EP1097201A1 - Snurpotine i human m 3?g-cap specific nucleus import receptor protein with new domain structure, the production and use thereof - Google Patents

Abstract

The invention relates to a novel polypeptide or a functional variant thereof, acting as a 5'-2,2,7 terminal trymethylguanosine(m3G-)Cap-specific receptor of nucleus import in cells, to the production and to the use thereof. The invention is preferably used as a medicament or diagnostic reagent.

Description

description

SNURPORTIN 1, HUMANESE M3G CAP-SPECIFIC CORE IMPORT RECEPTOR PROTEIN WITH A NEW DOMAIN STRUCTURE, THEIR PRODUCTION AND USE

The present invention relates to a human 5 ^' -2,2,7-terminal trimethyl guanosine (hereinafter: m ₃ G) -cap-specific nuclear import receptor protein, obtainable by nuclear, cytosol extraction and expression of recombinant nucleic acids, and their use in particular as a medicament , Diagnostic.

The targeting of proteins (protein targeting) within the cell is of particular importance, since promising diagnostic and pharmaceutical applications are promised.

Newly synthesized proteins contain signals that determine their final destination in the cell. So also in the case of the so-called protein import route into the nucleus from the cytosol, which takes place through a nuclear pore complex (NPC), and generally through a saturable one

Transport receptor - which specifically recognizes a nuclear localization signal (NLS) - is mediated (Göriich and Mattaj (1996), Science, 107, 1513, in particular Table 1; Nigg (1997), Nature, 386; 779; Ohno et al. (1998) , Cell, 92, 327).

The so-called basic NLS mostly consist of one or a collection of several basic amino acids (overview in Dingwall and Laskey (1991), Trends Biochem. Sei., 16, 478). The proteins which have such a basic NLS are referred to below as karyophilic proteins.

Görlich describes the isolation of a transport receptor, so-called importin, consisting of the complex heterodimeric subunits α (60 kD) and ß (90 kD). Importin α contains an N-terminal motif, the importin ß binding (hereinafter: IBB) domain, which mediates the complex formation with importin ß and a C-terminal domain that produces the NLS binding site and consists of eight so-called "armadillo" repetition motifs (Görlich et al. (1996), EMBO J., 15, 1810; Moroianu et al. (1996), Proc Natl. Acad. USA, 92, 2008; Weis et al. (1996), EMBO J., 15, 1818. The NLS-importin complex is bound to the NPC by means of Importin ß (Chi et al. (1995), J Cell Biol., 130, 265; Görlich et al. (1995), Curr. Biol., 5, 383 and (1995) Nature, 377, 246; Imamoto et al. (1995), FEBS Lett, 368, 415; Moroianu et al. (1995), Natl. Acad. Sci. USA., 92, 2008. These are also called karyopherin a / ß (Moroianu et al. 1995 supra; Radu et al. (1995) Proc. Natl. Acad Be. USA, 92, 1769).

The translocation of the complex through the core pore requires additional energy-providing transport factors such as GTP and Ran (Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore and Blobel (1993), Nature, 365, 661) and p10 / NTF2 (Moore and Blobel, (1994), Proc. Natl. Acad. Sei. USA, 91, 10212; Paschal and Geraee (1995), J. Cell. Biol., 129, 925).

In recent studies dealing with the transport signals of hnRNP A1 and K, a new protein import route could be identified which differs from the known basic NLS detection (Pollard et al. (1996), Cell, 86, 985; Michael et al. (1997) EMBO J., 16, 3587). The import of hnRNP A1 into the nucleus depends on a 38 amino acid transport signal, so-called M9, which has no sequence similarity to the basic NLS (Siomi and Dreyfuss (1995), J. Cell. Biol., 129, 551; Weighart et al. (1995), J. Cell. Sci., 108, 545; Michael et al. (1995), Cell, 83, 415). M9 is recognized directly by Transportin (Pollard et al. 1996, Cell, 86, 985; Nakielπy et al., Exp. Cell. Res., 1996, 261; Fridell et al., J. Cell Sei. 1997, 1325). In contrast to Importin ß, Transportin is functional without an α subunit, while the binding to the NPC and the Ran-dependent translocation of the hnRNP A1 / Transportin complex into the nucleus take place in an analogous manner to Importin ß (Nakielny et al. (1996) , Exp. Cell. Res., 229, 261; Izaurralde et al. (1997), J. Cell Biol., 137, 27). A homologue to Transportin, Kap104p, which imports a certain group of mRNA-binding proteins, has been described in the yeast (Aitchinson et al. (1996) Science, 274, 624). Two other Importin ß-like proteins, Kap123p / Yrb4p and Psel p, are suspected for the nuclear import of ribosomal proteins in yeast (Rout et al. (1997), Cell, 89, 715; Schlenstedt et al. (1997), EMBO J., 16, 6237). These new importin α independent transport receptors are all members of the large family of importin β-like transport factors (Fornerod et al. (1997), EMBO J., 16; 807, Görlich et al. (1997) J: Cell. Biol., 138 , 65)

However, the mechanism of importing the nuclear-specific spliceosomal U sπRNP is largely unknown. Each snRNP particle consists of one (U1, U2 and U5) or two (U4 / U6) snRNA molecules and a common set of eight basic proteins (B, B ^' , D1, D2, D3, E, F and G, so-called Sm proteins ), which are bound to each of the m ₃ G-cap containing sπRNAs U1, U2, U4 and U5 and differ with respect to the respective snRNA in specific further associated proteins (Will and Lührmaπn (1997), Curr. Opin. Cell. Biol. , 9, 320).

With the exception of the U6 snRNP, which does not leave the nucleus (Vankan et al. (1990), EMBO J., 9, 1075), the biogenesis of the snRNPs is dependent on a bidirectional transport of the snRNA through the nuclear membrane. The snRNAs (U1, U2, U4 and U5) are specifically synthesized with a 5 ^' terminal 7 monomethyl-guanosine (m ⁷ G-) cap structure, while the Sm proteins are formed in the cytoplasm and do not migrate into the nucleus without binding to U snRNA . Rather, newly synthesized U snRNAs are exported transiently into the cytoplasm, where they bind the Sm proteins at the specific snRNA Sm binding site to form a ribonucleoprotein complex (so-called Sm Core according to Mattaj and De Robertis (1985), Cell, 40, 111 ; Raker et al. (1996) EMBO J., 15, 2256). The stable association of all Sm proteins is essential for the hypermethylation of the m ⁷ G-cap to the m ₃ G-cap (Mattaj (1986) Cell, 46, 905; Plessel et al. (1994), Mol. Cell. Biol., 14 , 4160). After these processes and the processing of the 3 ^' end, the mature snRNP particle is transported back to the nucleus in a receptor and energy dependent manner (Neuman de Vegvar and Dahlberg (1995) Mol. Cell. Biol., 10, 3365). The NLS of the U1 snRNP in Xenopus laevis oocytes is described, which is also complex in nature. On the one hand by the m ₃ G-Cap (Fischer and Lührmann (1990), Science, 249, 786; Hamm et al., (1990) Cell, 62, 569), on the other hand by an unspecified part in the Sm basic domain (Sm Core NLS; Fischer et al. (1993) EMBO J. 12, 573). Not all spliceosomal snRNAs require the m ₃ G-Cap to the same extent for nuclear transport in oocytes. While U1 and U2 snRNA definitely need the m ₃ G-Cap for transport into the nucleus, U4 and U5 snRNAs can also reach the nucleus as ApppG-Cap derivatives, even if the efficiency is considerably reduced (Fischer et al. (1991), J. Cell. Biol., 113, 705; Michaud and Golgfarb (1992) J. Cell. Biol., 116, 851). Even if the m ₃ G-Cap is not essential for the core transport of snRNAs U4 and U5, it accelerates their transport considerably. This shows that the m ₃ G-Cap has a signaling function for the import of all U snRNAs (Fischer et al., J. Cell. Biol., 1994, 971; Marshallsay and Lührmann, 1994, Nucleic Acids Res, 13, 222 ).

