WO2000004144A1 - Snurportin 1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung - Google Patents
Snurportin 1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung Download PDFInfo
- Publication number
- WO2000004144A1 WO2000004144A1 PCT/EP1999/004750 EP9904750W WO0004144A1 WO 2000004144 A1 WO2000004144 A1 WO 2000004144A1 EP 9904750 W EP9904750 W EP 9904750W WO 0004144 A1 WO0004144 A1 WO 0004144A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- cap
- polypeptide
- polypeptide according
- snurportin
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to a human 5 ' -2,2,7-terminal trimethyl guanosine (hereinafter: m 3 G) -cap-specific nuclear import receptor protein, obtainable by nuclear, cytosol extraction and expression of recombinant nucleic acids, and their use in particular as a medicament , Diagnostic.
- m 3 G human 5 ' -2,2,7-terminal trimethyl guanosine
- proteins protein targeting
- Newly synthesized proteins contain signals that determine their final destination in the cell. So also in the case of the so-called protein import route into the nucleus from the cytosol, which takes place through a nuclear pore complex (NPC), and generally through a saturable one
- NPC nuclear pore complex
- Transport receptor - which specifically recognizes a nuclear localization signal (NLS) - is mediated (Göriich and Mattaj (1996), Science, 107, 1513, in particular Table 1; Nigg (1997), Nature, 386; 779; Ohno et al. (1998) , Cell, 92, 327).
- NLS nuclear localization signal
- the so-called basic NLS mostly consist of one or a collection of several basic amino acids (overview in Dingwall and Laskey (1991), Trends Biochem. Sei., 16, 478).
- the proteins which have such a basic NLS are referred to below as karyophilic proteins.
- IBB importin ß binding domain
- the NLS-importin complex is bound to the NPC by means of Importin ß (Chi et al. (1995), J Cell Biol., 130, 265; Görlich et al. (1995), Curr. Biol., 5, 383 and (1995) Nature, 377, 246; Imamoto et al. (1995), FEBS Lett, 368, 415; Moroianu et al. (1995), Natl. Acad. Sci. USA., 92, 2008. These are also called karyopherin a / ß (Moroianu et al. 1995 supra; Roh et al. (1995) Proc. Natl. Acad Be. USA, 92, 1769).
- the translocation of the complex through the core pore requires additional energy-providing transport factors such as GTP and Ran (Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore and Blobel (1993), Nature, 365, 661) and p10 / NTF2 (Moore and Blobel, (1994), Proc. Natl. Acad. Sei. USA, 91, 10212; Paschal and Geraee (1995), J. Cell. Biol., 129, 925).
- GTP and Ran Melchior et al. (1993) J. Cell. Biol., 123, 1649; Moore and Blobel (1993), Nature, 365, 661)
- p10 / NTF2 p10 / NTF2
- M9 is recognized directly by Transportin (Pollard et al. 1996, Cell, 86, 985; Nakiel ⁇ y et al., Exp. Cell. Res., 1996, 261; Fridell et al., J. Cell Sei. 1997, 1325).
- Transportin is functional without an ⁇ subunit, while the binding to the NPC and the Ran-dependent translocation of the hnRNP A1 / Transportin complex into the nucleus take place in an analogous manner to Importin ß (Nakielny et al. (1996) , Exp. Cell. Res., 229, 261; Izaurralde et al. (1997), J. Cell Biol., 137, 27).
- Each snRNP particle consists of one (U1, U2 and U5) or two (U4 / U6) snRNA molecules and a common set of eight basic proteins (B, B ' , D1, D2, D3, E, F and G, so-called Sm proteins ), which are bound to each of the m 3 G-cap containing s ⁇ RNAs U1, U2, U4 and U5 and differ with respect to the respective snRNA in specific further associated proteins (Will and Llikma ⁇ n (1997), Curr. Opin. Cell. Biol. , 9, 320).
- the biogenesis of the snRNPs is dependent on a bidirectional transport of the snRNA through the nuclear membrane.
- the snRNAs (U1, U2, U4 and U5) are specifically synthesized with a 5 ' terminal 7 monomethyl-guanosine (m 7 G-) cap structure, while the Sm proteins are formed in the cytoplasm and do not migrate into the nucleus without binding to U snRNA .
- the mature snRNP particle is transported back to the nucleus in a receptor and energy dependent manner (Neuman de Vegvar and Dahlberg (1995) Mol. Cell. Biol., 10, 3365).
- the NLS of the U1 snRNP in Xenopus laevis oocytes is described, which is also complex in nature.
- the m 3 G-Cap Fischer and Lroundmann (1990), Science, 249, 786; Hamm et al., (1990) Cell, 62, 569
- an unspecified part in the Sm basic domain Sm Core NLS; Fischer et al. (1993) EMBO J. 12, 573.
- spliceosomal snRNAs require the m 3 G-Cap to the same extent for nuclear transport in oocytes. While U1 and U2 snRNA definitely need the m 3 G-Cap for transport into the nucleus, U4 and U5 snRNAs can also reach the nucleus as ApppG-Cap derivatives, even if the efficiency is considerably reduced (Fischer et al. (1991), J. Cell. Biol., 113, 705; Michaud and Golgfarb (1992) J. Cell. Biol., 116, 851). Even if the m 3 G-Cap is not essential for the core transport of snRNAs U4 and U5, it accelerates their transport considerably.
- the object of the invention is therefore to provide a polypeptide which interacts specifically with m 3 G-Cap and is used as m 3 G-Cap-specific core import protein receptor in vivo and in vitro.
- the object is achieved in that a 45 kD protein from cytoplasmic extracts of HeLa cells is provided with high specificity for m 3 G-Cap structures.
- Kemimportrezeptorprotei ⁇ in the sense of this invention means that the polypeptide acts on the one hand as a receptor and on the other hand mediates the transport of formulated molecules from the cytosol (cytoplasm) into the nucleus.
- the m 3 G-cap-specific nuclear import protein receptor means that the above-defined core import receptor specifically receptes molecules with m 3 G-cap structures, ie recognizes them in the broadest sense, and mediates their transport into the nucleus, both “in vitro” and also "in vivo".
