Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
  • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
  • C12N9/2405—Glucanases
  • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
  • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
• • C—CHEMISTRY; METALLURGY
  • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
  • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
  • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
  • C11D3/16—Organic compounds
  • C11D3/38—Products with no well-defined composition, e.g. natural products
  • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
  • C11D3/38645—Preparations containing enzymes, e.g. protease or amylase containing cellulase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
  • C12P7/06—Ethanol, i.e. non-beverage
  • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
  • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
  • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
  • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
• • D—TEXTILES; PAPER
  • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
  • D06L—DRY-CLEANING, WASHING OR BLEACHING FIBRES, FILAMENTS, THREADS, YARNS, FABRICS, FEATHERS OR MADE-UP FIBROUS GOODS; BLEACHING LEATHER OR FURS
  • D06L4/00—Bleaching fibres, filaments, threads, yarns, fabrics, feathers or made-up fibrous goods; Bleaching leather or furs
  • D06L4/40—Bleaching fibres, filaments, threads, yarns, fabrics, feathers or made-up fibrous goods; Bleaching leather or furs using enzymes
• • D—TEXTILES; PAPER
  • D06—TREATMENT OF TEXTILES OR THE LIKE; LAUNDERING; FLEXIBLE MATERIALS NOT OTHERWISE PROVIDED FOR
  • D06M—TREATMENT, NOT PROVIDED FOR ELSEWHERE IN CLASS D06, OF FIBRES, THREADS, YARNS, FABRICS, FEATHERS OR FIBROUS GOODS MADE FROM SUCH MATERIALS
  • D06M16/00—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic
  • D06M16/003—Biochemical treatment of fibres, threads, yarns, fabrics, or fibrous goods made from such materials, e.g. enzymatic with enzymes or microorganisms
• • D—TEXTILES; PAPER
  • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
  • D21C—PRODUCTION OF CELLULOSE BY REMOVING NON-CELLULOSE SUBSTANCES FROM CELLULOSE-CONTAINING MATERIALS; REGENERATION OF PULPING LIQUORS; APPARATUS THEREFOR
  • D21C5/00—Other processes for obtaining cellulose, e.g. cooking cotton linters ; Processes characterised by the choice of cellulose-containing starting materials
  • D21C5/02—Working-up waste paper
• • D—TEXTILES; PAPER
  • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
  • D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
  • D21H17/00—Non-fibrous material added to the pulp, characterised by its constitution; Paper-impregnating material characterised by its constitution
  • D21H17/20—Macromolecular organic compounds
  • D21H17/21—Macromolecular organic compounds of natural origin; Derivatives thereof
  • D21H17/22—Proteins
• • D—TEXTILES; PAPER
  • D21—PAPER-MAKING; PRODUCTION OF CELLULOSE
  • D21H—PULP COMPOSITIONS; PREPARATION THEREOF NOT COVERED BY SUBCLASSES D21C OR D21D; IMPREGNATING OR COATING OF PAPER; TREATMENT OF FINISHED PAPER NOT COVERED BY CLASS B31 OR SUBCLASS D21G; PAPER NOT OTHERWISE PROVIDED FOR
  • D21H21/00—Non-fibrous material added to the pulp, characterised by its function, form or properties; Paper-impregnating or coating material, characterised by its function, form or properties
  • D21H21/06—Paper forming aids
  • D21H21/10—Retention agents or drainage improvers
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
  • Y02E50/00—Technologies for the production of fuel of non-fossil origin
  • Y02E50/10—Biofuels, e.g. bio-diesel
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
  • Y02W30/00—Technologies for solid waste management
  • Y02W30/50—Reuse, recycling or recovery technologies
  • Y02W30/64—Paper recycling

Definitions

• the present invention relates to an endoglucanase PPCE, a cellulase preparation containing the endoglucanase PPCE, and a method of treating a cellulose-containing fabric utilizing the endoglucanase PPCE or the cellulase preparation.
• a cellulose-containing fabric has been treated with cellulase to impart desired properties to the fabric.
• a treatment with cellulase is carried out to improve the touch feel and appearance of a cellulose-containing fabric, or to impart a "stonewash" appearance to a colored cellulose-containing fabric, thereby providing the fabric with localized color change [patent reference 1].
• Cellulases used for such uses include endoglucanases belonging to family 45, endoglucanases belonging to family 5, and endoglucanases belonging to family 12. It is normal in this technical field that these endoglucanases may be appropriately selected in accordance with their properties (for example, an optimum pH, an optimum temperature, an effect to improve the texture of a fabric, or an influence on fiber strength). Endoglucanases belonging to family 45 are mainly used under neutral conditions, endoglucanases belonging to family 12 are used under acidic conditions to neutral conditions, and endoglucanases belonging to family 5 are mainly used under acidic conditions.
• endoglucanases belonging to family 45 include a purified 43 kDa endoglucanase component derived from genus Humicola [patent reference 2], endoglucanase NCE5 derived from genus Humicola [patent reference 3], and endoglucanase RCE I derived from genus Rhizopus [patent reference 9].
• Examples of endoglucanases belonging to family 5 include endoglucanase SCE3 derived from genus Trichoderma [patent reference 5].
• Examples of endoglucanases belonging to family 12 include endoglucanase EG III derived from genus Trichoderma [non-patent reference 1] and endoglucanase FI-CMCase derived from genus Aspergillus [non-patent reference 2]. It is known that genus Penicillium produces endoglucanase having a molecular weight of 25 kDa [non-patent reference 3].
• Optimum temperatures of these known enzymes are within a middle temperature area (for example, 40°C to 60 °C), and optimum pHs thereof are around between an acidic condition and a neutral condition (for example, pH 4.0 to pH 8.0).
• a neutral condition for example, pH 4.0 to pH 8.0.
• an enzyme having a low optimum temperature such as lower than 40 °C
• a strongly acidic optimum pH such as less than pH 4.0
• a cellulase preparation is commonly provided as a preparation comprising a large amount of endoglucanase having a high activity.
• processes of overexpressing a desired endoglucanase component having a high activity in host cells using genetic recombinant techniques are known [patent references 6, 7].
• filamentous fungi belonging to Hyphomycetes such as filamentous fungi belonging to genus Aspergillus , Humicola , or Trichoderma .
• genus Trichoderma producing acidic cellulase is preferable as host cells, by comparison with genus Aspergillus or Humicola producing neutral cellulase, because a synergistic effect caused by cellulase derived from the host is expected.
• the filamentous fungi belonging to genus Trichoderma having a high productivity is most preferable [patent reference 8].
• RU 2 238 974 C2 describes endogluconase III enzymes from penicillium verruculosum.
• the enzymes have a temperature maximum of 95 to 55 °C and a ph optimum of pH 3.5 to ph 4.5.
• WO 00/14208 A1 describes endocluconase III-like enzymes derived from the EG III of Trichoderma reesei that differ from the Trichoderma enzyme in several defined amino acid positions and exhibit an improved stability in presence of thermal or surfactant mediated stress.
• various cellulases were isolated from filamentous fungi belonging to genus Humicola , Trichoderma , Rhizopus , Mucor , Phycomyces , Staphylotrichum or the like, and genes encoding the cellulases were also isolated.
• enzyme groups belonging to cellulase family 5, family 12, and family 45, derived from filamentous fungi exhibit advantageous activities in fabric processing, and thus, are widely used in this technical field.
• these enzyme groups are enzymes having a moderate optimum temperature and an acidic or neutral optimum pH, but there is not a low-temperature enzyme nor a strongly acidic enzyme.
• an enzyme having a high activity against fibers and a low optimum temperature and/or a strongly acidic optimum pH is strongly desired.
