EP1177283A1 - Regulierung von viraler genexpression - Google Patents

Regulierung von viraler genexpression

Info

Publication number
EP1177283A1
EP1177283A1 EP00927165A EP00927165A EP1177283A1 EP 1177283 A1 EP1177283 A1 EP 1177283A1 EP 00927165 A EP00927165 A EP 00927165A EP 00927165 A EP00927165 A EP 00927165A EP 1177283 A1 EP1177283 A1 EP 1177283A1
Authority
EP
European Patent Office
Prior art keywords
dna
gene
cell
dna sequence
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00927165A
Other languages
English (en)
French (fr)
Inventor
Peter Bernard Heifetz
David Andrew Patton
Joshua Zvi Levin
Qiudeng Que
Petrus Theodorus De Haan
Johannes Jacobus Ludgerus Gielen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syngenta Participations AG
Original Assignee
Syngenta Participations AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/309,038 external-priority patent/US7019195B1/en
Application filed by Syngenta Participations AG filed Critical Syngenta Participations AG
Priority to EP06026160A priority Critical patent/EP1801215B1/de
Publication of EP1177283A1 publication Critical patent/EP1177283A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance

Definitions

  • the present invention relates to methods of altering the expression of viral genes in cells, plants or animals using sense and antisense RNA fragments of said genes, and to cells, plants or animals with altered viral gene expression obtained using the methods of the present invention.
  • the invention particularly relates to such cells, plants or animals resistant or tolerant to viruses.
  • viruses An area of deep interest is resistance or tolerance to viruses. Viruses affect most living organisms. In crops, large proportions of the harvest may be lost due to virus infections. Farm animals are also often infected by viruses and must sometimes be slaughtered to prevent spreading of the disease leading to dramatic economic consequences. Companoin animals are also affected by viruses, and, finally, viruses infect humans causing a lot of suffering. Although treatments against viruses have been developed, they are very often either extremely expensive or of limited efficiency.
  • the present invention relates to methods of altering the expression of a viral gene in cells, plants or animals using sense and antisense RNA fragments of the gene.
  • sense and antisense RNA fragments are capable of forming a double-stranded RNA molecule.
  • the present invention relates to methods and compositions of conferring upon a cell, plant or animal resistance or tolerance to viruses.
  • the invention relates to methods of conferring upon a plant resistance or tolerance to viruses.
  • the invention also preferably relates to plant cells obtained using such methods, to plants derived from such cells, to the progeny of such plants and to seeds derived from such plants. In such plant cells or plants, the alteration of the gene expression of a particular viral gene is more effective, selective and more predictable than the alteration of the gene expression of a particular viral gene obtained using current methods known in the art.
  • the invention therefore provides:
  • a method comprising introducing into a cell a plurality of sub-sequences, e.g. RNA fragments or DNA sequences, characterized in that at least two of the sub-sequences have sense and antisense sequences of viral RNAs and are capable of forming a double- stranded RNA molecule.
  • the method comprises introducing into a cell an RNA which consists of a plurality of sub-sequences characterized in that at least two of the subsequences have the sequences of viral RNAs.
  • the RNA contains at least one translational stop codon located upstream of the 3' terminal sub-sequence.
  • the method comprises introducing into a cell a nucleotide sequence or DNA molecule encoding expression of said RNA.
  • the invention therefore provides:
  • a method comprising introducing into a cell a sense RNA fragment of a viral target gene and an antisense RNA fragment of said target gene, wherein said sense RNA fragment and said antisense RNA fragment are capable of forming a double-stranded RNA molecule, wherein the expression of said target gene in said cell is altered.
  • the target gene comprises a viral genome or a portion thereof and the cell is preferably resistant or tolerant to viruses.
  • the virus is selected from the group consisting of tospoviruses, potyviruses, potexviruses, tobamoviruses, luteoviruses, cucumoviruses, bromoviruses, closteorviruses, tombusviruses and furoviruses.
  • the RNA fragments comprise nucleotide sequences derived from a viral coat protein gene, a viral nucleocapsid protein gene, a viral replicase gene, a movement protein gene or portions thereof.
  • a cell is a plant cell, such as a monocotyledonous or a dicotyledonous cell.
  • the RNA fragments are comprised in two different RNA molecules.
  • the RNA fragments are mixed before being introduced into said cell.
  • the RNA fragments are mixed before being introduced into said cell under conditions allowing them to form a double-stranded RNA molecule.
  • the RNA fragments are introduced into said cell sequentially.
  • the RNA fragments are comprised in one RNA molecule. In such case, the RNA molecule is preferably capable of folding such that said RNA fragments comprised therein form a double-stranded RNA molecule.
  • the invention further provides:
  • a method comprising introducing into a cell a first DNA sequence capable of expressing in said cell a sense RNA fragment of a viral target gene, and a second DNA sequence capable of expressing in said cell an antisense RNA fragment of said target gene, wherein said sense RNA fragment and said antisense RNA fragment are capable of forming a double-stranded RNA molecule, wherein the expression of said viral target gene in said cell is altered.
  • the target gene comprises a viral genome or a portion thereof and the cell is preferably resistant or tolerant to viruses.
  • the virus is selected from the group consisting of tospoviruses, potyviruses, potexviruses, tobamoviruses, luteoviruses, cucumoviruses, bromoviruses, closteorviruses, tombusviruses and furoviruses.
  • the DNA sequences comprises a nucleotide sequence derived from a viral coat protein gene, a viral nucleocapsid protein gene, a viral replicase gene, a movement protein gene or portions thereof.
  • a cell is a plant cell, such as a monocotyledonous or a dicotyledonous cell.
  • the DNA sequences are stably integrated in the genome of the plant cell.
  • the DNA molecule further comprises a promoter operably linked to said first or said second DNA sequence.
  • the first DNA sequence and the second DNA sequence are comprised in two different, i.e. separate DNA molecules.
  • the first DNA sequence and the second DNA sequence are comprised in one DNA molecule.
  • the first DNA sequence and the second DNA sequence are preferably comprised in the same DNA strand of said DNA molecule meaning that the sense RNA fragment and the antisense RNA fragment are comprised in one RNA molecule.
  • the RNA molecule is capable of folding such that said RNA fragments comprised therein form a double-stranded region. Examples of such RNA molecules comprise the inverted repeat sequence of SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 25 or SEQ ID NO: 28.
  • the sense RNA fragment and the antisense RNA fragment are comprised in or expressed as two RNA molecules.
  • first DNA sequence and the second DNA sequence are preferably operably linked to a bi-directional promoter or, alternatively, the first DNA sequence is operably linked to a first promoter and the second DNA sequence is operably linked to a second promoter, wherein the first promoter and the second promoter are the same promoter or different promoters.
  • first DNA sequence and the second DNA sequence are comprised in complementary strands of said DNA molecule.
  • the first DNA sequence is the complementary DNA strand of the second DNA sequence in said DNA molecule.
  • the DNA molecule further comprises a first promoter operably linked to said first or second DNA sequence.
  • the DNA molecule further comprises a first site-specific recombination site between said first promoter and said first or second DNA sequence and a second site-specific recombination site at the 3'-end of said first DNA sequence, wherein said first and second site-specific recombination sites are capable of inverting said first or second DNA sequence between said first and second site-specific recombination sites in presence of a site-specific recombinase.
  • said inverting said first promoter is capable of expressing said second (or first, depending on which DNA sequence was originally linked to the promoter) DNA sequence.
  • the plant cell preferably further comprises a site-specific recombinase capable of recognizing said site-specific recombination sites.
  • the DNA molecule further comprises a first promoter operably linked to said first DNA sequence and a second promoter operably linked to said second DNA sequence, wherein the first promoter and the second promoter comprise the same promoter or comprise different promoters.
  • the promoter in the DNA molecule comprises a native promoter of said cell.
  • the promoter is a heterologous promoter, for example a tissue specific promoter, a developmentally regulated promoter, a constitutive promoter or an inducible promoter.
  • the promoter is a divergent or bidirectional promoter capable of initiating transcription of DNA sequences on each side of the promoter.
  • the DNA sequence further comprises a linker between the DNA sequences encoding the sense and antisense RNA fragments.
  • the linker comprises, e.g. an expression cassette comprising a functional gene, e.g. a selectable marker gene or regulatory sequences, e.g. intron processing signals.
  • the invention also further provides:
  • a cell comprising the sense and antisense RNA fragments of the present invention, wherein the expression of said viral target gene in said cell is altered by said RNA fragments.
  • the cell is resistant or tolerant to viruses.
  • the cell is a plant cell and the invention further provides a plant and the progeny thereof derived from the plant cell, and seeds derived from the plant.
  • the invention also provides:
  • DNA constructs comprising the DNA sequences of the present invention.
  • such a DNA construct comprises a first DNA sequence capable of expressing in a cell a sense RNA fragment of a viral genome or portion thereof and a second DNA sequence capable of expressing in said cell an antisense RNA fragment of said viral genome or portion thereof, wherein said sense RNA fragment and said antisense RNA fragment are capable of forming a double-stranded RNA molecule.
  • the expression of said viral genome or portion thereof in said cell is altered.
  • the cell is a plant cell.
  • the virus is selected from the group consisting of tospoviruses, potyviruses, potexviruses, tobamoviruses, luteoviruses, cucumoviruses, bromoviruses, closteorviruses, tombusviruses and furoviruses.
  • the DNA sequences comprises a nucleotide sequence derived from a viral coat protein gene, a viral nucleocapsid protein gene, a viral replicase gene, a movement protein gene or portions thereof.
  • the DNA construct further comprises a promoter operably linked to said first or said second DNA sequence.
  • the DNA construct comprises a first promoter operably linked to said first DNA sequence and a second promoter operably linked to said second DNA sequence. In yet another preferred embodiment, the DNA construct further comprises a bi-directional promoter operably linked to said first DNA sequence and said second DNA sequence.
  • the invention further provides:
  • a DNA construct comprising:
  • the expression of said target gene in said cell is altered.
  • a DNA construct comprising:
  • the expression of said target gene in said cell is altered.
  • a "double-stranded RNA (dsRNA)" molecule comprises a sense RNA fragment of a target gene and an antisense RNA fragment of the same target gene, which both comprise nucleotide sequences complementary to one another, thereby allowing the sense and antisense RNA fragments to pair and form a double-stranded RNA molecule.
  • “Complementary” refers to two nucleotide sequences which comprise antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen bonds between the complementary base residues in the antiparallel nucleotide sequences.
