EP0835323A4 - Modifizierte proteine und methoden fuer ihre produktion - Google Patents

Modifizierte proteine und methoden fuer ihre produktion

Info

Publication number
EP0835323A4
EP0835323A4 EP96922498A EP96922498A EP0835323A4 EP 0835323 A4 EP0835323 A4 EP 0835323A4 EP 96922498 A EP96922498 A EP 96922498A EP 96922498 A EP96922498 A EP 96922498A EP 0835323 A4 EP0835323 A4 EP 0835323A4
Authority
EP
European Patent Office
Prior art keywords
protein
modified
sequence
controllable intervening
target
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96922498A
Other languages
English (en)
French (fr)
Other versions
EP0835323A1 (de
Inventor
Donald G Comb
Francine B Perler
William E Jack
Ming-Qun Xu
Robert A Hodges
Christopher J Noren
Shaorong S C Chong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New England Biolabs Inc
Original Assignee
New England Biolabs Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New England Biolabs Inc filed Critical New England Biolabs Inc
Priority to EP05076460A priority Critical patent/EP1642980A1/de
Publication of EP0835323A1 publication Critical patent/EP0835323A1/de
Publication of EP0835323A4 publication Critical patent/EP0835323A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01081Beta-agarase (3.2.1.81)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C07K1/1072General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups
    • C07K1/1075General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups by covalent attachment of amino acids or peptide residues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2434Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2442Chitinase (3.2.1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01014Chitinase (3.2.1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/90Fusion polypeptide containing a motif for post-translational modification
    • C07K2319/92Fusion polypeptide containing a motif for post-translational modification containing an intein ("protein splicing")domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/95Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)

Definitions

  • the present invention is directed to modified proteins and methods of producing the same. More specifically, the modified protein of the present invention comprises a target protein and a controllable intervening protein sequence (CIVPS), the CIVPS being capable of excision or cleavage under predetermined conditions.
  • CIVPS controllable intervening protein sequence
  • Mycobacterium tuberculosis (Davis et al., J. Bad. 173:5653 (1991); Davis et al., Ce//71 :1 (1992)). Each contains internal in-frame peptide segments which must be removed to produce the mature protein. Expression of Tfp1 and Rec A each results in two peptides: one representing the intervening protein sequence (IVPS) and the other the ligated product of the external protein sequences (EPS). This post- translational processing event has been termed "protein splicing". Similarly, the Vent DNA polymerase gene from the hyperthermophilic archaea Thermococcus litoralis contains two in-frame IVPSs (Perler, et al, PNAS 89:5577 (1992)).
  • the present invention relates to modified proteins comprising an
  • IVPS and a target protein the IVPS being capable of excision by protein splicing, or cleavage in the absence of splicing, under predetermined conditions in either cis or in trans.
  • predetermined conditions depend on the IVPS used and can include, for example, increase in temperature, changes in pH conditions, exposure to light, dephosphorylation, or deglycosylation of amino acid residues or exposure to chemical reagents which induce cleavage/splicing.
  • the IVPS may be joined with the target protein either by inserting the IVPS into the target protein or fusing the IVPS with the target protein at either the amino or carboxy terminal end of the target protein.
  • controllable intervening protein sequences are therefore useful in controlling the splicing or cleavage reaction.
  • the present invention further relates to methods for producing, selecting and testing CIVPSs. ln one preferred embodiment, a DNA sequence encoding a CIVPS is inserted into, or joined with, a DNA sequence encoding a target protein such that both coding sequences form a continuous open reading frame. Thereafter, expression of this fusion DNA is utilized to produce the modified target protein. In another embodiment, the modified protein so produced is subjected to predetermined conditions under which the CIVPS will be excised or cleaved. In certain embodiments, the CIVPS is inserted into a region of the target protein which renders the target protein substantially inactive and excision of the CIVPS restores the activity of the target protein.
  • CIVPSs include CIVPS 1 and 2 obtainable from T. litoralis (also sometimes referred to as Vent IVPS 1 and 2 or IVS1 and 2) and CIVPS 3 obtainable from Pyrococcus sp.(also sometimes referred to as Deep Vent IVPS1 or IVS1 ). These CIVPSs are capable of excision, i.e., removal via protein splicing, from modified proteins upon an increase in temperature. Other preferred CIVPSs include those obtainable from yeast such as Saccharomyces cerevisiae.
  • the complete splicing reaction is not necessary or desirable.
  • the CIVPS can be modified to allow cleavage in the absence of splicing, thus allowing for controlled separation or cleavage of the CIVPS from the target protein.
  • modified proteins and CIVPSs of the present invention are manifold. These include, for example, control of a target protein's enzymatic activity, purification of modified proteins using antibodies specific to the CIVPS by affinity chromatography and production of proteins that are toxic to host cells.
  • the CIVPSs of the present invention may further be used in a method of protein purification in which a modified protein comprising a target protein fused to a CIVPS is produced.
  • a three-part fusion can be produced in which the CIVPS is between the target protein and a protein having affinity for a substrate (binding protein), e.g., MBP.
  • the modified protein is then contacted with a substrate to which the CIVPS or binding protein has specific affinity, e.g., using affinity chromatography.
  • the highly purified target protein can be liberated from the column by subjecting the CIVPS to predetermined conditions under which cleavage, for example, between the CIVPS and the target protein is initiated.
  • the fusion protein can be purified as above and then the target protein released from the fusion by subjecting the CIVPS to predetermined conditions.
  • Figure 1 depicts the amino acid sequence (SEQ ID NO:30, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:31
  • Figure 2 illustrates insertion of IVPS into the EcoRV site of the ⁇ - galactasidase gene.
  • PCR products of either Deep Vent IVPS1 (CIVPS3) or Vent IVPS2 (CIVPS2) are ligated to EcoRV digested pAHO5 between the Asp and Ile residues of ⁇ -galactosidase to produce a modified ⁇ - galactosidase product.
  • Figure 3A and 3B are graphs showing that splicing of modified ⁇ - galactosidase yields active ⁇ -galactosidase.
  • Incubation of crude extracts from hosts expressing the indicated IVPS- ⁇ -galactosidase fusion proteins at 42°C yields an increase in enzyme activity with time, whereas incubation at 42°C with the host alone (RR1) or an unmodified ⁇ -galactosidase construct (pAHO5) shows no increase in enzyme activity.
  • Figure 4 is a western blot showing the results of temperature controlled protein splicing experiments.
  • CIVPS2 and CIVPS3 were cloned into the EcoRV site of ⁇ -galactosidase.
  • Western blot examination of cell extracts with sera directed against ⁇ -galactosidase or the CIVPS protein detects modified ⁇ -galactosidase fusion protein (Lanes 1 ,4,7,10).
  • Figure 5 shows by western blot examination of cell extracts with sera directed against ⁇ -agarase, the detection of modified ⁇ -agarase fusion protein.
  • Lanes 1 & 4 size markers;
  • Lanes 2 & 5 ⁇ -agarase standard;
  • lane 3 CIVPS2- ⁇ -agarase fusion;
  • lane 6 CIVPS3- ⁇ -agarase fusion.
  • Figure 6 illustrates insertion of IVPS2 (CIVPS2) into the ⁇ - galactasidase gene by creation of new restriction sites (BspEI and Spel) within the IVPS by silent mutations.
  • Figure 7 illustrates insertion of either Deep Vent IVPS1 (CIVPS3) or Vent IVPS2 (CIVPS2) into the ⁇ -galactasidase gene by creation of new restriction sites ⁇ Xba ⁇ and Sail) by silent mutations within the target gene.
  • CIVPS3 Deep Vent IVPS1
  • CIVPS2 Vent IVPS2
  • Figure 8 is a plasmid map of pANG5.
  • Figure 9 is an autoradiogram of SDS-PAGE showing suppressor tRNA-mediated incorporation of a chemically blocked serine at the upstream junction of CIVPS2.
  • Figure 10 is an autoradiogram of SDS-PAGE showing the splicing reaction of CIVPS2 initiated by visible light irradiation of a chemically blocked precursor protein.
  • Figure 11 is a gel showing temperature controlled protein splicing and cleavage.
  • Deep Vent IVPS1 (CIVPS3) cassettes were cloned into the EcoRV site of ⁇ -galactosidase.
  • Western blot analysis was used to examine cell extracts of pDV7 (CVPS3 cassette, lanes 1-3), pDVC302 (CIVPS3/Cys cassette, lanes 4-6), pDVT321 (CIVPS3 Thr cassette, lanes 7-9) and pDVS712 (CIVPS3/Ser cassette, lanes 10-12).
  • Antibody directed against the CIVPS3 protein detects fusion proteins and cleavage products including free CIVPS3, N-EPS-CIVPS3 and CIVPS3-C-EPS (from cleavage at one of the splice junctions).
  • the untreated extracts were in lanes 1 , 4, 7, and 10.
  • Figure 12 is a Western blot showing temperature controlled protein splicing and cleavage.
  • Western blot analysis using antibody directed against l-Pspl and ⁇ -galactosidase (C-EPS domain) (Promega) were used to examine fusion constructs pDVC302 (lanes 1-3), pDVT321 (lanes 4-6) and pDVS712 (lanes 7-9).
  • C-EPS domain ⁇ -galactosidase
  • Lane 1 contains size markers.
  • Figure 13A and 13B show the purification of MIP precursor on amylose and MonoQ columns examined by Coomassie blue staining and immunoblot.
  • the diagram between Parts A and B represents the proposed structure of each band, including the branched molecule MIP * .
  • the black boxes represent the MBP domain, the white boxes the IVPS doman and the gray boxes the paramyosin ⁇ Sal domain.
  • the pluses (+) indicate that the sample was heat treated at 37°C for 120 min., minuses (-) indicate that the sample was not heat treated.
  • Part A Coomassie blue stained gel. Total, crude supernatants from MIP cultures. FT., amylose resin flow through. Amylose eluate (-), amylose resin purified MIP preparations.
  • MonoQ MonoQ purified sample.
  • MBP-CIVPS3 Ml
  • MIP * 180 kDa apparent molecular mass branched molecule
  • MIP 132 kDa precursor
  • single splice junction cleavage products Ml, MBP-CIVPS3; IP, CIVPS3- paramyosin ⁇ Sal; M, MBP
  • Part B Immunoblots.
  • the MonoQ sample from Part A was heat treated as above and electrophoresed in triplicate.
  • MlP-related proteins were identified by immune reactivity with anti-MBP sera, anti-paramyosin sera and anti-PI-Pspl (anti-CIVPS3) sera.
  • Figure 14 illustrates the replaceable splice junction cassettes in MIP21 fusion.
  • pMIP21 contains two unique restriction sites flanking each splice junction. Splice junctions are indicated by arrows. Amino acid residues around the splice junctions are shown. Splice junctions can be changed by replacing either the amino terminal Xho ⁇ -Kpn ⁇ cassette or the carboxyl terminal Bam ⁇ -Stu ⁇ cassette with another DNA cassette.
  • Figure 15A and 15B is a gel showing thermal inducible cleavage at a single splice junction from modified MIP fusions. Fusion proteins were purified using amylose resin columns.
  • Figure 15A shows cleavage at the C-terminal splice junction from MIP23 fusion.