The object of the invention is therefore to provide a polypeptide which interacts specifically with m ₃ G-Cap and is used as m ₃ G-Cap-specific core import protein receptor in vivo and in vitro.

The object is achieved in that a 45 kD protein from cytoplasmic extracts of HeLa cells is provided with high specificity for m ₃ G-Cap structures.

Kemimportrezeptorproteiπ in the sense of this invention means that the polypeptide acts on the one hand as a receptor and on the other hand mediates the transport of formulated molecules from the cytosol (cytoplasm) into the nucleus.

In the sense of this invention, the m ₃ G-cap-specific nuclear import protein receptor means that the above-defined core import receptor specifically receptes molecules with m ₃ G-cap structures, ie recognizes them in the broadest sense, and mediates their transport into the nucleus, both “in vitro” and also "in vivo". Molecules containing m ₃ G-cap in the sense of this invention means that they are accessible to the m ₃ G-cap-specific core import protein receptor according to the invention. Fusion molecules made of m ₃ G-Cap and protein or other biologically relevant molecules are therefore also conceivable.

In the context of the present invention, "in vivo" means a conversion, i.e. a reaction, understood, that takes place within a living organism.

In the context of the present invention, "in vitro" means an implementation, i.e. a reaction, understood, that takes place outside of a living organism.

"Cap" in the sense of this invention has the meaning as it is known to the expert in the field of U snRNA and snRNP work.

To carry out the invention, the identification of a potential m ₃ G-cap binding protein is carried out with the aid of a UV crosslinking assay and the synthetic substrate (m ₃ G) pppAmpUmpA oligonucleotide (m ₃ G-Caρ-oligo) as substrate. After UV-irradiation of cytosolic S100 extracts, which contain the m ₃ G-Cap-Oligo radioactively labeled with [ ³² P] pCp on the 3rd, the proteins are analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and autoradiography the cross-linked radioactively labeled proteins . 1A and 1B show that a radioactively labeled main band with an apparent molecular weight of 45 kD (arrowhead in FIGS. 1A and 1B) and three less intensely labeled proteins with the molecular weights 25, 35 and 150 kD are reproducibly detected.

The m ₃ G-Cap specificity for the polypeptide according to the invention, preferably a 45 kD protein, which is essential to the invention, is recognized with the aid of competition studies with various unlabeled cap structures. While a 10,000-fold excess of m ⁷ GpppG or ApppG cap dinucleotide shows only very slight effects on the effectiveness of the UV crosslink with the radioactively labeled m ₃ G cap oligo on the 45 kD protein (FIG. 1A, lanes 2- 4 and 5-7), a 10 to 100-fold excess of unlabelled m ₃ G-Cap oligo is sufficient to completely prevent the binding to the 45 kD protein (FIG. 1A, traces 9-11). In contrast, a significant inhibition of the crosslinking by-products could be observed only with a 1000-fold excess of the unlabeled m ₃ G-cap oligo (with the exception of a 150 kD protein). In addition, a synthetic m ₃ GpppG-Cap dinucleotide inhibited binding to the 45 kD protein by an order of magnitude less than the unlabeled m ₃ G-Cap oligo (FIG. 3A, compare lanes 8-11 with 12-15).

The polypeptide according to the task, preferably a 45 kD protein, binds both to isolated m ₃ G-cap structures and to πative m ₃ G-caps in the U1 snRNA as well as to πative U1 snRNP particles. This could be demonstrated by the inhibition of UV crosslinking of the m ₃ G cap oligo to the 45 kD protein by U1 snRNA and U1 snRNP (FIG. 1B, lanes 2-5 and 11-14). The interaction of the 45 kD protein with U1 snRNA or U1 snRNP is strictly dependent on the presence of the 5 ^' - terminal m ₃ G-Cap structure. U1 snRNA and U1 snRNP preparations, the 5 ^' terminal ends of which were removed with the aid of oligonucleotide-controlled RNase H hydrolysis, were unable to inhibit the UV crosslinking from the m ₃ G-cap oligo to the 45 kD protein (FIG. 1 B, Lanes 6-9 and 15-18). Equal concentrations of m ₃ G-Cap oligo, U1 snRNA or U1 snRNP are sufficient to completely inhibit the crosslinking of the 45 kD protein with the radioactively labeled m ₃ G-Cap oligo (compare FIGS. 1A and 1B). This experiment shows that neither additional RNA sequences nor Sm Core proteins could increase the affinity of the 45 kD protein for the 5 ^' -terminal m ₃ G-cap structure of U1 snRNA / snRNP.

An object of the present invention is therefore the task-related polypeptide as such with an amino acid sequence according to SEQ ID No. 1 or a functional variant thereof, and parts thereof with at least six

Amino acids, preferably with at least twelve amino acids, in particular with at least 65 amino acids and especially with 360 amino acids (hereinafter referred to as "inventive polypeptide" or "Snurportin 1"). For example, an approximately 6-12, preferably approximately 8 amino acids long polypeptide can contain an epitope which, after coupling to a support, is used to produce specific poly- or monoclonal antibodies. Polypeptides with one A length of at least approx. 65 amino acids can also be used directly without a carrier to produce poly- or monoclonal antibodies.

The term “functional variant” in the sense of the present invention means polypeptides which are functionally related to the peptide according to the invention, ie which have an m ₃ G-cap-specific core import receptor activity. Variants are also understood to mean allelic variants or polypeptides that are used by others For the purposes of this invention, this includes polypeptides that come from different human individuals.

In a broader sense, this also includes polypeptides which have a sequence homology, in particular a sequence identity of approximately 70%, preferably approximately 80%, in particular approximately 90%, in particular approximately 95%, of the polypeptide with the amino acid sequence SEQ ID No. Have 1. Furthermore, this also includes deletion of the polypeptide in the range from about 1-65, preferably from about 1-30, in particular from about 1-15, especially from about 1-6 amino acids. For example, the first amino acid methionine may be absent without significantly changing the function of the polypeptide. In addition, this also includes fusion proteins which contain the above-described polypeptides according to the invention, the fusion proteins themselves already having the function of a human m ₃ G-cap specific nuclear import tether or only being able to acquire the specific function after the fusion portion has been split off. Above all, this includes fusion proteins with a proportion of in particular non-human sequences of about 1 to 150, preferably about 1 to 100, in particular about 1 to 65, especially about 1 to 30, amino acids. Examples of non-human peptide sequences are prokaryotic peptide sequences, for example from the galactosidase from E. co, or a so-called histidine tag, for example a Met-Ala-His6 tag. A fusion protein with a so-called histidine tag is particularly advantageous for purifying the expressed protein on metal ion-containing columns, for example on a Ni ²⁺ NTA column. "NTA" stands for the chelator "nitrilotriacetic acid" (Qiagen GmbH, Hilden). The parts of the polypeptide according to the invention represent, for example, epitopes that can be specifically recognized by antibodies.

This cDNA coding for the polypeptide according to the invention codes for 360 amino acids (AS) with a predicted molecular weight of 45 kD (FIG. 1A). A database search with the human snurportin 1 surprisingly showed a high homology in the N-terminal region (AS 27 to 65, FIG. 6B to the IBB domain from importin α (31% identity, 62% similarity to hSRPI, similar correspondences were found with hRchl, xlmpα and ySRP1 observed, Fig. 6B) In addition, AS regions in the IBB domain of Snurportin 1 are very homologous to IBB domain sequences of other members of the Importin family (Görlich et al., EMBO J., 1996, 1810; Weis et al., 1996, supra; highlighted by black dots in Fig. 6B. In contrast to the extended N-terminal IBB domain, the C-terminal part of Snurportin 1 is structurally different from Importin (e.g. less than 10% sequence identity with the C-terminus of hSRPI) In particular, no significant sequence homology between Snurportin 1 and the arm repeat domain of Importin α could be detected (FIG. 6B).