  • Antiparallel refers herein to two nucleotide sequences paired through hydrogen bonds between complementary base residues with phosphodiester bonds running in the 5'-3' direction in one nucleotide sequence and in the 3'-5' direction in the other nucleotide sequence.
  • a “target gene” is any viral gene of known function or is a gene whose function is unknown, but whose total or partial nucleotide sequence is known.
  • a target gene is an native gene of the cell or is a heterologous gene which had previously been introduced into the cell, preferably by genetic transformation or viral infection of the cell.
  • the target gene is a gene in a plant cell.
  • a “native” gene refers to a gene which is present in the genome of the untransformed cell.
  • essential gene is a gene encoding a protein such as e.g. a biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein that is essential to the growth or survival of the cell.
  • a target gene in a cell means that the level of expression of the target gene in a cell after applying the method of the present invention is different from its expression in the cell without applying the method.
  • To alter gene expression preferably means that the expression of the target gene in the cell is reduced, preferably strongly reduced, more preferably the expression of the gene is not detectable, resulting in a knockout mutant phenotype in cells or plants or animals derived thereof.
  • isolated is, in the context of the present invention, an isolated nucleic acid molecule that, by the hand of man, exists apart from its native environment and is therefore not a product of nature.
  • An isolated nucleic acid molecule may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell.
  • “Expression cassette” as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
  • the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
  • the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
  • the expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Typically, however, the expression cassette is heterologous with respect to the host, i.e., the particular DNA sequence of the expression cassette does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, such as a plant, the promoter can also be specific to a particular tissue or organ or stage of development.
  • Heterologous as used herein means “of different natural origin” or represents a non- natural state. For example, if a host cell is transformed with a nucleic acid sequence derived from another organism, particularly from another species, that nucleic acid sequence is heterologous with respect to that host cell and also with respect to descendants of the host cell which carry that nucleic acid sequence. Similarly, heterologous refers to a nucleotide sequence derived from and inserted into the same natural, original cell type, but which is present in a non-natural state, e.g. a different copy number, or under the control of different regulatory elements.
  • the term "substantially similar”, when used herein with respect to a nucleotide sequence, means a nucleotide sequence corresponding to a reference nucleotide sequence, wherein the corresponding sequence encodes a polypeptide having substantially the same structure and function as the polypeptide encoded by the reference nucleotide sequence, e.g. where only changes in amino acids not affecting the polypeptide function occur.
  • the substantially similar nucleotide sequence encodes the polypeptide encoded by the reference nucleotide sequence.
  • the percentage of identity between the substantially similar nucleotide sequence and the reference nucleotide sequence desirably is at least 80%, more desirably 85%, preferably at least 90%, more preferably at least 95%, still more preferably at least 99%.
  • Regulatory elements refer to sequences involved in conferring the expression of a nucleotide sequence. Regulatory elements comprise a promoter operably linked to the nucleotide sequence of interest and termination signals. They also typically encompass sequences required for proper translation of the nucleotide sequence.
  • plant refers to any plant or part of a plant at any stage of development. Therein are also included cuttings, cell or tissue cultures and seeds. As used in conjunction with the present invention, the term “plant tissue” includes, but is not limited to, whole plants, plant cells, plant organs, plant seeds, protoplasts, callus, cell cultures, and any groups of plant cells organized into structural and/or functional units.
  • Virus resistance or tolerance means herein that a resistant or tolerant cell, plant or animal is either not susceptible or has reduced susceptibility to one or more viruses as compared to a sensitive cell, plant or animal. Resistance or tolerance for instance means that the usual symptoms of a virus infection are absent or reduced, or that accumulation or replication of the virus in the cell is prevented or reduced, or that movement of the virus, e.g. from cell to cell is prevented or reduced.
  • alteration of the expression of the viral genome or of a portion thereof is typically understood that accumulation, replication or movement of the virus or a portion or component thereof, e.g. a RNA, DNA or protein of the virus, in the cell is affected.
  • the present invention relates to methods to regulate, i.e. alter the expression of a viral gene in cells, plants or animals.
  • the present method alleviates these problems and provides for reproducible and efficacious regulation of a gene in cells, plants or animals.
  • the gene the expression of which is regulated is a viral genome or a portion thereof.
  • a cell is an eukaryotic cell, more preferably a plant cell, such as a monocotyledonous or a dicotyledonous cell, or an animal cell e.g. from a mammal, e.g.
  • the present invention utilizes a sense RNA fragment and an antisense RNA fragment of a viral target gene to alter the expression of the gene in a cell.
  • the invention provides a method comprising introducing into a cell a sense RNA fragment of a target gene and an antisense RNA fragment of said target gene, wherein said sense RNA fragment and said antisense RNA fragment are capable of forming a double-stranded RNA molecule, wherein the expression of said target gene in said cell is altered.
  • RNA fragments are introduced in the cells by different transformation methods such as particle bombardment or PEG-mediated transformation or electroporation. In another preferred embodiment, other techniques, such as microinjection of the RNA fragments, are used.
  • the RNA fragments are comprised in two different RNA molecules. In this case, the RNA fragments are mixed before being introduced into said cell, e.g. under conditions allowing them to form a double-stranded RNA molecule.
  • the RNA fragments are introduced into said cell sequentially.
  • the time interval between the introduction of each of the RNA molecules is short, preferably less than one hour.
  • the RNA fragments are comprised in one RNA molecule.
  • the two complementary RNA fragments are in close proximity such that pairing and is favored.
  • the RNA molecule is preferably capable of folding such that said RNA fragments comprised therein form a double-stranded region.
  • the complementary parts of the RNA fragments recognize one another, pair with each other and form the double-stranded RNA molecule.
  • the RNA fragments are incubated under conditions allowing them to form a double-stranded RNA molecule prior to introduction into the cell.
  • the RNA molecule comprises a linker between the sense RNA fragment and the antisense RNA fragment.
  • the linker preferably comprises a RNA sequence encoded by an expression cassette comprising a functional gene, e.g. a selectable marker gene.
  • the linker comprises a RNA sequence encoded by regulatory sequences, which e.g. comprise intron processing signals.
  • the present invention provides a method of altering the expression of a viral genome comprising introducing into a cell a first DNA sequence capable of expressing in said cell a sense RNA fragment of said viral genome and a second DNA sequence capable of expressing in said cell an antisense RNA fragment of said viral genome, wherein said sense RNA fragment and said antisense RNA fragment are capable of forming a double-stranded RNA molecule.
  • the first DNA sequence and the second DNA sequence are stably integrated in the genome of the cell.
  • the DNA sequences are comprised in two different DNA molecules.
  • the DNA sequences are comprised in one DNA molecule.
  • the DNA molecule preferably encodes a single RNA molecule which comprises the sense and antisense RNA fragments. By using one single RNA molecule the two complementary RNA fragments are in close proximity such that pairing and is favored.
  • the DNA molecule encodes two separate RNA molecules, e.g. one RNA molecule comprising a sense RNA fragment and one RNA molecule comprising an antisense RNA fragment.
  • the single RNA molecule or the two distinct RNA molecules are preferably capable of folding such that said RNA fragments comprised therein form a double-stranded region, in which the complementary parts of the RNA fragments recognize one another, pair with each other and form the double-stranded RNA molecule.
  • the single DNA molecule or each of the two distinct DNA molecules comprises a promoter operably linked to said DNA sequences.
  • the promoter in the DNA sequence comprises a native plant promoter or the natural promoter of said viral gene to be inactivated, in order to insure that the double-stranded RNA is expressed in the same tissues and at the same time in development as the viral target gene.
  • the promoter is a heterologous promoter, for example a tissue specific promoter, a developmentally regulated promoter, a constitutive promoter or an inducible promoter.
  • the DNA sequence comprises a linker between the DNA sequences encoding said two complementary RNA fragments.
  • the linker preferably comprises an expression cassette comprising a functional gene, e.g. a selectable marker gene.
  • the linker comprises regulatory sequences, which e.g. comprise intron processing signals.
  • DNA molecules of the present invention are transformed into cells using methods well- known in the art or described below.
  • the present invention also provides a DNA construct comprising DNA sequences of the present invention, a recombinant vector comprising such DNA constructs and a composition comprising DNA sequences of the present invention.
  • the complementary region between the sense and antisense RNA fragments is desirably at least 15 nucleotides long, more desirably at least 50 nucleotides long, and preferably at least 500 bp long.
  • the complementary region is less than 5 kb and more preferably less than 2 kb.
  • the complementary region between the sense and antisense RNA fragments comprises the coding region of the target gene.
  • the complementary region comprises untranslated regions (UTR) of the target gene, e.g. 5' UTR or 3' UTR.
  • UTR untranslated regions
  • a DNA sequence encoding a sense or antisense RNA fragment of the present invention is derived from a c-DNA molecule or comprises regulatory elements of the viral target gene whose expression is to be altered, such as promoter or termination signals.
  • the complementary region between the sense and antisense RNA fragments is identical to the corresponding sequence of the gene whose expression is altered. In another preferred embodiment, the complementary region between the sense and antisense RNA fragments is substantially similar to the corresponding sequence of the gene whose expression is altered and is still capable of altering the expression of the gene. In this case, the complementary region is desirably at least 50% identical to the corresponding sequence of the gene whose expression is altered more desirably at least 70% identical, preferably at least 90% identical, more preferably at least 95% identical.
  • RNA molecules allows to alter the expression of a single gene or of a plurality of genes, the single gene comprising sequences identical to the double-stranded RNA or being substantially similar to the double- stranded RNA.
  • the complementary region between the sense and antisense RNA fragments does not contain any mismatch between the sense and antisense RNA fragments.
  • the complementary region between the sense and antisense RNA fragments comprises at least one mismatch between the sense and antisense RNA fragments, and the two RNA fragments are still capable of pairing and forming a double-stranded RNA molecule, thereby altering the expression of the gene.