• the present inventors found a novel protein having endoglucanase activity and a gene thereof from Penicillium pinophilum PF1365 (FERM BP-10780).
• the present invention provides endoglucanase PPCE, a cellulase preparation containing endoglucanase PPCE, and a method of treating a cellulose-containing fabric utilizing endoglucanase PPCE or the cellulase preparation.
• the present inventors found that the novel protein having endoglucanase activity, which was isolated from Penicillium pinophilum PF1365 (FERM BP-10780), exhibited extremely high activities to improve the appearance of a cellulose-containing fabric and to impart a "stonewash" appearance to a colored cellulose-containing fabric.
• endoglucanase PPCE (hereinafter, simply referred to "PPCE") exhibited a remarkably high activity in fabric processing, by comparison with endoglucanase SCE3 [patent reference 5] and endoglucanase EG III [non-patent reference 1], which are widely used as a typical cellulase for fabric processing, mainly under acidic conditions.
• endoglucanase PPCE exhibited surprising features that its optimum pH and optimum temperature were remarkably low, i.e., around pH 3 and 30°C, respectively, by comparison with known cellulases for fabric processing. Even if compared with the optimum temperature (50 to 55°C) and the optimum pH (pH 4.0 to 5.0) of endoglucanase I derived from Penicillium pinophilum IMI87160ii [non-patent reference 3], which had not been used in fabric processing, the optimum pH and optimum temperature of endoglucanase PPCE were remarkably low.
• the present inventors isolated a gene encoding endoglucanase PPCE derived from Penicillium pinophilum PF1365 (FERM BP-10780), and attained an industrially large-scale production of PPCE in Trichoderma viride utilizing a regulatory sequence of a cellulase cbhI gene ( WO98/11239 ). Therefore, the present invention provides the novel protein having endoglucanase activity derived from Penicillium pinophilum PF1365 (FERM BP-10780) and the gene thereof, and a cellulase preparation containing the protein and having excellent properties.
• the present invention provides a host cell transformed with the gene encoding the protein, and a method of obtaining the protein of interest by cultivating the host cell. Furthermore, the present invention provides a method of treating a cellulose-containing fabric with the protein of the present invention or the cellulase preparation of the present invention.
• the present invention includes the following inventions.
• the protein of the present invention is available for washing or fabric processing, such as improvement of the touch feel and appearance of a cellulose-containing fabric, providing a localized color change to the fabric, color clarification, reduction of fuzz or a reduction of stiffness.
• doglucanase as used herein means an enzyme exhibiting an endoglucanase activity, i.e., endo-1,4- ⁇ -glucanase (EC 3.2.1.4), which has an activity of hydrolyzing the ⁇ -1,4-glucopyranosyl bond of ⁇ -1,4-glucan.
• the term “endoglucanase activity” as used herein means a CMCase activity.
• CMCase activity means an activity of hydrolyzing carboxymethylcellulose (CMC; Tokyo Kasei Kogyo Co., Ltd.).
• CMC carboxymethylcellulose
• a solution containing a protein (enzyme) to be assayed and CMC is incubated for a predetermined period and the amount of reducing sugar released is measured, the amount of the enzyme producing the reducing sugar corresponding to 1 ⁇ mol of glucose per minute is defined as 1 unit of CMCase activity.
• the endoglucanase activity can be measured, for example, by the following procedure. That is, 0.5 mL of a solution containing a protein to be assayed is added to 0.5 mL of a 2% CMC solution dissolved in a 50 mmol/L acetate-sodium acetate buffer (pH6.0), and the mixture is incubated at 50 °C for 30 minutes. A concentration of reducing sugar generated in the reaction mixture is measured by the 3,5-dinitrosalicylic acid method (DNS method).
• DNS method 3,5-dinitrosalicylic acid method
• a DNS reagent is added to 1.0 mL of the reaction mixture, the whole is incubated in a boiling water bath for 5 minutes and diluted with 8.0 mL of distilled water, and the absorbance at 540 nm is measured.
• a calibration curve is produced using glucose solutions prepared by stepwise dilution, and an amount of reducing sugar generated in the enzyme reaction mixture is determined as that of converted glucose. The activity is calculated by defining as 1 unit the amount of the enzyme producing the reducing sugar corresponding to 1 ⁇ mol of glucose per minute.
• the DNS reagent can be prepared in accordance with disclosures in references such as Sakuzo Hukui, "Seikagaku Jikken-hou 1, Kangen-Tou no Teiryo-hou (Laboratory Manual for Biological Chemistry, Vol. 1, Assay of Reducing Sugar)", pp. 19-20, Japan Scientific Societies Press , or by the following procedure. To 300 mL of a 4.5% aqueous solution of sodium hydrate, 880 mL of a 1% 3,5-dinitrosalicylic acid solution and 255 g of Rochelle salt are added (Solution A).
• the protein of the present invention may be obtained from filamentous fungi, such as a microorganism belonging to genus Penicillium , preferably Penicillium pinophilum , more preferably Penicillium pinophilum PF1365 (FERM BP-10780), and a mutant strain derived therefrom may be used.
• the N-terminal amino acid sequence of the protein of the present invention is typically that of SEQ ID NO: 2.
• the N-terminal amino acid sequence may be determined, for example, in accordance with the procedure described in Example 2. According to the present invention, a protein derived from Penicillium pinophilum , and having the following properties (A), (B), and (C) :
• the average molecular weight determined by SDS-PAGE may be determined in accordance with the procedure described in Example 1.
• the protein of the present invention derived from Penicillium pinophilum typically consists of the amino acid sequence consisting of amino acids 16-236 of SEQ ID NO: 4, and the N-terminal glutamine (Gln) residue is converted to a pyroglutamic acid (pyroGlu) residue by modification (that is, the protein consists of the amino acid sequence of SEQ ID NO: 30).
• a protein comprising the amino acid sequence of SEQ ID NO: 4 (or a partial sequence thereof), and a modified protein or a homologous protein thereof are provided.
• the protein comprising the amino acid sequence of SEQ ID NO: 4 or a partial sequence thereof include:
• addition of amino acid sequence includes an addition of part or the whole of the signal peptide consisting of amino acids 1-15 of SEQ ID NO: 4 to the N-terminus of the mature protein having the amino acid sequence consisting of amino acids 16-236 of SEQ ID NO: 4.
• modification of amino acid sequence includes a modification of the N-terminus of the mature protein having the amino acid sequence consisting of amino acids 16-236 of SEQ ID NO: 4 by an enzyme derived from a host. This modification includes a modification of the N-terminal glutamine (Gln) residue of the mature protein to a pyroglutamic acid (pyroGlu) residue.
• Examples of the signal peptide include the amino acid sequence consisting of amino acids 1-15 of SEQ ID NO: 4, that is, the amino acid sequence consisting of 15 amino acid residues encoded by the nucleotide sequence from the ATG codon at the 1st to 3rd positions to the codon at the 43rd to 45th positions.
• modified protein means a protein comprising an amino acid sequence in which one or plural amino acids (preferably one or several amino acids) are deleted, substituted, added, and/or modified in the amino acid sequence of SEQ ID NO: 4 (or a partial sequence thereof), and having endoglucanase activity.
• the number of amino acids to be modified is one or plural amino acids (preferably one or several amino acids), for example, 1 to 20, preferably 1 to 10, more preferably 1 to 5, most preferably 1 to 3.
• the modified protein includes a protein comprising an amino acid sequence in which one or plural amino acids are conservatively substituted in the amino acid sequence of SEQ ID NO: 4, and having endoglucanase activity.
• conservative substitution means that one or plural amino acid residues contained in a protein are replaced with different amino acids having similar chemical properties so that the activities of the protein are not substantially changed.