In particular, the parts of the polypeptide mentioned can also be synthesized with the aid of classic peptide synthesis (Merrifield technique). They are particularly suitable for obtaining antisera, with the aid of which suitable gene expression banks can be searched in order to arrive at further functional variants of the polypeptide according to the invention.

In a particularly preferred embodiment, the polypeptide according to the invention is a recombinantly produced protein. In the context of the present invention, this means a protein which has been produced by introducing a DNA sequence encoding the protein into a host cell and bringing it to expression there. The protein can then subsequently be obtained from the host cell and / or from the culture medium. The host cell is preferably a bacterium (e.g. E. coli strains such as DH5, HB101 or BL21), yeasts (e.g. Saccharomyces cerevisiae or Pichia pastoris), fungi (e.g. Aspergillus speα), mammalian cell lines (e.g. 293, Vero, HeLa, Cos or BHK cells), insect cell lines or a protist (microalgae or protozoa, e.g. of the ^' Tetrahymena genus as defined in Schlegel "General Microbiology" (Georg Thieme Verlag, 1985, 1-2) Snurportin is particularly preferably secreted by the host cell The production of such host cells for the production of a recombinant Snurportin can be carried out according to methods known to the person skilled in the art.

An overview of various expression systems can be found, for example, in Methods in Enzymology 153 (1987), 385-516 and in Bitter et al. (Methods in Enzymology 153: 516-544 (1987)). Expression vectors are widely described in the literature. In addition to a selection marker gene and an origin of replication which ensures replication in the selected host, they generally contain a bacterial or viral promoter, and usually a termination signal for transcription. There is at least one restriction site or a polylinker between the promoter and the termination signal, which enable the insertion of a coding DNA sequence. Provided that it is active in the selected host organism, the DNA sequence which naturally controls the transcription of the corresponding gene can be used as the promoter sequence. This sequence can also be exchanged for other promoter sequences. Both promoters which bring about a constitutive expression of the gene and inducible promoters which allow targeted regulation of the expression of the downstream gene can be used. Bacterial and viral promoter sequences with these properties are described in detail in the literature. Regulatory sequences for expression in microorganisms (eg E. coli, S. cerevisiae) have been adequately described in the literature. Promoters that allow a particularly strong expression of the downstream gene are, for example, the T7 promoter (Studier et al., Methods in Enzymology (1990), 185, 60-89), Iacuv5, trp, trp-lacUV5 (DeBoer et al. , in Rodriguez and Chamberlin (Eds), Promotors, Structure and Function; Praeger, New York, (1982), 462-481; DeBoer et al, Proc. Natl. Acad. Sei. USA (1983), 21-25), Ip1, rac (Boros et al., Gene (1986), 42, 97-100). The transformation of the host cell with the DNA coding for the polypeptide according to the invention can generally be carried out by standard methods, as described, for example, in Sambrook et al. (Molecular Cloning: A Laboratory Course Manual, 2nd edition (1989), Cold Spring Harbor Press, New York). The cultivation of the host cell takes place in nutrient media which correspond to the needs of the host cell used in each case, in particular taking into account pH, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc. The expression vectors can be, for example, prokaryotic or eukaryotic expression vectors. Examples of prokaryotic expression vectors for expression in E. coli are, for example, the T7 expression vector pGM10 (Martin, 1996), which codes for an N-terminal Met-Ala-His6 tag, which advantageously purifies the expressed protein via a Ni2 + -NTA Column allows. Examples of suitable eukaryotic expression vectors for expression in Saeeharomyces cerevisiae are vectors p426Met25 or p426GAL1 (Mumberg et al., Nucl. Acids Res., 1994, (22), 5767), for expression in insect cells, for example baculovirus vectors as in EP -B1-0127839 or EP-B1-0549721, and for expression in mammalian cells, for example SV40 vectors, which are generally available.

In general, the expression vectors also contain suitable regulatory sequences for the host cell, such as e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Rüssel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhedrin promoter for expression in insect cells (see, for example, EP-B1-0127839) or the early SV40 promoter or LTR promoters, for example by MMTV (Mouse Mammary Tumor Virus; Lee et al. (1981) Nature, 214, 228).

The cleaning of the enzyme produced by the host cells can be carried out according to conventional cleaning methods such as precipitation, ion exchange.

Chromatography, affinity chromatography, gel filtration, HPLC reverse phase chromatography etc. are carried out. By modifying the DNA expressed in the host cells and coding for the polypeptide according to the invention, a polypeptide can be produced in the host cell which, due to certain properties, can be more easily isolated from the culture medium. It is thus possible to express the protein to be expressed as a fusion protein with a further polypeptide sequence, the specific binding properties of which enable the fusion protein to be isolated via affinity chromatography (e.g. Hopp et al. (1988), Bio / Technology, 6, 1204-1210; Sassenfeld ( 1990), Trends Biotechnol., 8, 88-93).

The present invention therefore furthermore relates to a nucleic acid coding for an m ₃ G-cap-specific nuclear import receptor protein with a nucleic acid sequence according to FIG. 2 or a functional variant thereof, and parts thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, in particular with at least 100 nucleotides, especially with at least 300 nucleotides (hereinafter referred to as "nucleic acid according to the invention").

The complete nucleic acid encodes a protein with 360 amino acids and a molecular mass of 45 kDa. The expression of the nucleic acid in E. coli leads to a protein which has similar enzymatic activities to that of a human m ₃ G cap-specific nuclear import receptor.

Further experiments according to the present invention confirmed that the nucleic acid is a nucleic acid which codes for a human Snurportin 1.

In a preferred embodiment, the nucleic acid according to the invention is a DNA or RNA, preferably a double-stranded DNA, and in particular a DNA with a nucleic acid sequence according to SEQ ID No. 2. According to the present invention, the term “functional variant” is understood to mean a nucleic acid which is functionally related to the human m ₃ G-cap-specific nuclear import receptor and in particular human Is of origin. Examples of related nucleic acids are, for example, nucleic acids from different human cells or tissues or allelic variants. The present invention also encompasses variants of nucleic acids which can originate from different human individuals.

In a broader sense, the term “variants” according to the present invention means nucleic acids which have a homology, in particular a sequence identity of approximately 60%, preferably approximately 75%, in particular approximately 90% and above all approximately 95 % exhibit.

The parts of the nucleic acid according to the invention can be used, for example, for the production of individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids. For example, a nucleic acid of at least approx. 8 nucleotides is suitable as an antisense nucleic acid, a nucleic acid of at least approx. 15 nucleotides as a primer in the PCR method, a nucleic acid of at least approx. 20 nucleotides for the identification of further variants and a nucleic acid of at least approx 100 nucleotides as a probe.

In a further preferred embodiment, the invention contains

Nucleic acid one or more non-coding sequences. The non-coding sequences are, for example, intron sequences or regulatory sequences, such as promoter or enhancer sequences, for the controlled expression of the m ₃ G-cap-specific core import receptor.

In a further embodiment, the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector or vector which is active in gene therapy.

Examples of vectors which are active in gene therapy are virus vectors, preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, for example a Adeno-associated virus vector consisting exclusively of two inserted terminal repeat sequences (ITR).

Suitable adenovirus vectors are described, for example, in McGrory, W.J. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors" (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S et al. (1986) EMBO J .. 5, 2377 or WO95 / 00655.

Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO95 / 23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95 / 23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R.M. (1994) Human Gene Therapy 5, 793.

Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes. Are suitable for this

Lipid mixtures as in Feigner, P.L. et al. (1987) Proc. Natl. Acad. Sei, United States 84,

7413; Behr, J.P. et al. (1989) Proc. Natl. Acad. Be. USA 86, 6982; Feigner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 or Gao, X. & Huang, L. (1991) Biochim.