  • there is less than 50% mismatch between the sense and antisense RNA fragments in the complementary region more desirably less than 30% mismatch, preferably less than 20% mismatch, more preferably less than 10% mismatch, yet more preferably less than 5 % mismatch.
  • Viruses controlled using the present invention comprise but are not limited to dsDNA viruses, dsRNA viruses, plus-strand and minus-strand ssRNA viruses, ambisense RNA viruses and retroviruses.
  • plant viruses such astospoviruses (e.g. tomato spotted wilt virus abbreviated TSWV), potyviruses (e.g.
  • TuMV turnip mosaic virus
  • LMV lettuce mosaic virus
  • WMVII water melon mosaic virus II
  • ZYMV Zucchini yellow mosaic virus
  • PVY potato virus Y abbreviated PVY
  • PRSV papaya ringspot virus
  • potexviruses e.g. pepper mild mottle virus abbreviated PMMV, and tomato mosaic virus abbreviate ToMV
  • luteoviruses e.g. beet western yellows virus abbreviated BWYV, and beet mild yellowing virus abbreviated BMYV
  • cucumoviruses e.g.
  • CMV cucumber mosaic virus
  • CaMV Cauliflower mosaic virus
  • BNYVV furoviruses
  • Additional classes of viruses which can be controlled using the present invention are described in Zacomer et al. (1995) Journal of General Virology, 76: 231 -247 and in Martelli (1992) Plant Disease, 76: 436-441.
  • Preferred DNA sequences of a viral genome to achieve virus control corrspond to regions of the genes encoding viral coat proteins, viral nucleocapsid proteins, viral replicases, movement proteins and the like. Further nucleotide sequences useful to control virus genome expression are described in WO 95/09920. Preferred DNA sequences may include portions of the viral genome not translated into proteins, e.g. 5' or 3' untranslated regions.
  • a method of the present invention leads to resistance or tolerance to a broad- spectrum of viruses.
  • a method of the present invention leads to resistance or tolerance to the virus encoded by the viral genome and other viruses in the same virus class, group or genus.
  • a method of the present invention leads to resistance or tolerance to the virus encoded by the viral genome and other isolates of the same virus.
  • a method of the present invention leads to resistance or tolerance to the virus encoded by the viral genome and other viruses in the same virus group or genus in different species, preferably in related species, preferably species in which such viruses exist.
  • more than one pair i.e.
  • pairs of sense and antisense RNA fragments which are capable of forming a dsRNA are used.
  • pairs are for example derived from the same viral genome, but from different portions of the same viral genome.
  • pairs are derived from different viral genomes.
  • resistance or tolerance to different virus classes, groups or genera is achieved using the present invention.
  • Plant cells and plants derived thereof, which are virus resistant or tolerant are preferably dicotyledonous plants. Methods to confer resistance or tolerance to furoviruses (see e.g.
  • DNA molecules of the present invention are incorporated in plant or bacterial cells using conventional recombinant DNA technology.
  • a DNA molecule of the present invention is comprised in a transformation vector.
  • vector systems known in the art such as plasmids, bacteriophage viruses and other modified viruses.
  • the components of the expression system are also modified, e.g. to increase expression of the sense and antisense RNA fragments. For example, truncated sequences, nucleotide substitutions or other modifications are employed.
  • Expression systems known in the art are used to transform virtually any crop plant cell under suitable conditions.
  • a transgene comprising a DNA molecule of the present invention is preferably stably transformed and integrated into the genome of the host cells.
  • the transgene comprising a DNA molecule of the present invention is located on a self-replicating vector.
  • self-replicating vectors are viruses, in particular gemini viruses.
  • Transformed cells are preferably regenerated into whole plants.
  • Plants transformed in accordance with the present invention may be monocots or dicots and include, but are not limited to, maize, wheat, barley, rye, sweet potato, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, hemp, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugarbeet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, rice, potato, eggplant, cucumber, Arabid
  • A. Requirements for Construction of Plant Expression Cassettes Gene sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter expressible in plants.
  • the expression cassettes may also comprise any further sequences required or selected for the expression of the transgene. Such sequences include e.g., but are not restricted to, transcription terminators, extraneous sequences to enhance expression such as introns, vital sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments.
  • These expression cassettes can then be easily transferred to the plant transformation vectors described infra. The following is a description of various components of typical expression cassettes.
  • the selection of the promoter used in expression cassettes determine the spatial and temporal expression pattern of the transgene in the transgenic plant.
  • Selected promoters express transgenes in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection reflects the desired location of accumulation of the gene product.
  • the selected promoter drives expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters known in the art is used.
  • the CaMV 35S promoter, the rice actin promoter, or the ubiquitin promoter are used.
  • the chemically inducible PR-1 promoter from tobacco or Arabidopsis is used (see, e.g., U.S. Patent No. 5,689,044).
  • a preferred category of promoters is that which is wound inducible. Numerous promoters have been described which are expressed at wound sites. Preferred promoters of this kind include those described by Stanford et al. Mol. Gen. Genet. 215: 200-208 (1989), Xu et al. Plant Molec. Biol. 22: 573-588 (1993), Logemann et al. Plant Cell V. 151-158 (1989), Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993), Firek et al. Plant Molec. Biol. 22: 129-142 (1993), and Warner et al. Plant J. 3: 191-201 (1993).
  • Preferred tissue specific expression patterns include green tissue specific, root specific, stem specific, and flower specific. Promoters suitable for expression in green tissue include many which regulate genes involved in photosynthesis, and many of these have been cloned from both monocotyledons and dicotyledons.
  • a preferred promoter is the maize PEPC promoter from the phosphoenol carboxylase gene (Hudspeth & Grula, Plant Molec. Biol. 12: 579-589 (1989)).
  • a preferred promoter for root specific expression is that described by de Framond (FEBS 290: 103-106 (1991); EP 0 452 269 and a further preferred root-specific promoter is that from the T-1 gene provided by this invention.
  • a preferred stem specific promoter is that described in US patent 5,625,136 and which drives expression of the maize trpA gene.
  • Preferred embodiments of the invention are transgenic plants expressing nucleotide sequence in a root-specific fashion. Further preferred embodiments are transgenic plants expressing the nucleotide sequence in a wound-inducible or pathogen infection-inducible manner.
  • transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation. Appropriate transcriptional terminators are those that are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator. These are used in both monocotyledonous and dicotyledonous plants.
  • the coding sequence of the selected gene may be genetically engineered by altering the coding sequence for optimal expression in the crop species of interest. Methods for modifying coding sequences to achieve optimal expression in a particular crop species are well known (see, e.g. Perlak et al., Proc. Natl. Acad. Sci. USA 88: 3324 (1991 ); and Koziel et al., Bio/technol. 11: 194 (1993)).
  • a DNA molecule of the present invention is directly transformed into the plastid genome.
  • Plastid transformation technology is extensively described in U.S. Patent Nos. 5,451 ,513, 5,545,817, and 5,545,818, in PCT application no. WO 95/16783, and in McBride etal. (1994) Proc. Natl. Acad. Sci. USA 91 , 7301-7305.
  • the basic technique for chloroplast transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the gene of interest into a suitable target tissue, e.g., using biolistics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation).
  • the 1 to 1.5 kb flanking regions facilitate homologous recombination with the plastid genome and thus allow the replacement or modification of specific regions of the plastome.
  • point mutations in the chloroplast 16S rRNA and rpsl 2 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab, Z., Hajdukiewicz, P., and Maliga, P. (1990) Proc. Natl. Acad. Sci. USA 87, 8526-8530; Staub, J. M., and Maliga, P. (1992) Plant Cell 4, 39-45).
  • Plants homoplasmic for plastid genomes containing the DNA molecule of the present invention are obtained, and are preferentially capable of high expression of the DNA molecule.
  • sense and antisense RNA fragments encoded by the DNA molecule are capable of pairing and of forming a double-stranded RNA molecules in plant plastids to to alter the expression of plastid genes.
  • the sense and antisense fragments do not comprise any mismatch in the complementary region.
  • the sense and antisense fragments comprise at least one mismatch in the complementary region.
  • the DNA sequences in the DNA molecule encoding the RNA fragments are not capable of recombining with each other.
  • transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors.
  • the selection of vector depends upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers are preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra. Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucl. Acids Res 18: 1062 (1990), Spencer et al. Theor.
  • vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)) and pXYZ. Typical vectors suitable tor Agrobacterium transformation include the binary vectors pCIB200 and pCIB2001 , as well as the binary vector pCIB10 and hygromycin selection derivatives thereof. (See, for example, U.S. Patent No. 5,639,949). 2. Vectors Suitable for Transformation
  • Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences are utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. Typical vectors suitable for non-Agrobacterium transformation include pCIB3064, pSOG19, and pSOG35. (See, for example, U.S. Patent No. 5,639,949).
  • DNA sequence of interest is cloned into an expression system, it is transformed into a plant cell.
  • Methods for transformation and regeneration of plants are well known in the art.
  • Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, micro-injection, and microprojectiles.
  • bacteria from the genus Agrobacterium can be utilized to transform plant cells.
  • Transformation techniques for dicotyledons are well known in the art and include Acrabacter/ ' u/n-based techniques and techniques that do not require Agrobacterium.
  • Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This is accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. In each case the transformed cells are regenerated to whole plants using standard techniques known in the art. Transformation of most monocotyledon species has now also become routine.
  • Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, particle bombardment into callus tissue, as well as Agrobacterium-mediated transformation.
  • a chimeric DNA molecule encoding a luciferase RNA duplex A 738 bp "sense" oriented fragment of the firefly luciferase gene from plasmid pLuc+ (Promega) is amplified from pPH108 plasmid DNA using oligonucleotide primers ds_Lud (5 ' -CGC GGA Tec TGG AAG ACG CCA AAA ACA-3 ' , SEQ ID NO:1 ; BamHI restriction site underlined) and ds_Luc2 (5 ' -CGG AAG CTT AGG CTC GCC TAA TCG CAG TAT CCG GAA TG- 3 ' , SEQ ID NO:2; HindUl restriction site underlined).
  • TurboPfu thermostable DNA polymerase (Stratagene) is used in 50 ul reactions according to the manufacturers protocol with five cycles of 95°C / 1 min, 55°C / 1.5 min, 72°C / 2 min followed by twenty five cycles of 95°C / 1 min, 72°C / 3.5 min.
