Life Technologies, Carlsbad, CA) as bands of the correct size were gel extracted to remove any residual PCR generated primer-dimer or other spurious fragments, the DNA was extracted from the gel slice using a MinElute gel extraction kit® (Qiagen) following manufacturer's instructions. After completion of the gel extraction an additional clean up of the DNA was performed using AMPure magnetic beads® (Beckman- Coulter, Brea, CA) with a DNA to bead ratio of 1 :1.7. The DNA was then assessed for concentration using a quantitative PCR based library quantification kit for Illumina sequencing (KAPA) with a 1/40,000 and a 1/80,000 dilution and with the reaction being performed in triplicate.
  • KAPA quantitative PCR based library quantification kit for Illumina sequencing
  • the DNA was diluted to a standard concentration of 2 nM and all libraries were combined for DNA sequencing.
  • the samples were prepared for sequencing using a cBot cluster generation kit® (Illumina, San Diego, CA) and were sequenced on an Illumina GA2x® with 100 bp paired-end sequencing reads following manufacturer's instructions.
  • a custom PERL script was designed to extract and sort barcodes from DNA sequences computationally following a list of input sequences. The barcode had to match the reference sequence at a Phred score of greater than 30 to be accepted, to reduce misattributing sequence reads. After the sequence reads had been binned into the different barcode groups that had been used, a quality filter was passed across all sequences. The quality filter was a second custom developed PERL script.
  • Sequence reads were excluded if there were more than three bases called as "N", or if the median Phred score was less than 20, or if there were 3 consecutive bases with a Phred score of less than 20, or if the sequence read was shorter than 40 bp in length.
  • the remaining sequences were merged where both of the paired sequence reads were available using the NextGENe® (SoftGenetics, State College, PA) package.
  • the remaining merged sequence reads were then reduced to a collection of unique sequence reads using a third custom PERL script with a count of the number of redundant sequences that had been identified recorded on the end of the remaining sequence identifier.
  • the unique sequence reads were then aligned to the FAD2 and FAD3 reference sequence using the NextGENe® software that created a gapped FASTA aligned file.
  • gapped FASTA file Using the gapped FASTA file a conversion of the gapped base position number to the input reference was performed using a fourth custom PERL script. This enabled bases that discriminate the different gene family members (either homoeologous or paralogous sequence variation between the different gene family members) to be identified in the assembled data. Once the conversion of base numbering had been performed it was possible to generate haplotype reports for each unique sequence reads and assign the reads to specific gene family members. Once the reads had been grouped by gene a 10 bp window was identified and assessed that surrounded the ZFN target site. The number of sequences with deletions was recorded per gene along with the number of missing bases.
  • ZFN24828 and 24829 were selected for in planta targeting of an Engineered Transgene Integration Platform (ETIP) given its characteristics of significant genomic DNA cleavage activity and minimal non-target activity.
  • EIP Engineered Transgene Integration Platform
  • EXAMPLE 4 DNA CONSTRUCTS FOR ENGINEERED TRANSGENE INTEGRATION PLATFORM (ETIP) CANOLA PLANT LINES
  • the plasmid vector constructs described below were built using methods and techniques commonly known by one with skill in the art. The application of specific reagents and techniques described within this paragraph are readily known by those with skill in the art, and could be readily interchanged with other reagents and techniques to achieve the desired purpose of building plasmid vector constructs.
  • the restriction endonucleases were obtained from New England BioLabs (NEB; Ipswich, MA). Ligations were completed with T4 DNA Ligase (Invitrogen, Carlsbad, CA). Gateway reactions were performed using GATEWAY ® LR CLONASE ® enzyme mix (Invitrogen) for assembling one entry vector into a single destination vector.
  • IN-FUSIONTM reactions were performed using IN-FUSIONTM Advantage Technology (Clontech, Mountain View, CA) for assembling one entry vector into a single destination vector
  • Plasmid preparations were performed using NUCLEOSPIN ® Plasmid Kit (Macherey-Nagel Inc., Bethlehem, PA) or the Plasmid Midi Kit® (Qiagen) following the instructions of the suppliers. DNA fragments were isolated using QIAquick Gel Extraction KitTM (Qiagen) after agarose Tris-acetate gel electrophoresis. Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA. Plasmid DNA of selected clones was sequenced by a commercial sequencing vendor (Eurofins MWG Operon, Huntsville, AL). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, MI).
  • the ETIP consists of four expression cassettes (two incomplete) separated by additional ZFN recognition sequences and an Engineered Landing Pad (ELP) containing another ZFN recognition sequences.
  • the additional ZFN recognition sequences are unique and have been designed to be targeted for the introduction of polynucleotide sequences within the ETIP and ELP transgene insertions.
  • the ZFN recognition sequences can be utilized for excision of polynucleotide sequences.
  • the first gene expression cassette was an incomplete dsRED expression cassette and contained the promoter, 5' untranslated region and intron from the Arabidopsis thaliana Polyubiquitin 10 (AtUbi promoter) gene (Callis, et al, (1990) J. Biol.
  • dsRed a gene from the reef coral Discosoma sp. (Clontech, Mountain View, CA) codon-optimised for expression in dicot plants (ds RED (dicot optimized)exon 1) followed by an intron from the Arabidopsis thaliana thioreductase-like gene (Intron 1 from At thioreductase: Accession No: NC 00374) and the 3' untranslated region comprising the transcriptional terminator and polyadenylation site of the Zea mays Viviparous- 1 (Vpl) gene (Zmlip terminator: Paek et al, (1998) Molecules and Cells , 8(3): 336- 342).
  • the second expression cassette contained the 19S promoter including 5' UTR from cauliflower mosaic virus (CaMV 19S: Cook and Penon (1990) Plant Molecular Biology 14(3): 391-405) followed by the hph gene from E. coli, codon- optimised for expression in dicots (hph(HygR): Kaster et al, (1983) Nucleic Acids Research 11(19): 6895-6911) and the 3'UTR comprising the transcriptional terminator and polyadenylation site of open reading frame 1 of A. tumefaciens pTil5955 (At-ORFl terminator: Barker et al, (1983) Plant Molecular Biology 2(6): 335-50).
  • the third expression cassette was an incomplete PAT expression cassette and contained the first intron from Arabidopsis 4-coumaryl-CoA synthase (intron#2 4-coumaryl-CoA synthase v: Accession No: At3g21320/NC003074) followed by the last 256 bp of a synthetic, plant-optimized version of phosphinothricin acetyl transferase gene, isolated from Streptomyces viridochromogenes, which encodes a protein that confers resistance to inhibitors of glutamine synthetase comprising phophinothricin, glufosinate, and bialaphos (PAT(v6) 3'end: Wohlleben et al, (1988) Gene 70(1): 25-37).
  • This cassette was terminated with the 3' UTR comprising the transcriptional terminator and polyadenylation sites of open reading frame 23 of A. tumefaciens pTi 15955 (AtuORF23 terminator: Barker et al, (1983) Plant Molecular Biology 2(6): 335- 50).
  • the fourth Expression Cassette was the ipt gene cassette and contained a 588 bp truncated version of the promoter and 5' UTR from the Arabidopsis DNA- binding protein MYB32 gene (U26933) (AtMYB32(T) promoter: Li et al, (1999) Plant Physiology 121 : 313) followed by the isopentyl transferase ⁇ ipt) gene from A. tumefaciens and the 35s terminator comprising the transcriptional terminator and polyadenylation sites from cauliflower mosaic virus (CaMV 35S terminator: Chenault et al., (1993) Plant Physiology 101 (4): 1395-1396).
  • each end of the ETIP sequence was flanked by lkb of FAD2A genomic sequence from either side of the location of the double-stranded break induced by delivery of the ZFN encoded in pDABl 04010 to the FAD2A gene of B. napus.
  • the ETIP sequence was synthesized by a commercial gene synthesis vendor (GeneArt, Life Technologies).
  • the lkb segments of FAD2A genome sequence were amplified from genomic DNA purified from leaf tissue of B. napus DH12075 using a Qiagen DNeasy plant mini kit® (Qiagen, Hilden) following instructions supplied by the manufacturer.
  • the 1 kb FAD2A sequences were ligated into the ETIP vector using T4 ligase (NEB, Ipswich, MA). Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA. Restriction endonucleases were obtained from New England BioLabs (NEB, Ipswich, MA) and Promega (Promega Corporation, WI).
  • Plasmid preparations were performed using the QIAprep Spin Miniprep Kit® (Qiagen) or the Pure Yield Plasmid Maxiprep System® (Promega Corporation, WI) following the instructions of the suppliers. Plasmid DNA of selected clones was sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocol® (Applied Biosystems, Life Technologies). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, MI).
  • This construct has been designed to be delivered into canola protoplasts with the Zinc Finger Nuclease construct pDAB107828 or pDAB107829.
  • a specific Zinc Finger Nuclease Construct will cleave the FAD3A locus and then the pDAS000273 or pDAS275 construct will integrate within the canola genome via a homology directed repair mechanism.
  • a specific Zinc Finger Nuclease Construct will cleave the FAD3C locus and then the pDAS000271, pDAS000272 or pDAS000274 construct will integrate within the canola genome via a homology directed repair mechanism.
  • the ETIP consists of four expression cassettes (two incomplete) separated by additional ZFN recognition sequences and an Engineered Landing Pad (ELP) containing another ZFN recognition sequences.
  • the additional ZFN recognition sequences are unique and have been designed to be targeted for the introduction of polynucleotide sequences within the ETIP and ELP transgene insertions.
  • the ZFN recognition sequences can be utilized for excision of polynucleotide sequences.
  • the first gene expression cassette was an incomplete dsRED expression cassette and contained the promoter, 5' untranslated region and intron from the Arabidopsis thaliana Polyubiquitin 10 (AtUbi promoter) gene (Callis, et al, (1990) J. Biol.
  • dsRed a gene from the reef coral Discosoma sp. (Clontech, Mountain View, CA) codon-optimised for expression in dicot plants (ds RED (dicot optimized)exon 1) followed by an intron from the Arabidopsis thaliana thioreductase-like gene (Intron 1 from At thioreductase: Accession No: NC_00374) and the 3' untranslated region comprising the transcriptional terminator and polyadenylation site of the Zea mays Viviparous- 1 (Vpl) gene (Zmlip terminator: Paek et al, (1998) Molecules and Cells , 8(3): 336-342).
  • the second expression cassette contained the 19S promoter including 5' UTR from cauliflower mosaic virus (CaMV 19S: Cook and Penon (1990) Plant Molecular Biology 14(3): 391-405) followed by the hph gene from E. coli, codon-optimised for expression in dicots (hph(HygR): Kaster et al, (1983) Nucleic Acids Research 1 1(19): 6895-691 1) and the 3'UTR comprising the transcriptional terminator and polyadenylation site of open reading frame 1 of A. tumefaciens pTil-5955 (At-ORFl terminator: Barker et al., (1983) Plant Molecular Biology 2(6): 335-50).
  • the third expression cassette was an incomplete PAT expression cassette and contained the first intron from Arabidopsis 4-coumaryl- CoA synthase (intron#2 4-coumaryl-CoA synthase v: Accession No: At3g21320/NC003074) followed by the last 256 bp of a synthetic, plant-optimized version of phosphinothricin acetyl transferase gene, isolated from Streptomyces viridochromogenes, which encodes a protein that confers resistance to inhibitors of glutamine synthetase comprising phophinothricin, glufosinate, and bialaphos (PAT(v6) 3'end: Wohlleben et al, (1988) Gene 70(1): 25-37).
  • This cassette was terminated with the 3' UTR comprising the transcriptional terminator and polyadenylation sites of open reading frame 23 of A. tumefaciens pTil 5955 (AtuORF23 terminator: Barker et al, (1983) Plant Molecular Biology 2(6): 335- 50).
  • the fourth Expression Cassette was the ipt gene cassette and contained a 588 bp truncated version of the promoter and 5' UTR from the Arabidopsis DNA- binding protein MYB32 gene (U26933) (AtMYB32(T) promoter: Li et al, (1999) Plant Physiology 121 : 313) followed by the isopentyl transferase (ipt) gene from A. tumefaciens and the 35s terminator comprising the transcriptional terminator and polyadenylation sites from cauliflower mosaic virus (CaMV 35S terminator: Chenault et al, (1993) Plant Physiology 101 (4): 1395-1396).