Biophys. Acta 1189, 195. In the preparation of the liposomes, the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the DNA is completely complexed by the liposomes.

The nucleic acid according to the invention can be chemically described, for example, in 2 disclosed sequence or using SEQ ID No. 1 disclosed peptide sequence can be synthesized using the genetic code, for example by the phosphotriester method (see, for example, Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4). Another way of getting hold of the nucleic acid according to the invention is to isolate it from a suitable library, for example from a human gene bank, using a suitable probe (see, for example, Sambrook, J. et al. (1989) Molecular Cloπing. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York). Suitable as a probe For example, single-stranded DNA fragments having a length of about 100 to 1000 nucleotides, preferably with a length of about 200 to 500 nucleotides, ^'in particular with a length of about 300 to 400 nucleotides, the sequence of the nucleic acid sequence according to SEQ ID No. 2 can be derived.

Another object of the present invention also relates to antibodies which react specifically with the polypeptide according to the invention, the above-mentioned parts of the polypeptide either being themselves immunogenic or by coupling to suitable carriers, such as e.g. bovine serum albumin, immunogenic or can be increased in their immunogenicity.

The antibodies are either polyclonal or monoclonal. The preparation, which is also an object of the present invention, is carried out, for example, by generally known methods by immunizing a mammal, for example a rabbit, with the polypeptide according to the invention or the parts thereof, optionally in the presence of e.g. Freuπd's adjuvant and / or aluminum hydroxide gels (see e.g. Diamond, B.A. et al. (1981) The New England Journal of Medicine, 1344). The polyclonal antibodies produced in the animal as a result of an immunological reaction can then be easily isolated from the blood using generally known methods and e.g. purify by column chromatography. Preference is given to affinity purification of the antibodies, in which, for example, the C-terminal DAN fragment has been coupled to an NHS-activated HiTrap column.

Monoclonal antibodies can be produced, for example, by the known method from Winter & Milsteiπ (Winter, G. & Milstein, C. (1991) Nature, 349, 293).

Another object of the present invention is also a medicament which contains a nucleic acid according to the invention or a polypeptide according to the invention and optionally suitable additives or auxiliaries and a method for producing a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, especially in immunosuppression , especially in transplantations, in which a nucleic acid according to the invention, for example a so-called antisense nucleic acid, or a polypeptide according to the invention is formulated with pharmaceutically acceptable additives and / or auxiliary substances.

A medicinal product which contains the nucleic acid according to the invention in naked form or in the form of one of the gene therapy-effective vectors described above or in a form complexed with liposomes is particularly suitable for gene therapy use in humans.

Suitable additives and / or auxiliary substances are e.g. a physiological saline, stabilizers, proteinase inhibitors, nuclease inhibitors, etc.

Another object of the present invention is also a diagnostic agent containing a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention and, if appropriate, suitable ones

Additives and / or auxiliary substances and a method for producing a diagnostic for the diagnosis of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for analyzing cell metabolism, in particular the immune status, especially in transplants in which a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention are mixed with suitable additives and / or auxiliary substances.

For example, according to the present invention, a diagnostic agent based on the Polymerase chain reaction (PCR diagnostics, for example according to EP-0200362) or a Northern blot can be produced. These tests are based on the specific hybridization of the nucleic acid according to the invention with the complementary counter strand, usually the corresponding mRNA. The nucleic acid according to the invention can also be modified here, as described, for example, in EP0063879. A DNA fragment according to the invention is preferably labeled using suitable reagents, for example radioactive with -P ³² -dATP or non-radioactive with biotin, according to generally known methods and incubated with isolated RNA, which was preferably bound to suitable membranes made of cellulose or nylon, for example . It is also advantageous to separate the isolated RNA prior to hybridization and binding to a membrane, for example by means of agarose gel electrophoresis. With the same amount of RNA examined from each tissue sample, the amount of mRNA that was specifically labeled by the probe can thus be determined.

Another diagnostic agent contains the polypeptide according to the invention or the immunogenic parts thereof described in more detail above. The polypeptide or parts thereof, which are preferably attached to a solid phase, e.g. made of nitrocellulose or nylon, for example with the body fluid to be examined z. As blood, are brought into contact in vitro, for example with

To be able to react autoimmune antibodies. The antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies. The label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.

Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample from humans can be easily and quickly examined to determine whether the polypeptide in question is present. In this case, the antibodies according to the invention are labeled, for example, with an enzyme, as already described above. The specific one Antibody-peptide complex can be detected easily and just as quickly via an enzymatic color reaction.

Another object of the present invention also relates to a test for the identification of functional interactors, such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.

A suitable test for identifying functional interactors is e.g. B. the so-called "two-hybrid system" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286). In this test, a cell, for example a yeast cell, is transformed with one or more expression vectors or transfected that express a fusion protein that contains the polypeptide according to the invention and a DNA binding domain of a known protein, for example from Gal4 or LexA from E. coli, and / or express a fusion protein that contains an unknown polypeptide and a transcription activation domain, for example from Gal4, herpesvirus VP16 or B42. In addition, the cell contains a reporter gene, for example the LacZ gene from E. coli, "Green Fluorescence Protein" or the amino acid biosynthetic genes of the yeast His3 or Leu2, which are regulated by regulatory sequences such as the lexA promoter / operator or by a so-called "upstream activation sequence" (UAS) of the yeast. The unknown polypeptide is encoded, for example, by a DNA fragment that comes from a gene bank, for example from a human gene bank immediately produced a cDNA library using the expression vectors described in yeast so that the test can be carried out immediately thereafter.

For example, in a yeast expression vector the nucleic acid according to the invention is cloned in a functional unit to the nucleic acid coding for the lexA-DNA binding domain, so that a fusion protein from the polypeptide according to the invention and the LexA-DNA binding domain is expressed in the transformed yeast. In another yeast expression vector cDNA fragments from a cDNA library are cloned in a functional unit to the nucleic acid coding for the Gal4 transcription activation domain so that a fusion protein from an unknown polypeptide and the Gal4 transcription activation domain is expressed in the transformed yeast. The yeast transformed with both expression vectors, which is for example Leu2-, additionally contains a nucleic acid which codes for Leu2 and is controlled by the LexA promoter / operator. In the case of a functional interaction between the polypeptide according to the invention and the unknown polypeptide, the Gal4 transcription activation domain binds to the LexA promoter / operator via the LexA-DNA binding domain, whereby the latter is activated and the Leu2 gene is expressed. As a result, the Leu2 yeast can grow on minimal medium that does not contain leucine.

When using the LacZ or "Green Fluoresceπce Protein" reporter gene instead of an amino acid biosynthetic gene, the activation of the transcription can be demonstrated by the formation of blue or green fluorescent colonies. However, the blue or fluorescent staining can also be done easily quantify in the spectrophotometer eg at 585 nM in the event of a blue color.

In this way, expression gene banks can be easily and quickly searched for polypeptides that interact with the polypeptide according to the invention. The new polypeptides found can then be isolated and further characterized.

Another possible application of the "two-hybrid system" is

Influencing the interaction between the polypeptide according to the invention and a known or unknown polypeptide by other substances, such as. B. chemical compounds. In this way, it is also easy to find new valuable chemically synthesizable active ingredients that can be used as therapeutic agents. The present invention is therefore not only intended for a method for finding polypeptide-like interactors, but also extends to a method for finding substances which are identical to those described above Protein-protein complex can interact. Such peptide-like as well as chemical interactors are therefore referred to in the sense of the present invention as - functional interactors which can have an inhibiting or a stimulating effect.

In the following experiments and figures are explained which characterize the polypeptide according to the invention - Snurportin 1 - in more detail (see also examples).