  • a 737 bp "antisense" oriented fragment of the firefly luciferase gene from plasmid pLuc+ is amplified by PCR from pPH108 plasmid DNA using oligonucleotide primers ds_Luc3 (5 ' -CGG TCT AGA GGA AGA CGC CAA AAA CAT A-3 ' , SEQ ID NO:3; Xbal restriction site underlined) and ds_Luc2 (5 ' -CGG AAG CTT AGG CTC GCC TAA TCG CAG TAT CCG GAA TG-3',
  • DNA fragments are purified by electrophoresis through a 1% Tris-acetate gel made from low-melting point agarose (FMC) followed by phenol-chloroform extraction of the excised gel slices containing the PCR products.
  • DNA from the sense product (ds_Luc1/2) is digested with BamHI and HindUl and DNA from the antisense product (ds_Luc3/2) is digested with Xbal and HindUl according to standard methods (restriction enzymes were obtained from New England Biolabs).
  • the resulting sticky-ended DNA fragments are gel purified as described above.
  • a DNA fragment containing the mas 7 'promoter (Velten et al. (19984) EMBO J. 3: 2723-2730) is obtained by digesting plasmid CSA104 with EcoRI and Hindi and purifying a 564 bp DNA fragment. This fragment is redigested with BamHI and the 484 bp EcoRI - BamHI sub- fragment containing the mas 7 'promoter isolated and gel purified.
  • DNA from cloning vector pLitmus29 (New England Biolabs) is digested with EcoRI and Xbal, and the isolated fragment is ligated in a four-way reaction using T4 DNA ligase (New England Biolabs) to the mas 7 'promoter EcoRI - BamHI fragment and the sense (BamHI - HindUl) and antisense (Hind l - Xbal) ds_Luc luciferase gene fragments.
  • binary vector pPH170 for Agrobacterium-mediated plant transformation with the ds_Luc1/2/3 RNA duplex construct
  • DNA from binary plasmid pSGCHCI carrying a kanamycin resistance gene for bacterial selection and a hygromycin resistance gene for transgenic plant selection is digested with EcoRI and Xbal.
  • the resulting 1 1.6 kb isolated fragment from pSGCHCI is ligated in a four-way reaction using T4 DNA ligase (New England Biolabs) to the mas 7 'promoter EcoRI - BamHI fragment and the sense (BamHI - HindUl) and antisense (HindUl - Xbal) ds_Luc luciferase gene fragments.
  • Plasmids pPH170 is introduced into Agrobacterium tumafaciens GV3101 by electroporation and transformed colonies selected and amplified.
  • the GL1 gene encodes a myb-W e transcription factor that is required for initiation of normal trichome (leaf hair) formation (Oppenheimer et al. (1991) Cell 67: 483-493). Knock out of GL1 expression early in development results in plants lacking trichomes. The knockout phenotype is easy to identify in young seedlings and is not lethal.
  • Three vectors for constitutive expression and three vectors for Gal4CI-regulated expression are constructed. The three different vectors to test for each promoter are sense (+) expression, antisense (-) expression, and duplex (+/-) RNA expression of a GL1 gene fragment. The (+) and (-) vectors are controls to compare for their effect on expression of GL1. In each case a 5' fragment from bases #739 to #1781 of the GL1 sequence (GenBank Accession M79448) are used for vector construction.
  • Plasmid pJG304 is derived from pBSSK+. Plasmid pBS SK+ (Stratagene, LaJolla, CA) is linearized with Sad, treated with mung bean nuclease to remove the Sad site, and re-ligated with T4 ligase to make pJG201. The 10XGAL4 consensus binding site/CaMV 35S minimal promoter/GUS gene/CaMV terminator cassette is removed from pAT71 with Kpnl and cloned into the Kpnl site of pJG201 to make pJG304.
  • Plasmid pJG304 is partially digested with restriction endonuclease Asp718 to isolate a full- length linear fragment. This fragment is ligated with a molar excess of the 22 base oligonucleotide JG-L (5 ' -GTA CCT CGA G TC TAG ACT CGA G-3 ' , SEQ ID NO: 4). Restriction analysis is used to identify a clone with this linker inserted 5' to the GAL4 DNA binding site, and this plasmid is designated pJG304DXhol.
  • the Ncol and Sa sites are added to the ends of (+) and (-) fragments by synthesizing PCR primers with the appropriate restriction sites to the 5' termini.
  • the (+/) GL1 fragment is produced by first producing two fragment : a (+) fragment with the Ncol site at the 5' terminus and a HindUl site at the 3' terminus and a (-) fragment with a HindUl site at the 5' terminus and a Sad site at the 3' terminus.
  • the duplex unit is produced by ligation of the resulting fragments at the EcoRI site.
  • the expression unit contains the Gal4 DNA binding domain, followed by a minimal TATA sequence, and the GL1 gene fragment oriented either (+), (-) or (+/-).
  • the mas 7 'promoter of mannopine synthase from Agrobacterium(ref), a relatively strong and constitutive in dicot plants is used.
  • the GL (+), (-), and (+/-) fragments are ligated behind the 1' promoter in pBluescript.
  • the three different expression cassettes are ligated into pCIB200 as EcoRI/Sall fragments (Uknes et al. (1993) Plant Cell 5: 159-169).
  • Example 3 Regulation of the Expression of the Cystathionine Beta Lyase Gene
  • CBL Cystathionine Beta Lyase
  • Antisense construct binary BASTA vector pJG261 is used containing a fragment from the pJG304DXhol vector with an insertion of part of the CBL gene in an antisense orientation (nucleotides #13-1159, Genbank accession #L40511 ).
  • Sense construct same as antisense construct, except the CBL fragment is in the opposite orientation. This construct contains the ATG start codon and most of the CBL ORF and serves as a control for regulation of the expression of the CBL gene.
  • Double-stranded RNA construct A CBL gene fragment (#13-1159) in the sense orientation is inserted into the Sail site of vector pJG304-1 downstream of the antisense orientation version of the CBL gene. A linker of about 10 bp is present between the two copies of CBL.
  • Gene sequences intended for expression in transgenic plants are firstly assembled in expression cassettes behind a suitable promoter and upstream of a suitable transcription terminator. All requirement for constructions of plant expression cassettes apply to the DNA molecules of the present invention and are carried out using techniques well-known in the art.
  • the selection of promoter used in expression cassettes determines the spatial and temporal expression pattern of the DNA molecule in the transgenic plant.
  • Selected promoters express DNA molecule in specific cell types (such as leaf epidermal cells, meosphyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and this selection reflects the desired location of biosynthesis of a RNA fragment encoded by the DNA molecule.
  • the selected promoter may drive expression of the DNA molecule under a light-induced or other temporally regulated promoter.
  • the selected promoter be chemically regulated. This provides the possibility of inducing the expression of the DNA molecule only when desired and caused by treatment with a chemical inducer.
  • transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription and, preferably, correct polyadenylation. Appropriate transcriptional terminators and those which are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator. These can be used in both monocoylyedons and dicotyledons.
  • intron sequences have been found to enhance expression, particularly in monocotyledonous cells.
  • the introns of the maize Adh1 gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells.
  • Intron 1 is found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et al., Genes Develep 1: 1183-1200 (1987)).
  • the intron from the maize bronzel gene had a similar effect in enhancing expression (Callis et al., supra).
  • Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
  • leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
  • TMV Tobacco Mosaic Virus
  • MCMV Maize Chlorotic Mottle Virus
  • AMV Alfalfa Mosaic Virus
  • the present invention encompasses the expression of a DNA molecule of the present invention under the regulation of any promoter which is expressible in plants, regardless of the origin of the promoter. Therefore the DNA molecule is inserted into any of the expression cassette using techniques well-known in the art. These expression cassettes can then be easily transferred to the plant transformation vectors described below Furthermore, the invention also encompasses the use of any plant-expressible promoter in conjunction with any further sequences required or selected for the expression of the DNA molecule. Such sequences include, but are not restricted to, transcriptional terminators, extraneous sequences to enhance expression (such as introns [e.g. Adh intron 1], viral sequences [e. g. TMV- ⁇ ]).
  • pCGN1761 contains the "double" 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC-type backbone.
  • a derivative of pCGN1761 is constructed which has a modified polylinker which includes Notl and Xhol sites in addition to the existing EcoRI site. This derivative is designated pCGN1761 ENX.
  • pCGN1761 ENX is useful for the cloning of cDNA sequences or gene sequences (including microbial ORF sequences) within its polylinker for the purposes of their expression under the control of the 35S promoter in transgenic plants.
  • the entire 35S promoter-gene sequence-tm/ terminator cassette of such a construction can be excised by HindUl, Sphl, Sail, and Xbal sites 5' to the promoter and Xbal, BamHI and Bgll sites 3' to the terminator for transfer to transformation vectors. Furthermore, the double 35S promoter fragment can be removed by 5' excision with Hind l, Sphl, Sail, Xbal, or Pstl, and 3' excision with any of the polylinker restriction sites (EcoRI, Notl or Xhol) for replacement with another promoter.
  • a DNA molecule of the present invention is inserted into pCGN1761 ENX for constitutive expression under the control of the CaMV 35S promoter.
  • the promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers which carry appropriate terminal restriction sites. Should PCR-amplification be undertaken, then the promoter should be resequenced to check for amplification errors after the cloning of the amplified promoter in the target vector.
  • the chemically regulatable tobacco PR-1 a promoter is cleaved from plasmid pCIB1004 (see EP 0 332 104) and transferred to plasmid pCGN1761 ENX.
  • pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered blunt by treatment with T4 DNA polymerase.
  • the fragment is then cleaved with Hind l and the resultant PR-1 a promoter containing fragment is gel purified and cloned into pCGN1761 ENX from which the double 35S promoter has been removed. This is done by cleavage with Xhol and blunting with T4 polymerase, followed by cleavage with HindUl and isolation of the larger vector-terminator containing fragment into which the pCIB1004 promoter fragment is cloned. This generates a pCGN1761 ENX derivative with the PR-1 a promoter and the tml terminator and an intervening polylinker with unique EcoRI and Notl sites.
  • a DNA molecule of the present invention is inserted into this vector, and the fusion product (i.e. promoter-gene-terminator) is subsequently transferred to any selected transformation vector, including those described in this application, thus providing for chemically inducible expression of the DNA molecule.
  • the fusion product i.e. promoter-gene-terminator
  • actin promoter is a good choice for a constitutive promoter.
  • the promoter from the rice Act1 gene has been cloned and characterized (McElroy et al. Plant Cell 2: 163-171 (1990)).
  • a 1.3 kb fragment of the promoter is found to contain all the regulatory elements required for expression in rice protoplasts.
  • numerous expression vectors based on the Act1 promoter have been constructed specifically for use in monocotyledons (McElroy et al. Mol. Gen. Genet. 231 . : 150-160 (1991)).
  • promoter containing fragments are removed from the McElroy constructions and used to replace the double 35S promoter in pCGN1761 ENX, which is then available for the insertion or specific gene sequences.
  • the fusion genes thus constructed are transferred to appropriate transformation vectors.
  • the rice Act1 promoter with its first intron has also been found to direct high expression in cultured barley cells (Chibbar et al. Plant Cell Rep. 12: 506-509 (1993)).
  • a DNA molecule of the present invention is inserted downstream of such promoter, and the fusion products (i.e. promoter-gene-terminator) are subsequently transferred to any selected transformation vector, including those described in this application.
  • Ubiquitin is another gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower - Binet et al. Plant Science 79: 87-94 (1991), maize - Christensen et al. Plant Molec. Biol. 12: 619-632 (1989)).
