EP1097201A1 - Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung - Google Patents

Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung

Info

Publication number
EP1097201A1
EP1097201A1 EP99932844A EP99932844A EP1097201A1 EP 1097201 A1 EP1097201 A1 EP 1097201A1 EP 99932844 A EP99932844 A EP 99932844A EP 99932844 A EP99932844 A EP 99932844A EP 1097201 A1 EP1097201 A1 EP 1097201A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
cap
polypeptide
polypeptide according
snurportin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99932844A
Other languages
English (en)
French (fr)
Inventor
Christoph Hüls
Claus Simandi
Reinhard Lührmann
Jochen Huber
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Research and Technologies GmbH and Co KG
Original Assignee
Aventis Research and Technologies GmbH and Co KG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aventis Research and Technologies GmbH and Co KG filed Critical Aventis Research and Technologies GmbH and Co KG
Publication of EP1097201A1 publication Critical patent/EP1097201A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a human 5 ' -2,2,7-terminal trimethyl guanosine (hereinafter: m 3 G) -cap-specific nuclear import receptor protein, obtainable by nuclear, cytosol extraction and expression of recombinant nucleic acids, and their use in particular as a medicament , Diagnostic.
  • m 3 G human 5 ' -2,2,7-terminal trimethyl guanosine
  • proteins protein targeting
  • Newly synthesized proteins contain signals that determine their final destination in the cell. So also in the case of the so-called protein import route into the nucleus from the cytosol, which takes place through a nuclear pore complex (NPC), and generally through a saturable one
  • NPC nuclear pore complex
  • Transport receptor - which specifically recognizes a nuclear localization signal (NLS) - is mediated (Göriich and Mattaj (1996), Science, 107, 1513, in particular Table 1; Nigg (1997), Nature, 386; 779; Ohno et al. (1998) , Cell, 92, 327).
  • NLS nuclear localization signal
  • the so-called basic NLS mostly consist of one or a collection of several basic amino acids (overview in Dingwall and Laskey (1991), Trends Biochem. Sei., 16, 478).
  • the proteins which have such a basic NLS are referred to below as karyophilic proteins.
  • IBB importin ß binding domain
  • the NLS-importin complex is bound to the NPC by means of Importin ß (Chi et al. (1995), J Cell Biol., 130, 265; Görlich et al. (1995), Curr. Biol., 5, 383 and (1995) Nature, 377, 246; Imamoto et al. (1995), FEBS Lett, 368, 415; Moroianu et al. (1995), Natl. Acad. Sci. USA., 92, 2008. These are also called karyopherin a / ß (Moroianu et al. 1995 supra; Roh et al. (1995) Proc. Natl. Acad Be. USA, 92, 1769).
  • the translocation of the complex through the core pore requires additional energy-providing transport factors such as GTP and Ran (Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore and Blobel (1993), Nature, 365, 661) and p10 / NTF2 (Moore and Blobel, (1994), Proc. Natl. Acad. Sei. USA, 91, 10212; Paschal and Geraee (1995), J. Cell. Biol., 129, 925).
  • GTP and Ran Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore and Blobel (1993), Nature, 365, 661)
  • p10 / NTF2 p10 / NTF2
  • M9 is recognized directly by Transportin (Pollard et al. 1996, Cell, 86, 985; Nakiel ⁇ y et al., Exp. Cell. Res., 1996, 261; Fridell et al., J. Cell Sei. 1997, 1325).
  • Transportin is functional without an ⁇ subunit, while the binding to the NPC and the Ran-dependent translocation of the hnRNP A1 / Transportin complex into the nucleus take place in an analogous manner to Importin ß (Nakielny et al. (1996) , Exp. Cell. Res., 229, 261; Izaurralde et al. (1997), J. Cell Biol., 137, 27).
  • Each snRNP particle consists of one (U1, U2 and U5) or two (U4 / U6) snRNA molecules and a common set of eight basic proteins (B, B ' , D1, D2, D3, E, F and G, so-called Sm proteins ), which are bound to each of the m 3 G-cap containing s ⁇ RNAs U1, U2, U4 and U5 and differ with respect to the respective snRNA in specific further associated proteins (Will and Llikma ⁇ n (1997), Curr. Opin. Cell. Biol. , 9, 320).
  • the biogenesis of the snRNPs is dependent on a bidirectional transport of the snRNA through the nuclear membrane.
  • the snRNAs (U1, U2, U4 and U5) are specifically synthesized with a 5 ' terminal 7 monomethyl-guanosine (m 7 G-) cap structure, while the Sm proteins are formed in the cytoplasm and do not migrate into the nucleus without binding to U snRNA .
  • the mature snRNP particle is transported back to the nucleus in a receptor and energy dependent manner (Neuman de Vegvar and Dahlberg (1995) Mol. Cell. Biol., 10, 3365).
  • the NLS of the U1 snRNP in Xenopus laevis oocytes is described, which is also complex in nature.
  • the m 3 G-Cap Fischer and Lroundmann (1990), Science, 249, 786; Hamm et al., (1990) Cell, 62, 569
  • an unspecified part in the Sm basic domain Sm Core NLS; Fischer et al. (1993) EMBO J. 12, 573.
  • spliceosomal snRNAs require the m 3 G-Cap to the same extent for nuclear transport in oocytes. While U1 and U2 snRNA definitely need the m 3 G-Cap for transport into the nucleus, U4 and U5 snRNAs can also reach the nucleus as ApppG-Cap derivatives, even if the efficiency is considerably reduced (Fischer et al. (1991), J. Cell. Biol., 113, 705; Michaud and Golgfarb (1992) J. Cell. Biol., 116, 851). Even if the m 3 G-Cap is not essential for the core transport of snRNAs U4 and U5, it accelerates their transport considerably.
  • the object of the invention is therefore to provide a polypeptide which interacts specifically with m 3 G-Cap and is used as m 3 G-Cap-specific core import protein receptor in vivo and in vitro.
  • the object is achieved in that a 45 kD protein from cytoplasmic extracts of HeLa cells is provided with high specificity for m 3 G-Cap structures.
  • Kemimportrezeptorprotei ⁇ in the sense of this invention means that the polypeptide acts on the one hand as a receptor and on the other hand mediates the transport of formulated molecules from the cytosol (cytoplasm) into the nucleus.
  • the m 3 G-cap-specific nuclear import protein receptor means that the above-defined core import receptor specifically receptes molecules with m 3 G-cap structures, ie recognizes them in the broadest sense, and mediates their transport into the nucleus, both “in vitro” and also "in vivo".
  • Molecules containing m 3 G-cap in the sense of this invention means that they are accessible to the m 3 G-cap-specific core import protein receptor according to the invention. Fusion molecules made of m 3 G-Cap and protein or other biologically relevant molecules are therefore also conceivable.
  • in vivo means a conversion, i.e. a reaction, understood, that takes place within a living organism.
  • in vitro means an implementation, i.e. a reaction, understood, that takes place outside of a living organism.
  • Cap in the sense of this invention has the meaning as it is known to the expert in the field of U snRNA and snRNP work.
  • the identification of a potential m 3 G-cap binding protein is carried out with the aid of a UV crosslinking assay and the synthetic substrate (m 3 G) pppAmpUmpA oligonucleotide (m 3 G-Ca ⁇ -oligo) as substrate.
  • the synthetic substrate m 3 G
  • pppAmpUmpA oligonucleotide m 3 G-Ca ⁇ -oligo
  • the proteins are analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and autoradiography the cross-linked radioactively labeled proteins .
  • FIGS. 1A and 1B show that a radioactively labeled main band with an apparent molecular weight of 45 kD (arrowhead in FIGS. 1A and 1B) and three less intensely labeled proteins with the molecular weights 25, 35 and 150 kD are reproducibly detected.
  • the m 3 G-Cap specificity for the polypeptide according to the invention preferably a 45 kD protein, which is essential to the invention, is recognized with the aid of competition studies with various unlabeled cap structures. While a 10,000-fold excess of m 7 GpppG or ApppG cap dinucleotide shows only very slight effects on the effectiveness of the UV crosslink with the radioactively labeled m 3 G cap oligo on the 45 kD protein (FIG. 1A, lanes 2- 4 and 5-7), a 10 to 100-fold excess of unlabelled m 3 G-Cap oligo is sufficient to completely prevent the binding to the 45 kD protein (FIG. 1A, traces 9-11).
  • the polypeptide according to the task preferably a 45 kD protein, binds both to isolated m 3 G-cap structures and to ⁇ ative m 3 G-caps in the U1 snRNA as well as to ⁇ ative U1 snRNP particles. This could be demonstrated by the inhibition of UV crosslinking of the m 3 G cap oligo to the 45 kD protein by U1 snRNA and U1 snRNP (FIG. 1B, lanes 2-5 and 11-14). The interaction of the 45 kD protein with U1 snRNA or U1 snRNP is strictly dependent on the presence of the 5 ' - terminal m 3 G-Cap structure.
  • An object of the present invention is therefore the task-related polypeptide as such with an amino acid sequence according to SEQ ID No. 1 or a functional variant thereof, and parts thereof with at least six
  • Amino acids preferably with at least twelve amino acids, in particular with at least 65 amino acids and especially with 360 amino acids (hereinafter referred to as "inventive polypeptide” or “Snurportin 1").
  • an approximately 6-12, preferably approximately 8 amino acids long polypeptide can contain an epitope which, after coupling to a support, is used to produce specific poly- or monoclonal antibodies.
  • Polypeptides with one A length of at least approx. 65 amino acids can also be used directly without a carrier to produce poly- or monoclonal antibodies.
  • the term “functional variant” in the sense of the present invention means polypeptides which are functionally related to the peptide according to the invention, ie which have an m 3 G-cap-specific core import receptor activity. Variants are also understood to mean allelic variants or polypeptides that are used by others For the purposes of this invention, this includes polypeptides that come from different human individuals.
  • this also includes polypeptides which have a sequence homology, in particular a sequence identity of approximately 70%, preferably approximately 80%, in particular approximately 90%, in particular approximately 95%, of the polypeptide with the amino acid sequence SEQ ID No. Have 1. Furthermore, this also includes deletion of the polypeptide in the range from about 1-65, preferably from about 1-30, in particular from about 1-15, especially from about 1-6 amino acids. For example, the first amino acid methionine may be absent without significantly changing the function of the polypeptide.
  • this also includes fusion proteins which contain the above-described polypeptides according to the invention, the fusion proteins themselves already having the function of a human m 3 G-cap specific nuclear import tether or only being able to acquire the specific function after the fusion portion has been split off.
  • this includes fusion proteins with a proportion of in particular non-human sequences of about 1 to 150, preferably about 1 to 100, in particular about 1 to 65, especially about 1 to 30, amino acids.
  • non-human peptide sequences are prokaryotic peptide sequences, for example from the galactosidase from E. co, or a so-called histidine tag, for example a Met-Ala-His6 tag.
  • a fusion protein with a so-called histidine tag is particularly advantageous for purifying the expressed protein on metal ion-containing columns, for example on a Ni 2+ NTA column.
  • NTA stands for the chelator “nitrilotriacetic acid” (Qiagen GmbH, Hilden).
  • the parts of the polypeptide according to the invention represent, for example, epitopes that can be specifically recognized by antibodies.
  • This cDNA coding for the polypeptide according to the invention codes for 360 amino acids (AS) with a predicted molecular weight of 45 kD (FIG. 1A).
  • AS 360 amino acids
  • FIG. 1A A database search with the human snurportin 1 surprisingly showed a high homology in the N-terminal region (AS 27 to 65, FIG. 6B to the IBB domain from importin ⁇ (31% identity, 62% similarity to hSRPI, similar correspondences were found with hRchl, xlmp ⁇ and ySRP1 observed, Fig.
  • the parts of the polypeptide mentioned can also be synthesized with the aid of classic peptide synthesis (Merrifield technique). They are particularly suitable for obtaining antisera, with the aid of which suitable gene expression banks can be searched in order to arrive at further functional variants of the polypeptide according to the invention.
  • the polypeptide according to the invention is a recombinantly produced protein.
  • the host cell is preferably a bacterium (e.g. E. coli strains such as DH5, HB101 or BL21), yeasts (e.g. Saccharomyces cerevisiae or Pichia pastoris), fungi (e.g. Aspergillus spe ⁇ ), mammalian cell lines (e.g.
  • Snurportin is particularly preferably secreted by the host cell
  • the production of such host cells for the production of a recombinant Snurportin can be carried out according to methods known to the person skilled in the art.
  • Expression vectors are widely described in the literature.
  • a selection marker gene and an origin of replication which ensures replication in the selected host, they generally contain a bacterial or viral promoter, and usually a termination signal for transcription.
  • the DNA sequence which naturally controls the transcription of the corresponding gene can be used as the promoter sequence.
  • This sequence can also be exchanged for other promoter sequences. Both promoters which bring about a constitutive expression of the gene and inducible promoters which allow targeted regulation of the expression of the downstream gene can be used. Bacterial and viral promoter sequences with these properties are described in detail in the literature. Regulatory sequences for expression in microorganisms (eg E. coli, S. cerevisiae) have been adequately described in the literature. Promoters that allow a particularly strong expression of the downstream gene are, for example, the T7 promoter (Studier et al., Methods in Enzymology (1990), 185, 60-89), Iacuv5, trp, trp-lacUV5 (DeBoer et al.
  • the cultivation of the host cell takes place in nutrient media which correspond to the needs of the host cell used in each case, in particular taking into account pH, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc.
  • the expression vectors can be, for example, prokaryotic or eukaryotic expression vectors.
  • prokaryotic expression vectors for expression in E. coli are, for example, the T7 expression vector pGM10 (Martin, 1996), which codes for an N-terminal Met-Ala-His6 tag, which advantageously purifies the expressed protein via a Ni2 + -NTA Column allows.
  • Suitable eukaryotic expression vectors for expression in Saeeharomyces cerevisiae are vectors p426Met25 or p426GAL1 (Mumberg et al., Nucl. Acids Res., 1994, (22), 5767), for expression in insect cells, for example baculovirus vectors as in EP -B1-0127839 or EP-B1-0549721, and for expression in mammalian cells, for example SV40 vectors, which are generally available.
  • the expression vectors also contain suitable regulatory sequences for the host cell, such as e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhedrin promoter for expression in insect cells (see, for example, EP-B1-0127839) or the early SV40 promoter or LTR promoters, for example by MMTV (Mouse Mammary Tumor Virus; Lee et al. (1981) Nature, 214, 228).
  • suitable regulatory sequences for the host cell such as e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhe
  • the cleaning of the enzyme produced by the host cells can be carried out according to conventional cleaning methods such as precipitation, ion exchange.
  • a polypeptide By modifying the DNA expressed in the host cells and coding for the polypeptide according to the invention, a polypeptide can be produced in the host cell which, due to certain properties, can be more easily isolated from the culture medium. It is thus possible to express the protein to be expressed as a fusion protein with a further polypeptide sequence, the specific binding properties of which enable the fusion protein to be isolated via affinity chromatography (e.g. Hopp et al. (1988), Bio / Technology, 6, 1204-1210; Sassenfeld ( 1990), Trends Biotechnol., 8, 88-93).
  • affinity chromatography e.g. Hopp et al. (1988), Bio / Technology, 6, 1204-1210; Sassenfeld ( 1990), Trends Biotechnol., 8, 88-93).
  • the present invention therefore furthermore relates to a nucleic acid coding for an m 3 G-cap-specific nuclear import receptor protein with a nucleic acid sequence according to FIG. 2 or a functional variant thereof, and parts thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, in particular with at least 100 nucleotides, especially with at least 300 nucleotides (hereinafter referred to as "nucleic acid according to the invention").
  • the complete nucleic acid encodes a protein with 360 amino acids and a molecular mass of 45 kDa.
  • the expression of the nucleic acid in E. coli leads to a protein which has similar enzymatic activities to that of a human m 3 G cap-specific nuclear import receptor.
  • nucleic acid is a nucleic acid which codes for a human Snurportin 1.
  • the nucleic acid according to the invention is a DNA or RNA, preferably a double-stranded DNA, and in particular a DNA with a nucleic acid sequence according to SEQ ID No. 2.
  • the term “functional variant” is understood to mean a nucleic acid which is functionally related to the human m 3 G-cap-specific nuclear import receptor and in particular human Is of origin. Examples of related nucleic acids are, for example, nucleic acids from different human cells or tissues or allelic variants. The present invention also encompasses variants of nucleic acids which can originate from different human individuals.
  • variants means nucleic acids which have a homology, in particular a sequence identity of approximately 60%, preferably approximately 75%, in particular approximately 90% and above all approximately 95 % exhibit.
  • the parts of the nucleic acid according to the invention can be used, for example, for the production of individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids.
  • a nucleic acid of at least approx. 8 nucleotides is suitable as an antisense nucleic acid
  • a nucleic acid of at least approx. 15 nucleotides as a primer in the PCR method is suitable as a nucleic acid of at least approx. 20 nucleotides for the identification of further variants
  • a nucleic acid of at least approx 100 nucleotides as a probe for example, for the production of individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids.
  • the invention contains
  • Nucleic acid one or more non-coding sequences.
  • the non-coding sequences are, for example, intron sequences or regulatory sequences, such as promoter or enhancer sequences, for the controlled expression of the m 3 G-cap-specific core import receptor.
  • the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector or vector which is active in gene therapy.
  • virus vectors preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, for example a Adeno-associated virus vector consisting exclusively of two inserted terminal repeat sequences (ITR).
  • ITR inserted terminal repeat sequences
  • Suitable adenovirus vectors are described, for example, in McGrory, W.J. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors” (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S et al. (1986) EMBO J .. 5, 2377 or WO95 / 00655.
  • Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO95 / 23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95 / 23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R.M. (1994) Human Gene Therapy 5, 793.
  • Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes. Are suitable for this
  • the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the DNA is completely complexed by the liposomes.
  • the nucleic acid according to the invention can be chemically described, for example, in 2 disclosed sequence or using SEQ ID No. 1 disclosed peptide sequence can be synthesized using the genetic code, for example by the phosphotriester method (see, for example, Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4).
  • Another way of getting hold of the nucleic acid according to the invention is to isolate it from a suitable library, for example from a human gene bank, using a suitable probe (see, for example, Sambrook, J. et al. (1989) Molecular Clo ⁇ ing. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York).
  • Suitable as a probe For example, single-stranded DNA fragments having a length of about 100 to 1000 nucleotides, preferably with a length of about 200 to 500 nucleotides, 'in particular with a length of about 300 to 400 nucleotides, the sequence of the nucleic acid sequence according to SEQ ID No. 2 can be derived.
  • Another object of the present invention also relates to antibodies which react specifically with the polypeptide according to the invention, the above-mentioned parts of the polypeptide either being themselves immunogenic or by coupling to suitable carriers, such as e.g. bovine serum albumin, immunogenic or can be increased in their immunogenicity.
  • suitable carriers such as e.g. bovine serum albumin
  • the antibodies are either polyclonal or monoclonal.
  • the preparation which is also an object of the present invention, is carried out, for example, by generally known methods by immunizing a mammal, for example a rabbit, with the polypeptide according to the invention or the parts thereof, optionally in the presence of e.g. Freu ⁇ d's adjuvant and / or aluminum hydroxide gels (see e.g. Diamond, B.A. et al. (1981) The New England Journal of Medicine, 1344).
  • the polyclonal antibodies produced in the animal as a result of an immunological reaction can then be easily isolated from the blood using generally known methods and e.g. purify by column chromatography. Preference is given to affinity purification of the antibodies, in which, for example, the C-terminal DAN fragment has been coupled to an NHS-activated HiTrap column.
  • Monoclonal antibodies can be produced, for example, by the known method from Winter & Milstei ⁇ (Winter, G. & Milstein, C. (1991) Nature, 349, 293).