Purification of the polypeptide according to the invention, a 45 kD m ₃ G-cap-forming protein called snurportin 1 and detection of its activity:

For the purification of the protein, a cytosolic S100 extract from HeLa cells was first purified via a CM-Sepharose column and the run containing Snurportin 1 was separated by means of Q-Sepharose chromatography. The fractions containing Snurportin 1 (tested by the UV crosslinking assay) were then loaded onto an m ₃ G-Cap affinity column. For this purpose, biotinylated m ₃ G cap oligo (m ₃ GpppAmpUmpA- / CH ₂ ) 6-biotin) was attached to a

Streptavidin-agarose column bound. The bound proteins were eluted from the column with increasing NaCl concentrations and analyzed by SDS-PAGE. A clean protein, the polypeptide according to the invention, with an apparent molecular weight of 45 kD was eluted from the column with a salt concentration of 0.6 to 1 M NaCl (FIG. 2A, lanes 9-11). The purified 45 kD protein could be crosslinked efficiently with radioactively labeled m ₃ G cap oligo with the aid of UV light (FIG. 2B). These experiments show that the polypeptide according to the invention, which was purified from HeLa S100 extracts, is necessary and sufficient for the formation of the 45 kD UV cross-link. This means that the 45 kD protein carries the m ₃ G-Cap binding activity.

Snurportin 1 contains an IBB domain, but does not have the well-known armadillo repeats: In order to clone the protein, petid sequences of the purified protein were generated by micro-sequencing. All five generated peptide sequences could be found in the GenBank in an EST (expressed sequence tag) (FIG. 6A). This Snurportin 1 encoding cDNA encodes 360 amino acids (AS) with a predicted molecular weight of 45 kD (Figure 1A). A

Database search with the human snurportin 1 surprisingly showed a high homology in the N-terminal region (AS 27 to 65, Figure 6B) to the IBB domain from Importiπ (31% identity, 62% similarity to hSRPI, similar correspondences were found with hRchl, xlmpα and ySRP1 observed, Figure 6B). In addition, AS regions in the IBB domain of Snurportin 1 are very homologous to IBB domain sequences from other members of the Importin family (Görlich et al., 1996; supra; Weis et al., 1996; supra highlighted by black dots in FIG. 6B ). In contrast to the extended N-terminal IBB domain, the C-terminal part of Snurportin 1 is structurally different from Importin α (e.g. less than 10% sequence identity with the C-terminus of hSRPI). In particular, no significant sequence homology between Snurportin 1 and the "armadillo" repeat domain of Importin α could be detected (FIG. 6B). This means that there is no evolutionary conservation of the C-terminal regions of these two proteins.

Snurportin 1 surprisingly exhibits overall sequence homology with different ORF (open reading frames) from mouse ESTs (e.g. AA571557, more than 90% identity), a Drosophila EST (AA541081, more than 40% identity) and with a C. elegans protein of unknown function ( ACC AF024493). The homology between Snurportin 1 and the C. elegans protein is not limited to the N-terminal IBB domain (43% identity, 59% similarity; see FIG. 6A). It can therefore be seen that the protein is the functional homologue to Snurportin 1. Identification of the C. elegans homolog shows that Snurportin 1 has been preserved in an evolutionary manner and therefore has an essential specific function as a core import receptor protein.

Snurportin 1 binds Importin ß in vitro depending on the IBB domain: The presence of an IBB domain at the N-terminus of Snurportin 1 has the effect that the core transport of m ₃ G-Cap-containing molecules is mediated. Detection is carried out by in-vitro binding of the polypeptide according to the invention to Importin β.

Histidine fusion proteins from total snurportin or N-terminal

Deletion mutants of the polypeptide according to the invention (Δ1-65 snurportin 1 causes a missing IBB domain according to FIG. 3B) and likewise total hSRPIα and Xenopus importin α were incubated with ³⁵ S-labeled importin ß translated in vitro. The protein complexes were then precipitated with Ni-NTA agarose beads and the binding of Importin ß was analyzed by SDS-PAGE with subsequent autoradiography. Importin β coprecipitated with total snurportinl, hSRPI α and importin α, but not with Δ1 -65 snurportin 1 (Figure 3A, lanes 1-4). Snurportin 1 binds Importiπ ß demonstrably in vitro and the N-terminal IBB domain is necessary for this binding.

The C-terminal domain of Snurportin 1 has an m ₃ G-cap binding activity:

Importin α needs its C-terminal domain to bind the NLS of karyophilic proteins (Codes et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 7633). In order to investigate whether the C-terminal domain of snurportin 1 is analogously involved in the binding of the m ₃ G-cap NLS of snRNPs, cross-linking studies were carried out with the m ₃ G-cap oligo and deletion mutants of snurportin 1. For this purpose, purified recombinant snurportin 1, which lacks the N-terminal amino acids 1-65 (including the IBB domain), could be crosslinked with the radioactively labeled m ₃ G-cap oligo just as efficiently as the recombinant total snurportin 1 (FIG 3B, compare lanes 6 and 7). Deletion of the C-terminal 32 AS could not prevent cross-linking. The deletion of an additional 120 AS from the C-terminal end, however, was able to completely prevent binding to the m ₃ G-cap oligo. It can therefore be assumed that the middle part of the C-terminal region of Snurportin 1 is responsible for the binding to the m ₃ G-Cap. Snurportin 1 stimulates the nuclear import of U snRNP into Xenopus oocytes depending on the IBB domain:

The role of Snurportin 1 in the nuclear transport of U snRNPs was examined by microinjection in Xenopus laevis oocytes. First, m ₃ G-Cap modified HeLa U1 and U5 snRNA was microinjected into the cytoplasm of oocytes together with ApppG-Cap modified U6 snRNA. After one hour, the oocytes were given a second injection with purified Snurportin 1 or buffer. The core transport was examined 3, 5 and 8 hours later (Figure 5). U6 snRNA was injected as a control, since studies had shown that this RNA is transported into the nucleus via the route of the karyophilic proteins (cf. Michaud and Goldfarb (1991), J. Cell. Biol., 112, 215 and (1992) , J. Cell. Biol. 116, 851). The exogenous addition of Snurportin 1 stimulated the core import of U1 and U5 snRNA significantly by approx. 50-70%, while no effect on the ApppG-Cap modified U6 snRNA could be observed (FIG. 7A, compare lanes 4-12 upper part with the Lanes 13-21 in the middle part and for the quantification Figure 7B). The same stimulation of the core import could be observed with exogenously added Snurportin 1, which was affinity-purified from HeLa cells. In summary, these results show that Snurportin 1 is a novel snRNP-specific core import factor.

Importiπ α requires an intact IBB domain for its function (Görlich et al., 1996; supra, Weis et al., 1996; supra). In order to investigate the role of the IBB domain of snurportin 1 in the nuclear transport of snRNPs, the N-terminal deletion mutant of snurportin 1 (Δ1-65 snurportin 1) together with m ₃ G-Cap modified U1 and U5 snRNAs was also microinjected into oocytes. This mutant lacks the IBB domain, but it still has the full m ₃ G-cap binding capacity (see FIG. 3B, lane 7). Δ1-65 Snurportin 1 could not only not accelerate the core import of snRNPs, but also strongly inhibited the import of the m ₃ G-cap-modified U1 and U5 snRNAs (Fig. 7A, lanes 22-30). The unimpeded transport of ApppG-Cap modified U6 snRNA (Figure 4A, lanes 22-30) excludes an unspecific effect of Δ1-65 Snurportin 1 on the core import. This shows that the U1 and U5 snRNA import is due to competition between Δ1-65 Snurportin 1 and the endogenous Xenopus laevis Snurportin 1 for the m ₃ G-Cap. These results substantiate the essential role of the ^' IBB domain for the function of snurportin 1. At the same time, the inhibition of the core import of U1 and U5 snRNAs by the Δ1-65 deletion mutant of snurportin 1 underlines the decisive role of snurportin 1 in the m ₃ G-Cap -dependent core import into Xenopus oocytes.