• conservative substitution there may be mentioned, for example, a substitution of a hydrophobic residue for another hydrophobic residue, or a substitution of a polar residue for another polar residue with the same charge.
• Amino acids which have similar chemical properties and can be conservatively substituted for each other are known to those skilled in the art.
• nonpolar amino acids there may be mentioned, for example, alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, or methionine.
• polar (neutral) amino acids there may be mentioned, for example, glycine, serine, threonine, tyrosine, glutamine, asparagine, or cysteine.
• basic amino acids having a positive charge there may be mentioned, for example, arginine, histidine, or lysine.
• acidic amino acids having a negative charge there may be mentioned, for example, aspartic acid or glutamic acid.
• the protein of the present invention may be isolated and purified from a microorganism, for example, as described in Example 1.
• the protein of the present invention may be obtained by expressing a polynucleotide encoding the protein of the present invention in an appropriate host by genetic recombinant techniques, and isolating and purifying the produced protein, as described below.
• a homologous protein that includes a protein comprising an amino acid sequence having a 90% homology or more (preferably 95% or more, more preferably 98% or more, most preferably 99% or more) with the amino acid sequence consisting of amino acids 16-236 or 1-236 of SEQ ID NO: 4 or with the amino acid sequence of SEQ ID NO: 30, and having endoglucanase activity.
• the homology as used herein is shown as a value calculated by a commercially available Genetic Information Processing Software GENETYX (GENETYX Corporation), in accordance with default parameters in a homology search program.
• polynucleotides encoding a protein comprising the amino acid sequence of SEQ ID NO: 4 or a partial sequence thereof, or a modified protein thereof are provided.
• a nucleotide sequence encoding the amino acid sequence can be easily selected, and thus various nucleotide sequences encoding the protein of the present invention can be selected.
• the term "polynucleotide” as used herein includes DNA and RNA, and DNA is preferable.
• the polynucleotide of the present invention may be selected from the group consisting of: (a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 or 28 (or a partial sequence thereof), and (b) a polynucleotide comprising a nucleotide sequence in which one or plural nucleotides are deleted, substituted, and/or added in the nucleotide sequence of SEQ ID NO: 3 or 28 (or a partial sequence thereof), and encoding a protein having endoglucanase activity.
• the polynucleotide of the present invention includes a naturally-occurring polynucleotide. Further, the whole can be synthesized. Furthermore, the synthesis may be carried out using part of the naturally-occurring polynucleotide.
• the polynucleotide of the present invention may be obtained by performing a PCR reaction using genomic DNA of Penicillium pinophilum as a template. Further, the polynucleotide of the present invention may be obtained in accordance with an ordinary method commonly used in genetic engineering, for example, by preparing a genomic DNA library and screening the library using an appropriate DNA probe designed on the basis of information of a partial amino acid sequence.
• a typical nucleotide sequence encoding the amino acid sequence of endoglucanase PPCE has the nucleotide sequence of SEQ ID NO: 3.
• the nucleotide sequence of SEQ ID NO: 3 has an open reading frame from the ATG codon at the 1st to 3rd positions to the TAG codon at the 832nd to 834th positions and two introns at the 411th to 469th and 691st to 754th positions.
• the nucleotide sequence at the 46th to 48th positions corresponds to the N-terminal amino acid of a mature protein of endoglucanase PPCE consisting of 221 amino acid residues.
• an expression vector comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 4 or a partial sequence thereof, or a modified protein (hereinafter referred to as the polynucleotide of the present invention) so that the polynucleotide may be replicated and the protein encoded by the polynucleotide may be expressed in a host microorganism, is provided.
• the expression vector of the present invention can be constructed on the basis of a self-replicating vector (such as a plasmid), which exists as an extrachromosomal element and can replicate independently of the replication of chromosomes.
• the expression vector of the present invention may be a vector which is integrated into the genome of the host microorganism and replicated together with chromosomes, when the host is transformed with the vector.
• the construction of the vector of the present invention can be carried out by ordinary procedures or methods commonly used in genetic engineering.
• the expression vector contains, for example, a polynucleotide capable of controlling the expression, in addition to the polynucleotide of the present invention.
• a promoter for example, a promoter, a terminator, or a polynucleotide encoding a signal peptide
• the promoter which can be used in the present invention is not particularly limited, so long as it shows a transcriptional activity in a host microorganism.
• the promoter can be obtained as a polynucleotide which controls the expression of a gene encoding a protein the same as or different from that derived from the host microorganism.
• the signal peptide is not particularly limited, so long as it contributes to the protein secretion in a host microorganism.
• the signal peptide can be obtained as a polynucleotide derived from a gene encoding a protein the same as or different from that derived from the host microorganism.
• the expression vector of the present invention may contain a genetic marker to select a transformant obtained by introducing the expression vector into a host microorganism.
• the genetic marker can be appropriately selected in accordance with the method for selecting a transformant.
• a genetic marker for example, a drug resistance gene or a gene complementing an auxotrophic mutation can be used in the present invention.
• the genetic marker may be inserted into a vector other than the expression vector, and this vector containing the genetic marker may be mixed with the expression vector to transform a host with these vectors simultaneously (also called co-transform).
• a microorganism transformed with the expression vector is provided.
• a host-vector system which can be used in the present invention is not particularly limited.
• a system utilizing E. coli, Actinomycetes, yeasts, or filamentous fungi, or a system for the expression of a fusion protein using such a microorganism can be used. Transformation of a microorganism with the expression vector can be carried out in accordance with an ordinary method.
• the transformant of the present invention is cultured, and the resulting transformant or culture is used to obtain the protein of the present invention.
• the process for producing the novel protein of the present invention can be provided. Cultivation of the transformant (including culturing conditions) can be carried out in a fashion substantially similar to that of the original host used to prepare the transformant.
• filamentous fungus belonging to Hyphomycetes As a preferable process of producing the novel protein of the present invention, a method of expressing the protein in a filamentous fungus belonging to Hyphomycetes is provided.
• filamentous fungi which may be used as a host in the present invention, there may be mentioned, for example, filamentous fungi belonging to genus Trichoderma , Humicola , Aspergillus , Acremonium , or Penicillium , more preferably Trichoderma or Humicola .
• Trichoderma viride Trichoderma reesei , Trichoderma longibrachiatum , Humicola insolens , Humicola thermoidea , Aspergillus niger , Aspergillus oryzae , Acremonium cellulolyticus , or Penicillium pinophilum , preferably Trichoderma viride or Humicola insolens .
• the present invention relates to a cellulase preparation comprising the protein of the present invention (for example, a protein comprising the amino acid sequence of SEQ ID NO: 4 or a partial sequence thereof, a modified protein thereof, or a protein obtainable by cultivating the host cell of the present invention).
• the protein of the present invention for example, a protein comprising the amino acid sequence of SEQ ID NO: 4 or a partial sequence thereof, a modified protein thereof, or a protein obtainable by cultivating the host cell of the present invention.
• the cellulase preparation may contain, for example, fillers (for example, lactose, sodium chloride, or sorbitol), antiseptics, and/or nonionic surfactants, in addition to the cellulase enzyme.
• the form of the cellulase preparation may be solid or liquid, such as powder, particulate, granule, non-dusting granule, or liquid formulation.
• the cellulase preparation of the present invention may contain other cellulase enzymes, such as cellobiohydrolase, ⁇ -gulucosidase, and/or endoglucanase other than the endoglucanase of the present invention.
• the non-dusting granule (preferably a granule not having a dustability), that is one form of cellulase preparation, can be produced according to the common dry granulation method. That is, a powder protein of the present invention is mixed with one or plural substances selected from the group comprising inorganic salts (such as sodium sulfate or sodium chloride), minerals (such as bentonite or montmorillonite), and organic substances (such as starch or grinded cellulose). Thereafter, the powders or the finely suspended suspension of one or plural nonionic surfactants are added to the mixture, and then the obtained product is fully mixed or kneaded.