  • Another object of the present invention is also a medicament which contains a nucleic acid according to the invention or a polypeptide according to the invention and optionally suitable additives or auxiliaries and a method for producing a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, especially in immunosuppression , especially in transplantations, in which a nucleic acid according to the invention, for example a so-called antisense nucleic acid, or a polypeptide according to the invention is formulated with pharmaceutically acceptable additives and / or auxiliary substances.
  • autoimmune diseases in particular multiple sclerosis or rheumatoid arthritis
  • Alzheimer's disease allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis,
  • a medicinal product which contains the nucleic acid according to the invention in naked form or in the form of one of the gene therapy-effective vectors described above or in a form complexed with liposomes is particularly suitable for gene therapy use in humans.
  • Suitable additives and / or auxiliary substances are e.g. a physiological saline, stabilizers, proteinase inhibitors, nuclease inhibitors, etc.
  • Another object of the present invention is also a diagnostic agent containing a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention and, if appropriate, suitable ones
  • a diagnostic agent based on the Polymerase chain reaction PCR diagnostics, for example according to EP-0200362
  • a Northern blot can be produced. These tests are based on the specific hybridization of the nucleic acid according to the invention with the complementary counter strand, usually the corresponding mRNA.
  • the nucleic acid according to the invention can also be modified here, as described, for example, in EP0063879.
  • a DNA fragment according to the invention is preferably labeled using suitable reagents, for example radioactive with -P 32 -dATP or non-radioactive with biotin, according to generally known methods and incubated with isolated RNA, which was preferably bound to suitable membranes made of cellulose or nylon, for example .
  • RNA it is also advantageous to separate the isolated RNA prior to hybridization and binding to a membrane, for example by means of agarose gel electrophoresis. With the same amount of RNA examined from each tissue sample, the amount of mRNA that was specifically labeled by the probe can thus be determined.
  • Another diagnostic agent contains the polypeptide according to the invention or the immunogenic parts thereof described in more detail above.
  • the polypeptide or parts thereof which are preferably attached to a solid phase, e.g. made of nitrocellulose or nylon, for example with the body fluid to be examined z. As blood, are brought into contact in vitro, for example with
  • the antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies.
  • the label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.
  • Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample from humans can be easily and quickly examined to determine whether the polypeptide in question is present.
  • the antibodies according to the invention are labeled, for example, with an enzyme, as already described above.
  • the specific one Antibody-peptide complex can be detected easily and just as quickly via an enzymatic color reaction.
  • Another object of the present invention also relates to a test for the identification of functional interactors, such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
  • functional interactors such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
  • a suitable test for identifying functional interactors is e.g. B. the so-called "two-hybrid system" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286).
  • a cell for example a yeast cell, is transformed with one or more expression vectors or transfected that express a fusion protein that contains the polypeptide according to the invention and a DNA binding domain of a known protein, for example from Gal4 or LexA from E. coli, and / or express a fusion protein that contains an unknown polypeptide and a transcription activation domain, for example from Gal4, herpesvirus VP16 or B42.
  • the cell contains a reporter gene, for example the LacZ gene from E.
  • the unknown polypeptide is encoded, for example, by a DNA fragment that comes from a gene bank, for example from a human gene bank immediately produced a cDNA library using the expression vectors described in yeast so that the test can be carried out immediately thereafter.
  • a yeast expression vector the nucleic acid according to the invention is cloned in a functional unit to the nucleic acid coding for the lexA-DNA binding domain, so that a fusion protein from the polypeptide according to the invention and the LexA-DNA binding domain is expressed in the transformed yeast.
  • cDNA fragments from a cDNA library are cloned in a functional unit to the nucleic acid coding for the Gal4 transcription activation domain so that a fusion protein from an unknown polypeptide and the Gal4 transcription activation domain is expressed in the transformed yeast.
  • the yeast transformed with both expression vectors which is for example Leu2-, additionally contains a nucleic acid which codes for Leu2 and is controlled by the LexA promoter / operator.
  • the Gal4 transcription activation domain binds to the LexA promoter / operator via the LexA-DNA binding domain, whereby the latter is activated and the Leu2 gene is expressed.
  • the Leu2 yeast can grow on minimal medium that does not contain leucine.
  • the activation of the transcription can be demonstrated by the formation of blue or green fluorescent colonies.
  • the blue or fluorescent staining can also be done easily quantify in the spectrophotometer eg at 585 nM in the event of a blue color.
  • expression gene banks can be easily and quickly searched for polypeptides that interact with the polypeptide according to the invention.
  • the new polypeptides found can then be isolated and further characterized.
  • the present invention is therefore not only intended for a method for finding polypeptide-like interactors, but also extends to a method for finding substances which are identical to those described above Protein-protein complex can interact.
  • Such peptide-like as well as chemical interactors are therefore referred to in the sense of the present invention as - functional interactors which can have an inhibiting or a stimulating effect.
  • snurportin 1 Purification of the polypeptide according to the invention, a 45 kD m 3 G-cap-forming protein called snurportin 1 and detection of its activity:
  • a cytosolic S100 extract from HeLa cells was first purified via a CM-Sepharose column and the run containing Snurportin 1 was separated by means of Q-Sepharose chromatography. The fractions containing Snurportin 1 (tested by the UV crosslinking assay) were then loaded onto an m 3 G-Cap affinity column.
  • biotinylated m 3 G cap oligo m 3 GpppAmpUmpA- / CH 2 ) 6-biotin
  • Snurportin 1 contains an IBB domain, but does not have the well-known armadillo repeats: In order to clone the protein, petid sequences of the purified protein were generated by micro-sequencing. All five generated peptide sequences could be found in the GenBank in an EST (expressed sequence tag) (FIG. 6A). This Snurportin 1 encoding cDNA encodes 360 amino acids (AS) with a predicted molecular weight of 45 kD ( Figure 1A). A
  • the C-terminal part of Snurportin 1 is structurally different from Importin ⁇ (e.g. less than 10% sequence identity with the C-terminus of hSRPI).
  • the C-terminal part of Snurportin 1 is structurally different from Importin ⁇ (e.g. less than 10% sequence identity with the C-terminus of hSRPI).
  • no significant sequence homology between Snurportin 1 and the "armadillo" repeat domain of Importin ⁇ could be detected (FIG. 6B). This means that there is no evolutionary conservation of the C-terminal regions of these two proteins.
  • Snurportin 1 surprisingly exhibits overall sequence homology with different ORF (open reading frames) from mouse ESTs (e.g. AA571557, more than 90% identity), a Drosophila EST (AA541081, more than 40% identity) and with a C. elegans protein of unknown function ( ACC AF024493).
  • the homology between Snurportin 1 and the C. elegans protein is not limited to the N-terminal IBB domain (43% identity, 59% similarity; see FIG. 6A). It can therefore be seen that the protein is the functional homologue to Snurportin 1.
  • Identification of the C. elegans homolog shows that Snurportin 1 has been preserved in an evolutionary manner and therefore has an essential specific function as a core import receptor protein.
  • Snurportin 1 binds Importin ß in vitro depending on the IBB domain:
  • the presence of an IBB domain at the N-terminus of Snurportin 1 has the effect that the core transport of m 3 G-Cap-containing molecules is mediated.
  • Detection is carried out by in-vitro binding of the polypeptide according to the invention to Importin ⁇ .
  • Deletion mutants of the polypeptide according to the invention ( ⁇ 1-65 snurportin 1 causes a missing IBB domain according to FIG. 3B) and likewise total hSRPI ⁇ and Xenopus importin ⁇ were incubated with 35 S-labeled importin ß translated in vitro. The protein complexes were then precipitated with Ni-NTA agarose beads and the binding of Importin ß was analyzed by SDS-PAGE with subsequent autoradiography. Importin ⁇ coprecipitated with total snurportinl, hSRPI ⁇ and importin ⁇ , but not with ⁇ 1 -65 snurportin 1 ( Figure 3A, lanes 1-4). Snurportin 1 binds Importi ⁇ ß demonstrably in vitro and the N-terminal IBB domain is necessary for this binding.
  • the C-terminal domain of Snurportin 1 has an m 3 G-cap binding activity:
  • Importin ⁇ needs its C-terminal domain to bind the NLS of karyophilic proteins (Codes et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 7633).
  • C-terminal domain of snurportin 1 is analogously involved in the binding of the m 3 G-cap NLS of snRNPs.
  • cross-linking studies were carried out with the m 3 G-cap oligo and deletion mutants of snurportin 1.
  • purified recombinant snurportin 1 which lacks the N-terminal amino acids 1-65 (including the IBB domain), could be crosslinked with the radioactively labeled m 3 G-cap oligo just as efficiently as the recombinant total snurportin 1 (FIG 3B, compare lanes 6 and 7).
  • Deletion of the C-terminal 32 AS could not prevent cross-linking.
  • Snurportin 1 stimulates the nuclear import of U snRNP into Xenopus oocytes depending on the IBB domain:
  • Importi ⁇ ⁇ requires an intact IBB domain for its function (Görlich et al., 1996; supra, Weis et al., 1996; supra).
  • the N-terminal deletion mutant of snurportin 1 ( ⁇ 1-65 snurportin 1) together with m 3 G-Cap modified U1 and U5 snRNAs was also microinjected into oocytes. This mutant lacks the IBB domain, but it still has the full m 3 G-cap binding capacity (see FIG. 3B, lane 7).
  • ⁇ 1-65 Snurportin 1 could not only not accelerate the core import of snRNPs, but also strongly inhibited the import of the m 3 G-cap-modified U1 and U5 snRNAs (Fig. 7A, lanes 22-30).
  • the unimpeded transport of ApppG-Cap modified U6 snRNA ( Figure 4A, lanes 22-30) excludes an unspecific effect of ⁇ 1-65 Snurportin 1 on the core import. This shows that the U1 and U5 snRNA import is due to competition between ⁇ 1-65 Snurportin 1 and the endogenous Xenopus laevis Snurportin 1 for the m 3 G-Cap.
  • Snurportin 1 greatly accelerates the nuclear import of U1 snRNPs in vitro in digitonin-permeabilized cells:
  • ⁇ 1-65 Snurportin 1 did not inhibit the import of ⁇ 5 ' U1 snRNP * (compare M with K and B in Fig. 5).
  • these data show that in HeLa cells at least two different import receptors mediate the core import of U1 snRNP. These are snurportin 1 and probably the sm-core NLS receptor.
  • Snurportin 1 contributes significantly to the accumulation of IM snRNP in the nucleus of somatic cells.
  • the polypeptide according to the invention can be used in all cells, but preferably in mammalian cells and human cells. In principle, it can be carried out for all molecules that contain an m 3 G-cap structure.
  • polypeptide according to the invention is specifically deleted at the IBB domain described.
  • amino acids 1-65 on the polypeptide according to the invention - hereinafter referred to as ⁇ 1-65 Snurportin 1 - are deleted.
  • This ⁇ 1-65 Snurportin 1 can preferably be overexpressed in the target cell, preferably mammalian cells and human cells, using a described gene therapy vector according to the methods known to those skilled in the art. This is done to prevent Kermimport of molecules containing m 3 G-Cap.
  • the deletion polypeptide according to the invention is preferably produced as a recombinant protein using known recombinant methods, preferably from the nucleic acid according to SEQ ID No. Third
  • Another subject of the invention is therefore a nucleic acid or a functional variant (as defined for Snurportin 1) according to SEQ ID No. 3 obtainable from the nucleic acid according to SEQ ID No. 2 coding for ⁇ 1-65 Snurportin 1.
  • the SEQ ID No. 3 shows the necessary sequence by introducing a start codon ATG according to known recombinant methods, as a result of which it is expressed in accordance with the teaching of the nucleic acid described (SEQ ID No. 2) and is accessible to the other applications described, in particular as medicaments and diagnostics.
  • the use of the nucleic acid according to SEQ ID No. is particularly preferred. 3 as part of a gene therapy vector for the desired overexpression of ⁇ 1-65 Snurportin 1 in cells.
  • FIG. 4 shows the amino acid sequence of ⁇ 1-65 Snurportin 1, which can be obtained as an expression product by the methods already described. Another object of the invention is the possibility of the detection, identification, quantification, isolation and purification of m 3 G-Cap-containing molecules in the presence of • snurportin1 or ⁇ 1-65 snurportin1 in the context of in vitro experiments.
  • RNA polymerase and RNasin were purchased from Promega.
  • Pfu polymerase was obtained from Stratagene and RNaseH from Boehrimnger Mannheim.
  • the Cap homologs ApppG and m7GpppG were purchased from Pharmacia.
  • M 3 GpppG was synthesized and purified as described (Iwase et al. (1989), Nucleic Acids Res., 17, 8979) Radioactive-labeled triphosphate nucleotides and [ 32 P] pCp were purchased from Amersham. Sequencing was done with an automated sequencer using Taq polymerase and double stranded templates (PRISM Ready Reaction DyeDeoxy Terminator cycle sequencing kit) from Applied Biosystems.
  • Sepharose 4B (Bochnig et al. (1987), Eur. J. Biochem, 168, 461) was bound and obtained by chromatography on MonoQ (Bach et al. (1987), Methods Enzymo, 181, 232).
  • RNase H For competition studies and digestion with RNase H, U1 snRNPs were reduced to 12 ⁇ g / ml by centrifugation at 160,000 xg (2.5 h, 4 ° C) concentrated.
  • U1 snRNPs 60 ug with 10 U RNase H and a DNA oligonucleotide (5 ' -CAGGTAAGTAT-3 ' 1, 4 ug / ul) in a volume of 50 ul incubated (Lamond and Sproat (1994), RNA processing: A Practical Approach, IRL Press, Oxford UK, 103 ff.). Remaining m 3 G-cap-bearing U1 snRNPs were removed from the reaction mixture
  • m 3 G-cap oligonucleotide (m 3 GpppAmpUmpA), which is identical to the 5 ' end of the HeLa U1 snRNA, was synthesized according to Sekine (Sekine et al. (1994) Nucleic Acids Symp. Ser., 31, 61; Sekine et al. (1996), J. Org. Chem., 61, 4412).
  • Preparative [ 32 P] pCp labeling of the m 3 G cap oligos (5 ⁇ g) was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573), with the exception that 250 ⁇ Ci [ 32 P] pCp were used.
  • m 3 G-cap binding proteins were cleaned on a 20% polyacrylamide gel with 7.5 M urea.
  • a pM [ 32 P] pCp 3 ' end-labeled m 3 G-cap oligos (2.5 x 106 cpm / pM) for 10 min on ice with either 25 ⁇ g S100 cytosolic extract or 1.5 ⁇ g purified HeLa or recombinant Snurportin 1 in a volume of 10 ⁇ l.
  • the reaction mixture was then irradiated at 254 ⁇ m with a Sylvania G8T5 UV lamp for 5 min at a distance of 2 cm.
  • the cross-linked proteins were separated by SDS-PAGE and visualized by autoradiography.
  • HeLa S100 extract prepared as described by Dignam (Dignam et al. (1983), Nucleic Acids Res., 11, 1475), was carried out on a 240 ml CM-Sepharose FF column
  • the run containing the 45 kD m 3 G cap binding protein was applied directly to a Q-Sepharose FF column (volume 240 ml, Pharmacia) equilibrated in buffer D. The mixture was then washed with 2 l of buffer D and the bound proteins were eluted with a linear NaCl gradient (100-750 mM in buffer D) over 900 ml. Aliquots (0.5 ml) were dialyzed against buffer D at 4 ° C. for 4 h and analyzed for m 3 G-cap binding activity by means of the UV cross-linking assay. Most of the activity eluted between 170 and 280 mM NaCl.
  • a biotinylated m 3 G-cap oligo (m 3 GpppAmpUmpAp- (CH 2 ) 6-biotin) was chemically synthesized.
  • the coupling of the biotinylated m 3 G cap oligo was carried out according to Lamond and Sproat (1994, supra).
  • Example 5 Microsequencing, cDNA cloning and expression of Snurportin 1
  • Purified Snurportin 1 was digested with Lys-C, the peptides separated by HPLC and the AS sequence of various eluted fractions determined using an ABI 477A protein sequencer.
  • the following peptide sequences which were characterized with three overlapping EST of the ATCC (GenBank accession numbers: H43467, H08432, R14245): (a) KYSSLEQSERRRRLLELQK, (b) KRLDYVNHARRLAEDD, (c) KRLAIVASRGSTSAYTE, (d). (e) KLTHK.
  • the clone R14245 contained a 1.6 kb fragment with an ORF which encoded all five Snurportin 1 peptide sequences.
  • the transformed strains were incubated up to an OD 600 of 0.8 and the protein expression with isopropyl- ⁇ -D-thiogalactopyranoside was induced for 4 h at 30 ° C.
  • the cells from a 2 l culture were sonicated for 1 min on ice in resuspension buffer D (25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl, 1 mM PMSF, 0.1 mM Benzamidi ⁇ , 10 ⁇ g / ml bacitracin , 20 ⁇ g / ml leupeptin, 5 mM Imidazole, 10 mM ⁇ MerCaptoethanol, pH 7.9) treated for lysis.
  • resuspension buffer D 25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl, 1 mM PMSF, 0.1 mM Benzamidi ⁇ , 10 ⁇ g / ml
  • Ni-NTA nickel-nitrilo-acetic acid
  • Qiagen nickel-nitrilo-acetic acid
  • the bound proteins were eluted with resuspension buffer containing 200 mM imidazole and 8.7% glycerol.
  • the proteins were dialyzed against buffer D at 4 ° C. for 2 h and subjected to an m 3 G-cap affinity chromatography as described above.
  • the following primers were used for the PCR amplification: (i) pET28b / spn1 -for [5 ' - GGGCCATGGAAGAGTTGAGTCAGGCCCTG-3 ' ]; (ii) pET28b / ⁇ 1-65 / spn1-for [GGGCCATGGCTGAAGATGACTGGACAGGGATG-3 ' ], (iii) pET28b / spn1-rev and pET28b / ⁇ 1 -65 / spn1-rev [TTTGGATCCGCATTCTCCATGAGGCATC 3 '' -. All constructs generated by PCR were confirmed by sequencing. The expression and purification of hSRPI ⁇ and Xenopus Importin ⁇ have already been described (Weis et al., 1995; Görlich et al., 1994).
  • Importin ⁇ was produced with the help of rabbit reticulocyte lysate by in vitro translation of the plasmid pKW275 (Weis et al., 1996, supra) using the TnT kit (Promega) according to the manufacturer's specification.
  • the binding of Snurportin 1, hSRPI ⁇ or Importin ⁇ to Importin ß using Ni-NTA beads was carried out exactly as described by Weis (Weis et al. (1996), supra).
  • [ 32 P] pCp labeling of gel-purified HeLa U1 and U5 snRNAs was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573).
  • the in vitro transcription of the [ 32 P] pCp-labeled ApppG U6 snRNA was carried out according to Fischer (Fischer et al. (1991), J. Cell. Biol. 113, 705).
  • the isolated U1 snRNPs or ⁇ 5 ' -U1 snRNPs were carried out with the monofunctional reactive fluorescent dye Cy3 according to the manufacturer's instructions (Amersham).
  • the unbound dye molecules were subjected to ultrafiltration in an Amicon cell and subsequent dialysis with PBS (pH 8) removed until no dye molecule could be detected in the passing fractions.
  • the sedimentation analysis of the fluorescent-labeled snRNPs was carried out as described above.
  • Microinjections were carried out as described by Fischer (Fischer et al. (1993), supra), with the exception that OR-2 buffer was used instead of MBS buffer. After incubation at 18 ° C for the indicated periods, the oocytes were in J buffer (70 mM NH 4 CI, 7 mM MgCl 2 , 0.1 mM EDTA, 2.5 mM DTT, 20 mM Tris-HCl, 10 % Glycerin, pH 7.5) transferred and separated manually. The RNA was purified and analyzed as described (Fischer et al., 1993, supra). The gels were quantified using a Molecular Dynamics (Sunnyvale, CA) phosphor imaging system with the Image Quant software version 3.0.
  • Kemimportre forcee ⁇ were carried out with HeLa cells, which are on glass coverslips to a confluence of 50-70% in Dulbecco 's modified Eagle medium (Gibco-BRL) with 10% fetal calf serum and penicillin / streptomycin (Gibco-BRL) at 37 ° C, 5% CO 2 had grown. After permeabilization with digitonin (Adams et al. (1990), J.
  • the cells were washed with ice-cold import buffer (25 mM Hepes pH 7.9, 100 mM NaCl, 2.5 mM Mg Cl 2 , 0.25 mM EDTA) and washed with 25 ⁇ l import buffer containing 0.2 mg / ml tRNA, 1 mM ATP, 1 mM creatine phosphate, 20 U / ml creatine phosphokinase (Sigma), 4 ⁇ g / ml U1 snRNP * ⁇ 5 ' -U1 snRNP * (labeled as described above) and 10 ul HeLa S100 cytosolic extract (5mg / ml protein), incubated. Additional reagents were added as described in the figure legends. The import mix was depleted by ATP, in which ATP, creatine phosphate and
  • Creatine phosphate kinase was not added and preincubation took place for 30 min at 25 ° C in the presence of 20 U / ml apyrase (Sigma). The incubation of the import reactions was carried out at 25 ° C. for 30 min and the reaction was terminated as described by Marshallsay and Lendingmann (1994, supra). After the samples were covered with Fluoprep (bioMerieux), they were covered with Using the 50 x objective of a Leica DM / IRB inverse fluorescent microscope analyzed and saved in digitized images with a CCD camera. The images were processed with the Adobe Photoshop version 3.0 software and quantified with the NIH image software version 1.6. For each sample, the average fluorescence of approximately 100 randomly selected nuclei was calculated from at least three independent assays and averaged.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Transplantation (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)