  • Purified fusion protein samples were incubated at 4°C, 37°C, 50°C or 65°C for 1 hour. Products were analyzed by a 4/20% SDS-PAGE followed by Coomassie blue staining. Cleavage of the C-terminal splice junction of the MIP23 fusion protein (MIP) yielded MBP-CIVPS (Ml) and paramyosin ⁇ Sal (P).
  • Figure 15B shows cleavage at the N-terminal splice junction from MIP28 fusion.
  • Purified protein samples were incubated at 4°C, 42°C, 50°C or 65°C for 1 hour. Products were analyzed by a 4/20% SDS-PAGE followed by Coomassie blue staining. Cleavage of the N-terminal splice junction of the MIP28 fusion protein (MIP) yielded MBP (M) and CIVPS-paramyosin ⁇ Sal (IP). Size standards ( in kilodaltons) are shown on the left side.
  • Figure 16 is a gel showing thermal inducible cleavage of MIC fusion.
  • Purified fusion protein samples were incubated at 4°C, 37°C, 50°C or 65°C for 1 hour. Products were analyzed by a 4/20% SDS-PAGE followed by Coomassie blue staining.
  • cleavage products, MBP-Deep-Vent IVPS1 (MI) and Deep-Vent IVPSI-CBD(IC) are present in all samples and do not change with this heat treatment.
  • Figure 17A and 17B show the Western blot of a fra ⁇ s-splicing reaction with Ml' and I'P.
  • PP and MP were treated as described in the text to induce frans-splicing as observed by the accumulation of MP and P products.
  • Western blots with either anti-CIVPS3 (Anti-Pi-Pspl) sera or anti-Paramyosin sera were performed as described in the text. Lanes marked '4°' contain control PP and MP samples incubated at 4°C. Lanes
  • Lane S contains size markers (NEB broad range prestained protein markers).
  • Figure 18 shows that /ra ⁇ s-splicing re-establishes l-Pspl endonuclease activity.
  • Xmnl linearized pAKR7 DNA was digested with 0.01 , 0.1 or 1 ⁇ g of either Ml', PP, the trans -splicing reaction products (indicated by a plus in both the PP and MP rows) or cis- spliced MIP52.
  • l-Pspl activity was only present in MIP52 and the trans -spliced mixture.
  • Lane S contains size markers (a mixture of lambda DNA digested with Hindlll and PhiX174 DNA digested with Haelll).
  • Figure 19 shows the fra ⁇ s-cleavage of P by MP22.
  • PP and MP22 were treated as described in the text to induce fra ⁇ s-cleavage.
  • Lanes 1 and 2 contain the starting samples MP22 and PP, respectively.
  • Lane 3 contains size markers (NEB broad range protein markers).
  • Lanes 4-9 contain cleavage reaction samples from 0, 5, 10, 20, 40 and 90 minutes at 42°C, respectively.
  • Figure 20 illustrates the chemical activation of cleavage at the N- terminal splice junction from the MI94 fusion containing the Se Cys substitution.
  • Purified protein samples were incubated at 37°C with (+) or without (-) 0.25 M hydroxylamine. Products were analyzed by a 4-12% SDS-PAGE followed by Coomassie blue staining. Cleavage at the N- terminal splice junction of the MI94 fusion protein (Ml) yielded MBP (M) and CIVPS3 (I). Size standards (in kilodaltons) are shown on the left side.
  • Figure 21 illustrates pMYB129 fusion construct carrying N454A substitution.
  • Figure 22A and 22B illustrates one-step purification of the target protein (MBP) by chitin. Cleavage is induced by 30 mM DTT at pH 7.6 at 4°C at 16 hours. Size markers (NEB) (on the left); lane 1 : cell lysate; lane 2: flow-through lysate; lane 3: DTT-induced cleavage product, MBP (M); lane 4: 6M guanidine wash.
  • NEB Size markers
  • Figure 23A and 23B show activation of cleavage of MYB fusion protein by ⁇ -mercaptoethanol ( ⁇ -ME) (Figure 23A) and DTT ( Figure 23B).
  • Figure 24 illustrates the reaction vessel dimensions and set up used in the preparation of chitin beads.
  • the present invention is directed to modified proteins and methods of their production.
  • the modified proteins comprise a controllable intervening protein sequence (CIVPS) and a target protein, the CIVPS being capable of excision by protein splicing, or cleavage in the absence of splicing, under predetermined conditions, e.g., increase in temperature, changes in pH conditions, unblocking of amino acid residues by photolysis, dephosphorylation, deglycosylation, treatment with chemical reagents or other means. If desired, the modified protein can be subjected to these conditions.
  • the CIVPS may also be inserted into a region that substantially inactivates target protein activity.
  • IVPS Intervening protein sequences
  • CIVPSs of the present invention include any intervening protein sequence in which excision or cleavage can be controlled, either by inherent properties of the native IVPS, such as an increase in temperature, or by modifications made to an IVPS that allow the reaction to be controlled.
  • the Vent DNA polymerase gene from the hyperthermophilic archaea Thermococcus litoralis contains two in-frame IVPSs, IVPS1 (CIVPS1 ) and IVPS2 (CIVPS2), (Perler, et al. supra) that can be deleted at the DNA level without affecting the kinetic and biochemical properties of the expressed polymerase. Correct processing of the Vent DNA polymerase gene containing both IVPSs occurs in the native archaea, T. litoralis.
  • the nucleotide sequence for the Vent DNA polymerase gene is set out in the Sequencing Listing as SEQ ID NO:1.
  • the nucleotide sequence for CIVPS1 is from nucleotide 1773 to 3386.
  • the nucleotide sequence for CIVPS2 is from nucleotide 3534 to 4703.
  • CIVPS1 and CIVPS2 can be obtained from phage NEB 619, which was deposited with the American Type Culture Collection (ATCC) on April 24, 1990 and received ATCC accession number 40795.
  • a third IVPS (CIVPS3 or DV IVPS1), has been found by the present inventors in the DNA polymerase gene of the thermophilic archaebacteria, Pyrococcus species (isolate GB-D).
  • the Pyrococcus DNA polymerase is sometimes referred to as Deep Vent DNA polymerase.
  • the nucleotide sequence of the Deep Vent DNA polymerase is set out in the Sequence Listing as SEQ ID NO: 2.
  • the nucleotide sequence for CIVPS3 is from 1839 to 3449.
  • CIVPS3 can be obtained from plasmid pNEB #720 which was deposited with the ATCC on October 1 , 1991 and received ATCC accession number 68723.
  • the above CIVPS1 , CIVPS2 and CIVPS3 are capable of excision from modified proteins upon an increase in temperature.
  • the CIVPSs are excised at reduced rates at temperatures from 37°C and below, but undergo excision more efficiently at temperatures from about 42°C to 80°C.
  • Preferred excision temperatures are between about 42°C and 60°C.
  • predetermined excision conditions are experimentally determined taking into consideration temperatures at which the target protein will not denatu. or undergo thermal inactivation.
  • the modified proteins can be subjected to the predetermined temperatures for a period of time ranging from less than one minute to several hours. In certain situations, depending on the thermal sensitivity of the target protein, it may be desirable to increase the incubation time period while decreasing the temperature.
  • modified proteins may exhibit differences in splicing efficiency at various temperatures. If necessary, the optimum temperatures for isolation and splicing of each modified protein can be experimentally determined. If the CIVPS splices at too low a temperature for a proposed purpose, the CIVPS can be modified, or its position in the target protein changed such that the optimum splicing temperature is increased. If the optimum splicing temperature for a particular modified protein is about 37°C, in order to insure that the modified protein does not splice in vivo, and thus increase the yield of intact modified proteins, host cells can be grown and the modified protein purified at lower temperatures, e.g., 12°C-30°C. This can also be accomplished by mutating the splicing element to shift the splicing temperature optimum from, for example, 30°C-37°C to 42°C-50°C, and thus resulting in a reduced level of splicing at physiological temperature.
  • IVPSs can be isolated, for example, by identifying genes in which the coding capacity is significantly larger than the observed protein and that encodes a protein sequence not present in the mature protein.
  • a protein containing an IVPS can be distinguished from a protein having a "pre-pro" precursor in that the mature protein will still have the N-terminal and C-terminal sequences of the IVPS containing precursor.
  • IVPSs can be detected by the absence of motifs that are conserved in certain protein families, e.g., DNA polymerases. The absence of such a motif may indicate that an IVPS is interrupting that motif (Perler et al., supra).
  • Suspected IVPSs can be screened by inserting the suspected protein sequence into a marker protein, e.g., ⁇ - galactosidase, such that the insertion decreases marker protein activity.
  • the resulting modified protein can then be evaluated at periodic intervals for an increase in marker protein activity. See, Example 1-3.
  • the DNA encoding the IVPS can be isolated and manipulated using standard DNA manipulation techniques.
  • Chemical activation of splicing or cleavage may be accomplished by reacting the CIVPS of interest with a chemical reagent which enhances or induces splicing or cleavage.
  • splicing or cleavage is controlled by employing one or more chemical reagents in a two-step process which first inactivates cleavage or splicing by mutation of the CIVPS or any other means, and then activates cleavage or splicing by addition of a chemical reagent, such as hydroxylamine, ⁇ -mercaptoethanol or dithiothreitol, for example.
  • a chemical reagent such as hydroxylamine, ⁇ -mercaptoethanol or dithiothreitol
  • the chemical reagent employed depends, in part, on whether cleavage is occurring at the N-terminus or the C-terminus. While not wishing to be bound by theory, N-terminal cleavage is believed to involve an ester or thioester formation between the N-terminal domain and the IVPS. Accordingly, any chemical reagent which facilitates cleavage of the ester or thioester such as hydroxylamine (Bruice and
  • ⁇ -mercaptoethanol or dithiothreitol may be used to induce N- terminal cleavage.
  • C- terminal cleavage is believed to involve cyclization of the IVPS C-terminal conserved asparagine. Accordingly, any reagent which increases the rate of cyclization of asparagine could be used to facilitate C-terminal cleavage.
  • an enzyme can be mutated, resulting in an inactive form of the enzyme. The activity can then be restored by adding a chemical reagent to the reaction mixture. See, for example, Toney and
  • C-terminal cleavage is believed to involve cyclization of the IVPS C-terminal conserved asparagine. Accordingly, any reagent which increases the rate of cyclization of asparagine could be used to facilitate C-terminal cleavage.
  • IVPSs may also be identified by a larger open reading frame than observed in the mature protein and the presence of a region which has some of the following properties: (1 ) similarity to HO endonuclease or other homing endonucleases, (2) the amino acid sequence (Ala/Val) His Asn (Ser/Cys Thr) (SEQ ID NO:45).
  • CIVPSs of the present invention also include IVPSs which have been modified such that the splicing reaction can be controlled.
  • Figure 1 SEQ ID NO:30, SEQ ID NO:31 , SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37,
  • hydroxyl/sulfydryl groups participate in the splicing reaction and thus modification of these residues modulate the splicing reaction.
  • modifications can be evaluated by inserting the modified CIVPS into a marker protein, e.g., ⁇ -galactosidase, such that the insertion decreases marker protein activity.
  • the resulting modified protein can then be evaluated at periodic intervals and under controlled conditions for an increase in marker protein activity. See, Example 1-3.
  • Western blot analysis can be used to evaluate splicing and cleavage products. See, Example 8.