- Molecules containing m 3 G-cap in the sense of this invention means that they are accessible to the m 3 G-cap-specific core import protein receptor according to the invention. Fusion molecules made of m 3 G-Cap and protein or other biologically relevant molecules are therefore also conceivable.
- in vivo means a conversion, i.e. a reaction, understood, that takes place within a living organism.
- in vitro means an implementation, i.e. a reaction, understood, that takes place outside of a living organism.
- Cap in the sense of this invention has the meaning as it is known to the expert in the field of U snRNA and snRNP work.
- the identification of a potential m 3 G-cap binding protein is carried out with the aid of a UV crosslinking assay and the synthetic substrate (m 3 G) pppAmpUmpA oligonucleotide (m 3 G-Ca ⁇ -oligo) as substrate.
- the synthetic substrate m 3 G
- pppAmpUmpA oligonucleotide m 3 G-Ca ⁇ -oligo
- the proteins are analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) and autoradiography the cross-linked radioactively labeled proteins .
- FIGS. 1A and 1B show that a radioactively labeled main band with an apparent molecular weight of 45 kD (arrowhead in FIGS. 1A and 1B) and three less intensely labeled proteins with the molecular weights 25, 35 and 150 kD are reproducibly detected.
- the m 3 G-Cap specificity for the polypeptide according to the invention preferably a 45 kD protein, which is essential to the invention, is recognized with the aid of competition studies with various unlabeled cap structures. While a 10,000-fold excess of m 7 GpppG or ApppG cap dinucleotide shows only very slight effects on the effectiveness of the UV crosslink with the radioactively labeled m 3 G cap oligo on the 45 kD protein (FIG. 1A, lanes 2- 4 and 5-7), a 10 to 100-fold excess of unlabelled m 3 G-Cap oligo is sufficient to completely prevent the binding to the 45 kD protein (FIG. 1A, traces 9-11).
- the polypeptide according to the task preferably a 45 kD protein, binds both to isolated m 3 G-cap structures and to ⁇ ative m 3 G-caps in the U1 snRNA as well as to ⁇ ative U1 snRNP particles. This could be demonstrated by the inhibition of UV crosslinking of the m 3 G cap oligo to the 45 kD protein by U1 snRNA and U1 snRNP (FIG. 1B, lanes 2-5 and 11-14). The interaction of the 45 kD protein with U1 snRNA or U1 snRNP is strictly dependent on the presence of the 5 ' - terminal m 3 G-Cap structure.
- An object of the present invention is therefore the task-related polypeptide as such with an amino acid sequence according to SEQ ID No. 1 or a functional variant thereof, and parts thereof with at least six
- Amino acids preferably with at least twelve amino acids, in particular with at least 65 amino acids and especially with 360 amino acids (hereinafter referred to as "inventive polypeptide” or “Snurportin 1").
- an approximately 6-12, preferably approximately 8 amino acids long polypeptide can contain an epitope which, after coupling to a support, is used to produce specific poly- or monoclonal antibodies.
- Polypeptides with one A length of at least approx. 65 amino acids can also be used directly without a carrier to produce poly- or monoclonal antibodies.
- the term “functional variant” in the sense of the present invention means polypeptides which are functionally related to the peptide according to the invention, ie which have an m 3 G-cap-specific core import receptor activity. Variants are also understood to mean allelic variants or polypeptides that are used by others For the purposes of this invention, this includes polypeptides that come from different human individuals.
- this also includes polypeptides which have a sequence homology, in particular a sequence identity of approximately 70%, preferably approximately 80%, in particular approximately 90%, in particular approximately 95%, of the polypeptide with the amino acid sequence SEQ ID No. Have 1. Furthermore, this also includes deletion of the polypeptide in the range from about 1-65, preferably from about 1-30, in particular from about 1-15, especially from about 1-6 amino acids. For example, the first amino acid methionine may be absent without significantly changing the function of the polypeptide.
- this also includes fusion proteins which contain the above-described polypeptides according to the invention, the fusion proteins themselves already having the function of a human m 3 G-cap specific nuclear import tether or only being able to acquire the specific function after the fusion portion has been split off.
- this includes fusion proteins with a proportion of in particular non-human sequences of about 1 to 150, preferably about 1 to 100, in particular about 1 to 65, especially about 1 to 30, amino acids.
- non-human peptide sequences are prokaryotic peptide sequences, for example from the galactosidase from E. co, or a so-called histidine tag, for example a Met-Ala-His6 tag.
- a fusion protein with a so-called histidine tag is particularly advantageous for purifying the expressed protein on metal ion-containing columns, for example on a Ni 2+ NTA column.
- NTA stands for the chelator “nitrilotriacetic acid” (Qiagen GmbH, Hilden).
- the parts of the polypeptide according to the invention represent, for example, epitopes that can be specifically recognized by antibodies.
- This cDNA coding for the polypeptide according to the invention codes for 360 amino acids (AS) with a predicted molecular weight of 45 kD (FIG. 1A).
- AS 360 amino acids
- FIG. 1A A database search with the human snurportin 1 surprisingly showed a high homology in the N-terminal region (AS 27 to 65, FIG. 6B to the IBB domain from importin ⁇ (31% identity, 62% similarity to hSRPI, similar correspondences were found with hRchl, xlmp ⁇ and ySRP1 observed, Fig.
- the parts of the polypeptide mentioned can also be synthesized with the aid of classic peptide synthesis (Merrifield technique). They are particularly suitable for obtaining antisera, with the aid of which suitable gene expression banks can be searched in order to arrive at further functional variants of the polypeptide according to the invention.
- the polypeptide according to the invention is a recombinantly produced protein.
- the host cell is preferably a bacterium (e.g. E. coli strains such as DH5, HB101 or BL21), yeasts (e.g. Saccharomyces cerevisiae or Pichia pastoris), fungi (e.g. Aspergillus spe ⁇ ), mammalian cell lines (e.g.
- Snurportin is particularly preferably secreted by the host cell
- the production of such host cells for the production of a recombinant Snurportin can be carried out according to methods known to the person skilled in the art.