Abstract

The invention relates to a novel polypeptide or a functional variant thereof, acting as a 5'-2,2,7 terminal trymethylguanosine(m3G-)Cap-specific receptor of nucleus import in cells, to the production and to the use thereof. The invention is preferably used as a medicament or diagnostic reagent.

Description

Beschreibung
SNURPORTIN 1, HUMANES M3G-CAP-SPEZIFISCHES KERNIMPORTREZEPTORPROTEIN MIT EINER NEUEN DOMÄNENSTRUKTUR, DESSEN HERSTELLUNG UND VERWENDUNG
Die vorliegende Erfindung betrifft ein humanes 5'-2,2,7-terminale Trimethyl- Guanosin (im folgenden: m3G)-Cap-spezifisches Kernimportrezeptorprotein, erhältlich durch Kern-, Cytosolextraktion und Expression rekombinanter Nukleinsäuren, sowie deren Verwendung insbesondere als Arzneimittel, Diagnostikum.
Die Zielsteuerung von Proteinen (Protein Targeting) innerhalb der Zelle ist von besonderer Bedeutung, da vielverspechende diagnostische und pharmazeutische Anwendungen in Aussicht gestellt werden.
Neubiosynthetisierte Proteine enthalten Signale, die ihren endgültigen Bestimmungsort in der Zelle determinieren. So auch im Fall des sogenannten Protein-Importwegs in den Kern aus dem Cytosol, welcher durch einen nuklearen Poren Komplex (NPC) erfolgt, und im Allgemeinen durch einen sättigbaren
Transportrezeptor - der spezifisch ein nukleares Lokalisationssignal (NLS) erkennt - vermittelt wird (Göriich und Mattaj (1996), Science, 107, 1513, insbesondere Tabelle 1 ; Nigg (1997), Nature, 386; 779; Ohno et al. (1998), Cell, 92, 327).
Die sogenannten basischen NLS bestehen zumeist aus einer oder einer Ansammlung von mehreren basischen Aminosäuren (Übersicht in Dingwall and Laskey (1991), Trends Biochem. Sei., 16, 478). Die Proteine, die ein solches basisches NLS aufweisen, werden im folgenden als karyophile Proteine bezeichnet.
Görlich beschreibt die Isolierung eines Transportrezeptors, sogenanntes Importin bestehend aus den komplexen heterodimeren Untereinheiten α (60 kD) und ß (90 kD). Importin α enthält ein N-terminales Motiv, die importin ß binding (im folgenden: IBB) Domäne, die die Komplexformierung mit Importin ß vermittelt sowie eine C-terminale Domäne, die die NLS-Bindungsstelie herstellt und aus acht sogenannten „armadillo" Wiederholungsmotiveπ besteht (Görlich et al. (1996), EMBO J., 15, 1810; Moroianu et al. (1996), Proc Natl. Acad. Sei. USA, 92, 2008; Weis et al. (1996), EMBO J., 15, 1818). Mittels Importin ß erfolgt die Bindung des NLS-Importin-Komplexes an die NPC (Chi et al. (1995), J. Cell Biol., 130, 265; Görlich et al. (1995), Curr. Biol., 5, 383 und (1995) Nature, 377, 246; Imamoto et al. (1995), FEBS Lett, 368, 415; Moroianu et al. (1995), Natl. Acad. Sei. USA., 92, 2008). Diese werden auch als Karyopherin a/ß (Moroianu et al. 1995 supra; Radu et al. (1995) Proc. Natl. Acad. Sei. USA, 92, 1769) bezeichnet.
Die Translokation des Komplexes durch die Kernpore benötigt zusätzliche energieliefernde Transportfaktoren wie GTP und Ran (Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore und Blobel (1993), Nature, 365, 661 ) sowie p10/NTF2 (Moore und Blobel, (1994), Proc. Natl. Acad. Sei. USA , 91 , 10212; Paschal und Geraee (1995), J. Cell. Biol., 129, 925).
In aktuellen Untersuchungen, die sich mit den Transportsigπalen von hnRNP A1 und K beschäftigten, konnte ein neuer Protein-Importweg identifiziert werden, der sich von der bekannten basischen NLS-Erkenπung unterscheidet (Pollard et al. (1996), Cell, 86, 985; Michael et al. (1997), EMBO J., 16, 3587). Hierbei ist der Import von hnRNP A1 in den Kern von einem 38 Aminosäuren langen Transportsignal, sogenanntes M9, abhängig, welches keine Sequeπzähnlichkeit mit den basischen NLS aufweist (Siomi und Dreyfuss (1995), J. Cell. Biol., 129, 551 ; Weighart et al. (1995), J. Cell. Sei., 108, 545; Michael et al. (1995), Cell, 83, 415). M9 wird direkt von Transportin erkannt (Pollard et al. 1996, Cell, 86, 985; Nakielπy et al., Exp. Cell. Res., 1996, 261 ; Fridell et al., J. Cell Sei. 1997, 1325). Im Gegensatz zu Importin ß ist Transportin ohne eine α Untereinheit funktioneil, während die Bindung an den NPC und die Ran-abhängige Translokation des hnRNP A1 /Transportin-Komplexes in den Kern auf analoge Weise zu Importin ß erfolgt (Nakielny et al. (1996), Exp. Cell. Res., 229, 261 ; Izaurralde et al. (1997), J. Cell Biol., 137, 27). Ein Homolog zu Transportin, Kap104p, welches ein bestimmte Gruppe von mRNA-bindenden Proteinen importiert, wurde in der Hefe beschrieben (Aitchinson et al. (1996) Science, 274, 624). Zwei weitere Importin ß-ähnliche Proteine, Kap123p/Yrb4p und Psel p, werden für den Kernimport von ribosomalen Proteinen in der Hefe vermutet (Rout et al. (1997), Cell, 89, 715; Schlenstedt et al. (1997), EMBO J., 16, 6237). Diese neuen Importin α unabhängigen Transportrezeptoren sind alle Mitglieder der großen Familie der Importin ß-ähnlichen Transportfaktoren (Fornerod et al. (1997), EMBO J., 16; 807, Görlich et al. (1997) J: Cell. Biol., 138, 65)
Der Mechanismus des Imports der kernspezifischen spliceosomalen U sπRNP ist jedoch weitgehend unbekannt. Jedes snRNP Partikel besteht aus einem (U1 , U2 und U5) oder zwei (U4/U6) snRNA Molekülen sowie einem gemeinsamen Satz von acht Grundproteinen (B, B', D1 , D2, D3, E, F und G, sogenannte Sm Proteine), die an jede der m3G- Cap enthaltende sπRNAs U1 , U2, U4 und U5 gebunden sind und sich hinsichtlich der jeweiligen snRNA in spezifischen weiteren assoziierten Proteinen unterscheiden (Will und Lührmaπn (1997), Curr. Opin. Cell. Biol., 9, 320).
Mit der Ausnahme des U6 snRNP, welches den Kern nicht verläßt (Vankan et al. (1990), EMBO J., 9, 1075) ist die Biogenese der snRNPs von einem bidirektionalen Transport der snRNA durch die Kernmembraπ abhängig. Die snRNAs (U1 , U2, U4 und U5) werden spezifisch mit einer 5'terminalen 7 monomethyl-Guanosin (m7G-) Cap Stuktur synthetisiert, während die Sm Proteine im Zytoplasma entstehen und ohne Bindung an U snRNA nicht in den Kern wandern. Vielmehr werden neu synthetisierte U snRNAs transieπt in das Zytoplasma exportiert, wo sie an der spezifischen snRNA Sm Bindungsstelle die Sm Proteine binden, um einen Ribonucleoprotein-Komplex zu bilden (sogenanntes Sm Core nach Mattaj und De Robertis (1985), Cell, 40, 111 ; Raker et al. (1996), EMBO J., 15, 2256). Die stabile Assoziation aller Sm Proteine ist für die Hypermethylierung des m7G-Cap zum m3G- Cap essentiell (Mattaj (1986) Cell, 46, 905; Plessel et al. (1994), Mol. Cell. Biol., 14, 4160). Nach diesen Vorgängen und der Prozessierung des 3'Endes wird der reife snRNP Partikel in einer Rezeptor- und Energie-abhängigen Weise zurück in den Kern transportiert (Neuman de Vegvar und Dahlberg (1995) Mol. Cell. Biol., 10, 3365). Beschrieben ist das NLS des U1 snRNP in Xenopus laevis Oozyten, welches ebenfalls komplexer Natur ist. Zum einen durch das m3G-Cap (Fischer und Lührmann (1990), Science, 249, 786; Hamm et al., (1990) Cell, 62, 569), zum anderen durch einen nicht näher charakterisierten Teil in der Sm Grunddomäne (Sm Core NLS; Fischer et al. (1993) EMBO J. 12, 573). Nicht alle spliceosomalen snRNAs benötigen in gleichem Ausmaß das m3G-Cap für den Kerntransport in Oozyten. Während U1 und U2 snRNA das m3G-Cap für den Transport in den Kern auf jeden Fall benötigen, können U4 und U5 snRNAs den Kern auch als ApppG- Cap Derivate erreichen, auch wenn die Effizienz dadurch erheblich reduziert wird (Fischer et al. (1991 ), J. Cell. Biol., 113, 705; Michaud und Golgfarb (1992) J. Cell. Biol., 116, 851 ). Auch wenn das m3G-Cap für den Kerntransport der snRNAs U4 und U5 nicht essentiell ist, beschleunigt es deren Transport jedoch erheblich. Dies zeigt, daß das m3G-Cap eine Signalfunktion für den Import von allen U snRNAs besitzt (Fischer et al., J. Cell. Biol., 1994, 971 ; Marshallsay und Lührmann, 1994, Nucleic Acids Res, 13, 222).
Die Erfindung hat daher zur Aufgabe ein Polypeptid bereitzustellen, welches spezifisch mit m3G-Cap interagiert und als m3G-Cap-spezifischer Kernimportproteinrezeptor in vivo und in vitro verwendet wird.
Die Aufgabe wird dadurch gelöst, daß ein 45 kD Protein aus zytoplasmatischen Extrakten von HeLa-Zellen mit hoher Spezifität für m3G-Cap Strukturen bereitgestellt wird.
Kemimportrezeptorproteiπ im Sinne dieser Erfindung bedeutet, daß das Polypeptid zum einen als Rezeptor wirkt und zum anderen den Transport von rezeptierten Molekülen aus dem Cytosol (Zytoplasma) in den Kern mediiert.
m3G-Cap-spezifischer Kernimportproteinrezeptor im Sinne dieser Erfindung bedeutet, daß der obig definierte Kemimportrezeptor spezifisch Moleküle mit m3G- Cap Strukturen rezeptiert, d.h. im weitesten Sinne erkennt, und deren Transport in den Kern mediiert, sowohl „in vitro" als auch „in-vivo". m3G-Cap enthaltende Moleküle im Sinne dieser Erfindung bedeutet, daß diese dem erfindungsgemäßen m3G-Cap-spezifischen Kernimportproteinrezeptor zugänglich- sind. Denkbar sind daher auch Fusionsmoleküle aus m3G-Cap und Protein oder anderen biologisch relevanten Molekülen.
Unter "in vivo" wird im Rahmen der vorliegenden Erfindung eine Umsetzung, d.h. eine Reaktion, verstanden, die innerhalb eines lebenden Organismus abläuft.
Unter "in vitro" wird im Rahmen der vorliegenden Erfindung eine Umsetzung, d.h. eine Reaktion, verstanden, die außerhalb eines lebenden Organismus abläuft.
„Cap" im Sinne dieser Erfindung hat die Bedeutung, wie diese dem Fachmann auf dem Gebiet der U snRNA und snRNP Arbeiten bekannt ist.
Zur Ausführung der Erfindung wird mit Hilfe eines UV-crosslinking Assay sowie dem synthetischen Substrat (m3G)pppAmpUmpA-Oligonukleotid (m3G-Caρ-Oligo) als Substrat die Identifizierung eines potentiellen m3G-Cap bindenden Proteins durchgeführt. Nach der UV-Bestrahlung von cytosolischen S100 Extrakten, die das am 3Εnde radioaktiv mit [32P]pCp markierte m3G-Cap-Oligo enthalten, werden die Proteine mittels SDS-Polyacrylamid Gelelektrophorese (PAGE) und Autoradiographie die vernetzten radioaktiv markierten Proteien analysiert. Figur 1A und 1 B zeigen, daß eine radioaktiv markierte Hauptbande mit einem apparenten Molekulargewicht von 45 kD (Pfeilspitze in Figur 1 A und 1 B) und drei weniger intensiv markierte Proteine mit den Molekulargewichten 25, 35 und 150 kD reproduzierbar detektiert werden.
Die im folgenden erfindungswesentliche m3G-Cap Spezifität für das erfindungsgemäße Polypeptid, vorzugsweise ein 45 kD Protein, wird mit Hilfe von Kompetitionsstudien mit verschiedenen unmarkierten Cap-Strukturen erkannt. Während ein 10.000 facher Überschuß an m7GpppG- oder ApppG-Cap Dinukleotid nur sehr geringe Effekte auf die Effektivität des UV-Crosslinks mit dem radioaktiv markierten m3G-Cap-Oligo an das 45 kD Protein zeigen (Figur 1A, Spuren 2-4 und 5-7), reicht ein 10- bis 100-facher Überschuß an unmarkiertem m3G-Cap Oligo aus, um die Bindung an das 45 kD Protein vollständig zu unterbinden (Figur 1A, Spuren 9-11 ). Im Gegensatz dazu, konnte nur bei einem 1000-fachen Überschuß des unmarkierten m3G-Cap-Oligo eine signifikante Inhibierung der Crosslinking Nebenprodukte beobachtet werden (mit Ausnahme eines 150 kD Proteins). Zudem inhibierte ein synthetisches m3GpppG-Cap Dinukleotid um eine Größenordnung weniger effektiv die Bindung an das 45 kD Protein als das unmarkierte m3G-Cap- Oligo (Figur 3A, vergleiche Spuren 8-11 mit 12-15).
Das aufgabeπgemäße Polypeptid, vorzugsweise ein 45 kD Protein, bindet sowohl an isolierte m3G-Cap-Strukturen und an πative m3G-Caps in der U1 snRNA als auch an πativen U1 snRNP-Partikeln. Dies konnte durch die Inhibierung des UV- Crosslinking des m3G-Cap-Oligos an das 45 kD Protein durch U1 snRNA und U1 snRNP gezeigt werden (Figur 1 B, Spuren 2-5 und 11-14). Die Interaktion des 45 kD Proteins mit U1 snRNA oder U1 snRNP ist strikt von der Anwesenheit der 5'- terminalen m3G-Cap-Struktur abhängig. U1 snRNA und U1 snRNP Präparationen, deren 5'-terminale Enden mit Hilfe von Oligonukleotid-gesteuerter Rnase H Hydrolyse entfernt wurden, konnten das UV-crosslinking vom m3G-Cap-Oligo an das 45 kD Protein nicht inhibieren (Figur 1 B, Spuren 6-9 und 15-18). Gleiche Konzentrationen an m3G-Cap Oligo, U1 snRNA oder U1 snRNP sind ausreichend, um vollständig die Vernetzung des 45 kD Protein mit dem radioaktiv markierten m3G-Cap-Oligo zu inhibieren (vergleiche Figur 1A und 1 B). Dieses Experiment zeigt, daß weder zusätzliche RNA-Sequenzen, noch Sm Core Proteine die Affinität des 45 kD Protein für die 5'-terminale m3G-Cap-Struktur von U1 snRNA/snRNP erhöhen konnte.
Daher ist ein Gegenstand der vorliegenden Erfindung das aufgabengemäße Polypeptid als solches mit einer Aminosäuresequenz gemäß SEQ ID No. 1 oder einer funktioneilen Variante davon, und Teile davon mit mindestens sechs
Aminosäuren, vorzugsweise mit mindestens zwölf Aminosäuren, insbesondere mit mindestens 65 Aminosäuren und vor allem mit 360 Aminosäuren (nachfolgend „erfindungsgemäßes Polypeptid" oder „Snurportin 1" genannt). Beispielsweise kann ein ca. 6-12, vorzugsweise ca. 8 Aminosäuren langes Polypeptid ein Epitop enthalten, das nach Kopplung an einen Träger zur Herstellung von spezifischen poly- oder monoklonalen Antikörper dient. Polypeptide mit einer Länge von mindestens ca. 65 Aminosäuren können auch direkt ohne Träger zur Herstellung von poly- oder monoklonalen Antikörper dienen.