  • each end of the ETIP sequence was flanked by lkb of FAD3A or FAD3C genomic sequence from either side of the location of the double- stranded break induced by delivery of the ZFN encoded in FAD3A or FAD3c gene of B. napus.
  • the ETIP sequence was synthesized by a commercial gene synthesis vendor (GeneArt, Life Technologies).
  • the lkb segments of FAD3A and FAD3C genome sequence were amplified from genomic DNA purified from leaf tissue of B. napus DH 12075 using a Qiagen DNeasy plant mini kit® (Qiagen, Hilden) following instructions supplied by the manufacturer.
  • the 1 kb FAD3A or FAD3C sequences were ligated into the ETIP vector using T4 ligase (NEB, Ipswich, MA). Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA.
  • Plasmid DNA of selected clones was sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocol® (Applied Biosystems, Life Technologies). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, MI).
  • a control vector was used to develop a Fluorescence Activated Cell Sorting (FACS) cell based sorting method.
  • FACS Fluorescence Activated Cell Sorting
  • Standard cloning methods were used in the construction of a control vector, pDAS000031 ( Figure 14: T-strand insert as SEQ ID NO: 147) consisting of two gene expression cassettes.
  • the first gene expression cassette contained the Cauliflower mosaic virus 19s promoter (CaMV 19S promoter; Shillito, et al, (1985) Bio/Technology 3; 1099-1 103):: hygromycin resistance gene (hph(HygR);US Patent No.
  • the second gene expression cassette contained the Arabidopsis thaliana Ubiquitin 10 promoter (AtUbilO promoter; Callis, et al, (1990) J. Biol. Chem., 265: 12486-12493):: dsRED (dsRED(D); US Patent No.
  • ETIP T- Strand sequence Two binary vectors were constructed for random integration of an ETIP T- Strand sequence within the genome of Brassica napus. Standard cloning methods were used in the construction of the ETIP-containing vectors pDAS000036 ( Figure 15, T-strand insert as SEQ ID NO: 148) and pDAS000037 ( Figure 16, T-strand insert as SEQ ID NO: 149).
  • the ETIP vectors consist of four expression cassettes (two incomplete expression cassettes) separated by ZFN recognition sequences and an Engineered Landing Pad (ELP) containing further ZFN recognition sequences.
  • ELP Engineered Landing Pad
  • the first gene expression cassette was an incomplete dsRED expression cassette and contained the promoter, 5' untranslated region and intron from the Arabidopsis thaliana polyubiquitin 10 (AtUbilO pomoter) gene (Norris et al., (1993) Plant Molecular Biology, 21(5): 895-906) followed by 210bp of a dsRed gene from the reef coral Discosoma sp.
  • the second expression cassette contained the 19S promoter including 5' UTR from cauliflower mosaic virus (CsVMV 19 promoter: Cook and Penon (1990) Plant Molecular Biololgy 14(3): 391-405) followed by the hph gene from E. coli codon-optimised for expression in dicots (hph(D): Kaster et al (1983) Nucleic Acids Research, 11 (19): 6895-691 1) and the 3' UTR comprising the transcriptional terminator and polyadenylation site of open reading frame 1 (ORF1) of A. tumefaciens pTi 15955 (AtORFl terminator: Barker et al, (1983) Plant Molecular Biology, 2(6): 335-50).
  • CsVMV 19 promoter Cook and Penon (1990) Plant Molecular Biololgy 14(3): 391-405
  • hph gene from E. coli codon-optimised for expression in dicots
  • ORF1 open reading frame 1
  • the third expression cassette was an incomplete PAT expression cassette and contained the first intron from Arabidopsis 4-coumaryl-CoA synthase (Accesion No: At3g21320 (NC003074)) followed by the last 256bp of a synthetic, plant-optimized version of phosphinothricin acetyl transferase (PAT) gene, isolated from Streptomyces viridochromogenes, which encodes a protein that confers resistance to inhibitors of glutamine synthetase comprising phophinothricin, glufosinate, and bialaphos (PATv6(exon2); Wohlleben et al, (1988) Gene, 70(1): 25-37).
  • PAT phosphinothricin acetyl transferase
  • This cassette was terminated with the 3' UTR comprising the transcriptional terminator and polyadenylation sites of open reading frames 23 (ORF23) of A. tumefaciens pTil5955 (AtORF23 terminator; Barker et al, (1983) Plant Molecular Biology, 2(6): 335-50).
  • the fourth Expression Cassette was the ipt gene cassette and contained a 588bp truncated version of the promoter and 5' UTR from the Arabidopsis DNA-binding protein MYB32 gene (U26933) (AtMYB32(T)promoter; Li et al, (1999) Plant Physiology, 121 : 313) followed by the isopentyl transferase ⁇ ipt) gene from A. tumefaciens and the 35s terminator comprising the transcriptional terminator and polyadenylation sites from cauliflower mosaic virus (CaMV 35 S terminator; Chenault et al, (1993) Plant Physiology, 101 (4): 1395- 1396).
  • the expression cassettes and ELP were synthesized with Multi-Gateway sites by a commercial gene synthesis vendor (GeneArt, Life Technologies). Entry clones were constructed of each expression cassette and ELP using BP clonase II enzyme mixTM (Invitrogen, Life Technologies) and the pDONR221 vector suiteTM (Invitrogen, Life Technologies). The Entry clones were then used in a Multi- Gateway reaction with a Gateway-enabled binary vector using LR Clonase II Plus Enzyme mixTM (Invitrogen, Life Technologies). Colonies of all assembled plasmids were initially screened by restriction digestion of miniprep DNA.
  • Plasmid preparations were performed using the QIAprep Spin Miniprep KitTM (Qiagen, Hilden) or the Pure Yield Plasmid Maxiprep SystemTM (Promega Corporation, WI) following the instructions of the suppliers. Plasmid DNA of selected clones was sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocolTM (Applied Biosystems, Life Technologies). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corporation, Ann Arbor, MI).
  • the ETIP constructs (pDAS000036, pDAS000037), the DS-Red control construct (pDAS000031), and the FAD2A, FAD3A, and FAD3C site specific constructs (pDAS000130, and pDAS000271-pDAS000275) and accompanying Zinc Finger Nuclease (pDAB104010, pDAB10728, and pDAB10729) described in Example 4.
  • the binary vectors were transformed into Agrobacterium tumefaciens strain GV3101 : PM90. Transformation of Brassica napus protoplast cells was completed using the transfection protocol described in Example 3 with some modification.
  • the modifications to the protocol included the use of sodium alginate instead of Sea PlaqueTM agarose.
  • the transfection experiments in which both the Zinc Finger Nuclease construct and the ETIP construct were co-delivered into Brassica napus protoplast cells were completed at DNA concentrations comprising a 5:1 molar ratio of plasmid DNA.
  • the other ETIP and control plasmid constructs were transformed at concentrations of 30 ⁇ g of plasmid DNA.
  • pDAS000130 consisted of a concentration of 27.8 ⁇ g of plasmid DNA
  • pDAB104010 consisted of a concentration of 2.2 ⁇ g of plasmid DNA.
  • the other ETIP and control plasmid constructs were transformed at concentrations of 30 ⁇ g of plasmid DNA.
  • Additional modifications to the protocol included the propagation of whole plants from the transformed protoplast cells in medium containing 1.5 mg/mL of hygromycin.
  • the propagation of whole plants required that the A medium was replaced every two weeks and the growth of the protoplast-derived colonies was monitored. After the protoplast-derived colonies had grown to approximately 2-3 mm in diameter, the colonies were transferred into individual wells of a 12-well Costar® plate (Fisher Scientific, St. Louis, MO) containing solidified MS morpho medium. The plates were incubated for one to two weeks at 24 °C under continuous dim light until the calli had proliferated to a size of 8-10 mm in diameter.
  • the protoplast cells were transferred to individual 250 mL culture vessels containing MS morpho medium.
  • the vessels were incubated at 24 °C under 16 h light (20 ⁇ m "2 of Osram L36 W/21 Lumilux white tubes) and 8 h dark conditions.
  • the shoots were transferred into 250 mL culture vessels containing MS medium after they reached a length of 3-4 cm.
  • the 250 mL culture vessels were incubated at 24 °C under 16 h light (20 ⁇ m "2 s "1 of Osram L36 W/21 Lumilux white tubes) and 8h dark conditions.
  • the shoots were maintained in the culture vessels until they developed into plantlets at which time they were transferred to a greenhouse to grow to maturity.
  • EXAMPLE 6 MOLECULAR CONFIRMATION OF INTEGRATION OF T-DNAS CONTAINING ETIPS IN CANOLA
  • Genomic DNA was extracted from leaf tissue of all putative transgenic plants using a DNeasy 96 Plant DNA extraction kitTM or a DNeasy Plant Mini KitTM (Qiagen). The genomic DNA from each plant was analyzed by PCR using primers designed to amplify virC from pTiC58 Forward (SEQ ID NO: 150 CGAGAACTTGGCAATTCC) and pTiC58 Reverse (SEQ ID NO: 151 TGGCGATTCTGAGATTCC) to test for persistence of A.tumfaciens, primers designed to amplify actin from B.
  • DNA from plants with no backbone integration was purified from 20 g of leaf tissue using a modified CTAB method (Maguire et al friction (1994) Plant Molecular Biology Reporter, 12( 2): 106-109).
  • the isolated gDNA was digested with several restriction enzymes and 10 ⁇ g of gDNA was separated by electrophoresis on an agarose gel and transferred to membrane using a standard Southern blotting protocol. Membranes were probed using the DIG Easy Hyb SystemTM (Roche, South San Francisco, CA) following the manufacturer's instructions.
  • the ETIP sequence was amplified and sequenced from all plants containing only a single copy of the ETIP.
  • the sequence of each T-DNA insert was analyzed by direct sequencing of PCR products using the ABB 730x1TM (Applied Biosystems, Life Teachnologies).
  • the T-DNA insert was amplified from genomic DNA, using Phusion Hot Start II PolymeraseTM (Finnzymes, Thermo Fisher Scientific).
  • the amplification reactions of the T-DNA were completed with multiple primer pairs to amplify overlapping sequences of approximately 2 Kbp in length.
  • Each PCR product was sequenced with multiple primers to ensure complete coverage.
  • the PCR reactions were treated with shrimp alkaline phosphatase and exonuclease I (Applied Biosystems, Life Technologies) to inactivate excess primer prior to the sequencing PCR reaction.
  • the sequences flanking the T-DNA insert of each single copy ETIP line were identified by digestion of purified genomic DNA with eight restriction endonucl eases followed by ligation of double-stranded adapters specific for the overhangs created by the restriction endonucleases. Following this ligation step a PCR was performed with a biotinylated primer to either the 3 ' or 5' end of the ETIP and a primer to each adapter.
  • PCR products were captures and cleaned on Ampure Solid Phase Reversible Immobilization (SPRI) beadsTM (Agencourt Bioscience Corporation, Beckman Coulter Company). A nested PCR was performed and all products were sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycleTM sequencing protocol (Applied Biosystems, Life Technologies). Sequence data were assembled and analyzed using the SEQUENCHERTM software (Gene Codes Corp., Ann Arbor, MI).
  • SPRI Solid Phase Reversible Immobilization
  • the selected events contained full length expression cassettes which are capable of driving robust expression of the transgene.
  • the selected To events were grown to the Ti stage of development. The Ti were res- screened using the above described PCR assays to determine the zygosity of the integrated T-strand. Screened events were categorized as homozygous, hemizygous, or null.
  • the ETIP sequence was amplified and sequenced from all transgenic events containing only a single copy of the integrated ETIP sequence.
  • the sequence of each T-DNA insert was analyzed by direct sequencing of PCR products.
  • the T-DNA insert was amplified from genomic DNA, using Phusion Hot Start II PolymeraseTM (Finnzymes, Thermo Fisher Scientific).
  • the T-DNA was amplified with multiple primer pairs to amplify overlapping sequences of approximately 2Kb in length.
  • Each PCR product was sequenced with multiple primers to ensure complete coverage.
  • the PCR reactions were treated with Shrimp Alkaline Phosphotase and Exonuclease I (Applied Biosystems, Life Technologies) to inactivate excess primer prior to the sequencing PCR reaction.
  • sequences flanking the T-DNA insert of each single copy ETIP line was identified by digestion of purified genomic DNA with eight restriction endonucleases followed by ligation of double-stranded adapters specific for the overhangs created by the restriction endonucleases. Following this step a PCR reaction was performed with a biotinylated primer to either the 3' or 5' end of the ETIP and a primer to each adapter. The PCR products were captured and cleaned on Ampure Solid Phase Reversible ImmobilizationTM (SPRI) beads (Agencourt Bioscience Corporation, Beckman Coulter Company). A nested PCR was performed and all products were sequenced using ABI Sanger Sequencing and Big Dye Terminator v3.1 cycle sequencing protocol (Applied Biosystems, Life Technologies).