- Expression vectors are widely described in the literature.
- a selection marker gene and an origin of replication which ensures replication in the selected host, they generally contain a bacterial or viral promoter, and usually a termination signal for transcription.
- the DNA sequence which naturally controls the transcription of the corresponding gene can be used as the promoter sequence.
- This sequence can also be exchanged for other promoter sequences. Both promoters which bring about a constitutive expression of the gene and inducible promoters which allow targeted regulation of the expression of the downstream gene can be used. Bacterial and viral promoter sequences with these properties are described in detail in the literature. Regulatory sequences for expression in microorganisms (eg E. coli, S. cerevisiae) have been adequately described in the literature. Promoters that allow a particularly strong expression of the downstream gene are, for example, the T7 promoter (Studier et al., Methods in Enzymology (1990), 185, 60-89), Iacuv5, trp, trp-lacUV5 (DeBoer et al.
- the cultivation of the host cell takes place in nutrient media which correspond to the needs of the host cell used in each case, in particular taking into account pH, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc.
- the expression vectors can be, for example, prokaryotic or eukaryotic expression vectors.
- prokaryotic expression vectors for expression in E. coli are, for example, the T7 expression vector pGM10 (Martin, 1996), which codes for an N-terminal Met-Ala-His6 tag, which advantageously purifies the expressed protein via a Ni2 + -NTA Column allows.
- Suitable eukaryotic expression vectors for expression in Saeeharomyces cerevisiae are vectors p426Met25 or p426GAL1 (Mumberg et al., Nucl. Acids Res., 1994, (22), 5767), for expression in insect cells, for example baculovirus vectors as in EP -B1-0127839 or EP-B1-0549721, and for expression in mammalian cells, for example SV40 vectors, which are generally available.
- the expression vectors also contain suitable regulatory sequences for the host cell, such as e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhedrin promoter for expression in insect cells (see, for example, EP-B1-0127839) or the early SV40 promoter or LTR promoters, for example by MMTV (Mouse Mammary Tumor Virus; Lee et al. (1981) Nature, 214, 228).
- suitable regulatory sequences for the host cell such as e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhe
- the cleaning of the enzyme produced by the host cells can be carried out according to conventional cleaning methods such as precipitation, ion exchange.
- a polypeptide By modifying the DNA expressed in the host cells and coding for the polypeptide according to the invention, a polypeptide can be produced in the host cell which, due to certain properties, can be more easily isolated from the culture medium. It is thus possible to express the protein to be expressed as a fusion protein with a further polypeptide sequence, the specific binding properties of which enable the fusion protein to be isolated via affinity chromatography (e.g. Hopp et al. (1988), Bio / Technology, 6, 1204-1210; Sassenfeld ( 1990), Trends Biotechnol., 8, 88-93).
- affinity chromatography e.g. Hopp et al. (1988), Bio / Technology, 6, 1204-1210; Sassenfeld ( 1990), Trends Biotechnol., 8, 88-93).
- the present invention therefore furthermore relates to a nucleic acid coding for an m 3 G-cap-specific nuclear import receptor protein with a nucleic acid sequence according to FIG. 2 or a functional variant thereof, and parts thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, in particular with at least 100 nucleotides, especially with at least 300 nucleotides (hereinafter referred to as "nucleic acid according to the invention").
- the complete nucleic acid encodes a protein with 360 amino acids and a molecular mass of 45 kDa.
- the expression of the nucleic acid in E. coli leads to a protein which has similar enzymatic activities to that of a human m 3 G cap-specific nuclear import receptor.
- nucleic acid is a nucleic acid which codes for a human Snurportin 1.
- the nucleic acid according to the invention is a DNA or RNA, preferably a double-stranded DNA, and in particular a DNA with a nucleic acid sequence according to SEQ ID No. 2.
- the term “functional variant” is understood to mean a nucleic acid which is functionally related to the human m 3 G-cap-specific nuclear import receptor and in particular human Is of origin. Examples of related nucleic acids are, for example, nucleic acids from different human cells or tissues or allelic variants. The present invention also encompasses variants of nucleic acids which can originate from different human individuals.
- variants means nucleic acids which have a homology, in particular a sequence identity of approximately 60%, preferably approximately 75%, in particular approximately 90% and above all approximately 95 % exhibit.
- the parts of the nucleic acid according to the invention can be used, for example, for the production of individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids.
- a nucleic acid of at least approx. 8 nucleotides is suitable as an antisense nucleic acid
- a nucleic acid of at least approx. 15 nucleotides as a primer in the PCR method is suitable as a nucleic acid of at least approx. 20 nucleotides for the identification of further variants
- a nucleic acid of at least approx 100 nucleotides as a probe for example, for the production of individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids.
- the invention contains
- Nucleic acid one or more non-coding sequences.
- the non-coding sequences are, for example, intron sequences or regulatory sequences, such as promoter or enhancer sequences, for the controlled expression of the m 3 G-cap-specific core import receptor.
- the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector or vector which is active in gene therapy.
- virus vectors preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, for example a Adeno-associated virus vector consisting exclusively of two inserted terminal repeat sequences (ITR).
- ITR inserted terminal repeat sequences
- Suitable adenovirus vectors are described, for example, in McGrory, W.J. et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors” (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S et al. (1986) EMBO J .. 5, 2377 or WO95 / 00655.
- Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO95 / 23867; Samulski, R.J. (1989) J. Virol, 63, 3822; WO95 / 23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R.M. (1994) Human Gene Therapy 5, 793.
- Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes. Are suitable for this
- the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the DNA is completely complexed by the liposomes.
- the nucleic acid according to the invention can be chemically described, for example, in 2 disclosed sequence or using SEQ ID No. 1 disclosed peptide sequence can be synthesized using the genetic code, for example by the phosphotriester method (see, for example, Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4).
- Another way of getting hold of the nucleic acid according to the invention is to isolate it from a suitable library, for example from a human gene bank, using a suitable probe (see, for example, Sambrook, J. et al. (1989) Molecular Clo ⁇ ing. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York).