  • the DNA encoding the CIVPS can be isolated and manipulated using standard DNA manipulation techniques.
  • Wild-type CIVPS2 showed accumulation of a species of the size expected for cleavage at the carboxy terminal splice junction during the splicing reaction, although accumulation of this product decreased, but was still observed, when serine 1082 was changed to threonine, cysteine, or alanine.
  • the S1082A variant showed no evidence of protein splicing, but still produced this product.
  • CIVPSs of the present invention may also encompass autoproteolytic proteins, such as autoproteolytic proteases, for example, retroviral proteases such as the TABLE 1
  • HIV-1 protease (Louis, et al., Eur. J. Biochem., 199:361 (1991)) and Debouck, et al., Proc. Natl. Acad. Sci. USA, 84:8903-8906 (1987)).
  • the skilled artisan is familiar with other such proteins. See, Krausslich, et al., Ann. Rev. Biochem., 701-754 (1988).
  • Such proteins can be modified, in accordance with the disclosed methodology, such that the proteolytic activity is inducible under predetermined conditions.
  • Modification of the CIVPS amino acids can be accomplished in a number of ways.
  • the sequence surrounding the amino acid residue to be modified may be altered to create a biological phosphorylation site allowing it to be a substrate for specific kinases and phosphatases.
  • protein kinase include, for example, casein kinase II, cAMP-dependent protein kinase, cdc2, and pp60 c*src (Pearson and Kemp, Methods in Enzymology 200:62 (1991 )).
  • phosphatases include, for example, protein phosphatase 2A, lam ⁇ ja phosphatase, and the yop phosphatase from Yersinia (Tonks, Current Opinion in Cell Biology, 2:1114 (1990)).
  • the protein splicing reaction may then be regulated by the degree of phosphorylation, using a kinase to create phosphoserine and block the splicing, and phosphatases to remove the phosphate, restoring the wild type serine and, consequently, protein splicing.
  • critical splice junction residues can be modified chemically such that the splicing reaction is blocked until the modification is reversed. This can be accomplished by using, for example, unnatural amino acid mutagenesis (Noren, et al., Science
  • Blocking groups can be chosen not only on the basis of the chemistry of the side chain to be protected, but also on the desired method of deblocking (chemically or photolytically).
  • cysteine groups present in other examples of protein splicing have thiol side chains that could be blocked using, for example, disulfide exchange (e.g., with dithiodipyridine) or complexation with transition metal ions (e.g., Hg 2+ ). See, Corey and Schultz, J. Biological Chemistry 264:3666 (1989). The resulting blocked precursors could then be activated for splicing by mild reduction or addition of metal chelators, respectively.
  • IVPS1 and IVPS2 each encodes an endonuclease, l-Tli-ll and l-Tli-l, respectively.
  • DV IVPS1 also encodes an endonuclease, l-Pspl, which is inserted at the same position in the DV DNA polymerase gene as IVPS1 is in the Vent DNA polymerase gene and is 62% identical to the Vent IVPS1 gene.
  • the IVPS open reading frames in Tfp1, M. tuberculosis rec A, Vent and Deep Vent DNA polymerase have protein sequence similarity to homing endonucleases, a class of intron-encoded proteins capable of cleaving alleles which lack the intron. (Hirata et al., supra, Kane et al., supra, Davis et al., supra, Perler et al., supra)
  • Certain host cells may not be able to tolerate the gene product of the CIVPS and thus, in some embodiments it may be preferable to inactivate the endonuclease function.
  • protein splicing can occur when the CIVPS endonuclease function has been inactivated.
  • Such inactivation can be accomplished in a variety of ways, including for example, random mutagenesis, deletion or insertional inactivation, or site directed mutagenesis.
  • the endonuclease function is inactivated by site directed mutagenesis.
  • I-Tli-I shares sequence similarity with other "homing endonucleases" in the pair of characteristic dodecapeptide motifs (Cummings et al., Curr. Gent. 16:381 (1989)). As shown in
  • Example 6B endonuclease activity was inactivated by oligonucleotide- directed mutagenesis of a single residue (aspartate 1236 to alanine) within one of these motifs. Substitution of alternative residues could also reduce or abolish endonuclease activity without affecting protein splicing. Inactivation of endonuclease function has been shown to increase the stability of constructs carrying the modified proteins.
  • Target proteins which can be used in accordance with the present invention include, for example, enzymes, toxins, cytokines, glycoproteins and growth factors. Many such proteins are well known to the skilled artisan. The amino acid and nucleotide sequence of such proteins are easily available through many computer data bases, for example, GenBank, EMBL and Swiss-Prot. Alternatively, the nucleotide or amino acid sequence of a target protein can be determined using routine procedures in the art.
  • the CIVPS is inserted into a region(s) that will inactivate such activity.
  • regions are well known to the skilled artisan and include, for example, binding sites, enzyme active sites, the conserved motifs of proteins, e.g.,
  • the CIVPS may be inserted randomly and the activity of each modified protein measured until the desired level of activity is obtained.
  • a modified protein has about a 50% reduced level of activity compared to the native protein. More preferably about
  • the CIVPS may be inserted into the target gene by any number of means.
  • CIVPS1 , 2 or 3 can be inserted immediately before the appropriate splice junction amino acids, for example, serine, threonine or cysteine residues, most preferably before serine or threonine. See, Figure 1. Such sites are readily available in most target proteins.
  • the target protein is a toxin
  • insertion can be at any site within the target protein if the CIVPS "brings" the appropriate downstream amino acid with it. This can be accomplished by creation of CIVPS DNA having a codon for the desired downstream amino acid. Methods for producing such DNA are set out in detail below. This DNA can then be inserted at any site within the target DNA. Upon protein splicing of the resulting modified protein, the extra residue brought by the CIVPS will be left behind. Thus, if activity of the final product is important, the skilled artisan must takes steps to assure that the extra residue will not be left in an area of the target protein that will adversely affect activity.
  • the CIVPS may be inserted into the target protein, or fused to the target protein, by chemically synthesizing the primary amino acid sequence of the target protein, including the CIVPS, inserted at any desired site, using standard methods (e.g., see Hunkapiller, et al., Nature 310:105 (1984)) and a commercially available protein synthesizer.
  • a DNA sequence encoding a CIVPS is inserted in, or fused to, a DNA sequence encoding for a target protein such that both coding sequences form a continuous reading frame. This can be accomplished using a variety of methods known to the skilled artisan, several of which are set out below.
  • the CIVPS DNA is inserted into any restriction enzyme site that makes a blunt cut in the target gene and which is in frame.
  • This can be accompanied by first, synthesizing an CIVPS DNA fragment with a threonine codon (for Vent IVPS2) or a serine codon (for Deep Vent IVPS1 or Vent IVPS 1) at its 3' end.
  • This fragment is then ligated in-frame to a linear plasmid cut to blunt ends by the restriction endonuclease.
  • an EcoRV site can be used to insert Vent IVPS2 or Deep Vent IVPS1 between residue 375 (aspartic acid) and 376 (isoleucine). See, Figure 2.
  • this method if the CIVPS is excised an extra residue is expected to remain at the splice junction and therefore depending on where the CIVPS is inserted, the resulting protein may not have the same function or structure as the native protein.
  • the CIVPS DNA could also be inserted by making silent mutations (preserving the amino acid residue) near one end or both ends of the CIVPS to create restriction sites compatible with the target gene.
  • CIVPS2 as an example, a BspEI restriction site can be made near the 5' end and a Spel restriction site near its 3' end, by silent mutations.
  • PCR primers overlapping the new restriction sites and continuing through the beginning of the lacZ target gene at either asp 594 or thr 595, one can generate a lacZ fragment with compatible BspE1 and Spel restriction sites.
  • DNA fragment(s) can be synthesized from both the CIVPS and the target gene by PCR with their ends at the insertion site overlapping with the termini of the CIVPS, therefore, including the same restriction sites. After appropriate restri - ion endonuclease treatment, DNA fragments with compatible ends can then be ligated to create a fusion gene. Since no extra residue would be left after excision of the CIVPS, native polypeptide will form when splicing occurs.
  • the restriction site being created is unique within the CIVPS and within the target gene to avoid ligation of multiple fragments and thus, complicated screening procedures.
  • plasmid vector carrying the target gene sequence is relatively small, for example, less than about 5Kb
  • a linear form of the plasmid can be generated using PCR, and then the linear plasmid can be ligated to the CIVPS gene.
  • the CIVPS gene can be inserted at any location in the target gene as follows: First, plasmid DNA containing the target gene can be synthesized by PCR using a pair of primers starting at the insertion site, for example, serine or threonine codons for CIVPS1 , 2 and 3, or any codon if the CIVPS also brings the appropriate downstream amino acid.
  • the CIVPS gene (with or without serine or threonine) can be ligated to the linear plasmid DNA (without the serine or threonine codon).
  • the required splice junction amino acids (serine or threonine) can be positioned on either the CIVPS fragment or on the target gene.
  • the advantage of having the required amino acid on the CIVPS fragment when placing upstream of an endogenous serine or threonine is that the self-ligated vector DNA (without the CIVPS insert) may only express a deficient product of the target gene because of the deletion of the serine or threonine in the coding region. This may aid in phenotype selection for the fusion construct if the fusion protein can splice to produce a functional product.
  • the fusion DNA encoding the modified protein can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • host-vector systems may be utilized to express the protein-coding sequence. These include mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA.
  • any one of a number of suitable transcription and translation elements may be used. For instance, when expressing a modified eukaryotic protein, it may be advantageous to use appropriate eukaryotic vectors and host cells.
  • the modified proteins can be separated and purified by appropriate combination of known techniques. These methods include, for example, methods utilizing solubility such as salt precipitation and solvent precipitation, methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS- polyacrylamide gel electrophoresis, methods utilizing a difference in electrical charge such as ion-exchange column chromatography, methods utilizing specific affinity such as affinity chromatography, methods utilizing a difference in hydrophobicity such as reverse-phase high performance liquid chromatography and methods utilizing a difference in isoelectric point, such as isoelectric focusing electrophoresis.
  • solubility such as salt precipitation and solvent precipitation
  • methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS- polyacrylamide gel electrophoresis
  • methods utilizing a difference in electrical charge such as ion-exchange column chromatography
  • methods utilizing specific affinity such as affinity chromatography
  • the modified proteins can be subjected to predetermined conditions under which the CIVPS is excised.
  • Such conditions depend on the CIVPS used.
  • CIVPS 1 , 2 and 3 are capable of excision by subjecting the modified protein to increased temperature
  • the time period for incubation can range from less than one minute to greater than several hours. As discussed above, in certain situations, depending on the thermal sensitivity of the target protein, it may be desirable to increase the incubation period while decreasing the temperature. In addition, if in vivo splicing is desired, temperatures compatible with the growth of the host organism are preferred.
  • the present invention may be used to produce proteins that are highly toxic to the host cells by using the CIVPS to modifying a toxic target protein such that the modified protein is non-toxic.
  • a protein is extremely toxic to a host cell it may be desirable to produce that protein using a method referred to as "transplicing".
  • the toxic protein is produced in two or more pieces in separate host cells, each piece being modified by insertion of a CIVPS.