  • SPRI Solid Phase Reversible ImmobilizationTM
  • flanking sequence analysis (Table 15).
  • the left and right flanking sequences (also described as border or junction sequences) are provided as SEQ ID NO:431 - SEQ ID NO:446, the underlined sequences indicated plasmid vector, the non-underlined sequences indicate genomic flanking sequence.
  • CAATGACTTCAAATCTACTTGAAGGCATGGAGTATAAGCCATGTTCCTTT CAGAGGGGACTGTACTTCTGTAGATTACTTTCCCTCATTAACCAGATCTG GCCGGCCTACCCAGCTTTCTTGTACAAAGTGGTGATAAACTATCGCCGGC CTACCTCGCGTTGCTGCTCTTTTAGATGTCTCTCCTGTTACTGATGTTGTC
  • the three sequences were then compared and the most similar sequence from either of the diploid Brassica species compared to the flanking ETIP was designated the genome that the ETIP was located in.
  • the genome that the ETIP was located in For the majority of the samples significant variation did exist between the two diploid Brassica genome sequences and the B. napus derived flanking ETIP sequence showed a predominant association with one or other of the diploid sequences. There were instances however, where there was insufficient sequence variation between the diploids and a linkage group assignment may have been possible but a sub-genome assignment was not possible.
  • the specific genome location was then predicted from the location from the Brassica rapa genome sequence. In instances where the ETIP was identified as being integrated into the B.
  • Table 16 BLAST search and predicted the location of these above se uences (predicted locations in Brassica napus genome).
  • Table 17 description of single copy ETIP containing plant from the two constructs pDAS000036 and 37, BLASTn result to a Brassica oleracea genome sequence data base, potential disruption of gene sequence identified through
  • the homozygous events are used to produce protoplasts via the previously described method.
  • the protoplasts are subsequently co-transformed with a Zinc Finger Nuclease that is designed to target a Zinc Finger binding site which is incorporated within the ETIP sequence and a donor plasmid which shares homology with specific regions of the ETIP.
  • the Zinc Finger Nuclease cleaves the ETIP locus and the donor plasmid is integrated within the genome of Brassica napus cells via homology directed repair.
  • the partial DS-red transgene is repaired to a full length DS-red transgene.
  • the expression of the now fully operational DS-red transgene is used to sort protoplast cells with a FACS method.
  • Putative transgenic plants are sorted using the FACS method described in Example 7 and the isolated protoplasts are regenerated into mature plants.
  • the integration of the donor plasmid is confirmed within the ⁇ - targeted plants using molecular confirmation methods.
  • the ETIP locus serves as a site-specific locus for gene targeted integration of a donor polynucleotide sequence.
  • the genomic targeting locations provide genomic locations that do not alter the plants normal phenotype.
  • the resulting events, wherein a transgene is targeted within an ETIP present no agronomically meaningful unintended differences when the ETIP events are compared to the control plants.
  • the protein expression levels of transgenes integrated within the ETIP locus are robustly expressed and consistent and stable across multiple genomic locations.
  • the disclosed genomic sequences of SEQ ID NO:431 to SEQ ID NO:446 provide genomic locations within the brassica genome that are targetable for the integration of gene expression cassettes comprising a transgene.
  • a canola line containing the T-strand insert from pDAS000036 was obtained and confirmed via molecular characterization to contain a full length, single copy of the T-strand. This canola event was labeled as pDAS000036 - 88 and was used to produce protoplasts via the previously described method.
  • the protoplasts were isolated and -50,000 canola protoplast cells were subsequently co-transformed with a Zinc Finger Nuclease, either pDAS000074 ( Figure 25) or pDAS000075 ( Figure 26), that was designed to target the Zinc Finger binding sites incorporated within the ETIP sequence and a donor plasmid, pDAS000064, pDAS000068, pDAS000070, or pDAS000072 ( Figure 27, Figure 28, Figure 29, and Figure 30, respectively), which shares homology with specific regions of the ETIP.
  • Figure 19 and Figure 20 provide illustrations of the homology directed repair which results in the site-specific integration of the Ds-red transgene via Zinc Finger Nuclease mediated homologous recombination.
  • the Zinc Finger Nuclease was designed to cleave the ETIP locus at a defined Zinc Finger binding sequence, thereby creating a double strand break within the genome.
  • the donor plasmid was integrated within the genome of Brassica napus protoplast cells via homology directed repair.
  • the intron-1 and intron-2 regions of the donor plasmid share homology with the corresponding intron-1 and intron-2 regions of the ETIP locus.
  • the partial DS-red transgene was repaired to a full length, highly expressing DS-red transgene.
  • the expression of the fully operational DS-red transgene was used to sort protoplast cells with the above described FACS method.
  • the ETIP locus serves as a site-specific locus for targeted integration of a donor polynucleotide sequence.
  • the isolated protoplasts can be sorted and regenerated into mature plants. The integration of the donor plasmid can be confirmed within the ETIP -targeted plants using molecular confirmation methods.
  • the donor plasmid DNA and ZFN plasmid DNA were mixed at various concentrations and used to transfect the canola protoplast cells containing Event pDAS000036 - 88, and the transgenic protoplast cells were sorted using the FACS transfection that was previously described.
  • Table 18 describes the various transfection experiments and the DNA concentrations which were used for the transfection of the canola protoplasts containing Event pDAS000036 - 88.
  • the ZFN and donor plasmid DNA was isolated and prepared for the transfections via the previously described methods.
  • Table 18 Donor plasmids and Zinc Finger Nuclease constructs used for the ETIP targeting experiments. The DNA concentrations were used at the indicated ratio of donor to Zinc Finger Nuclease, for a total concentration of 30 micrograms of plasmid DNA per transfection.
  • the frequency of the Ds-Red transgene expression ranged from about 0.03 - 0.07% of the total canola protoplast cells (-50,000). However, the frequency of transfection efficiency for the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus was much higher and ranged from about 0.07 - 0.64%.
  • Figure 21 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000064, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 26 ⁇ g to 4 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.03% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.26 - 0.08%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 22 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000068, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 g to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.03% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ⁇ genomic locus transfection efficiency ranges from about 0.38— 0.12%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 23 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000070, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 g to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.07% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.34 - 0.11%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 24 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000072, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 ⁇ g to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.07% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.44 - 0.14%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • tion media media: PPT
  • tion media media: PPT
  • tion media media: PPT
  • tion media media: PPT
  • Molecular characterization of the FAD2A locus was performed using three independent assays. Assays were designed and optimized using the following controls; characterized transgenic events comprising a single randomly integrated transgene, characterized transgenic event with five randomly integrated transgenes, wildtype canola c.v. DH 12075 plants and non-template control reactions. The results from the three following molecular analyses are considered together in order to provide evidence for integration of the ETIP at FAD2A via HDR.
  • Plants with amplification of hph and HMG I/Y and a copy number of 0.5 or more were considered transgenic, while plants with a copy number of > 0.5 and ⁇ 1.2 were scored as putatively single copy.
  • Amplification was performed on a BioRad CFX96 TouchTM Real-Time PCR Detection System with FastStart Universal Probe Master (ROX), (Roche, Basel, Switzerland).
  • the assay is a SYBR® Green I qPCR assay and in singleplex, but with each reaction run simultaneously on the same PCR plate, targets an endogenous locus (FAD2A72C.RB.UnE.Fl , SEQ ID NO:453, 5' CTTCCACTCCTTCCTCCTCGT*C 3' and FAD2A/2C.RB.UnE.Rl, 5' SEQ ID NO:454, GCGTCCCAAAGGGTTGTTGA*G 3') and the ZFN locus (locus at which the ZFN pDAB104010 binds and cuts the genome) (FAD2A.UnE.Fl, SEQ ID NO:455, 5' TCTCTACTGGGCCTGCCAGGG* C 3' and FAD2A.UnE.Rl, SEQ ID NO:456, 5' CCCCGAGACGTTGAAGGC
  • Both primer pairs were amplified using the following conditions: 98°C for 30 seconds followed by 35 cycles of (98°C for 10 seconds, 65°C for 20 seconds, 72°C for 90 seconds) then followed by 95°C for 10 seconds then a melt analysis from 50°C to 95°C with 0.5°C increments for 0.05seconds and a plate read at each increment.
  • the reaction conditions are listed in Table 20.
  • Table 20 Single reaction reagent components and concentrations for PCR amplification.
  • Genomic DNA template ( ⁇ 20ng/ l) 2.00
  • Plants that had amplification of the endogenous target but no amplification of the ZFN target were scored as positive for the disrupted locus test and were considered to have a disrupted ZFN locus. This assay was considered to be positive when the ZFN binding site on both alleles at the FAD2A locus have been disrupted.
  • Each putative plant transformant was analysed using endpoint with PCR primers designed to amplify the transgene target hph (3 ⁇ 4 /z_ExoDigPC_F 1 , SEQ ID NO:457, 5' TTGCGCTGACGGATTCTACAAGGA 3' and ApA_ExoDigPC_Rl , SEQ ID NO:458, 5' TCCATCAGTCCAAACAGCAGCAGA 3'), the FAD2A endogenous locus (FAD2A.Out.Fl, SEQ ID NO:459, 5'
  • Amplification of the 5' transgene-genome flanking target and/or amplification of the 3' transgene-genome flanking target indicated a putative insertion event. It must be noted that due to the approximately l,000bp FAD2A homology arms in the pDAS000130 cassette (comprising polynucleotide sequences with 100% sequence identity to the FAD2A regions immediately upstream and downstream of the ZFN cut site), the PCR reactions were subject to false positive PCR product amplification due to PCR chimerism arising from amplification of off- target ETIP integration events. Amplification of the hph target confirmed transgene integration had occurred.
  • Amplification of the FAD2A target suggests that the FAD2A locus is intact or contains only a partial insertion. Due to the size of the ETIP (1 1,462 bp for the ETIP cassettes or 13,472 bp including the FAD2A homologous arms and the ETIP cassettes) it is expected that the FAD2A primers would not amplify a product when an intact ETIP is integrated into the FAD2A locus.
  • FAD2A 5' target region F, SEQ ID NO:465, 5' AGAGAGGAGACAGAGAGAGAGT 3' and R, SEQ ID NO:466, 5' AGACAGCATCAAGATTTCACACA 3'
  • FAD2A 3' target region F, SEQ ID NO:467, 5' CAACGGCGAGCGTAATCTTAG 3' and R, SEQ ID NO:468, 5' GTTCCCTGGAATTGCTGATAGG 3'
  • hph F, SEQ ID NO:469, 5' TGTTGGTGGAAGAGGATACG 3' and R, SEQ ID NO:470, 5' ATCAGCAGCAGCGATAGC 3'
  • Membrane-bound genomic DNA was probed in a specific order; firstly FAD2A 5 'sequences were probed, then the FAD2A 3' sequences were probe, and finally the hph sequences were probed (Figure 34).
  • the rational for this is as follows.
  • the first probe (FAD2A 5') is the diagnostic probe, and if the ETIP has integrated into FAD2A via perfect HDR, a 5,321 bp fragment will be visible on the membrane. The resulting band size is easily differentiated during electroporation and will sit close to the 5,148 bp fragments in the DIG labeled Roche DNA Molecular Weight Marker III® (Roche, Indianapolis, IN).