  • the maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926. Further, Taylor et al. (Plant Cell Rep.
  • a vector which comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment.
  • the ubiquitin promoter is clearly suitable for the expression of a DNA molecule of the present invention in transgenic plants, especially monocotyledons.
  • Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
  • a DNA molecule of the present invention is therefore inserted into any of these vector, and the fusion products (i.e. promoter-gene-terminator) are used for transformation of plants, resulting in constitutive expression of the DNA molecule.
  • the fusion products i.e. promoter-gene-terminator
  • a preferred pattern of expression for a DNA molecule of the instant invention is root expression.
  • Expression of the nucleotide sequence only in root tissue has the advantage of altering the expression of a target gene only in roots, without a concomitant alteration of its expression in leaf and flower tissue and seeds.
  • a suitable root promoter is that described by de Framond (FEBS 290: 103-106 (1991 )) and also in the published patent application EP 0 452 269. This promoter is transferred to a suitable vector such as pCGN1761 ENX and the DNA molecule is inserted into such vector. The entire promoter-gene-terminator cassette is subsequently transferred to a transformation vector of interest.
  • Patent application WO 93/07278 describes the isolation of the maize trpA gene which is preferentially expressed in pith cells. Using standard molecular biological techniques, this promoter or parts thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a DNA molecule of the present invention in a pith-preferred manner. In fact, fragments containing the pith- preferred promoter or parts thereof are transferred to any vector and modified for utility in transgenic plants. Pith preferred expression of the DNA molecule is achieved by inserting the DNA molecule in such vector.
  • Patent Application WO 93/07278 further describes the isolation of the maize calcium-dependent protein kinase (CDPK) gene which is expressed in pollen cells.
  • CDPK calcium- dependent protein kinase
  • the gene sequence and promoter extend up to 1400 bp from the start of transcription.
  • this promoter or parts thereof is transferred to a vector such as pCGN1761 where it replaces the 35S promoter and is used to drive the expression of a DNA moleucle of the present invention in a pollen-specific manner.
  • fragments containing the pollen-specific promoter or parts thereof can be transferred to any vector and modified for utility in transgenic plants.
  • a maize gene encoding phosphoenol carboxylase has been described by Hudspeth & Grula (Plant Molec Biol 12: 579-589 (1989)). Using standard molecular biological techniques the promoter for this gene is used to drive the expression of a DNA molecule of the present invention in a leaf-specific manner in transgenic plants.
  • transformation vectors are available for plant transformation, and a DNA molecule of this invention is inserted into any of the expression cassettes described above, such that they are capable of expressing the DNA molecule in desirable cells, under appropriate conditions.
  • a nucleotide sequence-containing expression cassette is then incorporated into any appropriate transformation vector described below.
  • the selection of vector for use will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred.
  • Selection markers used routinely in transformation include the nptll gene which confers resistance to kanamycin and related antibiotics (Messing & Vierra, Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the bar gene which confers resistance to the herbicide phosphinothricin (White et al, Nucl Acids Res 18: 1062 (1990), Spencer et al.
  • vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)) and pVictor HINK (SEQ ID NO: 5). Below the construction of two typical vectors is described. Construction of oCIB200 and PCIB2001
  • the binary vectors pCIB200 and pCIB2001 are used for the construction of recombinant vectors for use with Agrobacterium and is constructed in the following manner.
  • pTJS75kan is created by ⁇ /ar/ digestion of pTJS75 (Schmidhauser & Helinski, J Bacteriol.
  • Xhol linkers are ligated to the EcoR V fragment of pCIB7 which contains the left and right T-DNA borders, a plant selectable nos/nptll chimeric gene and the pUC polylinker (Rothstein et al., Gene 53: 153-161 (1987)), and the Xbo/-digested fragment is cloned into Sa//-digested pTJS75kan to create pCIB200 (see also EP 0 332 104).
  • pCIB200 contains the following unique polylinker restriction sites: EcoRI, Sstl, Kpnl, Bglll, Xbal, and Sail.
  • pCIB2001 is a derivative of pCIB200 which created by the insertion into the polylinker of additional restriction sites.
  • Unique restriction sites in the polylinker of pCIB2001 are EcoRI, Sstl, Kpnl, Bglll, Xbal, Sail, Mlul, Bell, Avrll, Apal, Hpal, and Stul.
  • pCIB2001 in addition to containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right T-DNA borders for Agrabacter/um-mediated transformation, the RK2-derived trfA function for mobilization between E. coli and other hosts, and the Or/Tand O ⁇ V functions also from RK2.
  • the pCIB2001 polylinker is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
  • Any one of the plant expression cassettes described above and comprising a DNA molecule of the present invention are inserted into pCIB2001 , preferably using the polylinker.
  • the binary vector pCIBIO contains a gene encoding kanamycin resistance for selection in plants, T-DNA right and left border sequences and incorporates sequences from the wide host-range plasmid pRK252 allowing it to replicate in both E. coli and Agrobacterium. Its construction is described by Rothstein et al. (Gene 53: 153-161 (1987)). Various derivatives of pCIBIO have been constructed which incorporate the gene for hygromycin B phosphotransferase described by Gritz et al. (Gene 25: 179-188 (1983)).
  • Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques which do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation), microinjection or pollen transformation (US Patent 5,629,183). The choice of vector depends largely on the preferred selection for the species being transformed. Below, the construction of some typical vectors is described.
  • PCIB3064 pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques in combination with selection by the herbicide basta (or phosphinothricin).
  • the plasmid pCIB246 comprises the CaMV 35S promoter in operational fusion to the E. coli GUS gene and the CaMV 35S transcriptional terminator and is described in the PCT published application WO 93/07278.
  • the 35S promoter of this vector contains two ATG sequences 5' of the start site. These sites are mutated using standard PCR techniques in such a way as to remove the ATGs and generate the restriction sites Sspl and Pvull.
  • the new restriction sites are 96 and 37 bp away from the unique Sail site and 101 and 42 bp away from the actual start site.
  • the resultant derivative of pCIB246 is designated pCIB3025.
  • the GUS gene is then excised from pCIB3025 by digestion with Sail and Sad, the termini rendered blunt and religated to generate plasmid pCIB3060.
  • the plasmid pJIT82 is obtained from the John Innes Centre, Norwich and the a 400 bp Smal fragment containing the bar gene from Streptomyces viridochromogenes is excised and inserted into the Hpal site of pCIB3060 (Thompson et al. EMBO J 6: 2519-2523 (1987)).
  • This generated pCIB3064 which comprises the bar gene under the control of the CaMV 35S promoter and terminator for herbicide selection, a gene fro ampicillin resistance (for selection in E. coli) and a polylinker with the unique sites Sphl, Pstl, Hind l, and BamHI.
  • This vector is suitable for the cloning of plant expression cassettes containing their own regulatory signals to direct expression of a DNA molecule of the present invention.
  • Construction of pSOG19 and PSOG35 pSOG35 is a transformation vector which utilizes the E. coli gene dihydrofolate reductase (DHFR) as a selectable marker conferring resistance to methotrexate.
  • DHFR E. coli gene dihydrofolate reductase
  • PCR is used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adh1 gene (-550 bp) and 18 bp of the GUS untranslated leader sequence from pSOG10.
  • a 250 bp fragment encoding the E. coli dihydrofolate reductase type II gene is also amplified by PCR and these two PCR fragments are assembled with a Sacl-Pstl fragment from pBI221 (Clontech) which comprised the pUC19 vector backbone and the nopaline synthase terminator.
  • pSOG19 which contains the 35S promoter in fusion with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator.
  • Replacement of the GUS leader in pSOG19 with the leader sequence from Maize Chlorotic Mottle Virus (MCMV) generated the vector pSOG35.
  • pSOG19 and pSOG35 carry the pUC gene for ampicillin resistance and have HindUl, Sphl, Pstl and EcoRI sites available for the cloning of foreign sequences, in particular a DNA molecule of the present invention.
  • plastid transformation vector pPH143 (WO 97/32011 , example 36) is used.
  • the DNA molecule is inserted into pPH143 thereby replacing the PROTOX coding sequence.
  • This vector is then used for plastid transformation and selection of transformants for spectinomycin resistance.
  • the DNA molecule is inserted in pPH143 so that it replaces the aadH gene. In this case, transformants are selected for resistance to PROTOX inhibitors.
  • Nicotiana tabacum c.v. 'Xanthi nc' were germinated seven per plate in a 1" circular array on T agar medium and bombarded 12-14 days after sowing with 1 ⁇ m tungsten particles (M10, Biorad, Hercules, CA) coated with DNA from plasmids pPH143 and pPH145 essentially as described (Svab, Z. and Maliga, P. (1993) PNAS 90, 913-917).
  • Example 8 Construction of a chimeric gene cassette encoding a sense and antisense (duplex) RNA fragment for the coat protein gene from BWYV, driven by the RolC promoter
  • HiNK025bis (5 ' -CAA TTA CCA TGG ACA CGG TCG TGG-3 ' , SEQ ID NO: 6; Ncol restriction site underlined), and HiNK226 (5 ' -GCC AAA TGT TTG AAC GCT GCA GCC
  • the fragment is amplified from plasmid pBW17 (Veidt et al, Nucleic Acids Research 16: 9917-9932, 1988; accession number X13063) using primers HiNK025bis2 (5 ' -AAT CGT CCA TGG ATA
  • Polymerase (Life Technologies) is used in 25 ⁇ l reactions according to the manufacturer's prescription applying 30 cycles of 94°C/30 sec, 55°C /30 sec, 72°C/90 sec (+2 sec/cycle).
  • the resulting PCR fragment is purified by electrophoresis through a 1 % Tris-acetate gel made from Seakem GTG agarose (FMC), followed by an extraction of the gel slices containing the PCR product with QIAquick Gel Extraction Kit (QIAGEN).
  • the PCR product is subsequently digested with Ncol and Pstl (all restriction enzymes were supplied by Life
  • a 1.4 Kb 'antisense' oriented BWYV CP fragment is amplified from plasmid pZU174A using primers HiNK251 (5 ' -CTC CCA GGT TGA GAC TGC CCT GCA GTG CCC A- 3 ' , SEQ ID NO: 10; Pstl restriction site underlined) and HiNK228 (5 ' -TTA CCA TGC ATA CGG TCG TGG GTA GG-3 ' , SEQ ID NO: 11 ; Nsil restriction site underlined) or from plasmid pBW17 using primers HiNK251 (nucleotides 4844 to 4814) and HiNK228bis (5 ' -CGT TAA TGC ATA CGG TCG TGG GTA GG-3 ' , SEQ ID NO: 12; nucleotides 3478 to 3503, Nsil restriction site underlined).
  • the PCR product is digested with Nsil and Pstl.
  • the 4.9 Kb plasmid pHiNK138 is linearised with Pstl and dephosphorylated using the Thermosensitive Alkaline Phosphatase (Life Technologies).
  • Both the vector and the PCR fragment are gel purified, followed by the bidirectional ligation of the PCR fragment into pHiNK138.
  • the orientation generating the duplex RNA for the CP gene (SEQ ID NO: 13) is identified by restriction site analysis, yielding plasmid pHiNK152 in which the inverted repeat consists of the 0.6 Kb CP gene separated by the 0.7 Kb spacer sequence derived from the BWYV genome downstream of the CP gene, referred to as ORF6.
  • the spacer sequence is in the antisense orientation.
  • the said gene cassette is transferred to the proprietary binary vector pVictorHiNK carrying phosphomannose isomerase as selectable marker gene (WO 94/20627), yielding pHiNK179
  • Example 9.1 Construction of a chimeric gene cassette encoding a sense and antisense (duplex) RNA fragment for the replicase gene from BNYVV, driven by the Arabidopsis Ubi3int promoter