• inorganic salts such as sodium sulfate or sodium chloride
• minerals such as bentonite or montmorillonite
• organic substances such as starch or grinded cellulose
• a synthetic polymer such as polyethylene glycol
• a natural polymer such as starch
• granulation is carried out by extrusion molding, using, for example, a disk pelleter, and the obtained molded material is then converted into a spherical form using a marumerizer followed by drying, so that non-dusting granules can be produced.
• the amount of one or plural nonionic surfactants is not particularly limited, and is preferably 0.1 to 50% by weight, more preferably 0.1 to 30% by weight, most preferably 1 to 10% by weight of the total weight of the cellulase preparation of the present invention.
• the liquid preparation which is one of the cellulase preparations (preferably a stabilized liquid) can be prepared by blending an endoglucanase stabilizer (such as a synthetic or natural polymer) with a solution containing the protein of the present invention and, if necessary, adding inorganic salts and/or a synthetic preservative.
• an endoglucanase stabilizer such as a synthetic or natural polymer
• one or plural nonionic surfactants can be blended with the liquid preparation.
• the amount of one or plural of the nonionic surfactants is not particularly limited, and is preferably 0.1 to 50% by weight, more preferably 0.1 to 30% by weight, most preferably 1 to 10% by weight of the total amount of the cellulase preparation of the present invention.
• the present invention provides a detergent composition comprising the protein of the present invention or the cellulase preparation of the present invention.
• the detergent composition of the present invention may also comprise surfactants, which may be anionic, nonionic, cationic, amphoteric, or zwitterionic, or a mixture thereof.
• the detergent composition may comprise other detergent compositions known in the art, for example, a builder, bleach, bleaching agent, tarnish inhibitor, sequestant, soil releasing polymer, flavor, other enzymes (such as protease, lipase, or amylase), stabilizer for enzyme, granulater, optical brightner, and/or foaming agent.
• a builder bleach, bleaching agent, tarnish inhibitor, sequestant, soil releasing polymer, flavor, other enzymes (such as protease, lipase, or amylase), stabilizer for enzyme, granulater, optical brightner, and/or foaming agent.
• anionic surfactants there may be mentioned, for example, linear alkyl benzene sulfonate (LAS), alkyl sulphate (AS), ⁇ -olefin sulfonate (AOS), polyoxyethylene alkylether sulfonate (AES), ⁇ -sulfo fatty acid ester ( ⁇ -SFMe), or alkali metal salts of naturally-occurring fatty acid.
• LAS linear alkyl benzene sulfonate
• AS alkyl sulphate
• AOS ⁇ -olefin sulfonate
• AES polyoxyethylene alkylether sulfonate
• ⁇ -SFMe ⁇ -sulfo fatty acid ester
• nonion surfactants there may be mentioned, for example, polyoxyethylene alkyl ether (AE), alkylpolyethylene glycol ether, nonylphenol polyethylene glycol ether, fatty acid methyl ester ethoxylate, sucrose, or fatty acid ester of glucose, or esters of alkylglucoside or polyethoxylated alkylglucoside.
• AE polyoxyethylene alkyl ether
• alkylpolyethylene glycol ether nonylphenol polyethylene glycol ether
• fatty acid methyl ester ethoxylate sucrose
• sucrose or fatty acid ester of glucose
• esters of alkylglucoside or polyethoxylated alkylglucoside esters of alkylglucoside or polyethoxylated alkylglucoside.
• the method of the present invention for treating a cellulose-containing fabric is carried out by bringing the cellulose-containing fabric into contact with the protein of the present invention, the cellulase preparation of the present invention, or the detergent composition of the invention.
• the following properties of cellulose-containing fabric can be improved by the method of the present invention:
• the method of the present invention can be carried out by adding the protein of the present invention, the cellulase preparation of the present invention, or the detergent composition of the present invention into water in which a fabric is or will be soaked, for example, during a soaking, washing, or rinsing of a fabric.
• Conditions such as contact temperature or the amount of the protein, the cellulase preparation, or the detergent composition to be added may be appropriately determined in accordance with various other conditions.
• the protein, the cellulase preparation, or the detergent composition in a protein concentration of 0.1 to 50 mg/L is preferably used at a temperature of approximately 10 to 60°C.
• the protein, the cellulase preparation, or the detergent composition in a protein concentration of 0.1 to 100 mg/L is preferably used at a temperature of approximately 20 to 60°C.
• the protein, the cellulase preparation, or the detergent composition in a protein concentration of 0.01 to 20 mg/L is preferably used at a temperature of approximately 10 to 60°C.
• the protein, the cellulase preparation, or the detergent composition in a protein concentration of 0.01 to 20 mg/L is preferably used at a temperature of 10 to 60°C.
• the protein, the cellulase preparation, or the detergent composition in a protein concentration of 0.01 to 20 mg/L is preferably used at a temperature of 10 to 60°C.
• the present invention relates to a method for deinking waste paper, characterized by using the protein of the present invention or the cellulase preparation of the present invention, in the process of treating the waste paper together with a deinking agent.
• the protein or the cellulase preparation of the present invention is useful in the process of producing recycled paper from waste paper, since an efficiency of the deinking can be improved by reacting waste paper therewith.
• the whiteness of waste paper can be remarkably improved by reducing residual-ink fiber.
• the deinking agent is not particularly limited, so long as it is agent which can be used in deinking waste paper in general.
• waste paper which can be treated by the deinking method is not particularly limited, so long as it is common waste paper.
• waste paper there may be mentioned, used newspaper, used magazine paper, and low to middle grade printed used paper which comprises mechanical pulp and chemical pulp; used wood-free paper comprising chemical pulp; or printed waste paper thereof such as coating paper.
• a paper other than the common waste paper can be treated by the deinking method, so long as it deposits ink.
• the present invention relates to a method for improving a water freeness of paper pulp, which comprises the process of treating a paper pulp with the protein of the present invention or the cellulase preparation of the present invention. According to the method, it is considered that this method can significantly improve a water freeness of paper pulp, without a serious decline of strength.
• a paper pulp which can be treated by the method is not particularly limited, but there may be mentioned, for example, waste paper pulp, recycled paperboard pulp, kraft pulp, sulfite pulp, thermo-mechanical treatment pulp, and other high-yield pulp.
• the present invention relates to a method for improving a digestibility of animal feed, comprising the step of treating the animal feed with the protein of the present invention or the cellulase preparation of the present invention.
• a digestibility of animal feed can be improved by digesting glucan in animal feed into appropriate molecules having a low molecular weight.
• a digestibility of glucan in animal feed can be improved by using the protein of the present invention in animal feed.
• a method for improving a digestibility of animal feed comprises the step of treating the animal feed with the protein of the present invention or the cellulase preparation of the present invention, is provided.
• the present invention relates to a method of producing biomass ethanol, comprising the step of treating a cellulose-based substance (such as cellulose fibers) with the protein or the cellulase preparation of the present invention.
• a cellulose-based substance such as cellulose fibers
• the cellulose-based substance may be digested and saccharified by treating the substance with the protein of the present invention, to produce glucose.
• the resulting glucose may be converted into biomass ethanol by fermentation techniques using other microorganisms such as yeasts.
• Penicillium pinophilum PF1365 from which the endoglucanase PPCE of the present invention was derived, was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on February 7, 2007, and the international deposit number is FERM BP-10780.