- Suitable as a probe For example, single-stranded DNA fragments having a length of about 100 to 1000 nucleotides, preferably with a length of about 200 to 500 nucleotides, 'in particular with a length of about 300 to 400 nucleotides, the sequence of the nucleic acid sequence according to SEQ ID No. 2 can be derived.
- Another object of the present invention also relates to antibodies which react specifically with the polypeptide according to the invention, the above-mentioned parts of the polypeptide either being themselves immunogenic or by coupling to suitable carriers, such as e.g. bovine serum albumin, immunogenic or can be increased in their immunogenicity.
- suitable carriers such as e.g. bovine serum albumin
- the antibodies are either polyclonal or monoclonal.
- the preparation which is also an object of the present invention, is carried out, for example, by generally known methods by immunizing a mammal, for example a rabbit, with the polypeptide according to the invention or the parts thereof, optionally in the presence of e.g. Freu ⁇ d's adjuvant and / or aluminum hydroxide gels (see e.g. Diamond, B.A. et al. (1981) The New England Journal of Medicine, 1344).
- the polyclonal antibodies produced in the animal as a result of an immunological reaction can then be easily isolated from the blood using generally known methods and e.g. purify by column chromatography. Preference is given to affinity purification of the antibodies, in which, for example, the C-terminal DAN fragment has been coupled to an NHS-activated HiTrap column.
- Monoclonal antibodies can be produced, for example, by the known method from Winter & Milstei ⁇ (Winter, G. & Milstein, C. (1991) Nature, 349, 293).
- Another object of the present invention is also a medicament which contains a nucleic acid according to the invention or a polypeptide according to the invention and optionally suitable additives or auxiliaries and a method for producing a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, especially in immunosuppression , especially in transplantations, in which a nucleic acid according to the invention, for example a so-called antisense nucleic acid, or a polypeptide according to the invention is formulated with pharmaceutically acceptable additives and / or auxiliary substances.
- autoimmune diseases in particular multiple sclerosis or rheumatoid arthritis
- Alzheimer's disease allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis,
- a medicinal product which contains the nucleic acid according to the invention in naked form or in the form of one of the gene therapy-effective vectors described above or in a form complexed with liposomes is particularly suitable for gene therapy use in humans.
- Suitable additives and / or auxiliary substances are e.g. a physiological saline, stabilizers, proteinase inhibitors, nuclease inhibitors, etc.
- Another object of the present invention is also a diagnostic agent containing a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention and, if appropriate, suitable ones
- a diagnostic agent based on the Polymerase chain reaction PCR diagnostics, for example according to EP-0200362
- a Northern blot can be produced. These tests are based on the specific hybridization of the nucleic acid according to the invention with the complementary counter strand, usually the corresponding mRNA.
- the nucleic acid according to the invention can also be modified here, as described, for example, in EP0063879.
- a DNA fragment according to the invention is preferably labeled using suitable reagents, for example radioactive with -P 32 -dATP or non-radioactive with biotin, according to generally known methods and incubated with isolated RNA, which was preferably bound to suitable membranes made of cellulose or nylon, for example .
- RNA it is also advantageous to separate the isolated RNA prior to hybridization and binding to a membrane, for example by means of agarose gel electrophoresis. With the same amount of RNA examined from each tissue sample, the amount of mRNA that was specifically labeled by the probe can thus be determined.
- Another diagnostic agent contains the polypeptide according to the invention or the immunogenic parts thereof described in more detail above.
- the polypeptide or parts thereof which are preferably attached to a solid phase, e.g. made of nitrocellulose or nylon, for example with the body fluid to be examined z. As blood, are brought into contact in vitro, for example with
- the antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies.
- the label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.
- Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample from humans can be easily and quickly examined to determine whether the polypeptide in question is present.
- the antibodies according to the invention are labeled, for example, with an enzyme, as already described above.
- the specific one Antibody-peptide complex can be detected easily and just as quickly via an enzymatic color reaction.
- Another object of the present invention also relates to a test for the identification of functional interactors, such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
- functional interactors such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.
- a suitable test for identifying functional interactors is e.g. B. the so-called "two-hybrid system" (Fields, S. & Sternglanz, R. (1994) Trends in Genetics, 10, 286).
- a cell for example a yeast cell, is transformed with one or more expression vectors or transfected that express a fusion protein that contains the polypeptide according to the invention and a DNA binding domain of a known protein, for example from Gal4 or LexA from E. coli, and / or express a fusion protein that contains an unknown polypeptide and a transcription activation domain, for example from Gal4, herpesvirus VP16 or B42.
- the cell contains a reporter gene, for example the LacZ gene from E.
- the unknown polypeptide is encoded, for example, by a DNA fragment that comes from a gene bank, for example from a human gene bank immediately produced a cDNA library using the expression vectors described in yeast so that the test can be carried out immediately thereafter.
- a yeast expression vector the nucleic acid according to the invention is cloned in a functional unit to the nucleic acid coding for the lexA-DNA binding domain, so that a fusion protein from the polypeptide according to the invention and the LexA-DNA binding domain is expressed in the transformed yeast.
- cDNA fragments from a cDNA library are cloned in a functional unit to the nucleic acid coding for the Gal4 transcription activation domain so that a fusion protein from an unknown polypeptide and the Gal4 transcription activation domain is expressed in the transformed yeast.
- the yeast transformed with both expression vectors which is for example Leu2-, additionally contains a nucleic acid which codes for Leu2 and is controlled by the LexA promoter / operator.
- the Gal4 transcription activation domain binds to the LexA promoter / operator via the LexA-DNA binding domain, whereby the latter is activated and the Leu2 gene is expressed.
- the Leu2 yeast can grow on minimal medium that does not contain leucine.
- the activation of the transcription can be demonstrated by the formation of blue or green fluorescent colonies.
- the blue or fluorescent staining can also be done easily quantify in the spectrophotometer eg at 585 nM in the event of a blue color.
- expression gene banks can be easily and quickly searched for polypeptides that interact with the polypeptide according to the invention.
- the new polypeptides found can then be isolated and further characterized.