Snurportin 1 greatly accelerates the nuclear import of U1 snRNPs in vitro in digitonin-permeabilized cells:

Purified HeLa U1 snRNP were injected into Xenopus oocytes in the context of “core import assays” (see example, “in vitro transport system” according to Marshallsay and Lührmann (1994), EMBO J., 13, 222). As a specific control for the core import, Δ5 ^' U1 snRNP was used, in which DNA oligonucleotide-induced RNase H-mediated hydrolysis removed 10 nucleotides from the 5 ^' terminus including the m ₃ G cap. The protein portions of both forms of U1 snRNPs were marked by modification with the fluorescent dye Cy3 (hereinafter U1 snRNP ^* or: Δ5 ^' U1 snRNP ^* ). SDS-PAGE and glycerol gradient centrifugation confirm that the integrity of the snRNP particles was not affected by the labeling method and that the degree of labeling in both forms is comparable.

As shown in Figure 5, intact U1 snRNP * becomes much more efficient in

Presence of cytosolic HeLa S100 extract transported into the nucleus as Δ1 - 65 U1 snRNP * In both cases the transport was energy (Figure 5 C and D) and temperature dependent. These results agree with the assumption that endogenous snurportin 1 in HeLa cell cytosol should contribute significantly to the nuclear import of U1 snRNPs. For this purpose, competition studies were carried out with unlabelled U1 snRNPs or m ₃ GpppG-Cap dinucleotide. In the presence of a 100-fold excess of unlabelled Δ5 ^' U1 snRNP, the core import of intact U1 snRNP ^{* was} reduced by approx. 35-40% (compare 8E with 8A), while the import of Δ5 ^' U1 snRNP * was completely inhibited ( compare 8F with 8B). This means that exogenous Δ5 ^' U1 snRNP particles titrated an snRNP import receptor which is limited in the HeLa cell cytosol and is different from Snurportin 1 (possibly the Sm-Core NLS binding receptor).

Since a significant proportion of the intact U1 snRNPs were still imported in the presence of competitive Δ5 ^' U1 snRNP, the import of these particles is mainly dependent on the m ₃ G-Cap. Consistent with this experiment, the core import of U1 snRNP * could be inhibited by approximately 90% by an excess of intact unlabeled U1 snRNP (G in FIG. 5) or by the simultaneous administration of Δ5 ^' U1 snRNP and synthetic m ₃ GpppG-Cap dinucleotide (H in Fig. 5).

In order to provide direct evidence that snurportin 1 is responsible for nuclear transport in somatic cells, in vitro import studies were carried out in the presence of recombinant snurportin 1. The addition of Snurportin 1 to cytosolic S100 extract resulted in a significant increase in the accumulation of U1 snRNP ^* in the nucleus (up to 180% in the presence of 100 pM exogenous Snurportin 1; compare I with A in Fig. 5). This stimulation is strictly dependent on an m ₃ G cap, since Δ5 ^' U1 snRNP * is not accelerated in the uptake into the core (K in FIG. 5). In addition, the pre-incubation of Snurportin 1 with an excess of -m ₃ GpppG-Cap dinucleotide prevented stimulation of the U1 snRNP import by Snurportin 1. Finally, in accordance with the results from the studies with Xenopus oocytes, stimulation of the core import by exogenous Snurportin 1 was required the presence of its N-terminal IBB domain in snurportin 1. The addition of 100 pM of Δ1-65 snurportin 1 to cytosolic S100 extract from HeLa cells did not accelerate but rather inhibited the U1 snRNP import by approx. 30-40% ( compare L and A in Fig. 5). As expected, Δ1-65 Snurportin 1 did not inhibit the import of Δ5 ^' U1 snRNP ^* (compare M with K and B in Fig. 5). In summary, these data show that in HeLa cells at least two different import receptors mediate the core import of U1 snRNP. These are snurportin 1 and probably the sm-core NLS receptor. In addition, Snurportin 1 contributes significantly to the accumulation of IM snRNP in the nucleus of somatic cells. The polypeptide according to the invention can be used in all cells, but preferably in mammalian cells and human cells. In principle, it can be carried out for all molecules that contain an m ₃ G-cap structure.

In a particular embodiment, the polypeptide according to the invention is specifically deleted at the IBB domain described. For this purpose, amino acids 1-65 on the polypeptide according to the invention - hereinafter referred to as Δ 1-65 Snurportin 1 - are deleted.

This Δ 1-65 Snurportin 1 can preferably be overexpressed in the target cell, preferably mammalian cells and human cells, using a described gene therapy vector according to the methods known to those skilled in the art. This is done to prevent Kermimport of molecules containing m ₃ G-Cap.

The deletion polypeptide according to the invention is preferably produced as a recombinant protein using known recombinant methods, preferably from the nucleic acid according to SEQ ID No. Third

Another subject of the invention is therefore a nucleic acid or a functional variant (as defined for Snurportin 1) according to SEQ ID No. 3 obtainable from the nucleic acid according to SEQ ID No. 2 coding for Δ 1-65 Snurportin 1. The SEQ ID No. 3 shows the necessary sequence by introducing a start codon ATG according to known recombinant methods, as a result of which it is expressed in accordance with the teaching of the nucleic acid described (SEQ ID No. 2) and is accessible to the other applications described, in particular as medicaments and diagnostics. The use of the nucleic acid according to SEQ ID No. is particularly preferred. 3 as part of a gene therapy vector for the desired overexpression of Δ 1-65 Snurportin 1 in cells.

FIG. 4 shows the amino acid sequence of Δ 1-65 Snurportin 1, which can be obtained as an expression product by the methods already described. Another object of the invention is the possibility of the detection, identification, quantification, isolation and purification of m ₃ G-Cap-containing molecules in the presence of ^• snurportin1 or Δ 1-65 snurportin1 in the context of in vitro experiments.

The following examples serve to explain the invention in more detail without restricting it to the products and embodiments described in the examples.

Examples

material and methods

All DNA manipulation enzymes were purchased from New England Biolabs. RNA polymerase and RNasin were purchased from Promega. Pfu polymerase was obtained from Stratagene and RNaseH from Boehrimnger Mannheim. The Cap homologs ApppG and m7GpppG were purchased from Pharmacia. M ₃ GpppG was synthesized and purified as described (Iwase et al. (1989), Nucleic Acids Res., 17, 8979) Radioactive-labeled triphosphate nucleotides and [ ³² P] pCp were purchased from Amersham. Sequencing was done with an automated sequencer using Taq polymerase and double stranded templates (PRISM Ready Reaction DyeDeoxy Terminator cycle sequencing kit) from Applied Biosystems.

Example 1: Preparation of snRNPs and snRNAs

The production of nuclear extracts from HeLa cells (Computer Cell Culture, Moπs, Belgium) is described in Dignam (Dignam et al. (1983), nucleic Acids Res., 11, 1475). Native U1 and U5 snRNPs were activated by affinity chromatography with the moπoclonal antibody (mAb) H20, which was covalently activated on CnBr

Sepharose 4B (Bochnig et al. (1987), Eur. J. Biochem, 168, 461) was bound and obtained by chromatography on MonoQ (Bach et al. (1987), Methods Enzymo, 181, 232). For competition studies and digestion with RNase H, U1 snRNPs were reduced to 12 μg / ml by centrifugation at 160,000 xg (2.5 h, 4 ° C) concentrated. To remove the 5 ^' ends of U1 snRNA, U1 snRNPs (60 ug) with 10 U RNase H and a DNA oligonucleotide (5 ^' -CAGGTAAGTAT-3 ^' 1, 4 ug / ul) in a volume of 50 ul incubated (Lamond and Sproat (1994), RNA processing: A Practical Approach, IRL Press, Oxford UK, 103 ff.). Remaining m ₃ G-cap-bearing U1 snRNPs were removed from the reaction mixture

Immunoprecipitation with 25 μl H20-mAb coupled to Sepharose beads in a final volume of 100 μl PBS (pH 8) removed. After two hours of incubation at 4 ° C., the samples were briefly centrifuged and the Δ5 ^' U1 snRNPs obtained in the supernatant and concentrated to a concentration of 30 μg / ml using an Amicon Uitrafiltration cell (Micrcon-100 concentrator). The purity and intactness of the particles was checked by SDS-PAGE and sedimentation analysis on a glycerol gradient (5-20%, PBS, pH8) in a Beckmann TLS-55 rotor (Marshallsay and Lührmann, 1994, supra). U1, Δ5 ^' U1 and U5 snRNA were isolated as described in Sumpter (Sumpter et al. (1992), Mol. Biol. Rep., 16, 229).