  • Total RNA is extracted from sugar beet root infected by the beet necrotic yellow vein virus
  • RNA1 RNAse H-Reverse Transcriptase
  • RT RNAse H-Reverse Transcriptase
  • Primer HiNK285 is located between nucleotides 6378 and 6405 of the
  • BNYW RNA1 sequence (accession number D00115) and designed to introduce an EcoRI site.
  • the RT reaction is subsequently used as template for two PCR reactions : Reaction A using primer HiNK283 (5 ' -AAG AAT TGC AGG ATC CAC AGG CTC GGT AC-3 ' , SEQ ID NO: 15) located between nucleotides 5168 bp and 5178 bp of BNYW RNA1 designed to introduce a BamHI site, and primer HiNK284 (5 ' -TTC CAA CGA ATT CGG TCT CAG AC A-3 ' , SEQ ID NO: 16) located between nucleotides 5597 and 5620 of BNYVV RNA1 designed to introduce an EcoRI site.
  • the thus obtained RT-PCR products share the BNYVV RNA1 sequence between nucleotides 5168-5620 that constitutes the future RNA duplex.
  • the future spacer sequence corresponds to nucleotides 5621-6405 bp of BNYVV RNA1 present at the RT-PCR product obtained with primers HiNK283 and HiNK285.
  • Taqf DNA Polymerase (Life Technologies) is used in 25 ⁇ l reactions according to the suppliers's prescription applying 30 cycles qf 94°C/30 sec, 55°C/30 sec, 72°C/90 sec(+2 sec/cycle).
  • the resulting RT-PCR products are purified by electrophoresis through a 1 % Tris-acetate gel made from Seakem GTG agarose (FMC), followed by an extraction of the gel slices containing the amplification products with the QIAquick Gel Extraction Kit (QIAGEN). After gel purification, the RT-PCR products are digested with restriction enzymes BamHI and EcoRI (Life Technologies) according to standard methods and purified as described above.
  • RT-PCR products are cloned between the Arabidopsis Ubiquitin3 (Ubi3int) promoter and the Nos terminator by means of a a three-way ligation reaction using T4 DNA ligase (Life Technologies).
  • the two resulting clones are named pHiNK181 (spacer in antisense orientation, see SEQ ID NO: 17) and pHiNK184 (spacer in sense orientation, see SEQ ID NO: 18).
  • DNA from binary vector pVictorHiNK carrying the phophomannose isomerase gene as selectable marker (WO 94/20627), as well as plasmids pHiNK181 and pHiNK184, are digested with with Ascl and Pad (New England Biolabs) and the vector and insert fragments purified by electrophoresis as described above.
  • Cotyledon explants are inoculated by dipping them into a suspension of Agrobacterium strain EHA101 carrying the appropriate transformation vector diluted in MS medium pH 5.2, supplemented with 20 g/l sucrose, 0.25 mg/l BA, 0.05 mg/l NAA, 500 ⁇ M acetosyringone diluted to an optical density (OD600) from 0.1 to 0.3.
  • the co-cultivation plates consist of petri dishes containing 1/10 MS medium pH 5.7, 30 g/l sucrose, 200 ⁇ M acetosyringone, solidified with 4.7 g/l agarose and covered with a filter paper moistened with 1.5 ml TXD medium (MS salts supplemented with PGO vitamins, 0.005 mg/l kinetin, 4 mg/l CPA (p-chlorophenoxy acetic acid), 30 g/l sucrose, pH 5.7) on the top of the solidified medium.
  • Explants are co-cultivated during 4 days at 21 °C and under dim light, and subsequently transferred to selective regeneration medium consisting of MS medium pH 5.9 supplemented with 20 g/l sucrose, 1.25 g/l mannose, 0.25 mg/l BA, 0.05 mg/l NAA, 500 mg/l carbenicillin, and solidified with 9 g/l agar. Every third week the explants are subcultured to fresh media containing gradually increasing concentrations of mannose to a maximum of 15 g/l.
  • seedlings or TO transformants are first allowed to establish a sufficiently developed root system for a period of approximately four weeks, prior to their transfer to soil infested with Polymyxa betae carrying BNYVV.
  • Infested soils are collected from rhizomania infected fields in Germany.
  • plants are grown in 12 cm pots at a temperature of approximately 21 °C and light period of 16 hours.
  • plants are pulled from the soil and the bottom half of the root system cleaned from any adhering dirt by rinsing with water.
  • Sap from a random sample of 0.5 g of root tissue is collected by means of a Pollahne press and added to 10 ml of extraction buffer consisting of phosphate buffered saline pH 7.2, supplemented with 2% PVP and 0.2% ovalbumin.
  • the amount of virus present in the samples (clones are obtained by in vitro propagation) is determined by means of the triple antibody sandwich (TAS) ELISA for BNYVV commercialized by Adgen Ltd, Scotland, UK, essentially following the supplier's instruction.
  • a standard curve is included on each plate to calculate the virus content of the root samples from the measured absorbance values.
  • Non- transformed susceptible sugar beet plants serve a negative controls, plants carrying the C28 gene for natural rhizomania resistance as positive controls.
  • Table 1 summarizes the results of transformation events obtained with plasmid pHINK188.
  • Example 10 Construction of a plant transformation vector for Zucchini yellow mosaic potwirus (ZYMV) and Papaya ringspot potyvirus (PRSV) resistance in Melon:
  • NOS terminator (Bevan, M., et al, 1983 Nucleic Acids Res. 11 (2), 369-385) is cloned as 260 bp Hindlll/Pstl fragment into the plasmid pZO1560 digested with Hindlll/Pstl.
  • PZO1560 is a pUC derived plasmid in which the multiple cloning site has been replaced by a more versatile one.
  • the new construct obtained after insertion of the NOS terminator is named pZU533.
  • the 5' primer (ZUP1563: 5 ' -GGGCGGATCCGCTAGCCCGCGGCCGCTCTTTCTTTCCAAGG-3 ' , SEQ ID NO: 19) anneals directly upstream of the 5' splice site and adds a BamHI, a Nhel and a Sacll restricion site to the 5'-end of the Actin2 IntronL fragment to be amplified.
  • the 3' primer (ZUP1564: 5 ' -CCCGCCATGGGTCGACGCCATTTTTTATGAGCTGC-3 ' , SEQ ID NO: 20) anneals directly downstream of the 3' splice site and adds a Sail and a Ncol restricion site to the 3'-end of the Actin2 IntronL fragment to be amplified.
  • the PCR fragment amplified with ZUP1563 and 1564 is cloned in the EcoRV site of pBluescript.
  • the new plasmid is named pZU611.
  • pZU615 To provide plasmid pZU615 with the Act2 IntronL a 499 bp BamH/Ncol Act2 IntronL fragment is isolated from pZU61 1 and cloned in pZU615 digested with BamHI and Ncol downstream of the Ubi3 promoter/intron and upstream of the NOS terminator. The new construct is designated pZU616. The insertion of this fragment simultaneously provides the cassette with five additional restriction sites for the next three cloning steps. To amplify a non-translated (nt) 739 bp PRSV CP fragment (Shyi-Dong, Y., et al, (1992).
  • the 5' primer (ZUP1565: 5 ' - CCCGCCATGGGATCCGATGATTTCTACCGAGAATTAAGGG -3 ' , SEQ ID NO: 21 ) anneals 285 bp downstream of the start codon of PRSV CP and adds a Ncol and a BamHI restricion site to the 5'-end of the non-translated PRSV CP fragment.
  • the 3' primer (ZUP1566 : 5 ' - GGGCGCTAGCCTAATGCTTATATAGTACC- 3 ' , SEQ ID NO: 22) anneals 55 bp downstream of the PRSV CP stop codon and adds a Nhel restricion site to the 3'-end of the non-translated PRSV CP fragment.
  • the amplified PCR fragment is cloned in the EcoRV site of pBluescript and the new plasmid is designated pZU612.
  • the 3' primer (ZUP1568: 5 ' - GGGCGTCGACCGCGGGCTTTAAAGGTGGGAGGCCC -3 ' , SEQ ID NO: 24) anneals 89 bp downstream of the ZYMV CP stop codon and includes Sacll and a Sail restricion sites at the 3' end of the non-translated ZYMV CP fragment.
  • the amplified PCR fragment is cloned in the EcoRV site of pBluescript.
  • the new plasmid is named pZU613.
  • a ZYMV CP non-translated fragment is subsequently cloned into pZU616 downstream of the Ubi3 promoter/intron and upstream of the Act2 IntronL.
  • a 719 bp Nhel/Sacll ZYMV CP non-translated fragment is isolated from pZU613 and cloned in the Nhel and Sacll sites of pZU616.
  • the construct is designated pZU617.
  • a PRSV CP non-translated fragment is cloned into pZU617 downstream of the Ubi3 promoter/intron and upstream of the ZYMV CP non-translated fragment.
  • a 720 bp BamHI/Nhel PRSV CP non-translated fragment is isolated from pZU612 and cloned in the BamHI and Nhel sites of pZU617.
  • This new construct is named pZU618.
  • the last fragment to be cloned to complete the gene cassette contains a PRSV CP non- translated fragment and downstream thereof a ZYMV CP non-translated fragment in the same orientation.
  • a corresponding fragment is amplified from pZU618 as template using Pfx PCR and the primers ZUP1565 and ZUP1568.
  • the PCR fragment is cloned into the EcoRV site of pBluescript SK+ and the resulting plasmid is named pZU619.
  • the PRSV CP (nt) / ZYMV CP (nt) fragment is inserted in pZU618 in opposite direction of the PRSV CP (nt) / ZYMV CP (nt) fragments already present in the pZU618 plasmid.
  • a 1445 bp Sall/Ncol PRSV CP (nt) / ZYMV CP (nt) fragment is isolated from pZU619 and cloned in pZU618 digested with Sail and Ncol downstream of the Act2 IntronL and upstream of the NOS terminator.
  • the resulting plasmid is designated pZU622.
  • Said cassette is inserted into the binary vector pZU547, a binary vector derived from the plasmid pVictorHink additionally containing a SMAS promoter / PMI / NOS terminator selection cassette.
  • the 5414 bp Ascl/Pacl DNA fragment containing the inverted repeat gene cassette is isolated from pZU622 and cloned into the Ascl and Pad sites of pZU547 in tandem orientation and upstream of the selection cassette.
  • the final construct is designated pZU623 (SEQ ID NO: 25).
  • Example 11 Construction of a plant transformation vector for Potato Virus Y (PVY) resistance in Tomato
  • the amplified PVY specific insert is excised from as a BamHI/Sacll fragment and cloned into the BamHI/Sacll sites of pZU616 (see exmaple 10), yielding pZUB.
  • PZUB and pZUA are both digested with Ncol and Sail.
  • the PVY specific fragment from pZUA is purified from agarose gel and ligated into the pZUB digested with Ncol and Sail, yielding pZUC containing the following elements:
  • Example 12 Transformation of binary vectors to melon and tomato plant material
  • the binary vectors are transferred to Agrobacterium tumefaciens by electroporation, followed by inoculation and cocultivation of plant explant material with the transformed Agrobacterium strain, selective killing of the Agrobacterium strain using an appropriate antibiotic, selection of transformed cells by growing on selective media containing mannose, transfer of tissue to shoot inducing media, transfer of selected shoots to root inducing media, and transfer of plantlets to soil.
  • total DNA from the transgenic plants is characterized using well known Southern Blot Analysis techniques.
  • Example 13 Screening transgenic melon plants for ZYMV and PRSV resistance
  • Transformed plants are grown in the greenhouse under standard quarantine conditions in order to prevent any infections by pathogens. Primary transformants are self pollinated and seeds harvested.
  • 100 plants of the S1 progeny of the primary transformants are analyzed for segregation of the inserted gene and subsequently infected with ZYMV by mechanical inoculation.
  • Tissue from host plants systemically infected with ZYMV is ground in 5 volumes of ice cold inoculation buffer (10mM phosphate buffer) and rubbed in the presence of carborundum powder on the cotelydons and first leave of 1 week old seedlings.
  • Inoculated plants are monitored for symptom development during 3 weeks after inoculation.
  • Plants containing ZYMV sequences show reduced susceptibility to ZYMV infection compared with untransformed control plants which show severe systemic ZYMV symptoms within 7 days after inoculation.
  • ZYMV tolerant plants are self pollinated and seeds harvested.
  • Transgenic ZYMV resistant plants are mechanically inoculated with PRSV according to the procedures described above. Plants already resistant to ZYMV also show reduced susceptibility to PRSV infection compared with untransformed control plants which show severe systemic PRSV symptoms within 7 days after inoculation.
  • Transformed plants are grown in the greenhouse under standard quarantine conditions in order to prevent any infections by pathogens. Primary transformants are self pollinated and seeds harvested.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Medicines Containing Plant Substances (AREA)
EP00927165A 1999-05-10 2000-05-08 Regulierung von viraler genexpression Withdrawn EP1177283A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP06026160A EP1801215B1 (de) 1999-05-10 2000-05-08 Regulierung der viralen Genexpression