Unter dem Begriff „funktioneile Variante" im Sinne der vorliegenden Erfindung versteht man Polypeptide, die funktioneil mit dem erfindungsgemäßen Peptid verwandt sind, d.h. eine m3G-Cap-spezifische Kernimportrezeptoraktivität aufweisen. Unter Varianten versteht man ebenfalls allelische Varianten oder Polypeptide, die von anderen menschlichen Zellen bzw. Gewebe abstammen. Im Sinne dieser Erfindung gelten darunter Polypeptide, die von verschiedenen menschlichen Individuen stammen.
Im weiteren Sinne versteht man darunter auch Polypeptide, die eine Sequenzhomologie, insbesondere eine Sequenzidentität von ca. 70%, vorzugsweise von ca. 80%, insbesondere von ca. 90%, vor allem von ca. 95% zu dem Polypeptid mit der Aminosäuresequenz gemäß SEQ ID No. 1 haben. Ferner zählen hierzu auch Deletion des Polypeptids im Bereich von ca. 1 - 65, vorzugsweise von ca. 1 - 30, insbesondere von ca. 1 - 15, vor allem von ca. 1 - 6 Aminosäuren. Beispielsweise kann die erste Aminosäure Methionin fehlen, ohne daß die Funktion des Polypeptids wesentlich verändert wird. Daneben zählen hierzu auch Fusionsproteine, die die oben beschriebenen erfindungsgemäßen Polypeptide enthalten, wobei die Fusioπsproteine selbst bereits die Funktion eines humanen m3G-Cap spezifischen Kerπimportreteptors haben oder erst nach Abspaltung des Fusionsanteils die spezifische Funktion bekommen können. Vor allem zählen hierzu Fusionsproteine mit einem Anteil von insbesondere nicht-humanen Sequenzen von ca. 1 - 150, vorzugsweise ca. 1 - 100, insbesondere ca. 1 - 65, vor allem ca. 1 - 30 Aminosäuren. Beispiele von nicht-humanen Peptidsequenzen sind prokaryotische Peptidsequenzeπ, z.B. aus der Galactosidase von E. co oder ein sogenannter Histidin-Tag, z.B. ein Met-Ala-His6-Tag. Ein Fusionsprotein mit einem sogenannten Histidin-Tag eignet sich besonders vorteilhaft zur Reinigung des exprimierten Proteins über Metallionen-haltige Säulen, beispielsweise über eine Ni2+-NTA-Säule. „NTA" steht für den Chelator „nitrilotriacetic acid" (Qiagen GmbH, Hilden). Die Teile des erfindungsgemäßen Polypeptids repräsentieren beispielsweise Epitope, die spezifisch von Antikörpern erkannt werden können.
Diese für das erfiπdungsgemäße Polypeptid codierende cDNA kodiert für 360 Aminosäuren (AS) mit einem vorausgesagten Molekulargewicht von 45 kD (Fig. 1A). Eine Datenbanksuche mit dem humanen Snurportin 1 zeigte überraschenderweise eine hohe Homologie im N-terminalen Bereich (AS 27 bis 65, Fig 6B zu der IBB Domäne vom Importin α (31% Identität, 62% Ähnlichkeit mit hSRPI , ähnliche Übereinstimmungen wurden mit hRchl , xlmpα und ySRP1 beobachtet, Fig. 6B). Darüber hinaus sind AS-Bereiche in der IBB-Domäne von Snurportin 1 sehr homolog zu IBB Domäneπsequenzen von anderen Mitgliedern der Importin - Familie (Görlich et al., EMBO J., 1996, 1810; Weis et al., 1996, supra; hervorgehoben durch schwarze Punkte in Fig. 6B). Im Gegensatz zur ausgedehnten N-termiπalen IBB- Domäne ist der C-terminale Teil von Snurportin 1 strukturell unterschiedlich von Importin (z.B. weniger als 10% Sequenzidentität mit dem C-Termiπus von hSRPI ). Insbesondere konnte keine signifikante Sequenzhomologie zwischen Snurportin 1 und der arm-Wiederholungsdomäne von Importin α detektiert werden (Fig. 6B).
Insbesondere die genannten Teile des Polypeptids können auch mit Hilfe der klassischen Peptidsynthese (Merrifield-Technik) synthetisiert werden. Sie eignen sich insbesondere zur Gewinnung von Antiseren, mit deren Hilfe geeignete Genexpressionsbanken durchsucht werden können, um so zu weiteren funktionelleπ Varianten des erfinduπgsgemäßen Polypeptids zu gelangen.
In einer besonders bevorzugten Ausführungsform ist das erfindungsgemäße Polypeptid ein rekombinant hergestelltes Protein. Darunter wird im Rahmen der vorliegenden Erfindung ein Protein verstanden, welches dadurch hergestellt wurde, daß eine das Protein codierende DNA-Sequenz in eine Wirtszelle eingebracht und dort zur Expression gebracht wird. Das Protein kann dann anschließend aus der Wirtszelle und/oder aus dem Kulturmedium gewonnen werden. Die Wirtszelle ist dabei vorzugsweise ein Bakterium (z.B. E. coli Stämme wie DH5, HB101 oder BL21), Hefen (z.B. Saccharomyces cerevisiae oder Pichia pastoris), Pilze (z.B. Aspergillus speα), Säugetierzellinien (z.B. 293-, Vero-, HeLa-, Cos- oder BHK- Zellen), Insektenzellinien oder ein Protist (Mikroalgen oder Protozoen, z.B. der ' Gattung Tetrahymena wie z. B. definiert in Schlegel "Allgemeine Mikrobiologie" (Georg Thieme Verlag, 1985, 1-2). Besonders bevorzugt wird Snurportin von der Wirtszelle sekretiert. Die Herstellung derartiger Wirtszellen zur Produktion eines rekombinanten Snurportin kann nach dem Fachmann bekannten Methoden erfolgen.
Eine Übersicht über verschiedene Expressionssysteme findet man z.B. in Methods in Enzymology 153 (1987), 385-516 und in Bitter et al. (Methods in Enzymology 153 (1987), 516-544). Expressionsvektoren sind in großem Umfang in der Literatur beschrieben. Sie enthalten neben einem Selektionsmarkergen und einem die Replikation in dem gewählten Wirt sicherstellenden Replikationsursprung in der Regel einen bakteriellen oder viralen Promotor, sowie meist ein Terminationssignal für die Transkription. Zwischen Promotor und Terminationssignal befinden sich mindestens eine Restriktionsschnittstelle oder ein Polylinker, die die Insertion einer codierenden DNA-Sequenz ermöglichen. Als Promotorsequenz kann, sofern sie in dem gewählten Wirtsorganismus aktiv ist, die natürlicherweise die Transkription des entsprechenden Gens steuernde DNA-Sequenz verwendet werden. Diese Sequenz kann aber auch gegen andere Promotor-Sequenzen ausgetauscht werden. Es können sowohl Promotoren verwendet werden, die eine koπstitutive Expression des Gens bewirken, als auch induzierbare Promotoren, die eine gezielte Regulation der Expression des nachgeschalteten Gens erlauben. Bakterielle und virale Promotorsequenzen mit diesen Eigenschaften sind in der Literatur ausführlich beschrieben. Regulatorische Sequenzen zur Expression in Mikroorganismen (z.B. E. coli, S. cerevisiae) sind ausreichend in der Literatur beschrieben. Promotoren, die eine besonders starke Expression des nachgeschalteten Gens erlauben, sind z.B. der T7-Promotor (Studier et al., Methods in Enzymology (1990), 185, 60-89), Iacuv5, trp, trp-lacUV5 (DeBoer et al., in Rodriguez and Chamberlin (Eds), Promotors, Structure and Function; Praeger, New York, (1982), 462-481 ; DeBoer et al, Proc. Natl. Acad. Sei. USA (1983), 21-25), Ip1 , rac (Boros et al., Gene (1986), 42, 97-100). Die Transformation der Wirtszelle mit der für das erfindungsgemäße Polypeptid - codierenden DNA kann in der Regel nach Standardmethoden durchgeführt werden, wie z.B. beschrieben in Sambrook et al. (Molecular Cloning: A Laboratory Course Manual, 2nd edition (1989), Cold Spring Harbor Press, New York). Die Kultivierung der Wirtszelle erfolgt in Nährmedien, die den Bedürfnissen der jeweils verwendeten Wirtszelle entsprechen, insbesondere unter Berücksichtigung von pH-Wert, Temperatur, Salzkonzentration, Belüftung, Antibiotika, Vitaminen, Spurenelementen usw. Die Expressionsvektoren können beispielsweise prokaryotische oder eukaryotische Expressioπsvektoren sein. Beispiele für prokaryotische Expressionsvektoren sind für die Expression in E. coli z.B. der T7 Expressionsvektor pGM10 (Martin, 1996), welcher für einen N-terminalen Met-Ala-His6-Tag kodiert, der eine vorteilhafte Reinigung des exprimierten Proteins über eine Ni2+-NTA-Säule ermöglicht. Als eukaryotische Expressionsvektoren für die Expression in Saeeharomyces cerevisiae eignen sich z.B. die Vektoren p426Met25 oder p426GAL1 (Mumberg et al., Nucl. Acids Res., 1994, (22), 5767), für die Expression in Insektenzellen z.B. Baculovirus- Vektoren wie in EP-B1 -0127839 oder EP-B1 -0549721 offenbart, und für die Expression in Säugerzelleπ z.B. SV40-Vektoren, welche allgemein erhältlich sind.
Im Allgemeinen enthalten die Expressioπsvektoren auch für die Wirtszelle geeignete regulatorische Sequenzen, wie z.B. den trp-Promotor für die Expression in E. coli (s. z.B. EP-B1-0154133), den ADH-2-Promotor für die Expression in Hefen (Rüssel et al. (1983), J. Biol. Chem. 258, 2674), den Baculovirus-Polyhedrin-Promotor für die Expression in Insektenzellen (s. z.B. EP-B1 -0127839) oder den frühen SV40- Promotor oder LTR-Promotoren z.B. von MMTV (Mouse Mammary Tumour Virus; Lee et al. (1981 ) Nature, 214, 228).
Die Reinigung des von den Wirtszellen produzierten Enzyms kann nach herkömmlichen Reiniguπgsmethoden wie Fällung, lonenaustausch-
Chromatographie, Affinitäts-Chromatographie, Gelfiltration, HPLC Reverse Phase Chromatographie usw. erfolgen. Durch Modifikation der in den Wirtszellen exprimierten, für das erfindungsgemäße - Polypeptid codierenden DNA läßt sich in der Wirtszelle ein Polypeptid herstellen, welches aufgrund bestimmter Eigenschaften leichter aus dem Kulturmedium isoliert werden kann. So besteht die Möglichkeit, das zu exprimierende Protein als Fusionsprotein mit einer weiteren Polypeptidsequenz zu exprimieren, deren spezifische Bindungseigenschaften die Isolierung des Fusionsproteins über Affinitätschromatographie ermöglichen (z.B. Hopp et al. (1988), Bio/Technology, 6, 1204-1210; Sassenfeld (1990), Trends Biotechnol., 8, 88-93).
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher eine Nukleinsäure kodierend für einen m3G-Cap-speifιschen Kernimportrezeptorprotein mit einer Nukleinsäuresequenz gemäß Figur 2 oder eine funktionelle Variante davon, und Teile davon mit mindestens 8 Nukleotiden, vorzugsweise mit mindestens 15 oder 20 Nukleotiden, insbesondere mit mindestens 100 Nukleotiden, vor allem mit mindestens 300 Nukleotiden (nachfolgend „erfinduπgsgemäße Nukleinsäure" genannt).
Die vollständige Nukleinsäure kodiert für ein Protein mit 360 Aminosäuren und einer molekularen Masse von 45 kDa. Die Expression der Nukleinsäure in E. coli führt zu einem Protein, welches ähnliche enzymatische Aktivitäten aufweist, wie die eines humanen m3G-Cap-spezifischeπ Kernimportrezeptors.
Weitere Experimente gemäß der vorliegenden Erfindung bestätigten, daß es sich bei der Nukleinsäure um eine Nukleinsäure handelt, die für ein humanes Snurportin 1 kodiert.
In einer bevorzugten Ausführuπgsform ist die erfindungsgemäße Nukleinsäure eine DNA oder RNA, vorzugsweise eine doppelsträngige DNA, und insbesondere eine DNA mit einer Nukleinsäuresequenz gemäß SEQ ID No. 2. Unter dem Begriff „funktionelle Variante" versteht man gemäß der vorliegenden Erfindung eine Nukleinsäure, die funktioneil mit dem humanen m3G-Cap- spezifischen Kemimportrezeptor verwandt ist und insbesondere humanen Ursprungs ist. Beispiele verwandter Nukleinsäuren sind bespielsweise Nukleinsäuren aus unterschiedlichen humanen Zellen bzw. Geweben oder allelische Varianten. Auch umfaßt die vorliegende Erfindung Varianten von Nukleinsäuren, die von verschiedenen menschlichen Individuen stammen können.
Im weiteren Sinne versteht man unter dem Begriff „Varianten" gemäß der vorliegenden Erfindung Nukleinsäuren, die eine Homologie, insbesondere eine Sequenzidentität von ca. 60%, vorzugsweise von ca. 75%, insbesondere von ca. 90% und vor allem von ca. 95% aufweisen.
Die Teile der erfindungsgemäßen Nukleinsäure können beispielsweise zur Herstellung einzelner Epitope, als Sonden zur Identifizierung weiterer funktioneller Varianten oder als Antisense-Nukleinsäuren verwendet werden. Beispielsweise eignet sich eine Nukleinsäure aus mindestens ca. 8 Nukleotiden als Antisense- Nukleinsäure, eine Nukleinsäure aus mindestens ca. 15 Nukleotiden als Primer beim PCR-Verfahren, eine Nukleinsäure aus mindestens ca. 20 Nukleotiden für die Identifizierung weiterer Varianten und eine Nukleinsäure aus mindestens ca. 100 Nukleotiden als Sonde.
In einer weiteren bevorzugten Ausführungsform enthält die erfiπdungsgemäße
Nukleinsäure eine oder mehrere nicht-kodierende Sequenzen. Die nichtkodierenden Sequenzen sind beispielsweise Intronsequenzen oder regulatorische Sequenzen, wie Promotor- oder Enhancer-Sequenzen, zur kontrollierten Expression des m3G- Cap spezifischen Kernimportrezeptors.
In einer weiteren Ausführuπgsform ist die erfindungsgemäße Nukleinsäure daher in einem Vektor, vorzugsweise in einem Expressionsvektor oder gentherapeutisch wirksamen Vektor enthalten.
Beispiele von gentherapeutisch wirksamen Vektoren sind Virusvektoren, vorzugsweise Adenovirusvektoren, insbesondere replikationsdefiziente Adenovirusvektoreπ, oder Adenoassoziierte Virusvektoren, z.B. ein Adenoassoziierter Virusvektor, der ausschließlich aus zwei insertierten terminalen Wiederholungssequenzen (ITR) besteht.
Geeignete Adenovirusvektoren sind beispielsweise in McGrory, W.J. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in „Eukaryotic Viral Vectors" (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S. et al. (1986) EMBO J.. 5, 2377 oder WO95/00655 beschrieben.
Geeignete Adeno-assoziierte Virusvektoren sind beispielsweise in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO95/23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95/23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 oder Kotin, R.M. (1994) Human Gene Therapy 5, 793 beschrieben.