  • the second probe of the membrane is with the FAD2A 3' probe and an edited plant will have a 22,433 bp fragment whereas an unedited plant will have a 16,468 bp fragment.
  • the same 22,433 bp fragment identified with the FAD2A 3' probe should also be bound by and identified with the hph probe. These fragments are difficult to differentiate on a gel as they are extremely large and it may be difficult to determine any difference between a fragment occurring above or below the largest, 21 ,226 bp fragment in the DIG labeled Roche DNA Molecular Weight Marker III®.
  • these probes provide evidence that may strengthen the identification of ETIP integration into FAD2A via homology directed repair (HDR), by visualization of a 5 kb fragment using the FAD2A 5' probe.
  • the restriction enzyme, Kpnl was the only suitable restriction endonuclease for use in this assay, as Kpnl sites occurred in a single locus of the cut the ETIP cassette in a single locus, and was present in two sites of the FAD2A ZFN locus. One site was located upstream and the second site located downstream of the FAD2A homology arms.
  • Kpnl is not methylation sensitive, and is available as a recombinant enzyme with increased fidelity (New England Biolabs).
  • Table 22 Overview of outcomes from analysis of ETIP integration.
  • the transgenic Brassica napus events which are produced via transformation of pDAS000130 and pDAB104010 result in the integration of a single copy, full length T-strand insertion of the ETIP polynucleotide sequence from pDAS000130 within the FAD2A locus. Three to four events are fully characterized and confirmed to contain the integrated ETIP. The confirmation is completed using an in-out PCR amplification method, and further validated via Southern blot. The selected To events are grown to the Tj stage of development. The Tj plants are re-screened to determine the zygosity of the integrated T-strand. Screened events are categorized as homozygous, hemizygous, or null.
  • the homozygous events are used to produce protoplasts via the previously described method.
  • the protoplasts are subsequently co-transformed with a Zinc Finger Nuclease that is designed to target a Zinc Finger binding site which is incorporated within the ETIP sequence and a donor plasmid which shares homology with specific regions of the ETIP wherein the donor is integrated within the ETIP via an HDR mechanism.
  • the protoplasts are subsequently co-transformed with a Zinc Finger Nuclease that is designed to target a Zinc Finger binding site which is incorporated within the ETIP sequence and a donor plasmid which does not share homology with specific regions of the ETIP, wherein the donor is integrated within the ETIP via an non-homologous end joining mechanism.
  • the Zinc Finger Nuclease cleaves the ETIP locus and the donor plasmid is integrated within the genome of Brassica napus cells via homology directed repair or non-homologous end joining.
  • the partial DS-red transgene is repaired to a full length DS-red transgene.
  • the expression of the now fully operational DS-red transgene is used to sort protoplast cells with a FACS method. Putative transgenic plants are sorted using the FACS method described in Example 7 and the isolated protoplasts are regenerated into mature plants.
  • the integration of the donor plasmid is confirmed within the ETIP-targeted plants using molecular confirmation methods.
  • the ETIP locus serves as a site-specific locus for gene targeted integration of a donor polynucleotide sequence.
  • the transgenic Brassica napus events which are produced via transformation of ETIP and Zinc Finger Nuclease constructs result in the integration of a single copy, full length T-strand insertion of the ETIP polynucleotide sequence from pDAS000273 or pDAS275 within the FAD3A locus, and from pDAS000271, pDAS000272 or pDAS000274 into the FAD3C locus.
  • Three to four events are fully characterized and confirmed to contain the integrated ETIP.
  • the confirmation is completed using an in-out PCR amplification method, and further validated via Southern blot.
  • the selected To events are grown to the Ti stage of development. The Ti plants are res-screened to determine the zygosity of the integrated T-strand. Screened events are categorized as homozygous, hemizygous, or null.
  • the homozygous events are used to produce protoplasts via the previously described method.
  • the protoplasts are subsequently co-transformed with a Zinc Finger Nuclease that is designed to target a Zinc Finger binding site which is incorporated within the ETIP sequence and a donor plasmid which shares homology with specific regions of the ETIP.
  • the Zinc Finger Nuclease cleaves the ETIP locus and the donor plasmid is integrated within the genome of Brassica napus cells via homology directed repair.
  • the partial DS-red transgene is repaired to a full length DS-red transgene.
  • the expression of the now fully operational DS-red transgene is used to sort protoplast cells with a FACS method.
  • Putative transgenic plants are sorted using the FACS method described in Example 7 and the isolated protoplasts are regenerated into mature plants.
  • the integration of the donor plasmid is confirmed within the ETIP- targeted plants using molecular confirmation methods.
  • the ETIP locus serves as a site-specific locus for gene targeted integration of a donor polynucleotide sequence.
  • Brassica napus protoplasts that were transfected with the DS-Red control construct, pDAS000031 were sorted via FACS-mediated cell sorting using a BD Biosciences Influx-Cell sorterTM (San Jose, CA). The protoplast cells were isolated and transfected as described in Example 3. After the cells had been transfected with pDAS000031, the cells were sorted using the FACS sorter with the conditions described in Table 23.
  • Table 23 Conditions used for sorting protoplast cells transfected with pDAS000031.
  • the protoplasts which expressed the DS-red transgene were sorted and isolated.
  • the FACS isolated protoplasts were counted using the sorter.
  • About l lO 5 to 1.8xl0 5 of cells were placed in a well of a 24-well micro titer plate on the first day after the FACS isolation.
  • the cells were transferred to a bead culture for 5 to 20 days.
  • Similar conditions were tested, wherein about lxlO 4 of cells were placed in a well of a 2 or 4-well micro titer plate on the second day after the FACS isolation.
  • the various conditions that were tested resulted in the recovery of cells at a viability or 95 - 98% of the total isolated protoplast cells.
  • the FACS sorted protoplast cells were transferred to a bead culture for 3 - 20 days.
  • the FACS sorted protoplast cells were regenerated into plants on media which contained 1.5 mg mL of hygromycin using the above described protocol.
  • the putative transgenic plants were confirmed to contain an intact T-strand insert from pDAS000031 via molecular conformation protocols.
  • a canola line containing the T-strand insert from pDAS000036 was obtained and confirmed via molecular characterization to contain a full length, single copy of the T-strand. This canola event was labeled as pDAS000036 - 88 and was used to produce protoplasts via the previously described method.
  • the protoplasts were isolated and -50,000 canola protoplast cells were subsequently co-transformed with a Zinc Finger Nuclease, either pDAS000074 ( Figure 25) or pDAS000075 ( Figure 26), that was designed to target the Zinc Finger binding sites incorporated within the ETIP sequence and a donor plasmid, pDAS000064, pDAS000068, pDAS000070, or pDAS000072 ( Figure 27, Figure 28, Figure 29, and Figure 30, respectively), which shares homology with specific regions of the ETIP.
  • Figure 19 and Figure 20 provide illustrations of the homology directed repair which results in the site-specific integration of the Ds-red transgene via Zinc Finger Nuclease mediated homologous recombination.
  • the Zinc Finger Nuclease was designed to cleave the ETIP locus at a defined Zinc Finger binding sequence, thereby creating a double strand break within the genome.
  • the donor plasmid was integrated within the genome of Brassica napus protoplast cells via homology directed repair.
  • the intron-1 and intron-2 regions of the donor plasmid share homology with the corresponding intron-1 and intron-2 regions of the ETIP locus.
  • the partial DS-red transgene was repaired to a full length, highly expressing DS-red transgene.
  • the expression of the fully operational DS-red transgene was used to sort protoplast cells with the above described FACS method.
  • the ETIP locus serves as a site-specific locus for targeted integration of a donor polynucleotide sequence.
  • the isolated protoplasts can be sorted and regenerated into mature plants. The integration of the donor plasmid can be confirmed within the ETIP-targeted plants using molecular confirmation methods.
  • the donor plasmid DNA and ZFN plasmid DNA were mixed at various concentrations and used to transfect the canola protoplast cells containing Event pDAS000036 - 88, and the transgenic protoplast cells were sorted using the FACS transfection that was previously described.
  • Table 24 describes the various transfection experiments and the DNA concentrations which were used for the transfection of the canola protoplasts containing Event pDAS000036 - 88.
  • the ZFN and donor plasmid DNA was isolated and prepared for the transfections via the previously described methods.
  • Table 24 Donor plasmids and Zinc Finger Nuclease constructs used for the ETIP targeting experiments. The DNA concentrations were used at the indicated ratio of donor to Zinc Finger Nuclease, for a total concentration of 30 micrograms of plasmid DNA per transfection.
  • PLASMID PLASMID DNA ( ⁇ 8 ) DNA ( ⁇ 8 )
  • the frequency of the Ds-Red transgene expression ranged from about 0.03 - 0.07% of the total canola protoplast cells (-50,000). However, the frequency of transfection efficiency for the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus was much higher and ranged from about 0.07 - 0.64%.
  • Figure 21 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000064, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 26 ⁇ g to 4 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.03% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.26 - 0.08%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 22 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000068, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 ⁇ g to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.03% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.38 - 0.12%.
  • the results of the zinc fmger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 23 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000070, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 ⁇ to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.07% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.34 - 0.11%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red flouresence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • Figure 24 shows the results of the transfections in which the donor plasmid and ZFN plasmid were co-transformed.
  • the top graph wherein donor, pDAS000072, and the Zinc Finger Nuclease, pDAS000074, were co-transformed at a ratio of 28 ⁇ g to 2 ⁇ g of plasmid DNA resulted in the Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus at a recombination frequency of about 0.07% of the -50,000 canola protoplast cells. In actuality, the recombination frequency is much higher.
  • the actual Zinc Finger Nuclease mediated integration of the donor DNA construct within the ETIP genomic locus transfection efficiency ranges from about 0.44 - 0.14%.
  • the results of the zinc finger mediated homology directed repair are significantly greater than the negative control experiments, wherein only one protoplast of -50,000 was identified to have red fluorescence, thereby resulting in a recombination frequency of 0.00%, as shown in Figure 20.
  • the FACS sorting method is directly applicable to screen any fluorescent transgene sequence and is used to isolate a proportion of Brassica napus protoplast cells that are targeted with a fluorescent transgene via homology mediated repair within a specific site in the ETIP region within a genomic locus.
  • Entry vector (pDAB 105852) comprised a RB7 MAR sequence (Hall et al., 1991) and eZFN4 Binding site vl (U.S. Patent Publication No. 201 10191899).
  • Another entry vector (pDAB 105853) comprised expression cassette comprising Rice Ubiquitin 3 (OsUbi3) promoter (Sivamani, E., Qu, R., (2006) Plant Molecular Biology 60; 225-239), yellow fluorescent protein (Phi YFP) marker gene coding region (Shagin, D. A., (2004) Mol Biol Evol.
  • Transformation/expression vectors for Agrobacterium-medisAed maize embryo transformation were constructed through the use of standard cloning methods and Gateway® recombination reactions employing a typical destination binary vector (pDAB 109805) and entry vectors as described above.