- the present invention is therefore not only intended for a method for finding polypeptide-like interactors, but also extends to a method for finding substances which are identical to those described above Protein-protein complex can interact.
- Such peptide-like as well as chemical interactors are therefore referred to in the sense of the present invention as - functional interactors which can have an inhibiting or a stimulating effect.
- snurportin 1 Purification of the polypeptide according to the invention, a 45 kD m 3 G-cap-forming protein called snurportin 1 and detection of its activity:
- a cytosolic S100 extract from HeLa cells was first purified via a CM-Sepharose column and the run containing Snurportin 1 was separated by means of Q-Sepharose chromatography. The fractions containing Snurportin 1 (tested by the UV crosslinking assay) were then loaded onto an m 3 G-Cap affinity column.
- biotinylated m 3 G cap oligo m 3 GpppAmpUmpA- / CH 2 ) 6-biotin
- Snurportin 1 contains an IBB domain, but does not have the well-known armadillo repeats: In order to clone the protein, petid sequences of the purified protein were generated by micro-sequencing. All five generated peptide sequences could be found in the GenBank in an EST (expressed sequence tag) (FIG. 6A). This Snurportin 1 encoding cDNA encodes 360 amino acids (AS) with a predicted molecular weight of 45 kD ( Figure 1A). A
- the C-terminal part of Snurportin 1 is structurally different from Importin ⁇ (e.g. less than 10% sequence identity with the C-terminus of hSRPI).
- the C-terminal part of Snurportin 1 is structurally different from Importin ⁇ (e.g. less than 10% sequence identity with the C-terminus of hSRPI).
- no significant sequence homology between Snurportin 1 and the "armadillo" repeat domain of Importin ⁇ could be detected (FIG. 6B). This means that there is no evolutionary conservation of the C-terminal regions of these two proteins.
- Snurportin 1 surprisingly exhibits overall sequence homology with different ORF (open reading frames) from mouse ESTs (e.g. AA571557, more than 90% identity), a Drosophila EST (AA541081, more than 40% identity) and with a C. elegans protein of unknown function ( ACC AF024493).
- the homology between Snurportin 1 and the C. elegans protein is not limited to the N-terminal IBB domain (43% identity, 59% similarity; see FIG. 6A). It can therefore be seen that the protein is the functional homologue to Snurportin 1.
- Identification of the C. elegans homolog shows that Snurportin 1 has been preserved in an evolutionary manner and therefore has an essential specific function as a core import receptor protein.
- Snurportin 1 binds Importin ß in vitro depending on the IBB domain:
- the presence of an IBB domain at the N-terminus of Snurportin 1 has the effect that the core transport of m 3 G-Cap-containing molecules is mediated.
- Detection is carried out by in-vitro binding of the polypeptide according to the invention to Importin ⁇ .
- Deletion mutants of the polypeptide according to the invention ( ⁇ 1-65 snurportin 1 causes a missing IBB domain according to FIG. 3B) and likewise total hSRPI ⁇ and Xenopus importin ⁇ were incubated with 35 S-labeled importin ß translated in vitro. The protein complexes were then precipitated with Ni-NTA agarose beads and the binding of Importin ß was analyzed by SDS-PAGE with subsequent autoradiography. Importin ⁇ coprecipitated with total snurportinl, hSRPI ⁇ and importin ⁇ , but not with ⁇ 1 -65 snurportin 1 ( Figure 3A, lanes 1-4). Snurportin 1 binds Importi ⁇ ß demonstrably in vitro and the N-terminal IBB domain is necessary for this binding.
- the C-terminal domain of Snurportin 1 has an m 3 G-cap binding activity:
- Importin ⁇ needs its C-terminal domain to bind the NLS of karyophilic proteins (Codes et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 7633).
- C-terminal domain of snurportin 1 is analogously involved in the binding of the m 3 G-cap NLS of snRNPs.
- cross-linking studies were carried out with the m 3 G-cap oligo and deletion mutants of snurportin 1.
- purified recombinant snurportin 1 which lacks the N-terminal amino acids 1-65 (including the IBB domain), could be crosslinked with the radioactively labeled m 3 G-cap oligo just as efficiently as the recombinant total snurportin 1 (FIG 3B, compare lanes 6 and 7).
- Deletion of the C-terminal 32 AS could not prevent cross-linking.
- Snurportin 1 stimulates the nuclear import of U snRNP into Xenopus oocytes depending on the IBB domain:
- Importi ⁇ ⁇ requires an intact IBB domain for its function (Görlich et al., 1996; supra, Weis et al., 1996; supra).
- the N-terminal deletion mutant of snurportin 1 ( ⁇ 1-65 snurportin 1) together with m 3 G-Cap modified U1 and U5 snRNAs was also microinjected into oocytes. This mutant lacks the IBB domain, but it still has the full m 3 G-cap binding capacity (see FIG. 3B, lane 7).
- ⁇ 1-65 Snurportin 1 could not only not accelerate the core import of snRNPs, but also strongly inhibited the import of the m 3 G-cap-modified U1 and U5 snRNAs (Fig. 7A, lanes 22-30).
- the unimpeded transport of ApppG-Cap modified U6 snRNA ( Figure 4A, lanes 22-30) excludes an unspecific effect of ⁇ 1-65 Snurportin 1 on the core import. This shows that the U1 and U5 snRNA import is due to competition between ⁇ 1-65 Snurportin 1 and the endogenous Xenopus laevis Snurportin 1 for the m 3 G-Cap.
- Snurportin 1 greatly accelerates the nuclear import of U1 snRNPs in vitro in digitonin-permeabilized cells:
- ⁇ 1-65 Snurportin 1 did not inhibit the import of ⁇ 5 ' U1 snRNP * (compare M with K and B in Fig. 5).
- these data show that in HeLa cells at least two different import receptors mediate the core import of U1 snRNP. These are snurportin 1 and probably the sm-core NLS receptor.
- Snurportin 1 contributes significantly to the accumulation of IM snRNP in the nucleus of somatic cells.
- the polypeptide according to the invention can be used in all cells, but preferably in mammalian cells and human cells. In principle, it can be carried out for all molecules that contain an m 3 G-cap structure.