• Escherichia coli JM109/p28FULL18 of the present invention i.e., Escherichia coli JM109 transformed with plasmid p28FULL18 obtained by inserting the PPCE gene into plasmid PCR 2.1-TOPO
• Escherichia coli JM109/p28FULL18 of the present invention was internationally deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on February 7, 2007, and the international deposit number is FERM BP-10781.
• Trichoderma viride MC300-1 which may be used as a host for the expression vector of the present invention, was domestically (originally) deposited in the International Patent Organism Depositary National Institute of Advanced Industrial Science and Technology (Address: AIST Tsukuba Central 6, 1-1, Higashi 1-chome Tukuba-shi, Ibaraki-ken 305-8566 Japan) on September 9, 1996, and was transferred to an international deposit on August 11, 1997.
• the international deposit number (a number in parenthesis [] following the international deposit number is a domestic deposit number) is FERM BP-6047 [FERM P-15842].
• Example 1 Isolation and purification of component having activity to remove fuzz from colored cotton from Penicillium pinophilum PF1365
• Penicillium pinophilum PF1365 was cultivated in a TS medium (2.0% soluble starch, 1.0% glucose, 0.5% polypeptone, 0.6% wheat germ, 0.3% yeast extract, 0.2% soybean cake, 0.2% calcium carbonate, pH 7.0) at 25°C under shaking. After cultivation for 24 hours, the fungus was inoculated into an (N) medium (5.0% avicel, 2.0% yeast extract, 0.1% polypeptone, 0.03% magnesium sulfate, pH6.8), and further cultivated at 25°C for 5 days. The mycelia were removed from the culture to obtain a culture supernatant as a crude cellulase preparation solution.
• Ammonium sulfate was added to the crude cellulase preparation solution so that a final concentration of ammonium sulfate in the solution became 1.2 mol/L.
• the solution was applied to a HiTrap TM Phenyl HP column (GE Healthcare Bio-Sciences) equilibrated with a 50 mM sodium acetate buffer (pH 5) containing 1.2 mol/L ammonium sulfate, and eluted by a stepwise elution method using 1.2 mol/L, 0.96 mol/L, 0.72 mol/L, 0.48 mol/L, 0.24 mol/L, and 0 mol/L ammonium sulfate in a 50 mmol/L sodium acetate buffer (pH 5), to collect fractions.
• the fraction eluted at an ammonium sulfate concentration of 0.24 mol/L exhibited an activity of removing fuzz from a colored cotton fabric.
• the activity of removing fuzz from a colored cotton fabric was evaluated by the following procedure. Cotton knit fabrics stained blue were treated in a large washer to generate fuzz. The blue cotton knit fabrics with fuzz were treated under the following conditions for removing fuzz and the fuzz-removing activity evaluated, by judging the extent of fuzz removed from fabrics after the treatment on the basis of a visual evaluation.
• the fraction eluted at an ammonium sulfate concentration of 0.24 mol/L was desalted using a PD-10 desalting column (GE Healthcare Bic-Sciences) in accordance with the conditions described in an attached manual, and adjusted to become a 50 mmol/L acetate buffer (pH 4.0).
• the adjusted fraction was applied to a Resource Mono S column (GE Healthcare Bio-Sciences) equilibrated with a 50 mmol/L acetate buffer (pH 4.0), and eluted by a stepwise elution method from a 50 mmol/L sodium acetate buffer (pH 4.0) to a 50 mmol/L sodium acetate buffer (pH 5.0) containing 1 mol/L sodium chloride, in increments of 0.1 mol NaCl, to collect fractions.
• a Resource Mono S column GE Healthcare Bio-Sciences
• This flow-through fraction was applied to a Resource Mono Q column (GE Healthcare Bio-Sciences) equilibrated with a 50 mmol/L acetate buffer (pH 4.0), and eluted by a stepwise elution method from a 50 mmol/L acetate buffer (pH 4.0) to a 50 mmol/L acetate buffer (pH 5.0) containing 1 mol/L sodium chloride, in increments of 0.1 mol NaCl, to collect fractions.
• the activity of removing fuzz from a colored cotton fabric was detected in the fraction that passed through the column without being adsorbed by the column.
• the resulting flow-through fraction was concentrated using a 10 kDa cut-off ultrafiltration membrane (Millipore) to designate a PPCE fraction.
• This PPCE fraction exhibited a CMCase activity.
• the crude cellulase preparation solution and active fractions obtained in the above column purification steps were subjected to SDS-PAGE.
• This SDS-PAGE was carried out using an electrophoresis apparatus Safety Cell Mini STC-808 (Tefco) and a Precast Mini Gel 12%-SDS-PAGEmini, 1.0 mm in gel thickness (Tefco) in accordance with protocols attached thereto.
• LMW Calibration For SDS Electrophoresis (GE Healthcare Bio-Sciences) was used as molecular markers.
• the PPCE fraction obtained in Example 1 was subjected to SDS-PAGE, and electrically blotted onto a PVDF membrane (Millipore) using Multiphor II (GE Healthcare Bio-Sciences). The membrane was stained with Brilliant Blue G (Tokyo Chemical Industry Co., Ltd.), and decolorized. From the membrane, the portion on which a protein (PPCE) having a molecular weight of approximately 26 kDa was blotted was excised. This piece was subjected to a protein sequencer Model 492 (Applied Biosystems) to determine the N-terminal amino acid sequence, but no signals from Edman degradation were detected. It was revealed from this result that the N-terminal amino acid was protected by modification.
• a protein sequencer Model 492 Applied Biosystems
• the excised membrane was immersed in a 0.5% polyvinylpyrrolidone-40 (Sigma)/100 mmol/L acetic acid solution at 37°C for 30 minutes to block protein-unbound portions on the membrane, and treated with Pfu pyroglutamate aminopeptidase (Takara Bio) at 50°C for 5 hours to remove the modified N-terminal residue from the protein.
• the resulting membrane was resubjected to the protein sequencer to obtain the following amino acid sequence.
• Xaa is an unknown amino acid residue.
• N-terminal amino acid of PPCE is pyroglutamic acid (pyroGlu).
• pyroGlu pyroglutamic acid
• Xaa is presumed to be cysteine (Cys), because a signal derived from cysteine is not detectable with this protein sequencer. Therefore, the N-terminal amino acid sequence of PPCE is considered the following sequence.
• N-terminal amino acid sequence of PPCE Gln-Gln-Ser-Leu-Cys-Ser-Gln-Tyr-Ser-Ser-Tyr-Thr-Ser (13 residues; The N-terminal Gln is modified into pyroGlu.)(SEQ ID NO: 2)
• Penicillium pinophilum PF1365 was cultivated in the TS medium at 28°C for 24 hours, and centrifuged to collect mycelia.
• a kit (ISOPLANT; Nippon Gene Co., Ltd.) was used to extract chromosomal DNA from the obtained mycelia. The extraction was carried out in accordance with the conditions described in the manual attached thereto.
• Synthetic primers having the following sequences were prepared on the basis of the N-terminal and C-terminal amino acid sequences of endoglucanase III derived from Penicillium verruculosum .
• a PCR reaction was carried out using the above primers (MSW-N, MSW-C), the chromosomal DNA prepared in Example 3(1) as the template, and an LA PCR TM Kit Ver2.1 (Takara Bio).
• This PCR reaction was carried out by performing a reaction at 94°C for 1 minute, repeating a cycle consisting of a reaction at 94°C for 30 seconds, a reaction at 60°C for 30 seconds, and a reaction at 72 °C for 1 minute 20 times, and performing a reaction at 72 °C for 10 minutes.
• the resulting reaction liquid was subjected to agarose gel electrophoresis.
• the resulting plasmid was amplified and extracted to determine the DNA sequence thereof in accordance with conventional procedures. This extraction of the plasmid was carried out using a QIAfilter Plasmid Kit (Xiagen) in accordance with the conditions described in the manual attached thereto.