  • a first modified protein can be produced comprising an amino portion of a target protein to which is inserted at its carboxy terminus an amino terminal fragment of a CIVPS, thereafter a second modified protein comprising the remaining portion of the target protein into which is inserted at its amino terminus the remaining fragment of CIVPSs.
  • overlapping CIVPS fragments can be used.
  • Each modified protein is then isolated from the host cells and incubated together under appropriate conditions for splicing of the CIVPS.
  • the entire CIVPS may be inserted on either side of the splice junction of the first modified protein and the remaining target protein fragment added to the splicing mixture.
  • trans -splicing may allow expression of highly toxic genes in £. coli by expressing only an inactive portion of the target protein in each of two different hosts.
  • the two complementary fragments can then be purified in large amounts and ligated together by in vitro trans -splicing.
  • By dividing the CIVPS into 2 parts its splicing activity is effectively controlled until the two parts are brought together. Therefore, any IVPS becomes a CIVPS when divided into 2 parts which are purified from different hosts and kept separate until splicing is required.
  • Tra ⁇ s-cleavage combines the properties of frans-splicing, CIVPS cleavage and the three part affinity-cleavage vector systems.
  • trans-cleavage the CIVPS is separated into 2 fragments, which, when combined and activated, result in cleavage between the protein of interest and the CIVPS.
  • trans-cleavage can be used for affinity purification of a protein of interest.
  • one or both fragments of the CIVPS has an affinity tag for purification and a cloning site to make an in-frame fusion with the protein of interest.
  • Each of the two constructs are grown and induced separately as described for trans- splicing. Protein from each of the two constructs is then purified either by standard chromatographic or affinity techniques.
  • the two protein fragments are then combined under conditions which allow the two parts of the CIVPS to come together to form an active CIVPS. Cleavage is then induced by temperature, pH, chemical reagents or other means, releasing the purified protein of interest.
  • the combination of the two parts of the CIVPS can occur while one part is bound to a solid matrix; in this case, after activation of cleavage, the protein of interest is released from the solid matrix while the CIVPS and any affinity tag remain on the solid matrix.
  • the two CIVPS fragments will remain associated after the cleavage reaction, allowing both to remain bound to the solid support even though only one fragment has an affinity tag.
  • affinity tags on both fragments of the CIVPS to allow separation of the protein of interest from the CIVPS fragments after cleavage.
  • the order of the binding domain, the CIVPS and the protein of interest can be varied. All variations described for CIVPS purification and cleavage schemes can be applied to fra ⁇ s-cleavage systems also.
  • cleavage may be programmed to occur at either the N-terminal or the C-terminal of the CIVPS.
  • the starting point for the CIVPS fragments are those described in Example 12.
  • These CIVPS3 fragments were converted to fra ⁇ s-cleavage reagents by cassette replacement as described in Example 10.
  • Some of the many possible mutations which we have shown result in frans-cleavage at the C- terminal of CIVPS3 are Ala535 of CIVPS3 to Lys, Ser1 of CIVPS3 to Ala and Ile2 of CIVPS3 to Lys. Asn537 of CIVPS to Ala resulted in trans- cleavage at the N-terminal of CIVPS3.
  • the IVPSs of the present invention may be used in a "protein ligation" to add unnatural amino acid residues, structural probes, identifying epitopes or tags, or other determinants to a target protein.
  • the target protein can be fused to the amino terminus of the IVPS.
  • a stop codon can be placed immediately following the carboxy terminus of the IVPS.
  • the peptide to be fused can then be added to the mixture. If necessary, in order to more closely mimic the native splicing mechanism, the amino terminus of this peptide may be serine, threonine, or cysteine.
  • the splicing reaction may then proceed, pushed by mass action towards splicing of the product.
  • the above reaction could also be adapted to occur with a starting material composed of the IVPS fused at the carboxy terminus to the amino terminus of the target protein. Initiation at a methionine engineered to precede the serine residue which begins in certain CIVPS would allow translation to occur which would likely be processed off in E. coli leaving an amino terminal serine residue.
  • the peptide to be fused to the amino terminus of this target protein could then be added, and splicing allowed to proceed. Such an approach may be favored since there is no known requirement for the carboxy terminal residue on the peptide being added. Additionally, current experimental evidence suggests that cleavage of the upstream splice junction precedes the ligation reaction, indicating this approach more closely approximates the native reaction mechanism.
  • Targeting peptides could also be added to the peptide to facilitate translocation of the fusion protein.
  • the present invention can also be used to study the effect of a target protein during a specific part of the cell cycle or under specific conditions such as induction of another protein or differentiation.
  • the chromosomal copy of a gene encoding a particular protein can be replaced with a version containing a CIVPS.
  • the cells are heated causing the precursor to splice, and thus the active target protein is present only at this point.
  • the CIVPs of the present invention can also be used to isolate modified proteins by use of affinity chromatography with antibodies specific to the CIVPS.
  • monoclonal or polyclonal antibodies can be generated having binding affinity to a CIVPS using standard techniques. These antibodies can then be utilized in affinity chromatography purification procedures to isolate a modified protein.
  • the modified proteins can be subjected to predetermined conditions under which the CIVPS will undergo excision.
  • cleavage at the CIVPS splice junction can be accomplished in the absence of protein splicing, thus allowing for controlled separation of the CIVPS from the target protein.
  • Such CIVPSs can therefore be used in a fusion protein purification system.
  • Fusion protein purification systems are well known to the skilled artisan. See, EPO 0 286 239 and N.M. Sassenfeld, TIBTECH, 8:88-93
  • a binding protein and a target protein are joined by a linker having a protease recognition site.
  • the fusion is then purified by affinity chromatography on a substrate having affinity for the binding protein.
  • the binding protein and the target protein are then separated by contact with a protease, e.g., factor Xa.
  • a protease e.g., factor Xa.
  • the protease in order to obtain a highly purified target protein, the protease must be separated from the target protein, thus adding an additional purification step, as well as the potential for contamination.
  • the method of the present invention by using a CIVPS, instead of a protease, avoids these and other problems encountered in currently used protein fusion purification systems.
  • a modified protein comprising a fusion protein in which a CIVPS is between the target protein and a protein having affinity for a substrate (binding protein) is formed.
  • Techniques for forming such fusion proteins are well known to the skilled artisan. See, EPO 0 286 239 and J. Sambrook, et al., Molecular Cloning: A Laboratory Manual (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. 17.29-17.33.
  • Binding proteins which may be employed in the method of the present invention include, for example, sugar binding proteins, such as maltose or arabinose binding protein, receptor binding proteins, amino acids binding proteins and metal binding proteins. Other binding proteins are well known to the skilled artisan. See, EPO 0 286 239 and N.M. Sassenfeld, TIBTECH, supra.
  • the modified protein is then contacted with a substrate to which the binding protein has specific affinity, e.g., using affinity chromatography.
  • the highly purified target protein can be liberated from the column by subjecting the CIVPS to predetermined conditions under which cleavage is initiated, for example, between the CIVPS and the target protein.
  • the purified fusion protein can be eluted from the column and liberated as above.
  • DNA fragments or cassettes for in-frame insertion of IVPSs into the lacZ coding region or any other target gene can be prepared by polymerase chain reaction (PCR) with or without the first downstream external protein sequence (EPS) codon.
  • PCR polymerase chain reaction
  • EPS first downstream external protein sequence
  • the native downstream residues are serine for Deep Vent IVPS1 and Vent IVPS1 or threonine for Vent IVPS2. It has been found that IVPS2 can splice if it precedes a threonine or cysteine, although at reduced levels. Although not wishing to be bound by theory, it is believed that all the IVPSs can splice to some extent when preceding either serine, threonine or cysteine.
  • Cassettes including the downstream serine or threonine can be inserted at any desired location in the target gene including preceding a serine or threonine. In the latter constructions, one may delete the serine or threonine from the target gene and substitute it with the incoming residue on the cassette. Cassettes lacking downstream serines, threonines or cysteines may be inserted prior to a serine, threonine or cysteine in the target gene.
  • the following protocol describes the production of cassettes for Deep Vent IVPS1 (CIVP3) and Vent IVPS2 (CIVPS2) (endo+ and endo * versions), including the first downstream EPS codon.
  • the PCR mixture contains Vent DNA polymerase buffer (NEB), supplemented with 2 mM Magnesium sulfate, 400 ⁇ M of each dNTP, 0.9 ⁇ M of each primer and 40 ng plasmid DNA and 2 units of Vent DNA polymerase in 100 ⁇ l.
  • Amplification was carried out by using a Perkin-Coupled Device (NEB), supplemented with 2 mM Magnesium sulfate, 400 ⁇ M of each dNTP, 0.9 ⁇ M of each primer and 40 ng plasmid DNA and 2 units of Vent DNA polymerase in 100 ⁇ l.
  • Amplification was carried out by using a Perkin-
  • Deep Vent IVPS1 was synthesized from pNEB #720 (ATCC No. 68723) which has a 4.8 Kb BamHI fragment containing the Pyrococcus sp. DNA polymerase gene inserted into the BamHI site of pUC19.
  • Vent IVPS2 was synthesized from pV153-2 which has a 1.9 kb EcoRI fragment (2851-4766) of the Vent DNA polymerase gene sequence in the vector Bluescribe SK- (Stratagene).
  • pNEB671 ATCC No. 68447) can also be used for IVPS2.
  • pAMQ29 is an endonuclease-deficient derivative of pV153-2, carrying an amino acid substitution (aspartic acid 1236 to alanine) within the Vent IVPS2 coding region.
  • T-3' (SEQ ID NO:3) (Vent IVPS2 forward, 3534-3556, a substitution of A3542 to C) and 5'-AGTATT GTGTACCAGGATGTTG-3' (SEQ ID NO:4) (Vent IVPS2/Thr reverse, 4685-4706) were used to synthesize endo + or endo" Vent IVPS2 fragment (1173 bp) with a threonine codon at its 3' terminus.
  • Primers ⁇ '-AGCATTTTACCGGAAGAATGGGTT-S' SEQ ID NO:3
  • PCR samples were extracted with phenol and chloroform, precipitated in 0.3 M NaAc and 70% ethanol at -20°C for overnight, recovered by spinning at 10 K for 10 min in a microfuge, dried and each resuspended in 30 ⁇ l of distilled water, loaded on a 1% agarose gel for electrophoresis at 60 volts for 15 hours.
  • the gel slices that contain the PCR-amplified fragments were placed in a 1% low melting agarose gel for electrophoresis at 80 volts for 2 hours.
  • DNA fragments were recovered from the low melting agarose gel by incubation in 0.5 ml of TE buffer (10 mM Tris-HCI/0.1 mM EDTA, pH8.0) at 65°C for 30 min, extractions with phenol, phenol-chloroform (1 :1 mixture) and chloroform, precipitation in 0.6 M NaAc (pH5.2) and 50% isopropanol at -20°C for overnight. DNA was spun down, washed with 70% ethanol, dried and resuspended in 15.5 ⁇ l distilled water.
  • TE buffer 10 mM Tris-HCI/0.1 mM EDTA, pH8.0
  • Phosphorylation of the IVPS DNA fragments was performed at 37°C for 60 min with 2 ⁇ l of 10 x poiynucleotide kinase buffer (NEB), 15.5 ⁇ l of purified DNA , 2 ⁇ l 10 mM ATP, and 5 units of T4 Poiynucleotide kinase (NEB) in 20 ⁇ l.