- polypeptide according to the invention is specifically deleted at the IBB domain described.
- amino acids 1-65 on the polypeptide according to the invention - hereinafter referred to as ⁇ 1-65 Snurportin 1 - are deleted.
- This ⁇ 1-65 Snurportin 1 can preferably be overexpressed in the target cell, preferably mammalian cells and human cells, using a described gene therapy vector according to the methods known to those skilled in the art. This is done to prevent Kermimport of molecules containing m 3 G-Cap.
- the deletion polypeptide according to the invention is preferably produced as a recombinant protein using known recombinant methods, preferably from the nucleic acid according to SEQ ID No. Third
- Another subject of the invention is therefore a nucleic acid or a functional variant (as defined for Snurportin 1) according to SEQ ID No. 3 obtainable from the nucleic acid according to SEQ ID No. 2 coding for ⁇ 1-65 Snurportin 1.
- the SEQ ID No. 3 shows the necessary sequence by introducing a start codon ATG according to known recombinant methods, as a result of which it is expressed in accordance with the teaching of the nucleic acid described (SEQ ID No. 2) and is accessible to the other applications described, in particular as medicaments and diagnostics.
- the use of the nucleic acid according to SEQ ID No. is particularly preferred. 3 as part of a gene therapy vector for the desired overexpression of ⁇ 1-65 Snurportin 1 in cells.
- FIG. 4 shows the amino acid sequence of ⁇ 1-65 Snurportin 1, which can be obtained as an expression product by the methods already described. Another object of the invention is the possibility of the detection, identification, quantification, isolation and purification of m 3 G-Cap-containing molecules in the presence of • snurportin1 or ⁇ 1-65 snurportin1 in the context of in vitro experiments.
- RNA polymerase and RNasin were purchased from Promega.
- Pfu polymerase was obtained from Stratagene and RNaseH from Boehrimnger Mannheim.
- the Cap homologs ApppG and m7GpppG were purchased from Pharmacia.
- M 3 GpppG was synthesized and purified as described (Iwase et al. (1989), Nucleic Acids Res., 17, 8979) Radioactive-labeled triphosphate nucleotides and [ 32 P] pCp were purchased from Amersham. Sequencing was done with an automated sequencer using Taq polymerase and double stranded templates (PRISM Ready Reaction DyeDeoxy Terminator cycle sequencing kit) from Applied Biosystems.
- Sepharose 4B (Bochnig et al. (1987), Eur. J. Biochem, 168, 461) was bound and obtained by chromatography on MonoQ (Bach et al. (1987), Methods Enzymo, 181, 232).
- RNase H For competition studies and digestion with RNase H, U1 snRNPs were reduced to 12 ⁇ g / ml by centrifugation at 160,000 xg (2.5 h, 4 ° C) concentrated.
- U1 snRNPs 60 ug with 10 U RNase H and a DNA oligonucleotide (5 ' -CAGGTAAGTAT-3 ' 1, 4 ug / ul) in a volume of 50 ul incubated (Lamond and Sproat (1994), RNA processing: A Practical Approach, IRL Press, Oxford UK, 103 ff.). Remaining m 3 G-cap-bearing U1 snRNPs were removed from the reaction mixture
- m 3 G-cap oligonucleotide (m 3 GpppAmpUmpA), which is identical to the 5 ' end of the HeLa U1 snRNA, was synthesized according to Sekine (Sekine et al. (1994) Nucleic Acids Symp. Ser., 31, 61; Sekine et al. (1996), J. Org. Chem., 61, 4412).
- Preparative [ 32 P] pCp labeling of the m 3 G cap oligos (5 ⁇ g) was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573), with the exception that 250 ⁇ Ci [ 32 P] pCp were used.
- m 3 G-cap binding proteins were cleaned on a 20% polyacrylamide gel with 7.5 M urea.
- a pM [ 32 P] pCp 3 ' end-labeled m 3 G-cap oligos (2.5 x 106 cpm / pM) for 10 min on ice with either 25 ⁇ g S100 cytosolic extract or 1.5 ⁇ g purified HeLa or recombinant Snurportin 1 in a volume of 10 ⁇ l.
- the reaction mixture was then irradiated at 254 ⁇ m with a Sylvania G8T5 UV lamp for 5 min at a distance of 2 cm.
- the cross-linked proteins were separated by SDS-PAGE and visualized by autoradiography.
- HeLa S100 extract prepared as described by Dignam (Dignam et al. (1983), Nucleic Acids Res., 11, 1475), was carried out on a 240 ml CM-Sepharose FF column
- the run containing the 45 kD m 3 G cap binding protein was applied directly to a Q-Sepharose FF column (volume 240 ml, Pharmacia) equilibrated in buffer D. The mixture was then washed with 2 l of buffer D and the bound proteins were eluted with a linear NaCl gradient (100-750 mM in buffer D) over 900 ml. Aliquots (0.5 ml) were dialyzed against buffer D at 4 ° C. for 4 h and analyzed for m 3 G-cap binding activity by means of the UV cross-linking assay. Most of the activity eluted between 170 and 280 mM NaCl.
- a biotinylated m 3 G-cap oligo (m 3 GpppAmpUmpAp- (CH 2 ) 6-biotin) was chemically synthesized.
- the coupling of the biotinylated m 3 G cap oligo was carried out according to Lamond and Sproat (1994, supra).
- Example 5 Microsequencing, cDNA cloning and expression of Snurportin 1
- Purified Snurportin 1 was digested with Lys-C, the peptides separated by HPLC and the AS sequence of various eluted fractions determined using an ABI 477A protein sequencer.
- the following peptide sequences which were characterized with three overlapping EST of the ATCC (GenBank accession numbers: H43467, H08432, R14245): (a) KYSSLEQSERRRRLLELQK, (b) KRLDYVNHARRLAEDD, (c) KRLAIVASRGSTSAYTE, (d). (e) KLTHK.
- the clone R14245 contained a 1.6 kb fragment with an ORF which encoded all five Snurportin 1 peptide sequences.