  • Binary destination vector pDAB 109805 comprised a herbicide tolerance gene (aryloxyalknoate dioxygenase (AAD-1); (U.S. Patent No. 7,838,733) under the expression control of a sugarcane bacilliform virus (SCBV) promoter; essentially as described in U.S. Patent No. 6,093,569.
  • a fragment comprising a 3'UTR from a maize lipase gene ZmLip 3'UTR, U.S. Patent No.
  • AAD-1 was used to terminate transcription of the AAD-1 mRNA.
  • the expression of AAD-1 confers tolerance to herbicidal compounds such as haloxyfop and quizalofop.
  • the Gateway® recombination reaction was used to recombine entry vectors pDAB105852, pDAB105853, pDAB105850, and pDAB105851 with destination vector pDAB 109805 to obtain expression vector pDAB 105855 ( Figure 36) that was used as a Target vector.
  • the ETIP plasmid pDAB1058 contains target DNA sequence comprising; RB7 MAR sequence/eZFN4 Binding site vl, OsUbi3 promoter/ Phi YFP/ ZmPer5 3'UTR v2/eZFNl binding site/ELPl HR2 v2, ZmUbil promoter v8/ Cry34Abl v2/StPinII 3' UTR v2, TaPer promoter v3/Cry35Abl v5/SfPinII 3' UTR v2, SCBVv2/AAD-lv3/ZmLip 3' UTR vl between T-DNA borders.
  • the pDAB 105855 plasmid is an ETIP plasmid and was used for integration within the maize genome.
  • the Zinc Finger Nuclease (ZFN1) vector (pDAB 105941 ; Figure 37) comprised a ZFN1 coding sequence under the expression of maize Ubiquitin 1 promoter with intron 1 (ZmUbil promoter v2) and ZmPer5 3'UTR v2.
  • the donor vector (pDAB 1 12366; Figure 38) contained promoterless intron (rubi3 intron) of Rice Ubiquitin 3 (OsUbi3) promoter followed by a herbicide tolerance gene (phosphinothricin acetyl transferase (PAT); Wehrmann et al. (1996) Nature Biotechnology 14: 1274-1278), and ZmLip 3'UTR.
  • This donor configuration without active promoter does not produce message of PAT gene for herbicide selection.
  • the ZmLip 3'UTR in donor vector is followed by eZFN4 and eZFN8 binding sites, and ELP1 HR2 v2 as described in U.S. Patent Publication No. 201 10191899.
  • the 5' rubi3 intron and 3' ELP1 HR2 v2 sequences in donor are used for 5' and 3' homologies with target (pDAB 105855) for gene targeting to precisely replace Phi YFP sequence in the target with PAT sequence of donor resulting into functional PAT driven by Rice Ubiquitin 3 (OsUbi3) promoter making positive selection for gene targeting.
  • a positive PAT control vector comprised Rice Ubiquitin 3 (OsUbi3) promoter driving the herbicide tolerance gene (phosphinothricin acetyl transferase (PAT) followed by ZmLip 3'UTR was constructed and used in subsequent experiments.
  • the binary expression vectors were transformed into Agrobacterium tumefaciens strain DAtl3192 ternary (International Pat. Pub. No. WO 2012016222). Bacterial colonies were isolated, and binary plasmid DNA was isolated and confirmed via restriction enzyme digestion.
  • Agrobacterium-mediated transformation was used to stably integrate the above described transgenes into the plant genome and thus generate transgenic maize cells, tissues, and plants that produce AAD-1.
  • Maize transformation methods employing superbinary or binary transformation vectors are known in the art, as described, for example, in International PCT Publication No.WO2010/120452. Transformed tissues were selected by their ability to grow on haloxyfop-or bialaphos-containing medium.
  • Glycerol stocks of the project vectors were provided in the Agrobacterium tumefaciens host strain DAtl3192 (WO 2012/016222A2).
  • Agrobacterium cultures were streaked from glycerol stocks onto AB minimal medium and incubated at 20°C in the dark for 3 days containing appropriate antibiotics. The cultures were then streaked onto a plate of YEP medium with antibiotics and incubated at 20°C in the dark for 1 day.
  • a mixture of Inoculation Medium and acetosyringone Frarame et al.
  • Inoculation Medium contains: 2.2 gm/L MS salts; 1 X ISU Modified MS Vitamins (Frame et al., ibid.) 68.4 gm/L sucrose; 36 gm/L glucose; 115 mg/L L-proline; and 100 mg/L myo-inositol; at pH 5.4.) Acetosyringone was added to the flask containing Inoculation Medium to a final concentration of 200 ⁇ from a 1 M stock solution in 100% dimethyl sulfoxide.
  • Ears from Zea mays cultivar B104 were produced in a greenhouse and harvested 10 to 12 days post pollination. Harvested ears were de-husked and surface- sterilized by immersion in a 20% solution of commercial bleach (Ultra Clorox® Germicidal Bleach, 6.15% sodium hypochlorite; with two drops of TWEEN 20) for 20 minutes, followed by three rinses in sterile, deionized water inside a laminar flow hood.
  • commercial bleach Ultra Clorox® Germicidal Bleach, 6.15% sodium hypochlorite; with two drops of TWEEN 20
  • Immature zygotic embryos (1.8 to 2.2 mm long) were aseptically excised from each ear and distributed into one or more micro-centrifuge tubes containing 2.0 mL of Agrobacterium suspension into which 2 ⁇ ⁇ of 10% BREAK-THRU® S233 surfactant (Evonik Industries; Essen, Germany) had been added.
  • Co-cultivation Medium which contains 4.33 gm L MS salts; IX ISU Modified MS Vitamins; 30 gm/L sucrose; 700 mg/L L-proline; 3.3 mg/L Dicamba in KOH (3,6-dichloro-o-anisic acid or 3,6-dichloro-2-methoxybenzoic acid); 100 mg/L myo-inositol; 100 mg/L Casein Enzymatic Hydrolysate; 15 mg/L AgN0 3 ; 200 ⁇ acetosyringone in DMSO; and 3 gm/L agar (SIGMA-ALDRICH, plant cell culture tested) at pH 5.8.
  • IX ISU Modified MS Vitamins 30 gm/L sucrose; 700 mg/L L-proline; 3.3 mg/L Dicamba in KOH (3,6-dichloro-o-anisic acid or 3,6-dichloro-2-methoxybenzoic acid)
  • the liquid Agrobacterium suspension was removed with a sterile, disposable, transfer pipette and co-cultivation plate containing the embryos was placed at the back of the laminar flow hood with the lid ajar for 30 minutes, after which time the embryos were oriented with the scutellum facing up using sterile forceps with the aid of a microscope.
  • the plate was returned to the back of the laminar flow hood with the lid ajar for a further 15 min.
  • the plate was then closed, sealed with 3MTM MicroporeTM medical tape, and placed in an incubator at 25°C with continuous light at approximately 60 ⁇ "2 sec "1 light intensity.
  • Resting Medium which is composed of 4.33 gm/L MS salts; IX ISU Modified MS Vitamins; 30 gm/L sucrose; 700 mg L L-proline; 3.3 mg L Dicamba in KOH; 100 mg/L myo- inositol; 100 mg/L Casein Enzymatic Hydrolysate; 15 mg/L AgN0 3 ; 0.5 gm/L MES (2-(N-morpholino)ethanesulfonic acid monohydrate; PhytoTechnologies Labr.; Lenexa, KS); 250 mg/L Cefotaxime; and 7.0 gm/L agar; at pH 5.8.
  • Resting Medium which is composed of 4.33 gm/L MS salts; IX ISU Modified MS Vitamins; 30 gm/L sucrose; 700 mg L L-proline; 3.3 mg L Dicamba in KOH; 100 mg/L myo- inositol; 100 mg/L Casein Enzymatic Hydrolysate; 15
  • the plates were wrapped with MicroporeTM tape and incubated at 27°C with continuous light at approximately 50 ⁇ "2 sec "1 light intensity for 7 days. Callused embryos ( ⁇ 12/plate) were then transferred to Selection Medium II, which is comprised of Resting Medium (above) but with only 6.5 gm/L agar, and with either 50 nM R-Haloxyfop acid (0.0181 mg/L) or 5.0 mg/L Bialaphos as appropriate. The plates were wrapped and incubated at 27°C with continuous light at approximately 50 pEm "2 sec "1 light intensity for 14 days.
  • Pre-Regeneration Medium contains 4.33 gm L MS salts; IX ISU Modified MS Vitamins; 45 gm/L sucrose; 350 mg/L L-proline; 100 mg/L myo-inositol; 50 mg/L Casein Enzymatic Hydrolysate; 1.0 mg L AgN0 3 ; 0.5 gm L MES; 0.5 mg L naphthaleneacetic acid in NaOH; 2.5 mg/L abscisic acid in ethanol; 1 mg/L 6- benzylaminopurine; 250 mg/L Cefotaxime; 5.5 gm/L agar; and either 50 nM R- Haloxyfop acid or 3.0 mg/L Bialaphos, as appropriate; at pH 5.8.
  • the plates were wrapped and incubated at 27°C with continuous light at approximately 50 ⁇ 2 sec "1 light intensity for 7 days.
  • Regenerating calli ( ⁇ 6/plate) were then transferred to Regeneration Medium in PhytatraysTM (sigma-aldrich) and incubated at 28°C with 16 hours light/8 hours dark per day at approximately 150 pmol m-2 s-1 light intensity for 14 days or until shoots developed.
  • Regeneration Medium contains 4.33 gm/L MS salts; IX ISU Modified MS Vitamins; 60 gm L sucrose; 0.50 gm L MES; 125 mg/L Cefotaxime; 5.5 gm/L agar; and either 50 nM R-Haloxyfop acid or 3.0 mg/L Bialaphos, as appropriate; at pH 5.8. Small shoots with primary roots were then isolated and transferred to Elongation Medium without selection (i.e. Regeneration Medium without R-Haloxyfop acid or Bialaphos) for further growth. Rooted plantlets about 6 cm or taller were transplanted into soil and moved to a growth chamber for hardening off.
  • Transformed plant tissues selected by their ability to grow on medium containing either Haloxyfop or Bialaphos, as appropriate, were transplanted from PhytatraysTM to small pots (T. O. Plastics, 3.5" SVD) filled with growing media (ProMix BX; Premier Tech Horticulture), covered with humidomes (Arco Plastics Ltd.), and then hardened-off in a growth room (28°C day/24°C night, 16-hour photoperiod, 50-70% RH, 200 ⁇ sec " light intensity).
  • Tl seed was planted and plants were analyzed for zygosity of the target transgene using qPCR method.
  • the plants homozygous for target transgene were advanced futher for pollen production.
  • the pollen from homozygous target plants was used to backcross B 104 com plants to obtain T1 S 1 hemizygous immature embryos.
  • the immature embryos were used for particle bombardment with donor and ZFN1 DNA to test gene targeting.
  • Microparticle gold (0.6 micron, BioRad, Hercules, CA,) was prepared for DNA precipitation by weighing out 15 mg into a sterile, siliconized 1.7 mL microcentrifuge rube (Sigma- Aldrich, St. Louis, MO, T3406) and 500 xL of ice cold 100% ethanol was slowly added. After a 15 second sonication in an FS- 14 ultrasonic water bath (Fisher Scientific, Nazareth, PA), the gold was allowed to settle for 30 minutes at room temperature prior to centrifugation at 3,000 rpm for 60 seconds using a MiniSpin (Eppendorf, Hauppauge, NY).
  • Plasmid DNA (0.6 ⁇ g ZFN + 4.4 ⁇ g Donor) was premixed in 0.6 mL microcentrifuge tubes (Fisher Scientific, Nazareth, PA) and added to the gold suspension gently pipeting up and down several times to mix thoroughly. Fifty microliters (50 pL) of ice cold 2.5 M calcium chloride was added and gently mixed by pipeting up and down several times.
  • Rupture discs (650 psi, BioRad, Hercules, CA) were sterilized by soaking for a few minutes in isopropyl alcohol then loaded into the retaining cap of a microparticle bombardment devise (PDS-1000, BioRad, Hercules, CA).
  • An autoclaved stopping screen (BioRad, Hercules, CA) and a loaded macrocarrier was placed into the launch assembly, the lid was screwed on and slide into the bombardment chamber just under the nozzle.
  • the Petri dish containing the screen-covered, leaf target was uncovered and placed in the bombardment chamber 6 cm below the nozzle. A vacuum was pulled (-0.9 bar) and the devise was fired.
  • the bombarded embryos were transferred (scutellum-up) to N6 basal medium and vitamins (Phytotechnology Laboratories, Shawnee Mission, KS) with 2.0 mg/L 2, 4-D, 2.8 g/L proline, 30 g/L sucrose, 100 mg/L casein enzymatic hydrolysate, 100 mg/L myo-inositol.
  • PAT control vector (pDAB 1 12364) was used to standardize tissue culture conditions for the particle bombarded corn embryos.
  • the donor vector (pDABl 12366) was tested for with and without ZFNl vector (pDAB105941) for potential background selection.
  • transformation frequency of 9% was obtained using PAT control vector (pDABl 12364).
  • This data show that Rice Ubiquitin 3 (OsUbi3) promoter drives robust expression of PAT gene to obtain selection for plant transformation using particle bombardment of corn B104 immature embryos.
  • a very small number (1-2) of plants were obtained on PAT selection media for the immature embryos bombarded using donor vector (pDABl 12366) with or without ZFNl vector (pDAB105941).
  • Table 25 Shows the transformation frequency for the ETIP constructs within the corn genome.
  • Immature corn embryos hemizygous to target pDAB105855 were treated for particle bombardment using ZFNl and donor DNA premix (pDAB105941/l 12366) to obtain gene targeting using positive PAT selection.
  • Tablel7 shows that target event and number of embryos that were used for each event.
  • Table 26 are the number of plants that were successfully regenerated on the PAT selection media for each target event. In total, 68 plants were regenerated form 13,563 immature embryos treated covering all the events. The small number of plants obtained on PAT selection media demonstrate that most of the non-targeted random PAT donor insertions were eliminated.
  • Table 26 Shows the target event and the number of embryos that were used for each event.