• the nucleotide sequence of the DNA was determined by a reaction using a dRhodamine Terminator Kit (Applied Biosystems) and the M13 universal primer or a Rev primer having the following sequence as a primer. Rev: CAGGAAACAGCTATGAC (SEQ ID NO: 7)
• This reaction was carried out in accordance with the conditions described in the manual attached thereto.
• the resulting reaction liquid was purified in accordance with the conditions described in the manual attached thereto, and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems).
• the gene fragment amplified by PCR was a gene having a homology with endoglucanase III derived from Penicillium verruculosum .
• Example 4 Cloning of gene fragment of family 12 endoglucanase derived from Penicillium pinophilum PF1365 by genome walking
• 24-GSP-R1 CGCCAGAGCTGGAAATGGAGTTGACATAAG (SEQ ID NO: 8)
• 24-GSP-R2 GTGCACTGGGAGCCAGAGCCACTGCTCTCA (SEQ ID NO: 9)
• 24-GSP-F1 TTTCGTATGATCTCTTCACGGCAGCGGATA (SEQ ID NO: 10)
• 24-GSP-F2 ATCAACCATGTTACCTACAGTGGTGACTAT (SEQ ID NO: 11)
• a PCR reaction was carried out by using the Pvu II or Stu I library as the template, the 24-GSP-R1 or 24-GSP-F1 primer and an AP-1 primer attached to the kit, and Ex Taq Premix (Takara Bio). This PCR reaction was carried out by performing a reaction at 94°C for 2 minutes, repeating a cycle consisting of a reaction at 94°C for 2 seconds and a reaction at 72°C for 3 minutes 7 times, repeating a cycle consisting of a reaction at 94°C for 2 seconds and a reaction at 67°C for 3 minutes 32 times, and performing a reaction at 67°C for 4 minutes.
• the PCR reaction liquid obtained by the first PCR reaction was diluted with deionized water, and the second PCR reaction was carried out by using the diluted liquid as the template, the 24-GSP-R2 or 24-GSP-F2 primer and an AP-2 primer attached to the kit, and Ex Taq Premix (Takara Bio).
• This PCR reaction was carried out by performing a reaction at 94°C for 2 minutes, repeating a cycle consisting of a reaction at 94°C for 2 seconds and a reaction at 72°C for 3 minutes 5 times, repeating a cycle consisting of a reaction at 94°C for 2 seconds and a reaction at 67°C for 3 minutes 20 times, and performing a reaction at 67°C for 4 minutes.
• the resulting reaction liquid was subjected to agarose gel electrophoresis. As a result, it was confirmed that a gene fragment of approximately 2 kbp was amplified in the sample obtained by using the Pvu II library as the template, performing the first PCR reaction using the 24-GSP-R1 primer and the AP-1 primer, and performing the second PCR reaction using the 24-GSP-R2 primer and the AP-2 primer. Further, it was confirmed that a gene fragment of approximately 2 kbp was amplified in the sample obtained by using the Stu I library as the template, performing the first PCR reaction using the 24-GSP-F1 primer and the AP-1 primer, and performing the second PCR reaction using the 24-GSP-F2 primer and the AP-2 primer.
• the resulting plasmids were amplified and purified to determine the DNA sequences thereof in accordance with conventional procedures.
• This purification of the plasmids was carried out using a QIAPREP MINIPREP KIT (Xiagen) in accordance with the conditions described in the manual attached thereto.
• the nucleotide sequences of the DNAs were determined by a reaction using a dRhodamine Terminator Kit (Applied Biosystems) and the M13 universal primer or the Rev primer as a primer. This reaction was carried out in accordance with the conditions described in the manual attached thereto.
• the resulting reaction liquids were purified in accordance with the conditions described in the manual attached thereto, and analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems).
• the PCR product of approximately 2 kbp derived from the Pvu II library contained the upstream region of the gene obtained in Example 3(2)
• the PCR product of approximately 2 kbp derived from the Stu I library contained the downstream region of the gene obtained in Example 3(2).
• These nucleotide sequences of the PCR products were linked to determine the full length of the nucleotide sequence of the PPCE gene derived from Penicillium pinophilum PF1365.
• the determined nucleotide sequence of the PPCE gene (SEQ ID NO: 3) contained a region homologous with the coding region of the endoglucanase III gene derived from Penicillium verruculosum .
• a blastp search based on the amino acid sequence (SEQ ID NO: 4) deduced from the nucleotide sequence of the DNA fragment, was carried out against the known database NCBI to find that it had a homology of 72% with that of FI-CMCase derived from Aspergollus aculeatus and a homology of 53% with that of EG III derived from Trichoderma reesei . Because all of these proteins were endoglucanases belonging to family 12, it was considered that the obtained DNA fragment was a gene fragment containing the coding region of a family 12 endoglucanase gene derived from Penicillium pinophilum PF1365 and the upstream and downstream regions thereof.
• 32228-NSTU CCAGGCCTGCGCATCATGAAGCTAACTTTTCTCCTG (SEQ ID NO: 12)
• 32228-CPST CCCTGCAGCTAATTGACAGAAGCAGACC (SEQ ID NO: 13)
• This PCR reaction was carried out using the chromosomal DNA of Penicillium pinophilum PF1365 obtained in Example 3(1) as the template, synthetic DNA primers 32228-NSTU and 32228-CPST, and Ex Taq Premix (Takara Bio), by performing a reaction at 94°C for 2 minutes, repeating a cycle consisting of a reaction at 94°C for 1 minute, a reaction at 50°C for 2 minutes, and a reaction at 72°C for 1.5 minutes 25 times, and performing a reaction at 72°C for 3 minutes.
• the sample after the reaction was subjected to agarose gel electrophoresis, and a gene fragment of approximately 800 bp was excised and purified using a QIAQUICK GEL EXTRACTION KIT (Xiagen) in accordance with the conditions described in the manual attached thereto.
• the resulting purified DNA was cloned into a TOPO vector (PCR 2.1-TOPO) using a TOPO PCR CLONING KIT (Invitrogen).
• the resulting plasmid was designated p28FULL18. Plasmid p28FULL18 was amplified and purified in accordance with conventional procedures, to determine the DNA sequence thereof as described above.
• plasmid p28FULL18 contained the PPCE gene having the Stu I recognition site upstream of the initiation codon and the Pst I recognition site downstream of the stop codon.
• the nucleotide sequence of the PPCE gene contained in plasmid p28FULL18 accorded with the nucleotide sequence of the PPCE coding region determined in Example 4, and thus, this gene fragment was used in the following procedures to express the PPCE gene.
• Plasmid p28FULL18 was digested with restriction enzymes Stu I and Pst I, and the sample after the reaction was subjected to agarose gel electrophoresis. The gene fragment of approximately 800 bp was excised from the gel, and a QIAQUICK GEL EXTRACTION KIT (Xiagen) was used to purify the DNA.
• Plasmid pCBI-M2 (Example B1 of WO 2005/056787 ) was digested with restriction enzymes Stu I and Pst I, and the sample after the reaction was subjected to agarose gel electrophoresis.
• a gene fragment of approximately 5.6 kbp was excised from the gel, and a QIAQUICK GEL EXTRACTION KIT (Xiagen) was used to purify the DNA.
• This gene fragment of approximately 5.6 kbp was ligated to the previously-obtained gene fragment of approximately 800 bp using a TaKaRa DNA Ligation Kit Ver.1 (Takara Bio) to construct plasmid pPPCE-F2.