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US309038 1999-05-10
US09/309,038 US7019195B1 (en) 1998-05-26 1999-05-10 Method for conferring resistance or tolerance aganist furovirus, potyvirus, tospovirus, and cucomovirus to plant cells
PCT/EP2000/004117 WO2000068374A1 (en) 1999-05-10 2000-05-08 Regulation of viral gene expression

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP06026160A Division EP1801215B1 (de) 1999-05-10 2000-05-08 Regulierung der viralen Genexpression

Publications (1)

Publication Number Publication Date
EP1177283A1 true EP1177283A1 (de) 2002-02-06

Family

ID=23196412

Family Applications (2)

Application Number Title Priority Date Filing Date
EP06026160A Expired - Lifetime EP1801215B1 (de) 1999-05-10 2000-05-08 Regulierung der viralen Genexpression
EP00927165A Withdrawn EP1177283A1 (de) 1999-05-10 2000-05-08 Regulierung von viraler genexpression

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP06026160A Expired - Lifetime EP1801215B1 (de) 1999-05-10 2000-05-08 Regulierung der viralen Genexpression

Country Status (18)

Country Link
EP (2) EP1801215B1 (de)
JP (3) JP2002543783A (de)
KR (1) KR20010112952A (de)
CN (2) CN101348785A (de)
AR (1) AR023885A1 (de)
AU (1) AU4563300A (de)
BR (1) BR0010496A (de)
CA (1) CA2369422A1 (de)
CZ (1) CZ20014028A3 (de)
EA (1) EA200101186A1 (de)
HK (2) HK1045325A1 (de)
HU (1) HUP0201235A3 (de)
IL (2) IL145538A0 (de)
PL (1) PL351385A1 (de)
SK (1) SK16222001A3 (de)
TR (1) TR200103088T2 (de)
WO (1) WO2000068374A1 (de)
ZA (1) ZA200109152B (de)