Gentherapeutisch wirksame Vektoren lassen sich auch dadurch erhalten, daß man die erfindungsgemäße Nukleinsäure mit Liposomen komplexiert. Hierzu eignen sich
Lipidmischungen wie bei Feigner, P.L. et al. (1987) Proc. Natl. Acad. Sei, USA 84,
7413; Behr, J.P. et al. (1989) Proc. Natl. Acad. Sei. USA 86, 6982; Feigner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 oder Gao, X. & Huang, L. (1991 ) Biochim.
Biophys. Acta 1189, 195 beschrieben. Bei der Herstellung der Liposomen wird die DNA ionisch auf der Oberfläche der Liposomen gebunden, und zwar in einem solchen Verhältnis, daß eine positive Nettoladung verbleibt und die DNA vollständig von den Liposomen komplexiert wird.
Die erfindungsgemäße Nukleinsäure kann beispielsweise chemisch anhand der in SEQ ID No. 2 offenbarten Sequenz oder anhand der SEQ ID No. 1 offenbarten Peptidsequenz unter Heranziehen des genetischen Codes z.B. nach der Phosphotriester-Methode synthetisiert werden (s. z.B. Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4). Eine weitere Möglichkeit, die erfinduπgsgemäße Nukleinsäure in die Hand zu bekommen, ist die Isolierung aus einer geeigneten Geπbank, beispielsweise aus einer humanen Genbaπk, anhand einer geeigneten Sonde (s. z.B. Sambrook, J. et al. (1989) Molecular Cloπing. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York). Als Sonde eignen sich beispielsweise einzelsträngige DNA-Fragmente mit einer Länge von ca. 100 bis 1000 Nucleotiden, vorzugsweise mit einer Länge von ca. 200 bis 500 Nucleotiden,' insbesondere mit einer Länge von ca. 300 bis 400 Nucleotiden, deren Sequenz aus der Nukleinsäuresequenz gemäß SEQ ID No. 2 abgeleitet werden kann.
Ein anderer Gegenstand der vorliegenden Erfindung bezieht sich auch auf Antikörper, die mit dem erfindungsgemäßen Polypeptid spezifisch reagieren, wobei die oben genannten Teile des Polypeptids entweder selbst immunogen sind oder durch Koppelung an geeignete Träger, wie z.B. bovines Serumalbumin, immunogen gemacht bzw. in ihrer Immunogenität gesteigert werden können.
Die Antikörper sind entweder polyklonal oder monoklonal. Die Herstellung, die auch einen Gegenstand der vorliegenden Erfindung darstellt, erfolgt beispielsweise nach allgemein bekannten Methoden durch Immunisieren eines Säugetiers, beispielsweise eines Kaninchens, mit dem erfindungsgemäßen Polypeptid oder den genannten Teilen davon, gegebenenfalls in Anwesenheit von z.B. Freuπd's Adjuvant und/oder Aluminiumhydroxidgelen (s. z.B. Diamond, B.A. et al. (1981 ) The New England Journal of Medicine, 1344). Die im Tier aufgrund einer immunologischen Reaktion entstandenen polyklonalen Antikörper lassen sich anschließend nach allgemein bekannten Methoden leicht aus dem Blut isolieren und z.B. über Säulenchromatographie reinigen. Bevorzugt wird eine Affinitätsreinigung der Antikörper, bei der beispielsweise das C-terminale DAN-Fragment an eine NHS- aktivierte HiTrap-Säule gekoppelt wurde.
Monoklonale Antikörper können beispielsweise nach der bekannten Methode von Winter & Milsteiπ (Winter, G. & Milstein, C. (1991 ) Nature, 349, 293) hergestellt werden.
Ein weiterer Gegenstand der vorliegenden Erfindung ist ebenfalls ein Arzneimittel, das eine erfindungsgemäße Nukleinsäure oder ein erfiπdungsgemäßes Polypeptid und gegebenenfalls geeignete Zusatz- oder Hilfsstoffe enthält und ein Verfahren zur Herstellung eines Arzneimittels zur Behandlung von Krebs, Autoimmuπkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und/oder Diabetis und/oder zur Beeinflussung des Zellmetabolismus, insbesondere bei der Immunsuppression, vor allem bei Transplantationen, bei dem eine erfindungsgemäße Nukleinsäure, beispielsweise eine sogenannte Antisense- Nukleinsäure, oder ein erfindungsgemäßes Polypeptid mit pharmazeutisch annehmbaren Zusatz- und/oder Hilfsstoffen formuliert wird.
Für die gentherapeutische Anwendung beim Menschen ist vor allem ein Arzneimittel geeignet, das die erfinduπgsgemäße Nukleinsäure in nackter Form oder in Form eines der oben beschriebenen gentherapeutisch wirksamen Vektoren oder in mit Liposomen komplexierter Form enthält.
Als geeignete Zusatz- und/oder Hilfsstoffe eignen sich z.B. eine physiologische Kochsalzlösung, Stabilisatoren, Proteinaseinhibitoren, Nukleaseinhibitoreπ etc.
Ein weiterer Gegenstand der vorliegenden Erfindung ist auch ein Diagnostikum enthaltend eine erfindungsgemäße Nukleinsäure, ein erfinduπgsgemäßes Polypeptid oder erfindungsgemäße Antikörper und gegebenenfalls geeignete
Zusatz- und/oder Hilfsstoffe und ein Verfahren zur Herstellung eines Diagπostikums zur Diagnose von Krebs, Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und/oder Diabetis und/oder zur Analyse des Zellmetabolismus, insbesondere des Immunstatus, vor allem bei Transplantationen, bei dem eine erfindungsgemäße Nukleinsäure, ein erfinduπgsgemäßes Polypeptid oder erfindungsgemäße Antikörper mit geeigneten Zusatz- und/oder Hilfsstoffen versetzt werden.
Beispielsweise können gemäß der vorliegenden Erfindung anhand der erfindungsgemäßen Nukleinsäure ein Diagnostikum auf der Basis der Polymerasekettenreaktion (PCR-Diagnostik, z.B. gemäß EP-0200362) oder eines Northern Blots hergestellt werden. Diese Tests beruhen auf der spezifischen Hybridisierung der erfindungsgemäßen Nukleinsäure mit dem komplementären Gegenstrang üblicherweise der entsprechenden mRNA. Die erfinduπgsgemäße Nukleinsäure kann hierbei auch modifiziert sein, wie z.B. in EP0063879 beschrieben. Vorzugsweise wird ein erfindungsgemäßes DNA-Fragment mittels geeigneter Reagenzien, z.B. radioaktiv mit -P32-dATP oder nicht-radioaktiv mit Biotin, nach allgemein bekannten Methoden markiert und mit isolierter RNA, die vorzugsweise an geeignete Membranen aus z.B. Zellulose oder Nylon gebunden wurde, inkubiert. Zudem ist es vorteilhaft, die isolierte RNA vor der Hybridisierung und Bindung an eine Membran der Größe nach, z.B. mittels Agarose- Gelelektrophorese, aufzutrennen. Bei gleicher Menge an untersuchter RNA aus jeder Gewebeprobe kann somit die Menge an mRNA bestimmt werden, die spezifisch durch die Sonde markiert wurde.
Ein weiteres Diagnostikum enthält das erfindungsgemäße Polypeptid bzw. die oben näher beschriebenen immuπogenen Teile davon. Das Polypeptid bzw. Teile davon, die vorzugsweise an eine Festphase, z.B. aus Nitrocellulose oder Nylon, gebunden sind, können beispielsweise mit der zu untersuchenden Körperflüssigkeit z. B. Blut, in vitro in Berührung gebracht werden, um so beispielsweise mit
Autoimmunantikörper reagieren zu können. Der Antikörper-Peptid-Komplex kann anschließend beispielsweise anhand markierter Antihuman-IgG- oder Antihuman- IgM-Antikörper nachgewiesen werden. Bei der Markierung handelt es sich beispielsweise um ein Enzym, wie Peroxidase, das eine Farbreaktion katalysiert. Die Anwesenheit und die Menge an anwesenden Autoimmunantikörpem kann somit über die Farbreaktion leicht und schnell nachgewiesen werden.
Ein anderes Diagnostikum enthält die erfindungsgemäßen Antikörper selbst. Mit Hilfe dieser Antikörper kann beispielsweise eine Gewebeprobe des Menschen leicht und schnell dahingehend untersucht werden, ob das betreffende Polypeptid vorhanden ist. In diesem Fall sind die erfindungsgemäßen Antikörper beispielsweise mit einem Enzym, wie oben bereits beschrieben, markiert. Der spezifische Antikörper-Peptid-Komplex kann dadurch leicht und ebenso schnell über eine enzymatische Farbreaktion nachgewiesen werden.
Ein anderer Gegenstand der vorliegenden Erfindung betrifft auch einen Test zur Identifizierung funktioneller Interaktoren, wie z.B. Inhibitoren oder Stimulatoren, enthaltend eine erfindungsgemäße Nukleinsäure, ein erfindungsgemäßes Polypeptid oder die erfindungsgemäßen Antikörper und gegebenenfalls geeignete Zusatz- und/oder Hilfsstoffe.
Ein geeigneter Test zur Identifizierung funktioneller Interaktoren ist z. B. das sogenannte „Two-Hybrid System" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286). Bei diesem Test wird eine Zelle, beispielsweise eine Hefezelle, mit einem oder mehreren Expressionsvektoren transformiert oder transfiziert, die ein Fusioπsprotein exprimieren, daß das erfindungsgemäße Polypeptid und eine DNA- Bindedomäne eines bekannten Proteins, beispielsweise von Gal4 oder LexA aus E. coli, enthält und/oder ein Fusioπsproteiπ exprimieren, das ein unbekanntes Polypeptid und eine Transkriptions-Aktivierungsdomäπe, beispielsweise von Gal4, Herpesvirus VP16 oder B42, enthält. Zudem enthält die Zelle ein Reportergen, beispielsweise das LacZ-Gen aus E. coli, „Green Fluorescence Protein" oder die Aminosäure-Biosynthesegene der Hefe His3 oder Leu2, das durch regulatorische Sequenzen, wie z.B. den lexA-Promotor/Operator oder durch eine sogenannte „Upstream Activation Sequeπce" (UAS) der Hefe kontrolliert wird. Das unbekannte Polypeptid wird beispielsweise durch ein DNA-Fragment kodiert, das aus einer Genbank, beispielsweise aus einer humanen Genbank, stammt. Üblicherweise wird gleich eine cDNA-Genbank mit Hilfe der beschriebenen Expressionsvektoren in Hefe hergestellt, so daß der Test unmittelbar danach durchgeführt werden kann.
Beispielsweise wird in einem Hefe-Expressionsvektor die erfindungsgemäße Nukleinsäure in funktioneller Einheit an die Nukleinsäure kodierend für die lexA- DNA-Bindedomäne kloniert, so daß ein Fusionsprotein aus dem erfinduπgsgemäßen Polypeptid und der LexA-DNA-Bindedomäne in der transformierten Hefe exprimiert wird. In einem anderen Hefe-Expressioπsvektor werden cDNA-Fragmente aus einer cDNA-Genbank in funktioneller Einheit an die Nukleinsäure kodierend für die Gal4-Transkriptions-Aktivierungsdomäne kloniert'so daß ein Fusionsprotein aus einem unbekannten Polypeptid und der Gal4- Transkriptions-Aktivierungsdomäne in der transformierten Hefe exprimiert wird. Die mit beiden Expressionsvektoren transformierte Hefe, die beispielsweise Leu2- ist, enthält zusätzlich eine Nukleinsäure, die für Leu2 kodiert, und durch den LexA- Promotor/Operator kontrolliert wird. Im Falle einer funktioneilen Interaktion zwischen dem erfiπdungsgemäßen Polypeptid und dem unbekannten Polypeptid bindet die Gal4-Traπskriptions-Aktivierungsdomäne über die LexA-DNA-Biπdedomäne an den LexA-Promotor/Operator, wodurch dieser aktiviert und das Leu2-Gen exprimiert wird. Dies hat zur Folge, daß die Leu2- Hefe auf Minimalmedium, das kein Leucin enthält, wachsen kann.
Bei Verwendung des LacZ- bzw. „Green Fluoresceπce Protein"-Reportergens anstelle eines Aminosäure-Biosynthesegens kann die Aktivierung der Transkription dadurch nachgewiesen werden, daß sich blau- bzw. grün-fluoreszierende Kolonien bilden. Die Blau- bzw. Fluoreszenzfärbung läßt sich aber auch leicht im Spectrophotometer z.B. bei 585 nM im Falle einer Blaufärbung quantifizieren.
Auf diese Weise können Expressionsgenbanken leicht und schnell auf Polypeptide durchsucht werden, die mit dem erfindungsgemäßen Polypeptid interagieren. Anschließend können die gefundenen neuen Polypeptide isoliert und weiter charakterisiert werden.
Eine weitere Anwendungsmöglichkeit des „Two-Hybrid-Systems" ist die
Beeinflussung der Interaktion zwischen dem erfindungsgemäßen Polypeptid und einem bekannten oder unbekannten Polypeptid durch weitere Substanzen, wie z. B. chemische Verbindungen. Auf diese Weise lassen sich auch leicht neue wertvolle chemisch synthetisierbare Wirkstoffe auffinden, die als Therapeutikum eingesetzt werden können. Die vorliegende Erfindung ist daher nicht nur auf ein Verfahren zum Auffinden von polypeptidartigen Interaktoren bestimmt, sondern erstreckt sich auch auf ein Verfahren zum Auffinden von Substanzen, die mit dem oben beschriebenen Protein-Protein-Komplex interagieren können. Derartige peptidartige, wie auch chemische Interaktoren werden daher im Sinne der vorliegenden Erfindungs als - funktionelle Interaktoren bezeichnet, die eine inhibierende oder eine stimulierende Wirkung haben können.
Im folgenden werden Experimente und Figuren erläutert, die das erfinduπgsgemäße Polypeptid - Snurportin 1 - näher charakterisieren (siehe auch Beispiele).
Reinigung des erfindungsgemäßen Polypeptids, ein 45 kD m3G-Cap-biπdeπden Proteins, genannt Snurportin 1 und Nachweis seiner Aktivität :
Für die Reinigung des Proteins wurde ein zytosolischer S100 Extrakt aus HeLa- Zellen zunächst über eine CM-Sepharose-Säule gereinigt und der Snurportin 1 enthaltende Durchlauf mittels einer Q-Sepharose Chromatographie aufgetrennt. Die Snurportin 1 enthaltenden Fraktionen (getestet durch den UV-Crosslinkiπg Assay) wurden anschließend auf eine m3G-Cap Affinitätssäule geladen. Hierfür wurde biotinyliertes m3G-Cap-Oligo (m3GpppAmpUmpA-/CH2)6-Biotin) an eine
Streptavidin-Agarose-Säule gebunden. Die gebundenen Proteine wurden mit steigenden NaCI-Konzentrationen von der Säule eluiert und mittels SDS-PAGE analysiert. Ein sauberes Protein, das erfindungsgemäße Polypeptid, mit einem apparenten Molekulargewicht von 45 kD wurde mit einer Salzkonzentration von 0,6 bis 1 M NaCI von der Säule eluiert (Figur 2A, Spuren 9-11 ). Das gereinigte 45 kD Protein konnte effizient mit radioaktiv markiertem m3G-Cap-Oligo mit Hilfe von UV- Licht quervenetzt werden (Figur 2B). Diese Experimente zeigen, daß das erfindungsgemäße Polypeptid, das aus HeLa S100 Extrakten gereinigt wurde, notwendig und ausreichend für die Formierung des 45 kD UV cross-link ist. Dies bedeutet, daß das 45 kD Protein die m3G-Cap bindende Aktivität trägt.