  • the samples were heated in a 65°C water bath for 10 min. After addition of 80 ⁇ l of TE buffer ( 10 mM Tris-HCI/0.1 mM EDTA, pH8.0), the samples were sequentially extracted with phenol, phenol-chloroform (1 :1 mixture) and chloroform.
  • DNA was precipitated in 2. ⁇ M NH4AC and 70% ethanol at -70°C for 3.5 hours, pelleted by spinning at 10 K for 10 min in a microfuge, washed with cold 70% ethanol, dried and resuspended in distilled water (20 ⁇ l for Vent IVPS2 or Deep Vent IVPS1 DNA, 10 ⁇ l for Vent IVPS endo ⁇ DNA).
  • the IVPS cassettes can be cloned into a target gene by inserting the cassette at a restriction enzyme site which makes a blunt cut in the target gene between 2 codons.
  • the cassette can carry a C-terminal serine, cysteine or threonine if necessary. This protocol works best if the restriction enzyme cuts the target gene vector once or twice.
  • insertion into the EcoRV site of the lacZ gene Figure 2.
  • pAHO ⁇ carries the entire lacZ gene sequence on a 3.1 kb BamHI-
  • Dral fragment from pRS41 (Simons, et al., Gene ⁇ 3:8 ⁇ -96 (1987)) inserted between BamHI and Smal sites in the polylinker of pAGR3 downstream of a tac promoter.
  • the tac promoter is a transcription control element which can be repressed by the product of the /acl gene and be induced by isopropyl ⁇ -D-thiogalactoside (IPTG).
  • IPTG isopropyl ⁇ -D-thiogalactoside
  • the ⁇ .9 Kb vector pAHO ⁇ also has a transcription terminator sequence upstream of the tac promoter and the polylinker, and the E. colilac ⁇ gene.
  • pAHO ⁇ contains two EcoRV recognition sequences. EcoRV leaves blunt ends at its cleavage site.
  • One of the EcoRV cleavage sites cuts within the lacZ coding region between the 375th codon (aspartic acid) and the 376th codon (isoleucine) and is planned as the site for in-frame insertion of the IVPS fragments.
  • the other site is located 3.2 Kb downstream within the -32-
  • E. co//7ac.°. gene The plasmid is cut partially to produce some molecules in which only one of the EcoRV sites has been cleaved. These linear plasmids are purified.
  • the IVPS cassettes will be randomly cloned into either EcoRV site. Therefore, the resultant recombinants must be screened for orientation and insertion into the proper EcoRV site.
  • DNA was partially digested by incubation of 15 ⁇ g of pAHO ⁇ DNA with 40 units of EcoRV (NEB) in 100 ⁇ l of 1 x NEB buffer 2 at 37°C for 60 min. 20 ⁇ l agarose gel loading dye was added to the sample after the sample was heated to 65°C for 10 min to inactivate EcoRV.
  • DNA fragments were separated by electrophoresis on a 1 % low melting agarose gel.
  • Linearized pAHO ⁇ plasmid DNA was recovered from the low melting agarose gel as described in example 1 and resuspended in 44.6 ⁇ l of distilled water.
  • E. coli strain RR1 was transformed by mixing 100 ⁇ l of competent ⁇ RR1 cells with 10 ⁇ l of ligation sample on ice for 30 min., heating at 42°C for 2 min., chilling on ice for 5 min., adding 0.8 ml LB media (10 grams/liter tryptone, ⁇ grams/liter yeast extract, 10 grams/liter NaCI, 1 gram/liter Dextrose, 1 gram/liter MgCl2-6H2 ⁇ , pH7.2 at 2 ⁇ °C) and incubating at 30°C for 4 ⁇ min. The samples were plated onto LB plates, supplemented with 100 ⁇ g/ml ampicillin. After incubation overnight at
  • Colony hybridization was utilized to screen for clones that carry recombinant plasmids.
  • the Vent IVPS2 forward primer and the Deep vent IVPS1 forward primer, described in example 1 were radio-labeled with (_- 32 P) ATP using T4 poiynucleotide kinase and used as hybridization probes. Colonies were lifted onto nitrocellulose and treated for 5 min. in each of the following solutions: 10% SDS, 0.5 M NaOH/1.5 M NaCI, O. ⁇ M Tris-HCI (pH7. ⁇ )/0. ⁇ M NaCI (twice) and 2XSSC (twice).
  • nitrocellulose filters were dried at room temperature for 1 hour, baked in vacuum at 80°C for 2 hours, soaked in 6 x SSC for 5 min and washed in a solution of 50 mM Tris-CI (pH8.0), 1 M NaCI, 1 mM EDTA and 0.1% SDS at 42°C for 2 hours.
  • the positive clones were further analyzed to determine insert location by PCR amplification of plasmid DNA extracted from these clones, using the Vent IVPS2 forward primer (or the Deep Vent IVPS1 forward primer) described in Example 1 , and a lacZ reverse primer ( ⁇ '- 0 AGGGTCGACAGATTTGATCCAGCG-3' (SEQ ID NO:7)) complementary to the lacZ coding sequence (1417-1440, with a G:T mismatch at 1437) 392 nt downstream of the insertion site. PCR reactions from 14 clones produced the corresponding DNA fragments.
  • Clones pVT133, 138, 139, 141 , 142, and 144 contain the 1.4 Kb Vent IVPS2 insert, and pVTE 834, ⁇ 836, 839 and 841 contain the Vent IVPS2 (endo-) insert, all yielding DNA fragments of approximately 1.1 kb.
  • Clones pDVS 712, 742, 745 and 746 carry the 1.6 Kb Deep Vent IVPS1 insert, producing DNA fragments of about 2.0 Kb.
  • the clones were further examined by their ability to express fusion (modified) proteins with inducer IPTG.
  • the clones were cultured in LB medium supplemented with 100 ⁇ g/ml ampicillin at 30°C until ODgoonm reached 0.5.
  • To prepare lysate from uninduced cells 1.5 ml of culture was pelleted and resuspended in 100 ⁇ l of urea lysis buffer, followed by boiling for 10 min. After addition of IPTG to a final concentration of 0.3 mM, the cultures were grown at 30°C 5 for 4 additional hours. Cells from 1.5 ml culture were pelleted and then lysed with 2 ⁇ 0 ⁇ l of the urea lysis buffer after induction for 2 hours and 4 hours. Protein products were analyzed by Coomassie Blue stained gels.
  • Vent IVPS2-/acZ fusion constructs Three of the Vent IVPS2-/acZ fusion constructs (pVT139, 142 and 144) and all four Vent IVPS2 (endo")-/acZ fusion constructs showed a major 0 product of about 162-16 ⁇ KDa, the expected size for a Vent IVPS2-B- galactosidase fusion protein. All four Deep Vent IVPS1-/acZ fusion clones expressed a larger product of 173-178 KDa, the expected size for the Deep Vent IVPS 1 - ⁇ -galactosidase fusion protein.
  • the IVPS protein can be excised from the fusion protein to generate a ligated target protein (active ⁇ -galactosidase) and free IVPS endonuclease by incubation at elevated temperatures.
  • a ligated target protein active ⁇ -galactosidase
  • Crude extracts were prepared from cultures of RR1 (the E. coli host) and RR1 containing pAHO ⁇ (the non-fusion ⁇ -galactosidase parent plasmid described in Example 2) or the fusion constructs, pVT142 (Vent IVPS2 or CIVPS2), pVTE836 (Vent IVPS1 endo") or pDVS712 (Deep Vent IVPS1 or CIVPS 3) by the following steps.
  • a single colony was inoculated in 10 ml LB medium supplemented with 100 ⁇ g/ml ampicillin, incubated at 30°C overnight, subcultured in 1 liter LB medium (100 ⁇ g/ml ampicillin) at 30°C to ODgoonm aD0Ut °- 5 and induced with IPTG at 0.3 mM at 30°C for 2 hours.
  • Cells were spun down and resuspended 0 in 100 ml of LB, sonicated for 3 min at 4°C and spun at 7000 rpm for 15 min. The supernatants were recovered and stored at -20°C.
  • ⁇ -galactosidase activity was measured according to Miller et al. (Experiments in Molecular Genetics (1972), Cold Spring Harbor, New York, Cold Spring Harbor Laboratory).
  • Assay buffer was prepared by mixing Z buffer with 2.7 ⁇ l/ml of 2-mercaptoethanol.
  • Substrate o- nitrophenyl- ⁇ -D-galactopyranoside was dissolved in the assay buffer at 4 mg/ml.
  • 0.1 ml of treated or untreated extract was transferred into a test tube containing 0.9 ml of assay buffer and 1 drop of 0.1%SDS and incubated for ⁇ min at 28°C.
  • 0.1 ml LB medium was used for blank.
  • 0.2 ml of 4 mg/ml ONPG was added to start an assay reaction. When adequate yellow color developed, the reaction was stopped by addition of 0.5 ml of 1 M Na2C ⁇ 3.
  • the incubation time was recorded and activity was measured on a spectrophotometer at OD420nm and O D 5 ⁇ 0n ⁇ v
  • the enzymatic activity from the heat-treated extract was calculated as follows. The activity after incubation was divided by the activity of the 5 zero time point; the ratio was then multiplied by 100 to yield a percentage.
  • the fusion constructs and the lacZ expression vector pAOH ⁇ were introduced into a /acZ-deletion E. coli strain ER2267 (NEB) by the 0 standard transformation procedure as previously described.
  • ER2267 ( ⁇ O ml), ER2267/pAHO ⁇ ( ⁇ O ml), pVT142 or pDVS712 plasmid (each in 1 liter) were grown at 30°C in LB media, supplemented with ampicillin at 100 ⁇ g/ml for plasmid-containing cells.
  • ODgrjOnm reached between 0.48 and O. ⁇
  • inducer IPTG was added into the cultures to 0.3 mM final concentration and the cultures were incubated at 23°C for 3 additional hours.
  • Cells were spun down, resuspended in ⁇ O ml (for ER2267 or pAHO ⁇ -bearing ER2267) or 100 ml (for pVT142- or pDVS712-bearing ER2267) LB media, sonicated for 3 0 min at 4°C and spun at 7000 rpm for 10 min. The supernatants were stored at -20°C. Three ⁇ ml aliquots of each extract were incubated and sampled at 23°C, 42°C or ⁇ 0°C for 16 hours. Aliquots of 0.9 ml were transferred into 1. ⁇ ml microfuge tubes after incubation for 1 , 2, 3, 4, 6 hours.
  • the fusion proteins were further tested for their ability to splice at higher temperatures, up to 80°C.
  • the initial reaction rates at different 0 temperatures were compared.
  • the extracts were incubated in 300 ⁇ l aliquots in 1. ⁇ ml-microfuge tubes at 42°C, ⁇ 0°C, 6 ⁇ °C or 80°C. 20 ⁇ l were taken from each heated extract sample at 1 ⁇ and 30 min and 1 , 2, and 4 hours, and mixed with 40 ⁇ l of water and 20 ⁇ l of ⁇ x sample buffer and boiled for 10 min.