Abstract

L'invention concerne une plateforme d'intégration de transgène génétiquement modifié (ETIP) qui peut être insérée aléatoirement ou à des emplacements ciblés dans des génomes de plantes pour faciliter la sélection rapide et la détection rapide d'un GOI qui est parfaitement ciblé (à la fois les extrémités 5' et 3') à l'emplacement génomique de l'ETIP. Un élément de la présente invention est l'introduction de coupures spécifiques double brin à l'intérieur de l'ETIP. Dans certains modes de réalisation, une ETIP est décrite à l'aide de sites de liaison à une nucléase à doigt de zinc mais peut utiliser d'autres technologies de ciblage telles que des méganucléases, CRISPR, TAL, ou des fermetures éclair à leucine. L'invention concerne également des compositions et des procédés de production de plantes transgéniques, l'ADN de donneur ou de charge utile exprimant un ou plusieurs produits d'une séquence d'acide nucléique exogène (par ex une protéine ou un ARN) qui a été intégrée de façon stable à l'intérieur d'une ETIP dans une cellule végétale. Dans des modes de réalisation, l'ETIP facilite le test de candidats de gène et des vecteurs d'expression de plantes à partir de l'idéation à travers des phases de développement.
EP13835965.8A 2012-09-07 2013-09-06 Plateforme d'intégration de transgène génétiquement modifié (etip) pour le ciblage génique et l'empilement de caractères Active EP2893025B1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261697882P 2012-09-07 2012-09-07
PCT/US2013/058584 WO2014039872A1 (fr) 2012-09-07 2013-09-06 Plateforme d'intégration de transgène génétiquement modifié (etip) pour le ciblage génique et l'empilement de caractères

Publications (3)

Publication Number Publication Date
EP2893025A1 true EP2893025A1 (fr) 2015-07-15
EP2893025A4 EP2893025A4 (fr) 2016-08-31
EP2893025B1 EP2893025B1 (fr) 2019-03-13

Family

ID=50237646

Family Applications (1)

Application Number Title Priority Date Filing Date
EP13835965.8A Active EP2893025B1 (fr) 2012-09-07 2013-09-06 Plateforme d'intégration de transgène génétiquement modifié (etip) pour le ciblage génique et l'empilement de caractères

Country Status (18)

Country Link
US (1) US10640779B2 (fr)
EP (1) EP2893025B1 (fr)
JP (1) JP6505599B2 (fr)
KR (1) KR102243727B1 (fr)
CN (2) CN107267524B (fr)
AR (1) AR092479A1 (fr)
AU (1) AU2013312352B2 (fr)
BR (1) BR112015004848B8 (fr)
CA (1) CA2883792C (fr)
CL (1) CL2015000565A1 (fr)
HK (1) HK1211054A1 (fr)
IL (1) IL237534B (fr)
NZ (1) NZ705675A (fr)
RU (1) RU2666916C2 (fr)
TW (1) TWI669396B (fr)
UA (1) UA119135C2 (fr)
WO (1) WO2014039872A1 (fr)
ZA (1) ZA201501735B (fr)