Snurportin 1 enthält eine IBB Domäne, aber verfügt nicht über die bekannte armadillo-Wiederholungen : Um das Protein zu klonieren, wurden durch Microsequeπzierung Petidsequenzen von dem gereinigten Protein generiert. Alle fünf generierten Peptidsequenzen konnten in der GenBank in einem EST (expressed sequence tag) gefunden werden (Figur 6A). Diese Snurportin 1 codierende cDNA kodiert für 360 Aminosäuren (AS) mit einem vorausgesagten Molekulargewicht von 45 kD (Figur 1A). Eine
Datenbanksuche mit dem humanen Snurportin 1 zeigte überraschenderweise eine hohe Homologie im N-terminalen Bereich (AS 27 bis 65, Figur 6B) zu der IBB Domäne vom Importiπ (31 % Identität, 62% Ähnlichkeit mit hSRPI , ähnliche Übereinstimmungen wurden mit hRchl , xlmpα und ySRP1 beobachtet, Figur 6B). Darüber hinaus sind AS-Bereiche in der IBB-Domäne von Snurportin 1 sehr homolog zu IBB Domänensequenzeπ von anderen Mitgliedern der Importin Familie (Görlich et al., 1996; supra; Weis et al., 1996; supra hervorgehoben durch schwarze Punkte in Figur 6B). Im Gegensatz zur ausgedehnten N-termiπalen IBB- Domäne ist der C-terminale Teil von Snurportin 1 strukturell unterschiedlich von Importin α (z.B. weniger als 10% Sequenzidentität mit dem C-Terminus von hSRPI ). Insbesondere konnte keine signifikante Sequenzhomologie zwischen Snurportin 1 und der „armadillo"-Wiederholungsdomäπe von Importin α detektiert werden (Figur 6B). Dies bedeutet, daß keine evolutionäre Konservierung der C-terminalen Regionen dieser beiden Proteine besteht.
Snurportin 1 weist überraschenderweise eine Gesamtsequenzhomologie mit verschiedenen ORF (open reading frames) von Maus ESTs (z.B. AA571557, mehr als 90% Identität), einem Drosophila EST (AA541081 , mehr als 40% Identität) und mit einem C. elegans Protein unbekannter Funktion (ACC AF024493) aufweist. Die Homologie zwischen Snurportin 1 und dem C. elegans Protein ist nicht auf die N- terminale IBB-Domäne begrenzt (43% Identität, 59% Ähnlichkeit; siehe Figur 6A). Es zeigt sich daher, daß das Protein das funktionelle Homolog zu Snurportin 1 darstellt. Die Identifizierung des C. elegans Homologs zeigt, daß Snurportin 1 evolutionär konserviert wurde und daher eine essentielle spezifische Funktion als Kernimportrezeptorprotein inne hat.
Snurportin 1 bindet Importin ß in vitro in Abhängigkeit von der IBB-Domäne : Die Anwesenheit einer IBB-Domäne am N-Terminus von Snurportin 1 bewirkt, daß der Kerntransport von m3G-Cap haltigen Molekülen mediiert wird. Der Nachweis erfolgt mittels einer in-vitro Bindung des erfindungsgemäßen Polypeptids an Importin ß.
Histidine-Fusionsproteine von Gesamt-Snurportin oder N-terminalen
Deletionsmutanten des erfindungsgemäßen Polypeptids (Δ1-65 Snurportin 1 bewirkt eine fehlende IBB-Domäne gemäß Fig. 3B) und ebenso Gesamt hSRPIα und Xenopus Importin α wurden mit in vitro translatiertem 35S-markiertem Importin ß inkubiert. Die Protein-Komplexe wurden anschließend mit Ni-NTA-Agarosebeads präzipitiert und die Bindung von Importin ß wurde mittels SDS-PAGE mit anschließender Autoradiographie analysiert. Importin ß copräzipitierte mit Gesamt- Snurportinl , hSRPI α und Importin α, jedoch nicht mit Δ1 -65 Snurportin 1 (Figur 3A, Spuren 1-4). Snurportin 1 bindet Importiπ ß nachweislich in vitro und die N-terminale IBB-Domäne ist für diese Bindung notwendig.
Die C-terminale Domäne von Snurportin 1 besitzt eine m3G-Cap-bindende Aktivität :
Importin α benötigt seine C-terminale Domäne, um die NLS von karyophilen Proteinen zu binden (Codes et al. (1994), Proc. Natl. Acad. Sei. USA, 91 , 7633). Um zu untersuchen, ob die C-terminale Domäne von Snurportin 1 analog in die Bindung des m3G-Cap-NLS von snRNPs involviert ist, wurden Querverπetzungsstudien mit dem m3G-Cap-Oligo und Deletionsmutanten von Snurportin 1 durchgeführt. Hierzu konnte gereinigtes rekombinantes Snurportin 1 , dem die N-terminalen Aminosäuren 1-65 (einschließlich der IBB-Domäne) fehlen, mit dem radioaktiv markierten m3G- Cap-Oligo genauso effizient quervernetzt werden, wie das rekombinante Gesamt- Snurportin 1 (Figur 3B, vergleiche Spuren 6 und 7). Eine Deletioπ der C-terminalen 32 AS konnte die Quervernetzung nicht unterbinden. Die Deletioπ von zusätzliche 120 AS vom C-terminalen Ende konnte dagegen die Bindung an das m3G-Cap-Oligo vollständig unterbinden. Deshalb kann davon ausgegangen werden, daß der mittlere Teil der C-terminaien Region von Snurportin 1 für die Bindung an das m3G- Cap verantwortlich ist. Snurportin 1 stimuliert den Kernimport von U snRNP in Xenopus Oozyten in Abhängigkeit der IBB-Domäne :
Die Rolle von Snurportin 1 beim Kerntransport von U snRNPs wurde durch Mikroinjection in Xenopus laevis Oozyten untersucht. Zunächst wurde m3G-Cap modifiziertes HeLa U1 und U5 snRNA zusammen mit ApppG-Cap modifizierter U6 snRNA in das Zytoplasma von Oozyten mikroinjiziert. Nach einer Stunde erhielten die Oozyten eine zweite Injektion mit gereinigtem Snurportin 1 oder Puffer. Der Kerntransport wurde 3, 5 und 8 Stunden später untersucht (Figur 5). U6 snRNA wurde als Kontrolle injiziert, da Untersuchungen gezeigt hatten, daß diese RNA über den Weg der karyophilen Proteine in den Kern transportiert wird (Vgl. Michaud und Goldfarb (1991 ), J. Cell. Biol., 112, 215 und (1992), J. Cell. Biol. 116, 851). Die exogene Zugabe von Snurportin 1 stimulierte den Kernimport von U1 und U5 snRNA signifikant um ca. 50-70%, während kein Effekt auf die ApppG-Cap modifizierte U6 snRNA beobachtet werden konnte (Figur 7A, vergleiche Spuren 4- 12 oberer Teil mit den Spuren 13-21 im mittleren Teil und für die Quantifizierung Figur 7B). Die gleiche Stimulation des Kerπimports konnte mit aus HeLa-Zellen affinitätsgereinigtem exogen zugegebenem Snurportin 1 beobachtet werden. Zusammengefaßt zeigen diese Ergebnisse, daß Snurportin 1 ein neuartiger snRNP- spezifischer Kernimportfaktor ist.
Importiπ α benötigt eine intakte IBB-Domäne für seine Funktion (Görlich et al., 1996; supra, Weis et al., 1996; supra). Um die Rolle der IBB-Domäne von Snurportin 1 beim Kerntransport von snRNPs zu untersuchen, wurde ebenfalls die N-terminale Deletionsmutantate von Snurportin 1 (Δ1-65 Snurportin 1 ) zusammen mit m3G-Cap modifiziertem U1 und U5 snRNAs in Oozyten mikroinjiziert. Dieser Mutante fehlt die IBB-Domäne, jedoch verfügt sie noch über die volle m3G-Cap-Bindungsfähigkeit (siehe Figur 3B, Spur 7). Δ1-65 Snurportin 1 konnte nicht nur den Kernimport von snRNPs nicht beschleunigen, sondern inhibierte sogar stark den Import der m3G- Cap-modifizierten U1 und U5 snRNAs (Fig. 7A, Spuren 22-30 ). Der ungehinderte Transport von ApppG-Cap modifizierter U6 snRNA (Figur 4A, Spuren 22-30) schließt einen unspezifischen Effekt von Δ1-65 Snurportin 1 auf den Kernimport aus. Dies zeigt, daß der U1 und U5 snRNA-lmport aufgrund einer Kompetition zwischen Δ1-65 Snurportin 1 und dem endogenen Xenopus laevis Snurportin 1 für das m3G-Cap bedingt ist. Diese Ergebnisse begründen die essentielle Rolle der ' IBB-Domäne für die Funktion von Snurportin 1. Zugleich unterstreicht die Hemmung des Kernimports von U1 und U5 snRNAs durch die Δ1-65 Deletionsmutante von Snurportin 1 die entscheidende Rolle von Snurportin 1 beim m3G-Cap-abhängigen Kernimport in Xenopus Oozyten.
Snurportin 1 beschleunigt den Kernimport von U1 snRNPs in vitro in Digitonin- permeabilisierten Zellen stark :
Im Rahmen von „Kernimportassays" (siehe Beispiel, „in-vitro Transportsystem" nach Marshallsay und Lührmann (1994), EMBO J., 13, 222) wurden gereinigte HeLa U1 snRNP in Xenopus Oozyten injiziert. Als spezifische Kontrolle für den Kernimport wurde Δ5'U1 snRNP verwendet, bei dem durch DNA Oligonukleotid-iπduzierte Rnase H-vermittelte Hydrolyse 10 Nukleotide vom 5'-Terminus einschließlich des m3G-Cap entfernt wurden. Die Proteinanteile beider Formen von U1 snRNPs wurden durch Modifizierung mit dem Fluoreszensfarbstoff Cy3 (im folgenden U1 snRNP* bzw: Δ5'U1 snRNP*) markiert. SDS-PAGE und Glycerin-Gradienten- Zentrifugation bestätigen, daß die snRNP Partikel durch die Markierungsmethode in Ihrer Integrität nicht beeinflußt wurden und der Grad der Markierung bei beiden Formen vergleichbar ist.
Wie in Figur 5 gezeigt, wird intaktes U1 snRNP* wesentlich effizienter in
Anwesenheit von zytosolischem HeLa S100 Extrakt in den Kern transportiert als Δ1 - 65 U1 snRNP* In beiden Fällen war der Transport Energie- (Figur 5 C und D) und Temperatur-abhängig. Diese Ergebnisse stimmen mit der Annahme übereiπ, daß das endogene Snurportin 1 in HeLa-Zellzytosol signifikant zum Kernimport von U1 snRNPs beitragen sollte. Hierzu wurden Kompetitionsstudien mit unmarkierten U1 snRNPs oder m3GpppG-Cap Dinukleotid durchgeführt. In der Anwesenheit von einem 100-fachen Überschuß an unmarkiertem Δ5'U1 snRNP war der Kernimport von intaktem U1 snRNP* um ca 35-40% reduziert (vergleiche 8E mit 8A), während der Import von Δ5'U1 snRNP* vollständig inhibiert war (vergleiche 8F mit 8B). Dies bedeutet, daß exogene Δ5'U1 snRNP Partikel einen snRNP-lmportrezeptor titrierten der im HeLa-Zellzytosol limitiert vorliegt und unterschiedlich von Snurportin 1 ist (möglicherweise der Sm-Core NLS Bindungsrezeptor).
Da ein signifikanter Anteil der intakten U1 snRNPs weiterhin in der Anwesenheit von kompetitivem Δ5'U1 snRNP importiert wurde, ist der Import dieser Partikel hauptsächlich m3G-Cap-abhängig. Konsistent mit diesem Experiment konnte der Kernimport von U1 snRNP* durch einen Überschuß von intaktem unmarkiertem U1 snRNP (G in Fig. 5) oder durch die gleichzeitige Gabe von Δ5'U1 snRNP und synthetischem m3GpppG-Cap Dinukleotid zu ca. 90% inhibiert werden (H in Fig. 5).
Um einen direkten Nachweis zu führen, daß Snurportin 1 für den Kerntransport in somatischen Zellen verantwortlich ist, wurden in Anwesenheit von rekombinantem Snurportin 1 in vitro Importstudien durchgeführt. Die Zugabe von Snurportin 1 zu zytosolischem S100-Extrakt führte zu einem signifikanten Anstieg in der Akkumulation von U1 snRNP* im Kern (bis zu 180% in der Anwesenheit von 100 pM exogenem Snurportin 1 ; vergleiche I mit A in Fig. 5). Diese Stimulation ist strikt von einem m3G-Cap abhängig, da Δ5'U1 snRNP* nicht in der Aufnahme in den Kern beschleunigt wird (K in Fig. 5). Darüberhinaus verhinderte die Vorinkubation von Snurportin 1 mit einem Überschuß an -m3GpppG-Cap Dinukleotid die Stimulation des U1 snRNP-lmports durch Snurportin 1. Schließlich benötigt in Übereinstimmung mit den Ergebnissen aus den Studien mit Xenopus Oozyten die Stimulation des Kernimports durch exogenes Snurportin 1 die Anwesenheit seiner N-terminalen IBB- Domäne im Snurportin 1. Die Zugabe von 100 pM des Δ1-65 Snurportin 1 zu zytosolischem S100-Extrakt aus HeLa-Zellen beschleunigte nicht sondern inhibierte eher den U1 snRNP Import um ca. 30-40% (vergleiche L und A in Fig. 5). Wie erwartet inhibierte Δ1-65 Snurportin 1 nicht den Import von Δ5'U1 snRNP* (vergleiche M mit K und B in Fig. 5). Zusammengefaßt belegen diese Daten, daß in HeLa-Zellen zumindest zwei verschiedene Importrezeptoreπ den Kernimport von U1 snRNP mediieren. Diese sind Snurportin 1 und wahrscheinlich der Sm-Core-NLS Rezeptor. Außerdem trägt Snurportin 1 signifikant zu der Akkumulierung von IM snRNP im Kern somatischer Zellen bei. Das erfindungsgemäße Polypeptid kann in allen Zellen verwendet werden, vorzugsweise jedoch in Säugetierzelleπ und menschlichen Zeilen. Prinzipiell ist es ausführbar für alle Moleküle, die eine m3G-Cap-Struktur enthalten.
In einer besonderen Ausführungsform wird das erfindungsgemäße Polypeptid an der beschriebenen IBB-Domäne spezifisch deletiert. Hierzu werden die Aminosäuren 1 -65 am erfindungsgemäßen Polypeptid - im folgenden Δ 1 -65 Snurportin 1 bezeichnet - deletiert.
Dieses Δ 1-65 Snurportin 1 kann vorzugsweise unter Verwendung eines beschriebenen gentherapeutischeπ Vektors nach dem für den Fachmann bekannten Methoden in der Zielzelle, vorzugsweise Säugetierzellen und menschliche Zellen, überexprimiert werden. Dies geschieht zur Verhinderung des Kermimports von m3G- Cap haltigen Molekülen.
Die Herstellung des erfindungsgemäßen Deletionspolypeptid erfolgt vorzugsweise als rekombinantes Protein unter Verwendung bekannter rekombinanter Methoden, vorzugsweise aus der Nukleinsäure gemäß SEQ ID No. 3.
Daher ist ein weiterer Gegenstand der Erfindung eine Nukleinsäure oder eine funktionelle Variante (wie definiert für Snurportin 1 ) gemäß SEQ ID No. 3 erhältlich aus der Nukleinsäure gemäß SEQ ID No. 2 codierend für Δ 1-65 Snurportin 1. Die SEQ ID No. 3 zeigt die notwendige Sequenz unter Einbringung eines Startcodons ATG nach bekannten rekombinanten Methoden, wodurch sie entsprechend der Lehre zur beschriebenen Nukleinsäure (SEQ ID No. 2) exprimiert und den weiteren beschriebenen Anwendungen, insbesondere als Arzneimttel und Diagnostika, zugänglich ist. Besonders bevorzugt ist die Verwendung der Nukleinsäure gemäß SEQ ID No. 3 im Rahmen eines gentherapeutischen Vektors zur gewünschten Überexpression des Δ 1-65 Snurportin 1 in Zellen.