  • Western blot analysis showed that Deep Vent ⁇ IVPS- ⁇ -galactosidase fusion protein was able to splice at 6 ⁇ °C and at
  • Example 2 IN-FRAME INSERTION OF IVPS IN A PCR GENERATED ⁇ LINEAR PLASMID. SUCH AS ONE ENCODING ⁇ -AGARASE I ln Example 2, we described inserting the IVPS cassettes from Example 1 into a restriction enzyme linearized plasmid. This method is limited by the availability of appropriate restriction enzyme sites in a target gene. PCR amplification using opposing primers on a circular plasmid allows linearization of any plasmid at any position, limited only by the capacity of the PCR reaction. Once the target plasmid is linear, the process is essentially the same as described in Example 2 for restriction enzyme generated linear plasmids.
  • insertion of an IVPS cassette into a target gene can be accomplished by ligation of an IVPS fragment with linear plasmid.
  • PCR primers are used to generate plasmids linearized just prior to a serine or threonine codon.
  • the serine or threonine at the insertion site can be positioned on either the IVPS fragment or on the target gene fragment.
  • the target gene PCR primer can be constructed with a deletion of the 3 nucleotides encoding the first residue of the downstream EPS. If the IVPS cassette lacks the serine or threonine codon, then PCR with opposing, abutting PCR primers is used to synthesize target plasmid linearized at the serine or threonine codons.
  • This example describes cloning two IVPS elements, Vent IVPS2 and Deep Vent IVPS1 , into a gene encoding ⁇ -agarase I (Yaphe, W.,
  • Example 2 Can. J. Microbiol. 3:987-993 (19 ⁇ 7)) by the procedure described in Example 2.
  • the Deep Vent IVPS1 is inserted in front of a serine, the 108th codon, of the 290 amino acid ⁇ -agarase I gene, while the Vent IVPS2 is inserted in front of a threonine, the 133th codon of the ⁇ - agarase I gene.
  • IVPS DNA fragments including the serine codon (for Deep Vent IVPS1) or the threonine codon (for Vent IVPS2) at the 3' end, were prepared as described in Example 1.
  • pAG6a1 NEB
  • a 3.8 Kb recombinant plasmid containing the ⁇ -c. arase I gene sequence in vector pUC18 in the orientation of lac promoter was used as a PCR template to synthesize linear plasmid DNA fragments.
  • Primers agaS108.rv ( ⁇ , -GAGAACTTTGTTCGTACCTG-3 , (SEQ ID NO:8)) and agaS108.fw ( ⁇ , -GGTATTATTTCTTCTAAAGCA-3 , (SEQ ID NO:9)) are compementary to DNA sequence ⁇ ' and 3' of the 108th codon, respectively.
  • the PCR mixture contained Vent DNA polymerase buffer (NEB), supplemented with 2 mM Magnesium sulfate, 400 ⁇ M of each dNTP, O. ⁇ ⁇ M of each primer, 20 ng plasmid DNA and 2 units of Vent DNA polymerase in 100 ⁇ l.
  • Amplification was carried out using a Perkin- Elmer/Cetus thermal cycler at 94°C for 30 sec, 4 ⁇ °C for 30 sec and 72°C for 5 min for 30 cycles.
  • PCR samples were extracted with phenol and chloroform, precipitated in 0.3 M NaAcetate and 50% isopropanol, recovered by spinning at 10 Krpm for 10 min in a microfuge, dried and resuspended in 100 ⁇ l of distilled water.
  • the DNA samples were then electrophoresed on a 1% low melting agarose gel and PCR-synthesized fragments were recovered as described in Example 1.
  • PCR-synthesized fragment with phosphorylated IVPS fragment (Example 1) was carried out at 16°C for 12 hours in 20 ⁇ l volume with addition of 9.5 ⁇ l distilled water, 2 ⁇ l of 10 X T4 DNA ligase buffer (NEB), 4 ⁇ l of 0.01 ⁇ g/ ⁇ l PCR-synthesized plasmid DNA, 4 ⁇ l IVPS DNA (0.20 ⁇ g of Vent IVPS2 or 0.32 ⁇ g Deep Vent IVPS1) and 0.5 ⁇ l of 400,000 M/ml of T4 DNA ligase (NEB). Transformation of E. coli strain RR1 with the ligation samples was performed as described in Example 2.
  • Transformants were cultured in LB medium, supplemented with 100 ⁇ g/ml ampicillin, for extraction of plasmid DNA using alkaline lysis method (Sambrook et al., Molecular Cloning: A Laboratory Manual (1989), Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York). Plasmid DNAs were compared with pAG6a1 by electrophoresis on a 0.8% agarose gel followed by staining with ethidium bromide. Recombinant plasmid pAG108S18 contains the Deep Vent IVPS1 insert while pAG133T22, 26, 31 and 3 ⁇ all contain the Vent IVPS2 insert.
  • RR1 cells carrying pAG108S18 or pAG133t3 ⁇ were cultured in 1 liter of a modified LB medium, lacking dextrose, supplemented with 100 ug/ml ampicillin, at 30°C until OD ⁇ oonm reached about O. ⁇ . After 0 addition of inducer IPTG to a final concentration of 0.3 mM, the cultures were cooled down and grown at 2 ⁇ °C for 4 additional hours. Cells were spun down and resuspended in ⁇ O ml LB medium. Crude extracts were prepared as described in Example 3.
  • IVPS sequence with or without the first downstream EPS codon, was inserted into a blunt, linearized plasmid. It is also possible to create a restriction site by silent mutations (preserving the amino acid residue) near the ends of either the IVPS or the target gene.
  • the target gene plasmid is generated by PCR. Since the restriction sites are within the IVPS, one must include the missing IVPS sequences on the ⁇ ' end of the respective target gene PCR primers to complete the IVPS and to generate compatible cloning sites in the target gene ( Figure ⁇ 6).
  • silent mutations in Vent IVPS2 can create a SspEI site at the ⁇ ' end using primer Vent IVS2 Forward SspEI ( ⁇ '-AGTGTCTC CGGAGAAAGTGAGAT-3' (SEQ ID N0:12)) and a Spel at its 3' end, by 0 using primer, Vent IVS2 Reverse Spel ( ⁇ '-ATTGTGTACTAGTATGTTGTT)
  • TGCAA-3 * (SEQ ID NO:13)
  • It can then be inserted, for example, between an aspartic acid codon (residue ⁇ 94) and a threonine codon (residue ⁇ 9 ⁇ ) within the lacZ coding region.
  • a linear target gene plasmid can be generated by PCR as described in Example 4 with ⁇ primers which include the SspEI and Spel sites, the remaining portion of the IVPS and a region with identity to lacZ using primer, /acZ1/BspE1 reverse ( ⁇ , -GCCTCCGGAGACACTATCGCCAAAATCACCGCCGTAA-3 , (SEQ ID NO:14)) and primer, lacZ2/Spe ⁇ forward ( ⁇ '-GCCACTAGTACAC AATACGCCGAACGATCGCCAGTTCT-3'(SEQ ID NO:1 ⁇ )).
  • DNA 0 fragments are synthesized from both the IVPS and the target gene by
  • a restriction site near the insertion site in the target gene can be used to insert an IVPS with ends compatible to the target gene.
  • Restriction site(s) can be created by silent nucleotide substitution at or near the insertion site or native restriction sites can be used.
  • a linear target gene plasmid is made by PCR as described in Example 4, beginning at the restriction sites near the insertion site.
  • the IVPS is synthesized with primers containing the compatible restriction sites and the remainder of the target gene sequence (the sequence between the restriction site and the insertion site).
  • the IVPS DNA fragment, with the ends overlapping the sequence at the insertion site can be synthesized, cut with the appropriate enzyme(s), and then ligated to the vector that is cut by the same enzyme(s).
  • IVPS elements can be inserted between residue 479 (aspartic acid) and 481 (serine) within the lacZ gene by creating a Sal ⁇ site (residues 478-479) and a Xbal site (residues 481-482 serine- arginine) by silent mutations.
  • This can be achieved by PCR of the target plasmid, pAHO ⁇ , described in example 2, using primers, /acZ3 Sal reverse ( ⁇ '-AGGGTCGACAGATTTGATCCAGCG-3' (SEQ ID NO:7)) and /acZ4 Xba forward ( ⁇ '-CCTTCTAGACCGGTGCAGTATGAAGG-3' (SEQ ID NO:16)).
  • the IVPS2 fragment is generated by PCR using primers,
  • Vent IVS2 Forward Sail ( ⁇ '-GCCGTCGACCCTAGTGTCTCAGGAGAAA GTGAGATC-3' (SEQ ID NO:17)) and Vent IVS2 reverse Xbal ( ⁇ '-GCCTC TAGAATTGTGTACCAGGATGTTGTTTGC-3' (SEQ ID NO:18)).
  • DNA fragments are synthesized from both the IVPS and the target gene by PCR.
  • Both IVPS and target gene primers contain the new restriction sites.
  • this vector also contains single Xbal and Sa I sites ( Figure 7). Therefore, the target gene vector PCR product must be cut under conditions which produce partial digestion. The required linear plasmid is then isolated from agarose gels.
  • DNA fragments with compatible ends can then be ligated to create a fusion gene. Since no extra residue would be left after excision of the IVPS, native ⁇ -galactosidase polypeptide would be expected to form if splicing occurs. Generally, it is important to select or create an unique site within the target gene and vector to facilitate the cloning process as described above.
  • Plasmids were screened for resistance to cleavage by Xmal.
  • the PpuMl site was similarly removed from the resulting vector, screening this time for resistance to PpuMl cleavage.
  • the ⁇ final vector was named pAML1. This vector allowed the use of unique Xmal and PpuMl sites within the polymerase gene.
  • the BsaAI/BamHI construct was mutagenized simultaneously with three oligonucleotides:
  • modified bases are underlined, and changes are indicated in parenthesis.
  • the oligonucleotide to create D1236A also 0 included silent base changes to create a Bsal site to assist in screening.
  • the resulting isolate was named pAMN2.
  • the ClallSspl construct was mutagenized simultaneously with four oligonucleotides: ⁇ ⁇ '-GTAGTGTCG 2 ACCCCATGCGG-3' (SEQ ID NO:22) ⁇ Sail nt 3863-3468)
  • the BsaAI/BamHI construct was also mutagenized with the oligonucleotide:
  • Ndel site at the initiation codon of pV174-1B1 was inactivated by partial Ndel cleavage, repairing the termini with Klenow, and recircularizing using T4 DNA ligase. Plasmids 0 were screened for the loss of the appropriate Ndel site.
  • One such construct was named pAKC4.
  • the pANG5 construct was assembled from the above parts:
  • Nsil BamHI from pAMW3 final ⁇ amino acids of the ⁇ polymerase plus the downstream region
  • BamH IXbal from pAML1 (T7 promoter, origin of replication, ampicillin resistance).
  • Comparisons between pANG ⁇ and the parent pV174-1 B1 show identical patterns of Vent DNA polymerase and I- 77/1 production, with the exception of the greater viability of the pANG ⁇ containing strains, as discussed below. This is as expected if splicing occurs at the protein level, as opposed to at the RNA or 0 DNA level.
  • the correct construct was verified by DNA sequencing.
  • tyrosine 1472 was replaced with an amber termination codon by placing the following duplex (SEQ ID NO:29) into pANG ⁇ cut with Agel and Smal:
  • pV174.1 B1 Two vectors were constructed using pV174.1 B1 to demonstrate photoactivatable protein splicing.