• Trichoderma viride was transformed with plasmid PPCE-F2 obtained in Example 5(2) in accordance with the procedures described in WO 2005/056787 . That is, this transformation was carried out by a co-transformation method using Trichoderma viride strain 2 deficient in a gene for uracil biosynthesis ( pyr4 ) as a host and a pyr4 gene of Neurospora crassa as a selection marker.
• pyr4 Trichoderma viride strain 2 deficient in a gene for uracil biosynthesis
• protoplasts of Trichoderma viride strain 2 were prepared, and 100 ⁇ L of the protoplast suspension was mixed with 7 ⁇ g of plasmid pPPCE-F2 and 3 ⁇ g of plasmid pPYR4 (a plasmid prepared by subcloning the pyr4 gene of Neurospora crassa into LITMUS28). After this mixture was allowed to stand on ice for 5 minutes, 400 ⁇ L of a PEG solution (60% polyethylene glycol 4000, 10 mmol/L calcium chloride, and 10 mmol/L Tris-HCL buffer, pH7.5) was added to the mixture, and allowed to stand on ice for 20 minutes.
• a PEG solution 50% polyethylene glycol 4000, 10 mmol/L calcium chloride, and 10 mmol/L Tris-HCL buffer, pH7.5
• the resulting protoplast suspension was washed with an SUTC buffer (0.5 mol/L sucrose, 10 mmol/L calcium chloride, and 10 mmol/L Tris-HCl buffer, pH 7.5), overlaid with soft agar on a minimum medium containing 0.5 mol/L sucrose, and cultivated at 28°C for 5 days. After the cultivation, grown colonies were transferred on the minimum medium, and colonies grown on this medium were used as transformants in the following procedures.
• SUTC buffer 0.5 mol/L sucrose, 10 mmol/L calcium chloride, and 10 mmol/L Tris-HCl buffer, pH 7.5
• Example 5(3) From the transformants obtained in Example 5(3), 50 strains were inoculated into a PSW medium (1.0% glucose, 4.0% lactose, 2.0% soybean cake, 1.0% wheat germ, 0.2% potassium dihydrogen phosphate, 0.2% ammonium sulfate, 0.2% ammonium phosphate, 0.2% calcium carbonate) and cultivated at 28°C for 5 days. After the cultivation, mycelia were removed by centrifugation to obtain culture supernatants as crude enzyme solutions. These crude enzyme solutions were subjected to SDS-PAGE, and it was confirmed that a protein of approximately 26 kDa was specifically expressed in the transformants. The culture supernatant of strain 322F-205, which most highly expressed the protein, was used to carry out the following washing test.
• a PSW medium 1.0% glucose, 4.0% lactose, 2.0% soybean cake, 1.0% wheat germ, 0.2% potassium dihydrogen phosphate, 0.2% ammonium sulfate, 0.2% ammonium phosphate, 0.2% calcium carbonate
• Example 6 Evaluation of fuzz-removing activity in strain expressing PPCE gene
• each gene of EG III derived from Trichoderma reesei (non-patent reference 1), SCE3 derived from Trichoderma viride (patent reference 5), and FI-CMCase derived from Aspergollus aculeatus (non-patent reference 2) was expressed in Trichoderma viride , and culture supernatants thereof were prepared, as controls, in accordance with the procedures described in Example 5.
• These culture supernatants for controls, and the culture supernatant of the strain expressing the PPCE gene were subjected to SDS-PAGE using a 12% gel in accordance with the procedures described in Example 1.
• the gel was stained using a SYPRO Ruby protein gel stain (Invitrogen) and washed with water. Bands were analyzed using a Molecular Imager FX (Bio-Rad Laboratories) and a Quantity One (Bio-Rad Laboratories) to determine a ratio of the expressed protein to the total proteins. Further, a concentration of total proteins contained in each culture supernatant was assayed using bovine ⁇ globulin as a standard and a Protein Assay Kit (Bio-Rad Laboratories). The concentration of the expressed protein was calculated by multiplying the concentration of total proteins by the ratio of the expressed protein.
• Table 1 Amount of expressed protein in Trichoderma transformants Active protein Concentration of total proteins Ratio of expressed protein Concentration of expressed protein PPCE (present invention) 13.2 ⁇ g/mL 6.1% 0.81 ⁇ g/mL EG III 11.8 ⁇ g/mL 18.1% 2.1 ⁇ g/mL SCE3 14.7 ⁇ g/mL 17.9% 2.6 ⁇ g/mL FI-CMCase 13.3 ⁇ g/mL 9.8% 1.3 ⁇ g/mL
• the culture supernatants from the PPCE-expressed strain and the control strains prepared in Example 6(1) were used to measure the fuzz-removing activity thereof. More particularly, cotton knit fabrics stained brown were treated in a large washer to generate fuzz. The brown cotton knit fabrics with fuzz were treated under the following conditions for removing fuzz and the fuzz-removing activity evaluated, by judging the extent of fuzz removed from fabrics after the treatment on the basis of a visual evaluation.
• Example 7 Temperature and pH profiles in fuzz-removing activity of PPCE
• the culture supernatants of the PPCE- and EG III-expressed strains used in Example 6 were used to examine temperature profiles under the following conditions for washing. After the washing treatment, extents of fuzz removed from fabrics were judged on the basis of a visual evaluation, and volumes of culture supernatants required to remove approximately 50% of fuzz on the basis of a visual evaluation were calculated. Relative activities were determined from the volumes, when the activity at the temperature showing the highest fuzz-removing activity in each sample was regarded as 100%. As shown in Table 3, the optimum temperature of PPCE was 30°C, and that of EG III was 40°C.
• the culture supernatants of the PPCE- and EG III-expressed strains used in Example 6 were used to examine pH profiles under the following conditions for washing. After the washing treatment, extents of fuzz removed from fabrics were judged on the basis of a visual evaluation, and volumes of culture supernatants required to remove approximately 50% of fuzz on the basis of a visual evaluation were calculated. Relative activities were determined from the volumes, when the activity at the pH showing the highest fuzz-removing activity in each sample was regarded as 100%. As shown in Table 4, the optimum pH of PPCE was pH 3, and that of EG III was pH 4.
• a PPCE gene consisting only of codons highly used in genus Trichoderma was synthesized by PCR reactions.
• a PCR reaction was carried out using 20 pmol of the above primers (PCEM-1 and PCEM-2) and Primestar MAX DNA POLYMERASE (Takara), in the absence of a template, by repeating a cycle consisting of a reaction at 98°C for 10 seconds, a reaction at 55°C for 5 seconds, and a reaction at 72°C for 30 seconds 30 times.
• the resulting DNA was purified from the reaction liquid using a QIAQUICK PCR PURIFICATION KIT (Xiagen), and eluted into 50 ⁇ L of a TE buffer, in accordance with the conditions described in the manual attached thereto.
• the resulting DNA fragment of approximately 150 bp was designated PCEM1-2.
• PCEM-3 and PCEM-4 A PCR reaction using 20 pmol of the above primers (PCEM-3 and PCEM-4) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 140 bp was designated PCEM3-4.
• PCEM-5 and PCEM-6 A PCR reaction using 20 pmol of the above primers (PCEM-5 and PCEM-6) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 140 bp was designated PCEM5-6.
• PCEM-7 and PCEM-8 A PCR reaction using 20 pmol of the above primers (PCEM-7 and PCEM-8) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 140 bp was designated PCEM7-8.
• PCEM9-10 A PCR reaction using 20 pmol of the above primers (PCEM-9 and PCEM-10) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 140 bp was designated PCEM9-10.
• PCEM-11 and PCEM-12 A PCR reaction using 20 pmol of the above primers (PCEM-11 and PCEM-12) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 140 bp was designated PCEM11-12.