In Figur 4 ist die Aminosäuresequenz von Δ 1-65 Snurportin 1 gegeben, welches als Expressionsprodukt erhalten werden kann nach den bereits beschrieben Methoden. Ein weiterer Gegenstand der Erfindung ist die Möglichkeit der Erkennung, Identifizierung, Quantifizierung, Isolierung und Reinigung von m3G-Cap-haltigen • Molekülen in Gegenwart von Snurportin 1 oder Δ 1-65 Snurportin 1 im Rahmen von in vitro Experimenten.
Die nachfolgenden Beispiele dienen zur näheren Erläuterungen der Erfindung, ohne dieselbe auf in den Beispielen beschriebenen Produkte und Ausführungsformen einzuschränken.
Beispiele
Material und Methoden
Alle Enzyme für DNA-Manipulationen wurden von New England Biolabs gekauft. RNA Polymerase und Rnasin wurden von Promega bezogen. Pfu Polymerase wurde bei Stratagene und RNaseH wurde von Boehrimnger Mannheim bezogen,. Die Cap- Homologe ApppG und m7GpppG wurde bei Pharmacia gekauft. M3GpppG wurde wie beschrieben synthetisiert und gereinigt (Iwase et al. (1989), Nucleic Acids Res., 17, 8979) Radioaktiv-markierte Triphosphatnukleotide und [32P]pCp wurden von Amersham bezogen. Sequenzierungen wurden mit einem automatischen Sequenzierer unter Benutzung von Taq-Polymerase und doppelsträngigen Templaten (PRISM Ready Reaction DyeDeoxy Terminator cycle sequencing kit) von Applied Biosystems durchgeführt.
Beispiel 1 : Präparation von snRNPs und snRNAs
Die Herstellung von Kernextrakten aus HeLa-Zellen (Computer Cell Culture, Moπs, Belgium) ist bei Dignam (Dignam et al. (1983), nucleic Acids Res., 11 , 1475) beschrieben. Native U1 und U5 snRNPs wurden durch Affinitätschromatographie mit dem moπoklonalen Antikörper (mAb) H20, der kovalent an CnBr-aktivierte
Sepharose 4B (Bochnig et al. (1987), Eur. J. Biochem, 168, 461 ) gebunden wurde und durch Chromatographie an MonoQ (Bach et al. (1987), Methods Enzymo , 181 , 232) gewonnen. Für Kompetitionsstudien und Verdaus mit Rnase H wurden U1 snRNPs auf 12 μg/ml durch Zentrifugation bei 160.000 x g (2,5 h, 4°C) aufkonzentriert. Um die 5'-Enden von U1 snRNA zu entfernen, wurden U1 snRNPs (60 μg) mkit 10 U RNase H und einem DNA-Oliginukleotid (5'-CAGGTAAGTAT-3' 1 ,4 μg/μl) in einem Volumen von 50 μl inkubiert (Lamond und Sproat (1994), RNA processing: A Practical Approach, IRL Press, Oxford UK, 103 ff.). Verbleibende m3G-Cap-tragende U1 snRNPs wurden aus dem Reaktionsansatz durch
Immunpräzipitation mit 25 μl H20-mAb an Sepharose beads gekoppelt in einem Endvolumen von 100 μl PBS (pH 8) entfernt. Nach zwei Stunden Inkubation bei 4°C wurden die Proben kurz zentrifugiert und die Δ5'U1 snRNPs im Überstand gewonnen und mittels einer Amicon Uitrafiltrationzelle (Micrcon-100 Konzeπtrator) auf eine Konzentration von 30 μg/ml eingeengt. Die Reinheit und Intaktheit der Partikel wurde durch SDS-PAGE und Sedimentatioπsanalyse auf einem Glyceringradienten (5-20%, PBS, pH8) in einem Beckmann TLS-55-Rotor überprüft (Marshallsay und Lührmann, 1994, supra). U1 , Δ5'U1 und U5 snRNA wurden isoliert wie bei Sumpter (Sumpter et al. (1992), Mol. Biol. Rep., 16, 229) beschrieben.
Beispiel 2 :UV-Quervemetzungsstudien
Ein m3G-Cap Oligonukleotid (m3GpppAmpUmpA), das identisch zum 5'-Ende der HeLa U1 snRNA ist, wurde synthetisiert nach Sekine (Sekine et al.(1994) Nucleic Acids Symp. Ser., 31 , 61 ; Sekine et al.(1996), J. Org. Chem., 61 , 4412). Präparative [32P] pCp Markierung der m3G-Cap-Oligos (5 μg) wurde wie bei Fischer (Fischer et al. (1993), EMBO J., 12, 573) beschrieben durchgeführt, mit der Ausnahme, daß 250 μCi [32P] pCp verwendet wurden. Nach einer Phenolextraktion und Ethanolpräzipitation wurden die radioaktiv-markierten m3G-Cap-Oligos auf einem 20%-igen Polyacrylamidgel mit 7,5 M Harnstoff gereinigt. Für die Identifizierung der m3G-Cap-bindenden Proteine in zytosolischen HeLa-Zellextrakteπ durch UV- Quervernetzung wurde ein pM [32P] pCp 3 '-Ende-markierte m3G-Cap-Oligos (2,5 x 106 cpm/pM) für 10 min auf Eis mit entweder 25 μg S100 zytosolischem Extrakt oder 1 ,5 μg gereinigtem HeLa- oder rekombinantem Snurportin 1 in einem Volumen von 10 μl inkubiert. Die Reaktionsmischung wurde anschließend bei 254 πm mit einer Sylvania G8T5 UV-Lampe für 5 min in einem Abstand von 2 cm bestrahlt. Die quervernetzten Proteine wurden mittels SDS-PAGE aufgetrennt und durch Autoradiographie sichtbar gemacht.
Beispiel 3 : Reinigung des 45 kD m3G-Cap-bindenden Proteins
HeLa S100 Extrakt, präpariert wie bei Dignam (Dignam et al. (1983), Nucleic Acids Res., 11 , 1475) beschrieben, wurde an einer 240 ml CM-Sepharose-FF-Säule
(Pharmacia) vorgereinigt. Hierzu wurden 960 ml des Extrakts (ca. 3,5 mg/ml Protein) über eine in Puffer D (25 mM HEPES-KOH, 100 mM NaCI, 2,5 mM MgCI2, 0,25 mM EDTA, 8,7% Glycerin, 2mM DTT, 1 mM PMSF, 0,1 mM Benzamidin, 10 μg/ml Bacitracin, pH 7,9) äquilibrierte Säule (Volumen 240 ml) aufgetrennt. Der Durchlauf, der das 45 kD m3G-Cap-bindende Protein enthielt, wurde direkt auf eine Q- Sepharose-FF-Säule (Volumen 240 ml, Pharmacia) äquilibriert in Puffer D aufgetragen. Anschließend wurde mit 2 I Puffer D gewaschen und die gebundenen Proteine mit einem linearen NaCI-Gradienten (100 - 750 mM in Puffer D) über 900 ml eluiert. Aliquots (0,5 ml) wurde für 4 h bei 4°C gegen Puffer D dialysiert und auf eine m3G-Cap-bindeπde Aktivität mittels des UV-Quervemetzungsassays analysiert. Dier Aktivität eluierte größtenteils zwischen 170 und 280 mM NaCI. Diese Fraktionen wurden vereinigt (210 ml, 627 mg Protein), auf 100 mM NaCI in Puffer D verdünnt (ca. 1 ,6 mg/ml) und auf eine m3G-Cap-Affinitätssäule aufgetragen (Herstellung der Säule siehe nächsten Abschnitt). Die Säulenmatrix wurde mit 10 Volumen Puffer D gewaschen und mit einer stufenweise erhöhten Salzkonzentration (je nach 2 ml 0,15; 0,2; 0,3; 0,4; 0,5; 0,6; 1 und 1 ,5 M NaCI in Puffer D) von der Säule eluiert. Ein 0,5 ml Aliquot jeder Fraktion wurde gegen Puffer D dialysiert und auf eine Konzentration von 30 μg/ml Protein mittels einer Amicoπ Ultrafiltrationszelle eingeengt. Anschließend wurde mittels des UV-Quervernetzungsassays die m3G- Cap-bindende Aktivität nachgewiesen. Die Ausbeute betrug insgesamt 0,36 mg Protein, was 0,01 % der Ausgangsproteinmenge entsprach. Beispiel 4 : Präparation der m3G-Cap-Affinitätssäule
Für die Affinitätsreinigung des m3G-Cap-bindenden Proteins wurde ein biotinyliertes m3G-Cap-Oligo (m3GpppAmpUmpAp-(CH2)6-Biotin) chemisch synthetisiert. Die Kopplung des biotinylierten m3G-Cap-Oligos wurde nach Lamond und Sproat (1994, supra) durch-geführt. 50 nM des biotinylierten m3G-Cap-Oligos wurde an 1 ml geblockten Streptavidin-Agarose für 18 h bei 4°C in einem gleichen Volumen Bindungspuffer (25 mM Hepes-KOH, 500 mM KCL, 1 mM EDTA, 1 mM DTT, 10% Glycerin, pH 7,9) gebunden. Vor der Benutzung wurden die Beads mit 5 Volumen Puffer D gewaschen.
Beispiel 5 : Mikrosequenzierung, cDNA-Klonierung und Expression von Snurportin 1
Gereinigtes Snurportin 1 wurde mit Lys-C verdaut, die Peptide mittels HPLC aufgetrennt und die AS-Sequenz verschiedener eluierter Fraktionen mittels eines ABI 477A Proteinsequeπziergerätes bestimmt. Die folgenden Peptidsequenzen, die mit drei überlappenden EST der ATCC (GenBank accession Nummern: H43467, H08432, R14245) wurden charakterisiert: (a) KYSSLEQSERRRRLLELQK, (b) KRLDYVNHARRLAEDD, (c) KRLAIVASRGSTSAYTK, (d) KLPEEEGLGEK. (e) KLTHK. Wie durch DNA-squeπzierung festgestellt werden konnte, enthielt der Klon R14245 ein 1 ,6 kb großes Fragment mit einem ORF, der für alle fünf Snurportin 1 Peptidsequenzen kodierte. Für die Expression von His-Tag-Snurportin 1 und von N- terminalen Deletionsmutanten (Δ1 -65 Snurportinl ) wurden entweder die komplette Snurportin 1 oder die für die AS 66-360 kodierende Sequenz aus einem pBluescript- plasmid, das die gesamte Snurportin 1 cDNA enthielt (pBS/spπ1 ), mittels PCR amplifiziert und in die Ncol/BamHI-Restriktionsschnittstellen des Plasmids pET28b (Novagen) umkloniert. Die resultierenden Plasmide (pET28b/sρn1 und pET28b/Δ1- 65spn1 ) wurden in den E. coli Bakterienstamm BL21 [LysS] transformiert. Die transformierten Stämme wurden bis zu einer OD 600 von 0,8 inkubiert und die Proteinexpression mit Isopropyl-ß-D-thiogalacto-pyranosid für 4 h bei 30°C induziert. Die Zellen aus einer 2 I Kultur wurden mit Ultraschall für 1 min auf Eis in Resuspensionspuffer D (25 mM HEPES-KOH, 100 mM NaCI, 2,5 mM MgCI , 1 mM PMSF, 0,1 mM Benzamidiπ, 10 μg/ml Bacitracin, 20 μg/ml Leupeptin, 5 mM Imidazol, 10 mM ß MerCaptoethanol, pH 7,9) zur Lyse behandelt. Nach Klärung der Lösung durch Zentrifuaagtion bei 25.000 g für 45 min. und 100.000 x g für 120 min. wurde der Überstand auf eine Nickel-nitrilo-Essigsäure (Ni-NTA) Agarosesäule (Qiagen) aufgetragen. Die gebundenen Proteine wurden mit Resuspensionspuffer, der 200 mM Imidazol und 8,7% Glycerin enthielt, eluiert. Für die weitere Reinigung wurden die Proteine für 2 h bei 4°C gegen Puffer D dialysiert und einer m3G-Cap- Affinitätschromatographie wie oben beschrieben unterzogen. Die folgenden Primer wurden für die PCR-Amplifikatioπ verwendet: (i) pET28b/spn1 -for [5'- GGGCCATGGAAGAGTTGAGTCAGGCCCTG-3']; (ii) pET28b/Δ1-65/spn1-for [GGGCCATGGCTGAAGATGACTGGACAGGGATG-3'], (iii) pET28b/spn1-rev and pET28b/Δ1 -65/spn1-rev [TTTGGATCCGCATTCTCCATGAGGCATC CAGGGTG-3'-]. Alle durch PCR erzeugte Konstrukte wurden durch Sequenzierung bestätigt. Die Expression und Reinigung von hSRPIα und Xenopus Importin α wurde bereits beschrieben (Weis et al., 1995; Görlich et al., 1994).
Beispiel 6 : In vitro-Translation und Protein Bindungsassays
Importin ß wurde mit Hilfe von Kaninchen Retikulozytenlysat durch in vitro- Translation des Plasmids pKW275 (Weis et al., 1996, supra) unter Benutzung des TnT Kits (Promega) nach Herstellerangabeπ hergestellt. Die Bindung von Snurportin 1 , hSRPIα oder Importin α an Importin ß mittels Ni-NTA-Beads wurde exakt wie bei Weis (Weis et al. (1996), supra) beschrieben durchgeführt.
A ) Vorgehen bei der Markierung von RNA und U snRNPs
[32P] pCp Markierung von Gel-gereinigten HeLa U1 und U5 snRNAs wurde wie bei Fischer (Fischer et al. (1993), EMBO J., 12, 573) beschrieben, durchgeführt. Die in vitro-Transkription der [32P] pCp-markierten ApppG U6 snRNA wurde nach Fischer (Fischer et al. (1991 ), J. Cell. Biol. 113, 705) beschrieben durchgeführt.
Für in vitro Kernimportassays wurden die isolierten U1 snRNPs oder Δ5'-U1 snRNPs mit dem moπofunktionalen reaktiven Fluoreszeπsfarbstoff Cy3 nach den Herstellerangaben (Amersham) durchgeführt. Die nicht gebundenen Farbstoffmoleküle wurden mittels Ultrafiltration in einer Amiconzelle und anschließender Dialyse mit PBS (pH 8) entfernt, bis keine Farbstoffmolekül in der durchlaufenden Fraktionen mehr nachzuweisen waren. Die Sedimentationsanalyse der Fluoreszens-markierten snRNPs wurde wie oben beschrieben durchgeführt.
B ) Oozyteninjektionen
Mikroinjektionen wurden wie bei Fischer (Fischer et al. (1993), supra) beschrieben durchgeführt, mit der Ausnahme, daß OR-2 Puffer anstelle von MBS-Puffer verwendet wurde. Nach der Inkubation bei 18°C für die angegebenen Zeiträume, wurden die Oozyten in J-Puffer (70 mM NH4CI, 7 mM MgCI2, 0,1 mM EDTA, 2,5 mM DTT, 20 mM Tris-HCI, 10% Glycerin, pH 7,5) transferriert und manuell getrennt. Die RNA wurde gereinigt und analysiert wie beschrieben (Fischer et al., 1993, supra). Die Gele wurden mittels eines Molecular Dynamics (Sunnyvale, CA) Phosphorimagersystems mit der Image Quant Software Version 3.0 quantifiziert.
Beispiel 7 : Kemimportassays
Kemimportreaktioneπ wurden mit HeLa-Zellen durchgeführt, die auf Glasdeckgläschen zu einer Konfluenz von 50 - 70% in Dulbecco's modified Eagle medium (Gibco-BRL) mit 10% fötalem Kälberserum und Penicillin/Streptomycin (Gibco-BRL) bei 37°C, 5% CO2 gewachsen waren. Nach der Permeabilistion mit Digitonin (Adams et al. (1990), J. Cell Biol., 111 , 807) wurden die Zellen mit eiskaltem Importpuffer (25 mM Hepes pH 7,9, 100 mM NaCI, 2,5 mM Mg Cl2, 0,25 mM EDTA) gewaschen und mit 25 μl Importpuffer, der 0,2 mg/ml tRNA, 1 mM ATP, 1 mM Creatinphospat, 20 U/ml Creatin-Phosphokinase (Sigma), 4 μg/ml U1 snRNP* opder Δ5'-U1 snRNP* (markiert wie oben beschrieben) und 10 μl HeLa S100 zytosolischen Extrakt (5mg/ml Protein) enthielt, inkubiert. Zusätzliche Reagenzien wurden wie in den Legenden der Abbildungen beschrieben zugegeben. Der Import- Mix wurde von ATP depletiert, in dem ATP, Creatinphosphat und
Creatinphosphatkinase nicht zugegeben wurde und eine Vorinkubation für 30 min bei 25°C in der Anwesenheit von 20 U/ml Apyrase (Sigma) stattfand. Die Inkubation der Importreaktionen wurde bei 25°C für 30 min durchgeführt und die Reaktion beendet wie bei Marshallsay und Lührmann (1994, supra) beschrieben. Nachdem die Proben mit Fluoprep (bioMerieux) eingedeckt worden waren, wurden sie mit Hilfe des 50 x Objektives eines Leica DM/IRB Invers Fluorezens-Mikroskops analysiert und mit einer CCD-Kamera in digitalisiierten Bilder gespeichert. Die Images wurden mit der Software Adobe Photoshop Version 3.0 prozessiert und mit der NIH Image Software Version 1.6 quantifiziert. Für jede Probe wurde die durchschnittliche Fluoreszens von ca. 100 zufällig ausgewählten Kernen aus mindestens drei unabhängige Assays berechnet und gemittelt.