Families Citing this family (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013066438A2 (fr) 2011-07-22 2013-05-10 President And Fellows Of Harvard College Évaluation et amélioration de la spécificité de clivage des nucléases
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
LT3401400T (lt) 2012-05-25 2019-06-10 The Regents Of The University Of California Būdai ir kompozicijos, skirtos rnr molekulės nukreipiamai tikslinės dnr modifikacijai ir rnr molekulės nukreipiamam transkripcijos moduliavimui
CN105264067B (zh) * 2012-09-07 2020-11-10 美国陶氏益农公司 Fad3性能基因座及相应的能够诱导靶向断裂的靶位点特异性结合蛋白
DE202013012597U1 (de) 2012-10-23 2017-11-21 Toolgen, Inc. Zusammensetzung zum Spalten einer Ziel-DNA, umfassend eine für die Ziel-DNA spezifische guide-RNA und eine Cas-Protein-codierende Nukleinsäure oder ein Cas-Protein, sowie deren Verwendung
EP3138911B1 (fr) 2012-12-06 2018-12-05 Sigma Aldrich Co. LLC Modification et régulation de génome à base de crispr
KR101780885B1 (ko) 2013-03-14 2017-10-11 카리부 바이오사이언시스 인코포레이티드 핵산-표적화 핵산의 조성물 및 방법
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
CA3109801C (fr) 2013-08-22 2024-01-09 Andrew Cigan Modification du genome des plantes a l'aide de systemes d'arn de guida /endonuclease cas et leurs procedes d'utilisation
BR102014021330A2 (pt) 2013-08-30 2015-09-22 Dow Agrosciences Llc construtos para expressão de transgenes usando elementos reguladores de genes de ubiquitina de panicum
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
LT3066201T (lt) 2013-11-07 2018-08-10 Editas Medicine, Inc. Su crispr susiję būdai ir kompozicijos su valdančiomis grnr
US20150165054A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Methods for correcting caspase-9 point mutations
GB201407852D0 (en) 2014-05-02 2014-06-18 Iontas Ltd Preparation of libraries od protein variants expressed in eukaryotic cells and use for selecting binding molecules
BR122023024818A2 (pt) * 2014-07-11 2023-12-26 Pioneer Hi-Bred International, Inc. Rna guia, polinucleotídeo e complexo de ribonucleoproteínas
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11071289B2 (en) 2014-08-14 2021-07-27 Biocytogen Boston Corp DNA knock-in system
CN108064129A (zh) 2014-09-12 2018-05-22 纳幕尔杜邦公司 玉米和大豆中复合性状基因座的位点特异性整合位点的产生和使用方法
TW201619386A (zh) * 2014-11-11 2016-06-01 陶氏農業科學公司 合成性雙向植物啓動子
AR102612A1 (es) * 2014-11-11 2017-03-15 Dow Agrosciences Llc Promotor vegetal bidireccional sintético
KR20240013283A (ko) 2014-12-03 2024-01-30 애질런트 테크놀로지스, 인크. 화학적 변형을 갖는 가이드 rna
EP3237624B1 (fr) 2014-12-23 2020-01-29 Syngenta Participations AG Procédés et compositions d'identification et d'enrichissement pour des cellules contenant des modifications génomiques spécifiques à un site
KR102194612B1 (ko) * 2015-03-16 2020-12-23 인스티튜트 오브 제네틱스 앤드 디벨롭멘털 바이오롤지, 차이니즈 아카데미 오브 사이언시스 비-유전성 물질을 이용한 식물 게놈의 부위-특이적인 변형 방법
JP6873911B2 (ja) 2015-04-06 2021-05-19 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー 初代細胞において標的核酸の遺伝子調節を誘導するためにインビトロで行う方法
GB201506509D0 (en) 2015-04-16 2015-06-03 Univ Wageningen Nuclease-mediated genome editing
WO2016176476A1 (fr) * 2015-04-28 2016-11-03 Bayer Cropscience Nv Plantes du genre brassica et composition d'huile de graines modifiées
EP3095870A1 (fr) 2015-05-19 2016-11-23 Kws Saat Se Procédés pour la transformation in planta de plantes et procédés de fabrication basés sur ceux-ci et produits pouvant être obtenus à partir de ceux-ci
US10648020B2 (en) 2015-06-18 2020-05-12 The Broad Institute, Inc. CRISPR enzymes and systems
EP3365357B1 (fr) 2015-10-23 2024-02-14 President and Fellows of Harvard College Protéines cas9 évoluées pour l'édition génétique
WO2017189336A1 (fr) 2016-04-25 2017-11-02 The Regents Of The University Of California Procédés et compositions pour l'édition génomique
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
TW201805425A (zh) * 2016-06-16 2018-02-16 艾格里遺傳學股份有限公司 用於轉殖基因表現之植物啟動子與３’ｕｔｒ
AU2017306676B2 (en) 2016-08-03 2024-02-22 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
AU2017308889B2 (en) 2016-08-09 2023-11-09 President And Fellows Of Harvard College Programmable Cas9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
SG11201903089RA (en) 2016-10-14 2019-05-30 Harvard College Aav delivery of nucleobase editors
CN109906030B (zh) 2016-11-04 2022-03-18 安健基因公司 用于产生仅重链抗体的经基因修饰的非人动物和方法
CA3043019A1 (fr) * 2016-11-21 2018-05-24 Dow Agrosciences Llc Integration specifique au site d'un transgene au moyen de la recombinaison intragenomique a l'aide d'une voie de reparation de raccordement d'extremites non homologue
WO2018119359A1 (fr) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Édition du gène récepteur ccr5 pour protéger contre l'infection par le vih
US11859219B1 (en) 2016-12-30 2024-01-02 Flagship Pioneering Innovations V, Inc. Methods of altering a target nucleotide sequence with an RNA-guided nuclease and a single guide RNA
US10828330B2 (en) * 2017-02-22 2020-11-10 IO Bioscience, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof
WO2018165504A1 (fr) 2017-03-09 2018-09-13 President And Fellows Of Harvard College Suppression de la douleur par édition de gène
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
IL306092A (en) 2017-03-23 2023-11-01 Harvard College Nucleic base editors that include nucleic acid programmable DNA binding proteins
WO2018209320A1 (fr) 2017-05-12 2018-11-15 President And Fellows Of Harvard College Arn guides incorporés par aptazyme pour une utilisation avec crispr-cas9 dans l'édition du génome et l'activation transcriptionnelle
IL271883B1 (en) * 2017-07-12 2024-04-01 Refuge Biotechnologies Inc Systems and methods for conditional regulation of gene expression
JP2020534795A (ja) 2017-07-28 2020-12-03 プレジデント アンド フェローズ オブ ハーバード カレッジ ファージによって支援される連続的進化（ｐａｃｅ）を用いて塩基編集因子を進化させるための方法および組成物
WO2019139645A2 (fr) 2017-08-30 2019-07-18 President And Fellows Of Harvard College Éditeurs de bases à haut rendement comprenant une gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11390876B2 (en) 2018-03-09 2022-07-19 Pioneer Hi-Bred International, Inc. Compositions and methods for modification of fatty acids in soybean
EP3790594A4 (fr) * 2018-05-07 2022-02-23 Pioneer Hi-Bred International, Inc. Méthodes et compositions pour la recombinaison homologue dirigée de cassures double brin médiées par une endonucléase cas
EP3578658A1 (fr) * 2018-06-08 2019-12-11 Johann Wolfgang Goethe-Universität Frankfurt Procédé pour générer un vecteur d'édition génique avec des paires d'arn de guidage fixe
WO2020081438A1 (fr) 2018-10-16 2020-04-23 Blueallele, Llc Procédés d'insertion ciblée d'adn dans des gènes
JP2022514493A (ja) 2018-12-14 2022-02-14 パイオニア ハイ－ブレッド インターナショナル， インコーポレイテッド ゲノム編集のための新規なｃｒｉｓｐｒ－ｃａｓシステム
JP2022526908A (ja) 2019-03-19 2022-05-27 ザ ブロード インスティテュート，インコーポレーテッド 編集ヌクレオチド配列を編集するための方法および組成物
BR112022013772A2 (pt) * 2020-01-09 2022-10-11 Pioneer Hi Bred Int Troca de genes em duas etapas
AU2021267940A1 (en) 2020-05-08 2022-12-08 President And Fellows Of Harvard College Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
RU2741092C1 (ru) * 2020-07-23 2021-01-22 Федеральное государственное бюджетное образовательное учреждение высшего образования "Кузбасская государственная сельскохозяйственная академия" Генетическая конструкция для получения устойчивых к вирусу лейкоза эмбрионов крупного рогатого скота
AU2022343300A1 (en) 2021-09-10 2024-04-18 Agilent Technologies, Inc. Guide rnas with chemical modification for prime editing
CN114807196B (zh) * 2022-03-30 2023-08-15 南京农业大学 一种追踪土传植物致病菌传播耐药基因的荧光标记方法