Example 2: UV cross-linking studies

An m ₃ G-cap oligonucleotide (m ₃ GpppAmpUmpA), which is identical to the 5 ^' end of the HeLa U1 snRNA, was synthesized according to Sekine (Sekine et al. (1994) Nucleic Acids Symp. Ser., 31, 61; Sekine et al. (1996), J. Org. Chem., 61, 4412). Preparative [ ³² P] pCp labeling of the m ₃ G cap oligos (5 μg) was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573), with the exception that 250 μCi [ ³² P] pCp were used. After phenol extraction and ethanol precipitation, the radioactively labeled m ₃ G cap oligos were cleaned on a 20% polyacrylamide gel with 7.5 M urea. For the identification of the m ₃ G-cap binding proteins in cytosolic HeLa cell extracts by UV cross-linking, a pM [ ³² P] pCp 3 ^' end-labeled m ₃ G-cap oligos (2.5 x 106 cpm / pM) for 10 min on ice with either 25 μg S100 cytosolic extract or 1.5 μg purified HeLa or recombinant Snurportin 1 in a volume of 10 μl. The reaction mixture was then irradiated at 254 πm with a Sylvania G8T5 UV lamp for 5 min at a distance of 2 cm. The cross-linked proteins were separated by SDS-PAGE and visualized by autoradiography.

Example 3: Purification of the 45 kD m ₃ G-Cap binding protein

HeLa S100 extract, prepared as described by Dignam (Dignam et al. (1983), Nucleic Acids Res., 11, 1475), was carried out on a 240 ml CM-Sepharose FF column

(Pharmacia) pre-cleaned. For this purpose, 960 ml of the extract (approx. 3.5 mg / ml protein) were added in a buffer D (25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl ₂ , 0.25 mM EDTA, 8.7% Glycerin, 2mM DTT, 1mM PMSF, 0.1mM benzamidine, 10μg / ml bacitracin, pH 7.9) equilibrated column (volume 240ml) separated. The run containing the 45 kD m ₃ G cap binding protein was applied directly to a Q-Sepharose FF column (volume 240 ml, Pharmacia) equilibrated in buffer D. The mixture was then washed with 2 l of buffer D and the bound proteins were eluted with a linear NaCl gradient (100-750 mM in buffer D) over 900 ml. Aliquots (0.5 ml) were dialyzed against buffer D at 4 ° C. for 4 h and analyzed for m ₃ G-cap binding activity by means of the UV cross-linking assay. Most of the activity eluted between 170 and 280 mM NaCl. These fractions were pooled (210 ml, 627 mg protein), diluted to 100 mM NaCl in buffer D (approx. 1.6 mg / ml) and applied to an m ₃ G-Cap affinity column (see next section for preparation of the column) . The column matrix was washed with 10 volumes of buffer D and with a gradually increasing salt concentration (depending on 2 ml 0.15; 0.2; 0.3; 0.4; 0.5; 0.6; 1 and 1.5 M) NaCl in buffer D) eluted from the column. A 0.5 ml aliquot of each fraction was dialyzed against buffer D and concentrated to a concentration of 30 μg / ml protein using an Amicoπ ultrafiltration cell. The m ₃ G cap-binding activity was then detected using the UV crosslinking assay. The total yield was 0.36 mg protein, which corresponded to 0.01% of the starting protein amount. Example 4: Preparation of the m ₃ G cap affinity column

For the affinity purification of the m ₃ G-cap binding protein, a biotinylated m ₃ G-cap oligo (m ₃ GpppAmpUmpAp- (CH ₂ ) 6-biotin) was chemically synthesized. The coupling of the biotinylated m ₃ G cap oligo was carried out according to Lamond and Sproat (1994, supra). 50 nM of the biotinylated m ₃ G-cap oligos was on 1 ml blocked streptavidin agarose for 18 h at 4 ° C in an equal volume of binding buffer (25 mM Hepes-KOH, 500 mM KCL, 1 mM EDTA, 1 mM DTT, 10% glycerin, pH 7.9). The beads were washed with 5 volumes of buffer D before use.

Example 5: Microsequencing, cDNA cloning and expression of Snurportin 1

Purified Snurportin 1 was digested with Lys-C, the peptides separated by HPLC and the AS sequence of various eluted fractions determined using an ABI 477A protein sequencer. The following peptide sequences, which were characterized with three overlapping EST of the ATCC (GenBank accession numbers: H43467, H08432, R14245): (a) KYSSLEQSERRRRLLELQK, (b) KRLDYVNHARRLAEDD, (c) KRLAIVASRGSTSAYTE, (d). (e) KLTHK. As could be determined by DNA scaling, the clone R14245 contained a 1.6 kb fragment with an ORF which encoded all five Snurportin 1 peptide sequences. For the expression of His-Tag-Snurportin 1 and of N-terminal deletion mutants (Δ1 -65 Snurportinl) either the complete Snurportin 1 or the sequence coding for the AS 66-360 was derived from a pBluescript plasmid which contains the entire Snurportin 1 cDNA contained (pBS / spπ1), amplified by PCR and cloned into the Ncol / BamHI restriction sites of the plasmid pET28b (Novagen). The resulting plasmids (pET28b / sρn1 and pET28b / Δ1- 65spn1) were transformed into the E. coli bacterial strain BL21 [LysS]. The transformed strains were incubated up to an OD 600 of 0.8 and the protein expression with isopropyl-β-D-thiogalactopyranoside was induced for 4 h at 30 ° C. The cells from a 2 l culture were sonicated for 1 min on ice in resuspension buffer D (25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl, 1 mM PMSF, 0.1 mM Benzamidiπ, 10 μg / ml bacitracin , 20 µg / ml leupeptin, 5 mM Imidazole, 10 mM β MerCaptoethanol, pH 7.9) treated for lysis. After clarification of the solution by centrifugation at 25,000 g for 45 min. and 100,000 xg for 120 min. the supernatant was applied to a nickel-nitrilo-acetic acid (Ni-NTA) agarose column (Qiagen). The bound proteins were eluted with resuspension buffer containing 200 mM imidazole and 8.7% glycerol. For further purification, the proteins were dialyzed against buffer D at 4 ° C. for 2 h and subjected to an m ₃ G-cap affinity chromatography as described above. The following primers were used for the PCR amplification: (i) pET28b / spn1 -for [5 ^' - GGGCCATGGAAGAGTTGAGTCAGGCCCTG-3 ^' ]; (ii) pET28b / Δ1-65 / spn1-for [GGGCCATGGCTGAAGATGACTGGACAGGGATG-3 ^' ], (iii) pET28b / spn1-rev and pET28b / Δ1 -65 / spn1-rev [TTTGGATCCGCATTCTCCATGAGGCATC 3 ^'' -. All constructs generated by PCR were confirmed by sequencing. The expression and purification of hSRPIα and Xenopus Importin α have already been described (Weis et al., 1995; Görlich et al., 1994).