Claims

Patentansprüche
1 . Polypeptid mit einer Aminosäuresequenz gemäß SEQ ID No. 1 oder eine funktionelle Variante davon, und Teile davon mit mindestens 6 Aminosäuren.
2. Polypeptid nach Anspruch 1 , dadurch gekennzeichnet, daß das Polypeptid ein m3G-Cap-spezifischer Kernimportrezeptorprotein ist.
3. Polypeptid nach Anspruch 1 und 2 erhältlich aus zytoplasmatischen Extrakten von HeLa-Zellen.
4. Polypeptid nach Anspruch 1 bis 3, dadurch gekennzeichnet, daß das Polypeptid eine m3G-Cap-spezifische Domäne enthält.
5. Antikörper gegen ein Polypeptid gemäß Anspruch 1 bis 4.
6. Nukleinsäure kodierend für ein Polypeptid gemäß Anspruch 1 bis 4 oder eine funktionelle Variante davon, und Teile davon mit mindestens 8 Nukleotiden, wobei SEQ ID No. 2 Teil des Anspruchs ist.
7. Nukleinsäure gemäß SEQ ID No. 3 erhältlich aus einer Nukleinsäure gemäß Anspruch 6, kodierend für ein Deletionspolypeptid gemäß SEQ ID No. 4, wobei SEQ ID No. 3 Teil des Anspruchs ist.
8. Nukleinsäure nach Anspruch 6 und 7, dadurch gekennzeichnet, daß die Nukleinsäure eine DNA oder RNA, vorzugsweise eine doppelsträngige DNA ist.
9. Nukleinsäure nach Anspruch 6 bis 8, dadurch gekennzeichnet, daß die Nukleinsäure eine oder mehrere nicht-kodierende Sequenzen enthält.
10. Nukleinsäure nach einem der Ansprüche 6 bis 9, dadurch gekennzeichnet, daß die Nukleinsäure in einem Vektor, vorzugsweise in einem Expressionsvektor oder gentherapeutisch wirksamen Vektor, enthalten ist.
1 1 . Polypeptid mit einer Aminosäuresequenz gemäß SEQ ID No. 4 erhältlich aus einer Nukleinsäure gemäß Anspruch 7, dadurch gekennzeichnet, daß das ' Polypeptid keine IBB-Domäne enthält.
12. Verfahren zur Herstellung einer Nukleinsäure nach einem der Ansprüche 6 bis 9, dadurch gekennzeichnet, daß die Nukleinsäure chemisch synthetisiert oder anhand einer Sonde aus einer Genbank isoliert wird.
1 3. Verfahren zur Herstellung eines Antikörpers gemäß Anspruch 5, dadurch gekennzeichnet, daß ein Säugetier mit einem Polypeptid gemäß Anspruch 1 oder 9 immunisiert und gegebenenfalls die entstandenen Antikörper isoliert werden.
14. Arzneimittel enthaltend eine Nukleinsäure gemäß einem der Ansprüche 6 bis 9 und/oder ein Polypeptid gemäß einer der Ansprüchen 1 bis 5 oder 1 1 und gegebenenfalls pharmazeutisch annehmbare Zusatz- und/oder Hilfsstoffe.
1 5. Verfahren zur Herstellung eines Arzneimittels zur Behandlung von Krebs, Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide
Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und/oder Diabetis und/oder zur Beeinflussung des Zellmetabolismus, insbesondere bei der Immunsuppression, vor allem bei Transplantationen, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß einem der Ansprüche 6 bis 9 oder ein Polypeptid gemäß Anspruch 1 oder 1 1 oder Antikörper gemäß Anspruch 5 mit einem pharmazeutisch annehmbaren Zusatz- und/oder Hilfsstoff formuliert wird.
1 6. Diagnostikum enthaltend eine Nukleinsäure gemäß einem der Ansprüche 6 bis 9 oder ein Polypeptid gemäß Anspruch 1 oder 1 1 oder Antikörper gemäß Anspruch 5 und gegebenenfalls geeignete Zusatz- und/oder Hilfsstoffe.
1 7. Verfahren zur Herstellung eines Diagnostikums zur Diagnose von Krebs,
Autoimmunkrankheiten, insbesondere Multiple Sklerose oder Rheumatoide ' Arthritis, Alzheimer-Krankheit, Allergien, insbesondere Neurodermitis, Typ I Allergien oder Typ IV Allergien, Arthrose, Atherosklerose, Osteoporose, akute und chronische Infektionskrankheiten und/oder Diabetis und/oder zur Analyse des Zellmetabolismus, insbesondere des Immunstatus, vor allem bei Transplantationen, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß einem der Ansprüche 6 bis 9 oder ein Polypeptid gemäß Anspruch 1 oder 1 1 oder Antikörper gemäß Anspruch 5 pharmazeutisch annehmbaren Träger versetzt wird.
1 8. Test zur Identifizierung von funktioneilen interaktoren enthaltend eine Nukleinsäure gemäß einem der Ansprüche 6 bis 9 oder ein Polypeptid gemäß Anspruch 1 oder 1 1 oder Antikörper gemäß Anspruch 5 und gegebenenfalls geeignete Zusatz- und/oder Hilfsstoffe.
1 9. Verwendung einer Nukleinsäure gemäß einem der Ansprüche 6 bis 9 oder eines Polypeptids gemäß Anspruch 1 oder 1 1 zur Identifizierung funktioneller Interaktoren.
20. Verwendung einer Nukleinsäure gemäß einem der Ansprüche 6 bis 9 zum Auffinden von Varianten eines humanen m3G-Cap-spezifischen Kernimportrezeptors dadurch gekennzeichnet, daß eine Genbank mit der genannten Nukleinsäure abgesucht und die gefundene Variante isoliert wird.
21 . Verwendung eines Polypeptids gemäß einem der Ansprüche 1 bis 4 als m3G- Cap spezifischer Kemimportrezeptor und zum Tansport von m3G Cap enthaltender Moleküle in den Kern.
22. Verwendung eines Polypeptids gemäß einem der Ansprüche 1 bis 4 oder 1 1 zur Erkennung und/oder Identifizierung von m3G-Cap enthaltenden Molekülen.
3. Verwendung eines Polypeptids gemäß einem der Ansprüche 1 bis 4 oder 1 1 zur Reinigung und Quantifizierung von m3G-Cap enthaltenden Molekülen.
EP99932844A 1998-07-14 1999-07-07 Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung Withdrawn EP1097201A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE19831382A DE19831382A1 (de) 1998-07-14 1998-07-14 Humanes m¶3¶G-cap-spezifisches Kernimportrezeptorprotein mit einer neuen Domänenstruktur, dessen Herstellung und Verwendung
DE19831382 1998-07-14
PCT/EP1999/004750 WO2000004144A1 (de) 1998-07-14 1999-07-07 Snurportin 1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung

Publications (1)

Publication Number Publication Date
EP1097201A1 true EP1097201A1 (de) 2001-05-09

Family

ID=7873911

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99932844A Withdrawn EP1097201A1 (de) 1998-07-14 1999-07-07 Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung

Country Status (6)

Country Link
EP (1) EP1097201A1 (de)
JP (1) JP2002520052A (de)
AU (1) AU751571B2 (de)
CA (1) CA2333895A1 (de)
DE (1) DE19831382A1 (de)
WO (1) WO2000004144A1 (de)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0004144A1 *

Also Published As

Publication number Publication date
JP2002520052A (ja) 2002-07-09
WO2000004144A1 (de) 2000-01-27
DE19831382A1 (de) 2000-02-03
CA2333895A1 (en) 2000-01-27
AU4908599A (en) 2000-02-07
AU751571B2 (en) 2002-08-22

Similar Documents

Publication Publication Date Title
EP1027440B1 (de) Inhibitor-protein des wnt-signalwegs
DE69733204T2 (de) Neuartige vegf-ähnliche faktoren
DE69531892T2 (de) Fibroblasten-wachstumsfaktor 10
DE69535063T2 (de) Denaturierter low-density lipoprotein (ldl) rezeptor
WO1997023611A2 (de) Nukleinsäuresequenzen von genen der high mobility group proteine sowie verwendungen derselben
DE69725018T2 (de) Gereinigte telomerase
DE4038189C2 (de) Humanes, Epididymis-spezifisches Polypeptid und dessen Verwendung zur Therapie und Diagnose männlicher Infertilität
EP0805204B1 (de) Nebenhoden-spezifisches Rezeptorprotein und dessen Verwendung
EP1287142B1 (de) Nukleinsaure-molekul umfassend eine fur ein sdf-1 gamma chemokin,einen neuropeptid-prakursor oder mindestens ein neuropeptid kodierende nukleinsauresequenz
DE69631041T2 (de) Promotor des utrophingens
EP1127133B1 (de) Zellpermeabilität-vermittelndes polypeptid
DE69434090T2 (de) Epsilon-untereinheit des gaba a-rezeptors
EP1097201A1 (de) Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung
EP1007671B1 (de) Fanconi-gen ii
EP1015583B1 (de) Srcr domäne-enthaltendes protein
EP0842278B1 (de) Protein mit dnase-aktivität
EP1161535B1 (de) Rna polymerase i transkriptionsfaktor tif-ia
DE19725186C2 (de) Herz- und Skelettmuskel-spezifische Nukleinsäure, ihre Herstellung und Verwendung
DE10001377A1 (de) bHLH-Transkriptionsfaktor ASCL3 und diesen enthaltendes Arzneimittel
DE69827808T2 (de) Protease-ähnliches protein
EP1230265B1 (de) Nukleinsäure, die für ein protein der ctage-familie kodiert, deren verwendung und herstellung
DE19515514C1 (de) Nukleoläres/endosomales Autoantigen
DE19730997C1 (de) SRCR Domäne-enthaltendes Protein
DE4041464A1 (de) 5-ht(pfeil abwaerts)1(pfeil abwaerts)-rezeptor
EP1084234A2 (de) Humane deadenylierende nuclease, ihre herstellung und verwendung

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010214

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20030924