- the transformed strains were incubated up to an OD 600 of 0.8 and the protein expression with isopropyl- ⁇ -D-thiogalactopyranoside was induced for 4 h at 30 ° C.
- the cells from a 2 l culture were sonicated for 1 min on ice in resuspension buffer D (25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl, 1 mM PMSF, 0.1 mM Benzamidi ⁇ , 10 ⁇ g / ml bacitracin , 20 ⁇ g / ml leupeptin, 5 mM Imidazole, 10 mM ⁇ MerCaptoethanol, pH 7.9) treated for lysis.
- resuspension buffer D 25 mM HEPES-KOH, 100 mM NaCl, 2.5 mM MgCl, 1 mM PMSF, 0.1 mM Benzamidi ⁇ , 10 ⁇ g / ml
- Ni-NTA nickel-nitrilo-acetic acid
- Qiagen nickel-nitrilo-acetic acid
- the bound proteins were eluted with resuspension buffer containing 200 mM imidazole and 8.7% glycerol.
- the proteins were dialyzed against buffer D at 4 ° C. for 2 h and subjected to an m 3 G-cap affinity chromatography as described above.
- the following primers were used for the PCR amplification: (i) pET28b / spn1 -for [5 ' - GGGCCATGGAAGAGTTGAGTCAGGCCCTG-3 ' ]; (ii) pET28b / ⁇ 1-65 / spn1-for [GGGCCATGGCTGAAGATGACTGGACAGGGATG-3 ' ], (iii) pET28b / spn1-rev and pET28b / ⁇ 1 -65 / spn1-rev [TTTGGATCCGCATTCTCCATGAGGCATC 3 '' -. All constructs generated by PCR were confirmed by sequencing. The expression and purification of hSRPI ⁇ and Xenopus Importin ⁇ have already been described (Weis et al., 1995; Görlich et al., 1994).
- Importin ⁇ was produced with the help of rabbit reticulocyte lysate by in vitro translation of the plasmid pKW275 (Weis et al., 1996, supra) using the TnT kit (Promega) according to the manufacturer's specification.
- the binding of Snurportin 1, hSRPI ⁇ or Importin ⁇ to Importin ß using Ni-NTA beads was carried out exactly as described by Weis (Weis et al. (1996), supra).
- [ 32 P] pCp labeling of gel-purified HeLa U1 and U5 snRNAs was carried out as described by Fischer (Fischer et al. (1993), EMBO J., 12, 573).
- the in vitro transcription of the [ 32 P] pCp-labeled ApppG U6 snRNA was carried out according to Fischer (Fischer et al. (1991), J. Cell. Biol. 113, 705).
- the isolated U1 snRNPs or ⁇ 5 ' -U1 snRNPs were carried out with the monofunctional reactive fluorescent dye Cy3 according to the manufacturer's instructions (Amersham).
- the unbound dye molecules were subjected to ultrafiltration in an Amicon cell and subsequent dialysis with PBS (pH 8) removed until no dye molecule could be detected in the passing fractions.
- the sedimentation analysis of the fluorescent-labeled snRNPs was carried out as described above.
- Microinjections were carried out as described by Fischer (Fischer et al. (1993), supra), with the exception that OR-2 buffer was used instead of MBS buffer. After incubation at 18 ° C for the indicated periods, the oocytes were in J buffer (70 mM NH 4 CI, 7 mM MgCl 2 , 0.1 mM EDTA, 2.5 mM DTT, 20 mM Tris-HCl, 10 % Glycerin, pH 7.5) transferred and separated manually. The RNA was purified and analyzed as described (Fischer et al., 1993, supra). The gels were quantified using a Molecular Dynamics (Sunnyvale, CA) phosphor imaging system with the Image Quant software version 3.0.
- Kemimportre forcee ⁇ were carried out with HeLa cells, which are on glass coverslips to a confluence of 50-70% in Dulbecco 's modified Eagle medium (Gibco-BRL) with 10% fetal calf serum and penicillin / streptomycin (Gibco-BRL) at 37 ° C, 5% CO 2 had grown. After permeabilization with digitonin (Adams et al. (1990), J.
- the cells were washed with ice-cold import buffer (25 mM Hepes pH 7.9, 100 mM NaCl, 2.5 mM Mg Cl 2 , 0.25 mM EDTA) and washed with 25 ⁇ l import buffer containing 0.2 mg / ml tRNA, 1 mM ATP, 1 mM creatine phosphate, 20 U / ml creatine phosphokinase (Sigma), 4 ⁇ g / ml U1 snRNP * ⁇ 5 ' -U1 snRNP * (labeled as described above) and 10 ul HeLa S100 cytosolic extract (5mg / ml protein), incubated. Additional reagents were added as described in the figure legends. The import mix was depleted by ATP, in which ATP, creatine phosphate and
- Creatine phosphate kinase was not added and preincubation took place for 30 min at 25 ° C in the presence of 20 U / ml apyrase (Sigma). The incubation of the import reactions was carried out at 25 ° C. for 30 min and the reaction was terminated as described by Marshallsay and Lendingmann (1994, supra). After the samples were covered with Fluoprep (bioMerieux), they were covered with Using the 50 x objective of a Leica DM / IRB inverse fluorescent microscope analyzed and saved in digitized images with a CCD camera. The images were processed with the Adobe Photoshop version 3.0 software and quantified with the NIH image software version 1.6. For each sample, the average fluorescence of approximately 100 randomly selected nuclei was calculated from at least three independent assays and averaged.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Rheumatology (AREA)
- Physical Education & Sports Medicine (AREA)
- Diabetes (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hospice & Palliative Care (AREA)
- Transplantation (AREA)
- Pain & Pain Management (AREA)
- Psychiatry (AREA)
- Cardiology (AREA)
- Emergency Medicine (AREA)
- Endocrinology (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Cell Biology (AREA)
- Pulmonology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2000560242A JP2002520052A (ja) | 1998-07-14 | 1999-07-07 | スナルポルチン1、新規ドメイン構造をもつヒトm3G−キャップ特異性核移入受容体タンパク質、ならびにその製造および使用 |