Example 6: In vitro translation and protein binding assays

Importin β was produced with the help of rabbit reticulocyte lysate by in vitro translation of the plasmid pKW275 (Weis et al., 1996, supra) using the TnT kit (Promega) according to the manufacturer's specification. The binding of Snurportin 1, hSRPIα or Importin α to Importin ß using Ni-NTA beads was carried out exactly as described by Weis (Weis et al. (1996), supra).

A) Procedure for labeling RNA and U snRNPs

[ ³² P] pCp labeling of gel-purified HeLa U1 and U5 snRNAs was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573). The in vitro transcription of the [ ³² P] pCp-labeled ApppG U6 snRNA was carried out according to Fischer (Fischer et al. (1991), J. Cell. Biol. 113, 705).

For in vitro core import assays, the isolated U1 snRNPs or Δ5 ^' -U1 snRNPs were carried out with the monofunctional reactive fluorescent dye Cy3 according to the manufacturer's instructions (Amersham). The unbound dye molecules were subjected to ultrafiltration in an Amicon cell and subsequent dialysis with PBS (pH 8) removed until no dye molecule could be detected in the passing fractions. The sedimentation analysis of the fluorescent-labeled snRNPs was carried out as described above.

B) Oocyte injections

Microinjections were carried out as described by Fischer (Fischer et al. (1993), supra), with the exception that OR-2 buffer was used instead of MBS buffer. After incubation at 18 ° C for the indicated periods, the oocytes were in J buffer (70 mM NH ₄ CI, 7 mM MgCl ₂ , 0.1 mM EDTA, 2.5 mM DTT, 20 mM Tris-HCl, 10 % Glycerin, pH 7.5) transferred and separated manually. The RNA was purified and analyzed as described (Fischer et al., 1993, supra). The gels were quantified using a Molecular Dynamics (Sunnyvale, CA) phosphor imaging system with the Image Quant software version 3.0.

Example 7: Core import assays

Kemimportreaktioneπ were carried out with HeLa cells, which are on glass coverslips to a confluence of 50-70% in Dulbecco ^'s modified Eagle medium (Gibco-BRL) with 10% fetal calf serum and penicillin / streptomycin (Gibco-BRL) at 37 ° C, 5% CO _{2 had} grown. After permeabilization with digitonin (Adams et al. (1990), J. Cell Biol., 111, 807), the cells were washed with ice-cold import buffer (25 mM Hepes pH 7.9, 100 mM NaCl, 2.5 mM Mg Cl ₂ , 0.25 mM EDTA) and washed with 25 μl import buffer containing 0.2 mg / ml tRNA, 1 mM ATP, 1 mM creatine phosphate, 20 U / ml creatine phosphokinase (Sigma), 4 μg / ml U1 snRNP ^* Δ5 ^' -U1 snRNP * (labeled as described above) and 10 ul HeLa S100 cytosolic extract (5mg / ml protein), incubated. Additional reagents were added as described in the figure legends. The import mix was depleted by ATP, in which ATP, creatine phosphate and

Creatine phosphate kinase was not added and preincubation took place for 30 min at 25 ° C in the presence of 20 U / ml apyrase (Sigma). The incubation of the import reactions was carried out at 25 ° C. for 30 min and the reaction was terminated as described by Marshallsay and Lührmann (1994, supra). After the samples were covered with Fluoprep (bioMerieux), they were covered with Using the 50 x objective of a Leica DM / IRB inverse fluorescent microscope analyzed and saved in digitized images with a CCD camera. The images were processed with the Adobe Photoshop version 3.0 software and quantified with the NIH image software version 1.6. For each sample, the average fluorescence of approximately 100 randomly selected nuclei was calculated from at least three independent assays and averaged.

Claims

claims

1 . Polypeptide with an amino acid sequence according to SEQ ID No. 1 or a functional variant thereof, and parts thereof with at least 6 amino acids.

2. Polypeptide according to claim 1, characterized in that the polypeptide is an m ₃ G-cap-specific nuclear import receptor protein.

3. Polypeptide according to claim 1 and 2 obtainable from cytoplasmic extracts of HeLa cells.

4. Polypeptide according to claim 1 to 3, characterized in that the polypeptide contains an m ₃ G-cap-specific domain.

5. Antibody against a polypeptide according to claim 1 to 4.

6. Nucleic acid coding for a polypeptide according to claims 1 to 4 or a functional variant thereof, and parts thereof with at least 8 nucleotides, where SEQ ID No. 2 is part of the claim.

7. Nucleic acid according to SEQ ID No. 3 obtainable from a nucleic acid according to claim 6, coding for a deletion polypeptide according to SEQ ID No. 4, with SEQ ID No. 3 is part of the claim.

8. Nucleic acid according to claim 6 and 7, characterized in that the nucleic acid is a DNA or RNA, preferably a double-stranded DNA.

9. Nucleic acid according to claim 6 to 8, characterized in that the nucleic acid contains one or more non-coding sequences.

10. Nucleic acid according to one of claims 6 to 9, characterized in that the nucleic acid is contained in a vector, preferably in an expression vector or gene therapy vector.

1 1. Polypeptide with an amino acid sequence according to SEQ ID No. 4 obtainable from a nucleic acid according to claim 7, characterized in that the 'polypeptide contains no IBB domain.

12. A method for producing a nucleic acid according to any one of claims 6 to 9, characterized in that the nucleic acid is chemically synthesized or isolated from a gene bank using a probe.

1 3. A method for producing an antibody according to claim 5, characterized in that a mammal is immunized with a polypeptide according to claim 1 or 9 and optionally the resulting antibodies are isolated.

14. Medicament containing a nucleic acid according to one of claims 6 to 9 and / or a polypeptide according to one of claims 1 to 5 or 11 and optionally pharmaceutically acceptable additives and / or auxiliaries.

1 5. Process for the manufacture of a medicament for the treatment of cancer, autoimmune diseases, especially multiple sclerosis or rheumatoid

Arthritis, Alzheimer's disease, allergies, especially neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, especially in immunosuppression, especially in transplants , characterized in that a nucleic acid according to one of claims 6 to 9 or a polypeptide according to claim 1 or 11 or antibody according to claim 5 is formulated with a pharmaceutically acceptable additive and / or auxiliary.

1 6. Diagnostic agent containing a nucleic acid according to one of claims 6 to 9 or a polypeptide according to claim 1 or 1 1 or antibody according to claim 5 and optionally suitable additives and / or auxiliaries.

1 7. Method for the production of a diagnostic agent for the diagnosis of cancer,

Autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for analyzing cell metabolism, in particular of the immune status, especially in the case of transplantations, characterized in that a nucleic acid according to one of claims 6 to 9 or a polypeptide according to claim 1 or 11 or an antibody according to claim 5 is added to pharmaceutically acceptable carriers.

1 8. Test for the identification of functional interactors containing a nucleic acid according to one of claims 6 to 9 or a polypeptide according to claim 1 or 1 1 or antibodies according to claim 5 and optionally suitable additives and / or auxiliaries.

1 9. Use of a nucleic acid according to one of claims 6 to 9 or a polypeptide according to claim 1 or 1 1 for the identification of functional interactors.

20. Use of a nucleic acid according to one of claims 6 to 9 for finding variants of a human m ₃ G-cap-specific nuclear import receptor, characterized in that a gene bank is searched with the said nucleic acid and the variant found is isolated.

21. Use of a polypeptide according to one of claims 1 to 4 as a m ₃ G cap-specific nuclear import receptor and for transporting m ₃ G cap-containing molecules into the core.

22. Use of a polypeptide according to any one of claims 1 to 4 or 1 1 for the detection and / or identification of molecules containing m ₃ G-Cap.

3. Use of a polypeptide according to one of claims 1 to 4 or 1 1 for the purification and quantification of m ₃ G-cap containing molecules.