  • the first construct, pANY ⁇ (also referred to as "wild-type"), can be described on the amino acid level as follows: pV174.1 B1 ⁇ 1 -1063, ⁇ 1 ⁇ 44-1702, V1 ⁇ 42M, V1 ⁇ 41M,
  • 1 ⁇ 43opal(TGA) This construct is designed to give a ⁇ .8 kDa precursor protein, which splices out the 4 ⁇ .3 kDa endonuclease (I- 77/1) and yields a 10. ⁇ kDa ligation product, when translated in an in vitro transcription/translation system.
  • the second construct, pAOD1 (also referred to as the "amber mutant"), can be described on the amino acid level as follows: pV174.1B1 ⁇ 1-1063, ⁇ 1 ⁇ 44-1702, V1 ⁇ 42M, V1 ⁇ 41M, 1 ⁇ 43opal(TGA), S1082amber(TAG).
  • This construct is designed to give a 2.2 kDa amber fragment under standard in vitro transcription/translation conditions, but will incorporate a photoactivatible serine when the in vitro reaction is supplemented with an amber suppressor tRNA that has been chemically aminocylated with o-nitrobenzylserine. With the serine at position 1082 "blocked", the precursor is unable to splice. When irradiated with intense 3 ⁇ 0 nm light, the o-nitrobenzyl group is released (Pillai, supra), the nuceophilic hydroxyl side chain of serine is freed, and the protein is able to splice.
  • amber suppresssor tRNA (lacking the 3' terminal CA residues) was synthesized on milligram scale by in vitro runoff transcription of Fo/ -linearized pYPhe2 plasmid template with T7 RNA polymerase as 0 described (Ellman, et al., supra; Noren, et al., Nucleic Acids Res. 18:83
  • N-blocked serine can be converted to N- blocked O-(o-nitrobenzyl) serine by a standard alkyl halide substitution ⁇ reaction with a reagent such as o-nitrobenzylbromide.
  • the fully blocked serine was then coupled to ⁇ '-phosphc. 3 ⁇ xyribocytidylyl-(3'- ⁇ ')- riboadenosine (pdCpA) as described (Ellman, et al., supra).
  • the aminoacylated dimer was then ligated to the truncated suppressor tRNA with T4 RNA ligase (New England Biolabs, Inc.) to yield full-length aminoacylated suppressor tRNA.
  • coli D10 (Ellman, et al. supra) was thawed. 8.5 ⁇ l of S-30 extract was added, followed by 1.5 ⁇ l of T7 RNA polymerase (300 U/ ⁇ L, New England ⁇ Biolabs, Inc.), and the reactions were incubated 60 min. at 37°C.
  • the suppressor tRNA was added to the reaction immediately before addition of the S-30 extract. ⁇
  • Figure 9 shows a 10-20% tricine SDS-PAGE gel of in vitro transcription/translation reactions primed with either the "wild-type” (pANY ⁇ ) or "amber mutant” (pAOD1) constructs.
  • Lane 1 shows the ⁇ .8 kDa precursor and excised 45.3 kDa I- 77/1 endonuclease expressed in 0 vitro from the "wild-type” construct.
  • Lane 2 shows the "wild-type” reaction supplemented with 13.5 ⁇ g of full length uncharged amber suppressor tRNA to demonstrate there is no inhibition of translation due to added tRNA.
  • Lanes 3 and 4 show the result of in vitro expression of the "amber mutant" without and with full length unacylated supressor ⁇ tRNA (10. ⁇ ⁇ g) added. Neither of these reactions produce the full length -61 -
  • Precursor protein is produced in vitro, but no splice products (i.e., I- 77/1) are visible.
  • Controlled splicing was achieved by photochemically removing the o-nitrobenzyl group from the serine which had been incorporated site- specifically at position 1082 of the precursor protein.
  • a 6 ⁇ L aliquot of an in vitro reaction was treated with O. ⁇ ⁇ l of RNase A (10 ⁇ g/ ⁇ l) to arrest translation, irradiated with intense (27 ⁇ W) visible light from a GE model
  • #RSK6B tanning lamp at 10 cm for 10 minutes, diluted with 4 ⁇ l of water, and then incubated at 37°C for 60 minutes to allow splicing to occur.
  • the resulting splice products were visualized by electrophoresis on a 10-20% tricine SDS-PAGE gel followed by autoradiography ( Figure 10).
  • Figure 10 illustrates the results of exposing the chemically blocked precursor (Lane ⁇ , Figure 9) to 3 ⁇ 0 nm light.
  • Lanes 1 through 4 are controls in which the "wild-type" reaction (Lane 1 , Figure 9) was treated as follows. Lane 1 , incubated 60 min. at 37°C; Lane 2 added O. ⁇ ⁇ l RNase (10 ⁇ g/ ⁇ l) and incubated 60 min. at 37°C; Lane 3, irradiated 10 minutes with 3 ⁇ 0 nm light and incubated 60 min. at 37°C; Lane 4, treated with RNase as above, irradiated 10 min. with 3 ⁇ 0 nm light and incubated 60 min. at 37°C.
  • Lanes 5-8 show the result of treating the "blocked" precursor (Lane 5, Figure 9) in the same way as for Lanes 1-4, respectively. Irradiated of the "blocked" precursor results in the excision of the I- 77/1 (4 ⁇ .3 kDa) endonuclease encoded by IVPS2 (cf. Lanes 7-8 with Lanes ⁇ -6).
  • an IVPS (CIVPS) cassette can be modified and inserted into a target gene.
  • CIVPS3 modification of Pyrococcus sp. (or Deep Vent) IVPS1 (CIVPS3) 0 by substitution or deletion of the first native downstream residue (serine), and in-frame insertion of the modified cassettes into the EcoRV site of the E. coli lacZ gene.
  • an IVPS cassette can be modified by substitution and deletion of residue(s) or addition of residue(s) to one or both ends of IVPS.
  • the modified or fusion proteins using such modified IVPS cassettes may exhibit different catalytic activities, such as splicing 0 (peptide ligation) or cleavage at a specific peptide bond.
  • the first downstream residues at the carboxyl splice junction are serine for Deep Vent IVPS1 (CIVPS3) and Vent IVPS1 or threonine for Vent IVPS2.
  • the first IVPS residue at the ⁇ amino splice junction of CIVPS1 , CIVPS2 and CIVPS3 is serine.
  • Cysteine residues have been found at the splice junctions of the yeast TFP1 and M. tuberculosis RecA (See, Hirata, et al., supra; Kane, et al., supra; Davis, et al., supra). It is believed that serine, threonine or cysteine residues at splice junctions are essential for protein splicing 0 and cleavage. The previous examples have shown that an IVPS with the first downstream residue is sufficient to contain information for protein splicing. However, these residues may function differently in various IVPS contexts.
  • IVPS cassettes for in-frame insertion into the lacl coding region or any other target gene can be prepared by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the following protocol describes the production of four Deep Vent IVPS1 cassettes without or with an additional carboxyl terminal codon, serine, threonine or cysteine, referred as CIVPS3, CIVPS3/Ser, CIVPS3/Thr and CIVPS3/Cys, respectively.
  • pNEB#720 used as template has a 4.8 Kb BamHI fragment containing Deep Vent DNA polymerase gene inserted into the BamHI site of pUC19.
  • Reverse primers ⁇ '-GCAATTATGTGCATAGAGG AATCCA-3' (SEQ ID NO:40) and ⁇ '-GGTATTATGTGCATAGAGGAATCC A-3' (SEQ ID NO:41) (3428-3462) were used to generate CIVPS3/Thr 0 and and CIVPS3/Cys fragments (1614 bp), respectively.
  • the PCR mixture contains Vent DNA polymerase buffer (NEB), supplemented with 2 mM magnesium sulfate, 400 ⁇ M of each dNTP, 100 ⁇ g/ml BSA, 0.9 ⁇ M of each primer and 40 ng plasmid DNA and 2 units of Vent DNA polymerase in 100 ⁇ l.
  • Amplification was carried out by using a Perkin- ⁇ Elmer/Cetus thermal cycler at 94°C for 30 sec, 48°C for 30 sec. and
  • Primer ⁇ '-ATTATGTGCATAGAGGAATCCA AAG-3' (SEQ ID NO:42) (3425-3449) was used to synthesize CIVPS3 fragment (1611 bp) by PCR as described above except the amplification was carried out for 30 cycles.
  • Primer 5'-GCTATTATGTGCATAGAGGAAT 0 CCA-3' (SEQ ID NO:6) (3428-34 ⁇ 2) were used to synthesize IVPS1/Ser fragment (1614 bp) as previously described in Example 1.
  • PCR samples were extracted with phenol and chloroform, and precipitated in 0.3 ⁇ M NaAc and 60% isopropanol at -20°C for 6 hours, ⁇ recovered by spinning at 10 Krpm for 10 min. in a microfuge, dried and each resuspended in 20 ⁇ l of distilled water, loaded on a 1% low melting -64-
  • DNA fragments were recovered from the low melting agarose gel by incubation in 0.4 ml of TE buffer (10 mM Tris-HCI/0.1 mM EDTA, pH 8.0) at 6 ⁇ °C for 30 min., extractions with phenol and chloroform, precipitation in 0.3 ⁇ M NaAc 5 (pH ⁇ .2) and 60% isopropanol at -20°C for overnight. DNA was spun down, washed with 70% ethanol, dried and resspended in 10 ⁇ l distilled water.
  • TE buffer 10 mM Tris-HCI/0.1 mM EDTA, pH 8.0
  • PCR-synthesized CIVPS cassettes can be inserted into a target coding region by ligation with linearized vector bearing the target gene.
  • Linear plasmid vector can be prepared by restriction enzyme or PCR synthesis as previously described.
  • pAHO ⁇ carries the entire lacZ gene sequence on a 3.1 kb BamHI-Dral fragment from pRS41 ⁇ (Simons, et 0 al., Gene, 63:86-96 (1987)) inserted between BamHI and Smal sites in the polylinker of pAGR3 (NEB) downstream of a tac promoter.
  • the tac promoter is a transcription control element which can be repressed by the prodct of the /acl gene and be induced by isopropyl ⁇ -D- thiogalactoside (IPTG).
  • IPTG isopropyl ⁇ -D- thiogalactoside
  • EcoRV cleavage sites cuts within lacZ coding region between the 37 ⁇ th codon (aspartic acid) and the 376th codon (isoleucine).
  • DNA was partially digested by incubation of 16 ⁇ g of pAHO ⁇ DNA with 40 units of EcoRV (NEB) in 100 ⁇ l of 1 x NEB bffer 2 at 37°C for 60 min. 20 ⁇ l agarose gel loading dye was added to the sample after the sample was heated to 6 ⁇ °C for 10 min. to inactivate EcoRV. DNA fragments were separated by electrophoresis on a 1% low melting agarose gel. Linearized pAHO ⁇ plasmid DNA was recovered from the low melting agarose gel as described in Example 8 and resuspended in distilled water.
  • EcoRV EcoRV
  • CIVPS3-/acZ fusion was made by ligation of dephosphorylated pAHO ⁇ DNA to the phosphorylated IVPS1 fragment. The reaction was carried at 16°C for ⁇ hours in 20 ⁇ l volume with 1X T4 DNA ligase bffer (NEB), 0.1 ⁇ g pAHO ⁇ DNA, O. ⁇ ⁇ g IVPS1 DNA and 160 units of T4 DNA 0 ligase (NEB).