CA002333895A CA2333895A1 (en) | 1998-07-14 | 1999-07-07 | Snurportin i human m3g-cap specific nucleus import receptor protein with new domain structure, the production and use thereof |
AU49085/99A AU751571B2 (en) | 1998-07-14 | 1999-07-07 | Snurpotine 1 human M3G-CAP specific nucleus import receptor protein with new domain structure, the production and use thereof |
EP99932844A EP1097201A1 (de) | 1998-07-14 | 1999-07-07 | Snurportin1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19831382A DE19831382A1 (de) | 1998-07-14 | 1998-07-14 | Humanes m¶3¶G-cap-spezifisches Kernimportrezeptorprotein mit einer neuen Domänenstruktur, dessen Herstellung und Verwendung |
DE19831382.9 | 1998-07-14 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000004144A1 true WO2000004144A1 (de) | 2000-01-27 |
Family
ID=7873911
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP1999/004750 WO2000004144A1 (de) | 1998-07-14 | 1999-07-07 | Snurportin 1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1097201A1 (de) |
JP (1) | JP2002520052A (de) |
AU (1) | AU751571B2 (de) |
CA (1) | CA2333895A1 (de) |
DE (1) | DE19831382A1 (de) |
WO (1) | WO2000004144A1 (de) |
-
1998
- 1998-07-14 DE DE19831382A patent/DE19831382A1/de not_active Withdrawn
-
1999
- 1999-07-07 AU AU49085/99A patent/AU751571B2/en not_active Ceased
- 1999-07-07 CA CA002333895A patent/CA2333895A1/en not_active Abandoned
- 1999-07-07 WO PCT/EP1999/004750 patent/WO2000004144A1/de not_active Application Discontinuation
- 1999-07-07 EP EP99932844A patent/EP1097201A1/de not_active Withdrawn
- 1999-07-07 JP JP2000560242A patent/JP2002520052A/ja active Pending
Non-Patent Citations (2)
Title |
---|
HUBER J, CRONSHAGEN U, KADOKURA M, MARSHALLSAY C, WADA T, SEKINE M, LUHRMANN R: "Snurportin1, an m3G-cap-specific nuclear import receptor with a novel domain structure.", EMBO JOURNAL, vol. 17, no. 14, 15 July 1998 (1998-07-15), EYNSHAM, OXFORD GB, pages 4114 - 4126, XP002119913 * |
WILSON R, AINSCOUGH R, ANDERSON K, BAYNES C, BERKS M, BONFIELD J, BURTON J, CONNELL M, COPSEY T, COOPER J, ET AL: "2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans.", NATURE, vol. 368, March 1994 (1994-03-01), LONDON GB, pages 32 - 38, XP002119914 * |
Also Published As
Publication number | Publication date |
---|---|
JP2002520052A (ja) | 2002-07-09 |
AU4908599A (en) | 2000-02-07 |
DE19831382A1 (de) | 2000-02-03 |
AU751571B2 (en) | 2002-08-22 |
EP1097201A1 (de) | 2001-05-09 |
CA2333895A1 (en) | 2000-01-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1027440B1 (de) | Inhibitor-protein des wnt-signalwegs | |
DE69733204T2 (de) | Neuartige vegf-ähnliche faktoren | |
DE69531892T2 (de) | Fibroblasten-wachstumsfaktor 10 | |
DE69535063T2 (de) | Denaturierter low-density lipoprotein (ldl) rezeptor | |
WO1997023611A2 (de) | Nukleinsäuresequenzen von genen der high mobility group proteine sowie verwendungen derselben | |
DE69725018T2 (de) | Gereinigte telomerase | |
DE4038189C2 (de) | Humanes, Epididymis-spezifisches Polypeptid und dessen Verwendung zur Therapie und Diagnose männlicher Infertilität | |
EP0805204B1 (de) | Nebenhoden-spezifisches Rezeptorprotein und dessen Verwendung | |
EP1287142B1 (de) | Nukleinsaure-molekul umfassend eine fur ein sdf-1 gamma chemokin,einen neuropeptid-prakursor oder mindestens ein neuropeptid kodierende nukleinsauresequenz | |
DE69631041T2 (de) | Promotor des utrophingens | |
EP1127133B1 (de) | Zellpermeabilität-vermittelndes polypeptid | |
DE69434090T2 (de) | Epsilon-untereinheit des gaba a-rezeptors | |
WO2000004144A1 (de) | Snurportin 1, humanes m3g-cap-spezifisches kernimportrezeptorprotein mit einer neuen domänenstruktur, dessen herstellung und verwendung | |
EP1007671B1 (de) | Fanconi-gen ii | |
EP1015583B1 (de) | Srcr domäne-enthaltendes protein | |
EP0842278B1 (de) | Protein mit dnase-aktivität | |
EP1161535B1 (de) | Rna polymerase i transkriptionsfaktor tif-ia | |
DE69832447T2 (de) | Gen kodierend für Afadin-1 | |
DE10001377A1 (de) | bHLH-Transkriptionsfaktor ASCL3 und diesen enthaltendes Arzneimittel | |
DE69827808T2 (de) | Protease-ähnliches protein | |
EP1230265B1 (de) | Nukleinsäure, die für ein protein der ctage-familie kodiert, deren verwendung und herstellung | |
DE19515514C1 (de) | Nukleoläres/endosomales Autoantigen | |
EP1000145A1 (de) | Herz- und skelettmuskel-spezifische nukleinsäure, ihre herstellung und verwendung | |
DE4041464A1 (de) | 5-ht(pfeil abwaerts)1(pfeil abwaerts)-rezeptor | |
EP1084234A2 (de) | Humane deadenylierende nuclease, ihre herstellung und verwendung |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP NZ US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1999932844 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 509325 Country of ref document: NZ Ref document number: 49085/99 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2000 560242 Country of ref document: JP Kind code of ref document: A Ref document number: 2333895 Country of ref document: CA |
|
WWP | Wipo information: published in national office |
Ref document number: 1999932844 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09743425 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: CA |
|
WWG | Wipo information: grant in national office |
Ref document number: 49085/99 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999932844 Country of ref document: EP |