• PCEM13-14 A PCR reaction using 20 pmol of the above primers (PCEM-13 and PCEM-14) was carried out in the absence of a template, and the resulting fragment was purified, in accordance with the procedures described in Example 8(1)a). The resulting DNA fragment of approximately 120 bp was designated PCEM13-14.
• a second PCR reaction was carried out using 1 ⁇ L of PCEM1-2 obtained in Example 8(1)a) and 1 ⁇ L of PCEM3-4 obtained in Example 8(1)b) as templates, 20 pmol of the above primers (PCEM-1 and PCEM-4), and Primestar MAX DNA POLYMERASE (Takara), by repeating a cycle consisting of a reaction at 98°C for 10 seconds, a reaction at 55°C for 5 seconds, and a reaction at 72°C for 30 seconds 30 times.
• the resulting DNA was purified from the reaction liquid using a QIAQUICK PCR PURIFICATION KIT (Xiagen), and eluted into 50 ⁇ L of a TE buffer.
• the resulting DNA fragment of approximately 270 bp was designated PCEM1-4.
• a second PCR reaction was carried out using 1 ⁇ L of PCEM5-6 obtained in Example 8(1)c) and 1 ⁇ L of PCEM7-8 obtained in Example 8(1)d) as templates, and 20 pmol of the above primers (PCEM-5 and PCEM-8).
• This PCR reaction and a purification of the resulting fragment were carried out in accordance with the procedures described in Example 8(1)h) to designate the resulting DNA fragment of approximately 260 bp as PCEM5-8.
• a second PCR reaction was carried out using 1 ⁇ L of PCEM9-10 obtained in Example 8(1)e) and 1 ⁇ L of PCEM11-12 obtained in Example 8(1)f) as templates, and 20 pmol of the above primers (PCEM-9 and PCEM-12).
• This PCR reaction and a purification of the resulting fragment were carried out in accordance with the procedures described in Example 8(1)h) to designate the resulting DNA fragment of approximately 260 bp as PCEM9-12.
• a third PCR reaction was carried out using 1 ⁇ L of PCEM1-4 obtained in Example 8(1)h) and 1 ⁇ L of PCEM5-8 obtained in Example 8(1)i) as templates, 20 pmol of the above primers (PCEM-1 and PCEM-8), and Primestar MAX DNA POLYMERASE (Takara), by repeating a cycle consisting of a reaction at 98°C for 10 seconds, a reaction at 55°C for 5 seconds, and a reaction at 72°C for 30 seconds 30 times.
• the resulting DNA was purified from the reaction liquid using a QIAQUICK PCR PURIFICATION KIT (Xiagen), and eluted into 50 ⁇ L of a TE buffer.
• the resulting DNA fragment of approximately 510 bp was designated PCEM1-8.
• a third PCR reaction was carried out using 1 ⁇ L of PCEM9-12 obtained in Example 8(1)j) and 1 ⁇ L of PCEM13-14 obtained in Example 8(1)g) as templates, and 20 pmol of the above primers (PCEM-9 and PCEM-14).
• This PCR reaction and a purification of the resulting fragment were carried out in accordance with the procedures described in Example 8(1)k) to designate the resulting DNA fragment of approximately 360 bp as PCEM9-14.
• a fourth PCR reaction was carried out using 1 ⁇ L of PCEM1-8 obtained in Example 8(1)k) and 1 ⁇ L of PCEM9-14 obtained in Example 8(1)1) as templates, and 20 pmol of the above primers (PCEM-1 and PCEM-14), by repeating a cycle consisting of a reaction at 98°C for 10 seconds, a reaction at 55°C for 5 seconds, and a reaction at 72°C for 30 seconds 30 times.
• the sample after the reaction was subjected to agarose gel electrophoresis.
• a gene fragment of approximately 800 bp was excised from the gel, purified using a QIAQUICK GEL EXTRACTION KIT (Xiagen), and eluted into a 50 ⁇ L of a TE buffer.
• a buffer, dNTPs, and EXTaq (Takara) were added to the resulting purified DNA, and incubated at 72°C for 10 minutes to add the A bases to the DNA.
• the treated DNA was cloned into a TOPO vector (PCR 2.1-TOPO) using a TOPO PCR CLONING KIT (Invitrogen) to designate the obtained plasmid as pCR-PCEm. Plasmid pCR-PCEm was amplified and purified in accordance with conventional methods, and the DNA sequence thereof was analyzed in accordance with the procedures described above.
• plasmid pCR-PCEm contained not only the coding region (SEQ ID NO: 28) of a codon-optimized PPCE gene, but also the Stu I recognition site upstream of the initiation codon and the Xho I recognition site downstream of the stop codon.
• Plasmid pCR-PCEm was digested with restriction enzymes Stu I and Xho I, and the sample after the reaction was subjected to agarose gel electrophoresis. The separated gene fragment of approximately 800 bp was excised from the gel, and a QIAQUICK GEL EXTRACTION KIT (Xiagen) was used to purify the DNA.
• Plasmid pCBI-M2 was digested with restriction enzymes Stu I and Xho I, and a gene fragment of approximately 5.6 kbp was collected and purified, in a similar fashion as described in Example 5(2). The previously obtained gene fragment of approximately 800 bp was ligated to this gene fragment of approximately 5.6 kbp using Ligation High (TOYOBO) to prepare plasmid pPPCE-M.
• Trichoderma viride was transformed with plasmid pPPCE-M obtained in Example 8(2). That is, this transformation was carried out by a co-transformation method using Trichoderma viride strain 2 deficient in a gene for uracil biosynthesis ( pyr4 ) as a host and a pyr4 gene of Neurospora crassa as a selection marker, in accordance with the procedures described in Example 5(3).
• Trichoderma viride strain 2 was transformed with 7 ⁇ g of plasmid pPPCE-M and 3 ⁇ g of plasmid pPYR4 to obtain 40 strains of transformants.
• the present invention is useful for various treatments for cellulose, for example, in treating a cellulose-containing fabric, deinking waste paper, improving a water freeness of paper pulp, improving a digestibility of animal feed, and producing bioethanol.
• Each sequence of SEQ ID NOS: 5 to 27 in the Sequence Listing is a primer for PCR.
• the sequence of SEQ ID NO: 28 is a codon optimized (modified) gene.
• the sequence of SEQ ID NO: 29 is an amino acid sequence deduced from the codon optimized (modified) gene.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biotechnology (AREA)
• Textile Engineering (AREA)
• General Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Enzymes And Modification Thereof (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Chemical Or Physical Treatment Of Fibers (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Detergent Compositions (AREA)
• Paper (AREA)

Applications Claiming Priority (2)

Publications (3)

Family

ID=39759547

Family Applications (1)

Country Status (9)

Families Citing this family (18)

Family Cites Families (17)

• 2008
  • 2008-03-12 CN CN2008800078441A patent/CN101679965B/zh active Active
  • 2008-03-12 DK DK08721927.5T patent/DK2135944T3/en active
  • 2008-03-12 EP EP08721927.5A patent/EP2135944B1/en active Active
  • 2008-03-12 JP JP2009504069A patent/JP5193997B2/ja active Active
  • 2008-03-12 WO PCT/JP2008/054511 patent/WO2008111613A1/ja active Application Filing
  • 2008-03-12 CN CN2013100971627A patent/CN103451170A/zh active Pending
  • 2008-03-12 CA CA2680656A patent/CA2680656C/en not_active Expired - Fee Related
  • 2008-03-12 ES ES08721927.5T patent/ES2556728T3/es active Active
  • 2008-03-12 US US12/531,041 patent/US8257955B2/en active Active
  • 2008-03-12 BR BRPI0808461-0A patent/BRPI0808461A2/pt not_active Application Discontinuation

Also Published As

Similar Documents

Legal Events