Family Cites Families (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US789538A (en) 1904-11-11 1905-05-09 Colin E Ham Dumb-bell.
US4727028A (en) 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US5428147A (en) 1983-04-15 1995-06-27 Mycogen Plant Science, Inc. Octopine T-DNA promoters
CA2181548C (fr) 1994-01-18 2009-11-03 Carlos F. Barbas, Iii Derives de proteine a doigts zinciques et procedes associes
US6242568B1 (en) 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6140466A (en) 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
USRE45795E1 (en) 1994-08-20 2015-11-10 Gendaq, Ltd. Binding proteins for recognition of DNA
GB9824544D0 (en) 1998-11-09 1999-01-06 Medical Res Council Screening system
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
US5994123A (en) 1996-08-09 1999-11-30 Regents Of University Of Minnesota Sugarcane bacilliform virus promoter
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
GB2338237B (en) 1997-02-18 2001-02-28 Actinova Ltd In vitro peptide or protein expression library
GB9703369D0 (en) 1997-02-18 1997-04-09 Lindqvist Bjorn H Process
GB9710809D0 (en) 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
GB9710807D0 (en) 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
EP0991764B1 (fr) 1997-06-12 2006-07-12 Dow AgroSciences LLC Sequences regulatrices pour plantes transgeniques
US6087166A (en) 1997-07-03 2000-07-11 Basf Aktiengesellschaft Transcriptional activators with graded transactivation potential
US6410248B1 (en) 1998-01-30 2002-06-25 Massachusetts Institute Of Technology General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites
AU746454B2 (en) 1998-03-02 2002-05-02 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US7070934B2 (en) 1999-01-12 2006-07-04 Sangamo Biosciences, Inc. Ligand-controlled regulation of endogenous gene expression
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6794136B1 (en) 2000-11-20 2004-09-21 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US7030215B2 (en) 1999-03-24 2006-04-18 Sangamo Biosciences, Inc. Position dependent recognition of GNN nucleotide triplets by zinc fingers
ATE309536T1 (de) 1999-12-06 2005-11-15 Sangamo Biosciences Inc Methoden zur verwendung von randomisierten zinkfingerprotein-bibliotheken zur identifizierung von genfunktionen
WO2001059450A2 (fr) 2000-02-08 2001-08-16 Sangamo Biosciences, Inc. Cellules destinees a la decouverte de medicaments
US20020061512A1 (en) 2000-02-18 2002-05-23 Kim Jin-Soo Zinc finger domains and methods of identifying same
US20030044787A1 (en) 2000-05-16 2003-03-06 Joung J. Keith Methods and compositions for interaction trap assays
JP2002060786A (ja) 2000-08-23 2002-02-26 Kao Corp 硬質表面用殺菌防汚剤
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7022826B2 (en) 2001-02-26 2006-04-04 The Regents Of The University Of California Non-oligomerizing fluorescent proteins
GB0108491D0 (en) 2001-04-04 2001-05-23 Gendaq Ltd Engineering zinc fingers
DE10131786A1 (de) * 2001-07-04 2003-01-16 Sungene Gmbh & Co Kgaa Rekombinationssysteme und Verfahren zum Entfernen von Nukleinsäuresequenzen aus dem Genom eukaryotischer Organismen
US20040224385A1 (en) 2001-08-20 2004-11-11 Barbas Carlos F Zinc finger binding domains for cnn
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
CA2474486C (fr) 2002-01-23 2013-05-14 The University Of Utah Research Foundation Mutagenese chromosomique ciblee au moyen de nucleases en doigt a zinc
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
JP2005521400A (ja) 2002-03-29 2005-07-21 シンジェンタ パーティシペーションズ アクチェンゲゼルシャフト 植物におけるラムダインテグラーゼ媒介型組換え
AU2003256373A1 (en) 2002-06-27 2004-01-19 Dow Agrosciences Llc Use of regulatory sequences in transgenic plants
US7361635B2 (en) 2002-08-29 2008-04-22 Sangamo Biosciences, Inc. Simultaneous modulation of multiple genes
EP2806025B1 (fr) 2002-09-05 2019-04-03 California Institute of Technology Utilisation de nucléases à doigt de zinc pour stimuler le ciblage de gènes
US7888121B2 (en) 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US8409861B2 (en) 2003-08-08 2013-04-02 Sangamo Biosciences, Inc. Targeted deletion of cellular DNA sequences
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
CA2561714A1 (fr) 2004-04-08 2005-10-27 Sangamo Biosciences, Inc. Procedes et compositions permettant de traiter les troubles neuropathiques et neurodegeneratifs
AU2005233550B2 (en) 2004-04-08 2010-11-18 Sangamo Therapeutics, Inc. Treatment of neuropathic pain with zinc finger proteins
CA2897475C (fr) 2004-04-30 2018-07-10 Dow Agrosciences Llc Nouveaux genes de resistance aux herbicides
KR101419729B1 (ko) * 2005-07-26 2014-07-17 상가모 바이오사이언스 인코포레이티드 외래 핵산 서열의 표적화된 통합 및 발현
PL2049663T3 (pl) * 2006-08-11 2015-08-31 Dow Agrosciences Llc Homologiczna rekombinacja za pośrednictwem nukleazy z palcami cynkowymi
SI2415872T1 (sl) * 2006-12-14 2016-09-30 Dow Agrosciences Llc Optimizirani nekanonični proteini s cinkovim prstom
EP2167666A2 (fr) * 2007-06-29 2010-03-31 Pioneer Hi-Bred International Inc. Procédés de modification du génome d'une cellule de plante monocotylédone
CA2700231C (fr) 2007-09-27 2018-09-18 Sangamo Biosciences, Inc. Identification in vivo rapide de nucleases biologiquement actives
EP2205749B1 (fr) 2007-09-27 2016-05-18 Dow AgroSciences LLC Protéines à doigt de zinc synthétisées ciblant des gènes de 5-énolpyruvyl shikimate-3-phosphate synthase
US8273535B2 (en) 2008-02-08 2012-09-25 Dow Agrosciences, Llc Methods for detection of corn event DAS-59132
US8293533B2 (en) 2008-12-19 2012-10-23 E.I. Du Pont De Nemours And Company Site-specific integration and stacking of transgenes in soybean via DNA recombinase mediated cassette exchange
EP2206723A1 (fr) 2009-01-12 2010-07-14 Bonas, Ulla Domaines modulaires de liaison à l'ADN
AU2010236944B2 (en) 2009-04-17 2016-07-21 Dow Agrosciences Llc DIG-3 insecticidal Cry toxins
JP2012529287A (ja) 2009-06-11 2012-11-22 トゥールゲン インコーポレイション 部位−特異的ヌクレアーゼを用いた標的ゲノムの再配列
MY174390A (en) * 2009-10-22 2020-04-15 Sangamo Biosciences Inc Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
SG181601A1 (en) 2009-12-10 2012-07-30 Univ Minnesota Tal effector-mediated dna modification
GEP201606544B (en) 2010-01-22 2016-09-26 Dow Agrosciences Llc Excision of transgenes in genetically modified organisms
EA031322B1 (ru) 2010-01-22 2018-12-28 Дау Агросайенсиз Ллс Клетка или клеточная линия для экспрессии экзогенных нуклеотидных последовательностей и применение клетки или клеточной линии
HUE033500T2 (en) 2010-01-22 2017-12-28 Dow Agrosciences Llc Genetically modified landing site for gene targeting in plants
EP2571512B1 (fr) 2010-05-17 2017-08-23 Sangamo BioSciences, Inc. Nouvelles protéines se liant à l'adn et leurs utilisations
RU2611188C2 (ru) 2010-07-29 2017-02-21 ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи Штаммы agrobacterium, модифицированные для увеличения частоты трансформации растений
CN105264067B (zh) 2012-09-07 2020-11-10 美国陶氏益农公司 Fad3性能基因座及相应的能够诱导靶向断裂的靶位点特异性结合蛋白
UA118090C2 (uk) * 2012-09-07 2018-11-26 ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі Спосіб інтегрування послідовності нуклеїнової кислоти, що представляє інтерес, у ген fad2 у клітині сої та специфічний для локусу fad2 білок, що зв'язується, здатний індукувати спрямований розрив
TWI670004B (zh) * 2012-09-07 2019-09-01 美商陶氏農業科學公司 用來產生植物之螢光激活細胞分選富增技術
CN209006297U (zh) 2018-10-08 2019-06-21 河南精诚汽车零部件有限公司 一种热处理工件超声波清洗筐

Also Published As

Publication number Publication date
JP2015531598A (ja) 2015-11-05
UA119135C2 (uk) 2019-05-10
TW201425580A (zh) 2014-07-01
KR20150046345A (ko) 2015-04-29
BR112015004848A2 (pt) 2017-07-04
AU2013312352B2 (en) 2019-03-14
WO2014039872A1 (fr) 2014-03-13
AU2013312352A1 (en) 2015-03-26
EP2893025B1 (fr) 2019-03-13
CA2883792A1 (fr) 2014-03-13
CN107267524A (zh) 2017-10-20
CN104838001B (zh) 2017-07-18
NZ705675A (en) 2018-07-27
HK1211054A1 (en) 2016-05-13
RU2666916C2 (ru) 2018-09-13
US20140090113A1 (en) 2014-03-27
CA2883792C (fr) 2021-12-07
AR092479A1 (es) 2015-04-22
US10640779B2 (en) 2020-05-05
RU2015112593A (ru) 2016-10-27
TWI669396B (zh) 2019-08-21
IL237534B (en) 2019-08-29
CN104838001A (zh) 2015-08-12
CL2015000565A1 (es) 2015-06-12
ZA201501735B (en) 2016-07-27
KR102243727B1 (ko) 2021-04-26
IL237534A0 (en) 2015-04-30
EP2893025A4 (fr) 2016-08-31
BR112015004848B1 (pt) 2023-01-24
CN107267524B (zh) 2021-08-24
JP6505599B2 (ja) 2019-04-24
BR112015004848B8 (pt) 2023-05-16

Similar Documents

Publication Publication Date Title
AU2013312352B2 (en) Engineered transgene integration platform (ETIP) for gene targeting and trait stacking
US11198883B2 (en) Methods and compositions for integration of an exogenous sequence within the genome of plants
US20180223297A1 (en) Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
CA2883800C (fr) Enrichissement par tri cellulaire par fluorescence (facs) pour generer des plantes
US20200377899A1 (en) Methodologies and compositions for creating targeted recombination and breaking linkage between traits
AU2013312538A1 (en) FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
EA041676B1 (ru) Создание маиса, устойчивого к северной пятнистости листьев

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20150323

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 5/10 20060101AFI20160330BHEP

REG Reference to a national code

Ref country code: DE

Ref legal event code: R079

Ref document number: 602013052423

Country of ref document: DE

Free format text: PREVIOUS MAIN CLASS: C12N0015820000

Ipc: C12N0005100000

RA4 Supplementary search report drawn up and despatched (corrected)

Effective date: 20160728

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 5/10 20060101AFI20160722BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20170705

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20180927

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DOW AGROSCIENCES LLC

RIN1 Information on inventor provided before grant (corrected)

Inventor name: FORSTER, JOHN

Inventor name: SPANGENBERG, GERMAN

Inventor name: AINLEY, W. MIKE

Inventor name: HENRY, MATTHEW J.

Inventor name: KUMAR, SANDEEP

Inventor name: MASON, JOHN

Inventor name: NOVAK, STEPHEN

Inventor name: HAYDEN, MATTHEW

Inventor name: GUPTA, MANJU

Inventor name: COGAN, NOEL

Inventor name: SAWBRIDGE, TIM

Inventor name: WEBB, STEVEN R.

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

Ref country code: AT

Ref legal event code: REF

Ref document number: 1107687

Country of ref document: AT

Kind code of ref document: T

Effective date: 20190315

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: FIAMMENGHI-FIAMMENGHI, CH

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602013052423

Country of ref document: DE

REG Reference to a national code

Ref country code: NL

Ref legal event code: MP

Effective date: 20190313

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190613

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190614

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190613

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 1107687

Country of ref document: AT

Kind code of ref document: T

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190713

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602013052423

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190713

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

26N No opposition filed

Effective date: 20191216

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20190906

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20190906

REG Reference to a national code

Ref country code: BE

Ref legal event code: MM

Effective date: 20190930

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20190930

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20190930

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20130906

Ref country code: MT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

REG Reference to a national code

Ref country code: DE

Ref legal event code: R081

Ref document number: 602013052423

Country of ref document: DE

Owner name: CORTEVA AGRISCIENCE LLC, INDIANAPOLIS, US

Free format text: FORMER OWNER: DOW AGROSCIENCES LLC, INDIANAPOLIS, IND., US

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20190313

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20230926

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20230921

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20231001

Year of fee payment: 11