Families Citing this family (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19956568A1 (de) 1999-01-30 2000-08-17 Roland Kreutzer Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens
EP1206558B1 (de) 1999-08-26 2008-01-09 Calgene LLC Pflanzen mit veränderten mehrfachungesättigten fettsäuren
US7067722B2 (en) 1999-08-26 2006-06-27 Monsanto Technology Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7531718B2 (en) 1999-08-26 2009-05-12 Monsanto Technology, L.L.C. Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
DE10100586C1 (de) 2001-01-09 2002-04-11 Ribopharma Ag Verfahren zur Hemmung der Expression eines Ziegens
CH695778A5 (de) * 2000-11-29 2006-08-31 Hoffmann La Roche Hemmung der Transkription eines Zielgens in einer Zelle oder in Geweben.
US8546143B2 (en) 2001-01-09 2013-10-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US8022272B2 (en) 2001-07-13 2011-09-20 Sungene Gmbh & Co. Kgaa Expression cassettes for transgenic expression of nucleic acids
US7456335B2 (en) 2001-09-03 2008-11-25 Basf Plant Science Gmbh Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants
DE10163098B4 (de) 2001-10-12 2005-06-02 Alnylam Europe Ag Verfahren zur Hemmung der Replikation von Viren
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
DE10202419A1 (de) 2002-01-22 2003-08-07 Ribopharma Ag Verfahren zur Hemmung der Expression eines durch eine Chromosomen-Aberration entstandenen Zielgens
US7166771B2 (en) 2002-06-21 2007-01-23 Monsanto Technology Llc Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
US7566813B2 (en) 2002-03-21 2009-07-28 Monsanto Technology, L.L.C. Nucleic acid constructs and methods for producing altered seed oil compositions
EP2294915A3 (de) 2002-03-21 2011-04-13 Monsanto Technology LLC Nukleinsäurekonstrukte und Verfahren zur Herstellung von veränderten Samenölzusammensetzungen
ATE405658T1 (de) 2002-07-26 2008-09-15 Basf Plant Science Gmbh Neue selektionsverfahren
CA2494626A1 (en) 2002-08-07 2004-03-04 Basf Plant Science Gmbh Nucleic acid sequences encoding proteins associated with abiotic stress response
WO2006032707A2 (en) 2004-09-24 2006-03-30 Basf Plant Science Gmbh Plant cells and plants with increased tolerance to environmental stress
WO2005014828A2 (en) 2003-08-01 2005-02-17 Basf Plant Science Gmbh Process for the production of fine chemicals in plants
EP2080769A3 (de) 2004-07-02 2010-12-01 Metanomics GmbH Verfahren zur Herstellung von Feinchemikalien
EP2166103B1 (de) 2004-08-02 2013-05-22 BASF Plant Science GmbH Verfahren zur Isolierung von Transkriptionsabschlusssequenzen
EP2163632A1 (de) 2004-10-05 2010-03-17 SunGene GmbH Konstitutive Expressionskassetten zur Regulation der Pflanzenexpression
ES2444001T3 (es) * 2004-10-21 2014-02-21 Venganza Inc. Procedimientos y materiales para conferir resistencia a plagas y patógenos de plantas
EP1655364A3 (de) 2004-11-05 2006-08-02 BASF Plant Science GmbH Expressionskassetten zur bevorzugten Expression in Pflanzensamen
EP2163631B1 (de) 2004-11-25 2013-05-22 SunGene GmbH Expressionskassetten zur bevorzugten Expression in pflanzlichen Schliesszellen
EP1666599A3 (de) 2004-12-04 2006-07-12 SunGene GmbH Expressionskassetten zur bevorzugten Expression in Mesophyll- und/oder Epidermiszellen in Pflanzen
EP2072620B1 (de) 2004-12-08 2013-05-08 SunGene GmbH Expressionskassetten für preferentiell vaskuläre Expression in Pflanzen
EP1669456A3 (de) 2004-12-11 2006-07-12 SunGene GmbH Expressionskasseten für meristembevorzugte Expression in Pflanzen
EP2199304A1 (de) 2004-12-17 2010-06-23 Metanomics GmbH Verfahren zur Steuerung der Chemikalienherstellung
CA2596600A1 (en) 2005-02-09 2006-08-17 Basf Plant Science Gmbh Expression cassettes for regulation of expression in monocotyledonous plants
WO2006089950A2 (en) 2005-02-26 2006-08-31 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
EP1859037A2 (de) 2005-03-08 2007-11-28 BASF Plant Science GmbH Expressionsverbessernde intronsequenzen
AU2006245701B2 (en) 2005-05-10 2011-04-28 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
WO2006128572A1 (en) * 2005-06-02 2006-12-07 Syngenta Participations Ag Ce46-02a insecticidal cotton
US7994399B2 (en) 2005-06-23 2011-08-09 Basf Plant Science Gmbh Methods for the production of stably transformed, fertile Zea mays plants
EP2980220A1 (de) 2005-09-20 2016-02-03 BASF Plant Science GmbH Verbesserte verfahren zur steuerung der genexpression
EP1948806A2 (de) 2005-11-08 2008-07-30 BASF Plant Science GmbH Verwendung von armadillo-repeat (arm1)-polynukleotiden zum erreichen einer pathogenresistenz in pflanzen
US8178751B2 (en) 2006-01-12 2012-05-15 Basf Plant Science Gmbh Use of stomatin (STM1) polynucleotides for achieving a pathogen resistance in plants
CN101421406B (zh) 2006-02-13 2016-08-31 孟山都技术有限公司 用于产生改变的种子油组成的核酸构建体和方法
AU2007299219A1 (en) 2006-04-05 2008-03-27 Metanomics Gmbh Process for the production of a fine chemical
KR100809736B1 (ko) 2006-05-15 2008-03-05 대한민국 안토시아닌 생합성 억제 활성을 가진 myb60 유전자와상기 유전자가 도입된 형질전환 상추 및 그 제조방법
EP2121921A4 (de) * 2006-12-13 2010-08-04 Idiverse Inc Neue, stresstoleranz übertragende gene und rna-moleküle
US8592652B2 (en) 2007-01-15 2013-11-26 Basf Plant Science Gmbh Use of subtilisin-like RNR9 polynucleotide for achieving pathogen resistance in plants
AU2008214568B2 (en) 2007-02-16 2013-04-18 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
AU2008252998A1 (en) 2007-05-22 2008-11-27 Basf Plant Science Gmbh Plant cells and plants with increased tolerance and/or resistance to environmental stress and increased biomass production-KO
EP2240587A2 (de) 2007-12-21 2010-10-20 BASF Plant Science GmbH Pflanzen mit erhöhtem ertrag (ko nue)
AR075549A1 (es) 2008-09-29 2011-04-20 Monsanto Technology Llc Evento transgenico de soja mon87705 y metodos para detectar el mismo
EP2208785A1 (de) * 2009-01-15 2010-07-21 Newbiotechnic, S.A. Verfahren und Kits zum Erzeugen von miRNA- und smallRNA-Expressionsvektoren und ihre Anwendung zur Entwicklung von lentiviralen Expressionsbibliotheken
CA2756146C (en) 2009-04-22 2018-12-04 Basf Plant Science Company Gmbh Whole seed specific promoter
AU2010270309A1 (en) 2009-07-10 2012-02-02 Basf Plant Science Company Gmbh Expression cassettes for endosperm-specific expression in plants
DE112010005958T5 (de) 2009-12-03 2013-08-14 Basf Plant Science Company Gmbh Expressionskassetten für die Embryo-spezifische Expression in Pflanzen
WO2012008768A2 (ko) * 2010-07-14 2012-01-19 대한민국(농촌진흥청장) 다종 바이러스 저항성을 갖는 형질전환 감자 식물체의 제조방법 및 이를 이용하여 제조된 감자 식물체
CN103667322B (zh) * 2013-11-21 2015-11-11 上海市农业科学院 一种抗番茄黄化曲叶病毒的多基因嵌合体avctc及其制备方法和应用
AP2016009478A0 (en) * 2014-03-12 2016-09-30 Univ Sydney Rna production in higher plants
CA3067988A1 (en) * 2017-05-22 2018-11-29 Pebble Labs Usa Inc. Transbiotic regulation of bacterial gene expression
CN116004714B (zh) * 2022-07-27 2024-09-10 武汉大学 基于Spacer基因定向插入TC-Tag标签的细胞系、重组病毒及其制备方法与应用

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04507083A (ja) * 1989-05-19 1992-12-10 ヘム・リサーチ・インコーポレーテッド 規定された構造の短い治療用dsRNA
ES2079647T5 (es) * 1990-03-02 2009-01-16 Bayer Bioscience N.V. Transformacion genetica y regeneracion de la remolacha azucarera.
GB9320548D0 (en) * 1993-10-06 1993-11-24 Sandoz Ltd Improvements in or relating to organic compounds
GB9703146D0 (en) * 1997-02-14 1997-04-02 Innes John Centre Innov Ltd Methods and means for gene silencing in transgenic plants
CN1252102A (zh) * 1997-02-19 2000-05-03 康乃尔研究基金会有限公司 能赋予植物多种性状的dna构建体
GB9710475D0 (en) * 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
GB9720148D0 (en) * 1997-09-22 1997-11-26 Innes John Centre Innov Ltd Gene silencing materials and methods
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
JP4187413B2 (ja) * 1998-03-20 2008-11-26 コモンウェルス サイエンティフィック アンドインダストリアル リサーチ オーガナイゼーション 遺伝子発現の制御
PT1068311E (pt) * 1998-04-08 2011-07-20 Commw Scient Ind Res Org Processos e meios de obter fenótipos modificados
AR020078A1 (es) * 1998-05-26 2002-04-10 Syngenta Participations Ag Metodo para alterar la expresion de un gen objetivo en una celula de planta
WO2000044914A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0068374A1 *

Also Published As

Publication number Publication date
BR0010496A (pt) 2002-04-02
IL145538A (en) 2010-11-30
HK1047769B (zh) 2009-08-14
CN101348785A (zh) 2009-01-21
EP1801215A2 (de) 2007-06-27
CN1357040A (zh) 2002-07-03
JP2002543783A (ja) 2002-12-24
HUP0201235A2 (en) 2002-08-28
IL145538A0 (en) 2002-06-30
HK1045325A1 (zh) 2002-11-22
AR023885A1 (es) 2002-09-04
CN100420748C (zh) 2008-09-24
TR200103088T2 (tr) 2002-05-21
KR20010112952A (ko) 2001-12-22
HK1047769A1 (en) 2003-03-07
AU4563300A (en) 2000-11-21
CZ20014028A3 (cs) 2002-02-13
JP2010088435A (ja) 2010-04-22
JP2009022291A (ja) 2009-02-05
HUP0201235A3 (en) 2004-10-28
EA200101186A1 (ru) 2002-04-25
CA2369422A1 (en) 2000-11-16
ZA200109152B (en) 2002-09-06
PL351385A1 (en) 2003-04-07
WO2000068374A1 (en) 2000-11-16
EP1801215B1 (de) 2013-02-27
SK16222001A3 (sk) 2002-04-04
EP1801215A3 (de) 2008-12-17

Similar Documents

Publication Publication Date Title
EP1801215B1 (de) Regulierung der viralen Genexpression
AU751409B2 (en) DSRNA-mediated regulation of gene expression in plants
AU748604B2 (en) Expression of trehalose biosynthetic genes in plants
WO1999047552A2 (en) Genes encoding mlo proteins and conferring fungal resistance upon plants
US7019195B1 (en) Method for conferring resistance or tolerance aganist furovirus, potyvirus, tospovirus, and cucomovirus to plant cells
WO2007128755A2 (en) P15 hairpin constructs and use
WO2000078799A2 (en) Mlo-genes controlling diseases
WO2000053762A2 (en) Plant disease resistance associated genes and uses thereof
CA2402136A1 (en) Novel monocotyledonous plant genes and uses thereof
MXPA01011262A (en) Regulation of viral gene expression
MXPA00009108A (en) Genes controlling diseases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010927

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO PAYMENT 20010927;SI

17Q First examination report despatched

Effective date: 20050307

17Q First examination report despatched

Effective date: 20050307

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070109

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1045325

Country of ref document: HK