  • coli strain RR1 was transformed by mixing 100 ⁇ l of competent RR1 cells with 10 ⁇ l of ligation sample on ice for 30 min., heating at 42°C for 2 min., chilling on ice for ⁇ min., adding 0.8 ml LB media (10 grams/liter tryptone, ⁇ grams/liter yeast extract, 10 grams/liter NaCI, 1 gram/liter dextrose, 1 gram/liter MgC.26H2 ⁇ , pH 7.2 at 2 ⁇ °C) ⁇ and incubating at 30°C for 45 min. The samples were plated onto LB plates, supplemented with 100 ⁇ g/ml ampicillin. After incubation overnight at 30°C, abot 150-300 colonies per plate were observed.
  • CIVPS3/Thr-/acZ and CIVPS3/Cys-/acZ fusions were made by 0 ligation of 0.1 ⁇ g EcoRV-linearized pAHO ⁇ DNA with 0.7 g of
  • CIVPS3/Thr or CIVPS3/Cys fragment Transformation of E. coli strain ER2262 (NEB) was carried out by the same protocol as described above. Colony hybridization was utilized to screen for clones that carry recombinant plasmids.
  • the filters were incubated with the radiolabeled oligomer probe under the same conditions for overnight and then washed in 2 x SSC for times at 42°C for 1 ⁇ min. and twice at 60°C for two min., followed by autoradiography. ⁇
  • the positive clones that hybridized to the oligomer probe were further examined by their ability to express fusion proteins with inducer IPTG.
  • the clones were cultured in LB medium supplemented with 100 ⁇ g/ml ampicillin at 30°C until OD ⁇ oonm reached O. ⁇ . After addition of 0 IPTG to a final concentration of 0.3 mM, the cultures were grown at 30°C for 4 additional hours. Crude lysates were prepared by boiling 0.1 ml of cells with 0.1 ml of the urea lysis buffer for 10 min.
  • fusion proteins from the positive clones described above was analyzed by Western blots using antibody raised against ⁇ -galactosidase ⁇ (Promega) or l-Pspl (the protein product of Deep Vent CIVPS3, NEB).
  • pDVC302, 306 and 307 carry the CIVPS3/Cys cassette while pDVT319, 321 , 322 and 323 contain the CIVPS3/Thr cassette.
  • pDVS712 and 742 containing the CIVPS3/Ser insert were previously described in Example 2.
  • the constructs described above (CIVPS3 cassettes inserted into the lacZ EcoRV site) yield fusion proteins after induction by IPTG.
  • Cell extracts prepared from cells grown at 25°C were treated at elevated temperatures (42°C or 6 ⁇ °C) and ⁇ analyzed by Western blots using antibody against ⁇ -galactosidase
  • the IVPS1/Ser fusion protein can undergo protein splicing to generate a ligated protein and free IVPS endonuclease by incubation at elevated temperatures. While no ligation activity was observed, the 0 fusion proteins with the CIVPS3/Thr or CIVPS3/Cys cassette cleave dominantly at the amino splice jnction at 42°C and both fuuion proteins exhibit increased cleavage activity at the carboxyl splice jnction at 6 ⁇ °C.
  • a single colony from pDV7, pDVC302, 0 pDVT332 or pDVS712 clone was inoculated in 1.5 ml LB medium supplemented with 100 ⁇ g/ml ampicillin, incubated at 30°C until OD ⁇ OOnm reached about 0.5 and induced with 0.3 mM IPTG by adding 1.5 ml of 0.6 mM IPTG, 100 ⁇ g ampicillin/ml LB at 2 ⁇ °C for ⁇ hours. 3 ml of cells were spun down and resuspended in O. ⁇ ml of LB, sonicated for ⁇ 1 min. at 4°C and spun at 6,000 rpm for ⁇ min. at 4°C. The supernatants were recovered and stored at -20°C. -68-
  • the cell extracts were heat-treated at 42°C or 6 ⁇ °C after being quickly thawed at room temperature.
  • the untreated control sample was prepared by mixing 48 ⁇ l of extract with 12 ⁇ l of ⁇ x sample buffer (0.31 Tris-HCI, pH 6.8/10% SDS/2 ⁇ % 2-mercaptoethanol/ ⁇ 0% glycerol/0.00 ⁇ % Bromophenol ble), followed by boiling for 10 min. Aliquots of 48 ⁇ l were transferred into 1.6 ml microfuge tubes and incubated for 30, 60, 120, or 240 min. in a 42°C water bath, or 1 ⁇ , 30, 60 or 120 min. in a 6 ⁇ °C water bath. Each was mixed with 12 ⁇ l of ⁇ x 0 sample buffer and boiled for 10 min.
  • the treated samples were analyzed by Western blots using antibodies raised against l-Pspl (NEB) ( Figure 11 and 12) or ⁇ - galactosidase (Promega) (Figure 12), ⁇ ⁇ l of each sample was loaded ⁇ on 4/20% SDS polyacrylamide gels (ISS, Daichi, Tokyo, Japan) and electrophoresed at 100 volts for 4 hours.
  • Western blots were carried out according to the procedure of Promega.
  • IVPS1-C-EPS Another major product (IVPS1-C-EPS) of about 130 KDa 0 (corresponding to cleavage at the amino splice junction) was observed.
  • the pDV7 (CIVPS3- ⁇ -galactosidase fusion) sample produced only trace amounts of l-Pspl and products 5 corresponding to cleavage at single splice junctions at 6 ⁇ °C, indicating poor excision at either splice junction ( Figure 11 , lanes 1-3).
  • pDVC302, containing CIVPS3/Cys cassette showed accumulation of moderate amounts of l-Pspl and CIVPS3-C-EPS species at 42°C ( Figure 11 , lane 5).
  • a three-part fusion can be generated comprising a CIVPS; a segment which can be easily purified, e.g., a binding protein; and a protein or peptide of interest, i.e., a target protein.
  • the order of these parts can be varied.
  • the advantage of such a fusion is that it can be easily purified.
  • the peptide of interest can be separated from the fusion by unidirectional protein cleavage induced by a modified CIVPS.
  • This Example demonstrates that such a 3-part fusion composed of a binding protein, maltose binding protein (MBP), CIVPS3 and a paramyosin peptide can be easily purified on an amylose resin as an unspliced precursor.
  • the precursor can then be induced to splice, in this case by thermal activation.
  • no attempt has been made to limit cleavage to one side of the CIVPS so as to interfere with splicing to generate only cleavage products without ligation.
  • a CIVPS3 cassette was synthesized by PCR as described in previous Examples, with the following modifications.
  • the PCR mixture contained Vent DNA polymerase buffer (NEB), 200M of each dNTP, lOpmoles of each primer, 40ng of plasmid DNA and 2 units of Vent DNA polymerase in 1001.
  • Amplification was carried out using a Perken- Elmer thermal cycler at 94°C for 30 sec, ⁇ O°C for 30 sec and 72°C for 2 min for 20 cycles.
  • Deep Vent IVPS1 was synthesized from pNEB #720.
  • the forward primer was, Primer 96-6, ⁇ '-GGTACCCGTCGTGCTAG 5 CATTTTACCGGAAGAATGGGTACCA-3'(SEQ ID NO:43), consisting of
  • Deep Vent IVPS1 reverse primer, Primer 96-7, ⁇ '-CCC 0 GCTATTATGTGCATAGAGGGATCC-3' (SEQ ID NO:44) has a BamHI site at the 3' end. 23/24 bases at the 3' end are homologous to the 3' end of DV IVPS1 , with a single base substitution to create the BamHI site.
  • Primers 96-6 and 96-7 were used to synthesize the Deep Vent IVPS1 cassette (1.6kb). ⁇
  • the PCR sample was mixed 1 :1 with chloroform and the top aqeous layer was loaded on a 1% low melt agarose gel for electrophoresis.
  • the 1.6 kb band was excised from the gel and incubated at 6 ⁇ °C.
  • 0.2 ⁇ ml TE buffer (10mM Tris- 0 HCI/0.1 mM EDTA, pH7. ⁇ ) at 6 ⁇ °C was added and the sample was phenol-chloroform extracted (1 :1 mixtre).
  • the DNA was precipitated in O. ⁇ M NaCI and 2 volumes isopropanol at -20°C for 30 min.
  • the DNA was spun down, dried and resuspended in 60 ⁇ l TE bffer.
  • pPR1002 a pMAL-c2-paramyosin ⁇ Sal fusion plasmid, is a 7.2 kb vector that contains a tac promoter driven malE gene linked to an EcoRI- 0 Sail fragment of the D. immitis Paramyosin gene, referred to as the paramyosin ⁇ Sal deletion (Steel, et al., J. Immnology, 146:3917-3923 (1990)).
  • Two samples of 4 ⁇ g each of pPR1002 were linearized with 6 units of Xmnl (NEB) in 20 ⁇ l of 1X NEB bffer #2 containing 100 ⁇ g/ml BSA at 37°C for 2 hours. The reactions were loaded onto a 1% low ⁇ melting agarose gel. The 7.2 kb band was excised and purified from the gel as above, and resuspended in 40 ⁇ l of TE buffer. CONSTRUCTION OF pMIP17
  • Ligation of pPR1002 and Deep Vent IVPS1 was carried out at 5 16°C for 16 hours in a 25 ⁇ l volume with addition of 14. ⁇ l distilled water,
  • PCR amplification was utilized to screen for colonies that carried recombinant plasmids. Individual colonies were picked into 100 ⁇ l of distilled water in a 96 well microtitre dish, and boiled for ⁇ min to lyse the cells.
  • the PCR mixture contained Vent DNA polymerase buffer (NEB), ⁇ 200 ⁇ M of each dNTP, 10pmoles of each primer (same as above), 2. ⁇ l of cell lysate and 2 units of Vent Exo" DNA polymerase in a ⁇ O ⁇ l reaction.
  • Amplification was carried out by using a Perkin-Elmer thermal cycler at 94°C for 30 sec, 60°C for 30 sec and 72°C for 2 min for 30 cycles.
  • Positive clones containing pMIP17 were cultured in LB media supplemented with 100 ⁇ g/ml ampicillin at 30°C until ODeoonm reached
  • the pre-induction and 5-hour samples were frozen at -20°C for 16 hours and the 20-hour sample was frozen at -70°C for 1 ⁇ minutes.
  • cultures were induced at 12°C-20°C and amounts of precursor determined by Coomassie Blue stained gel. All the samples were boiled for ⁇ minutes and the protein products were analyzed by electrophoresis in SDS-PAGE followed by Coomassie Blue staining or Western blots using antibody raised against l-Pspl (NEB).
  • the samples were electrophoresed on 4-20% SDS gels (ISS, Daichi, Tokyo, Japan) with prestained markers (BRL), transferred to nitrocellulose, probed with antisera (mouse anti-l-Pspl), and detected using alkaline phosphate- linked anti-mouse secondary antibody as described by the manufacturer (Promega).
  • SDS gels ISS, Daichi, Tokyo, Japan
  • prestained markers BBL
  • antisera mouse anti-l-Pspl
  • alkaline phosphate- linked anti-mouse secondary antibody as described by the manufacturer (Promega).
  • a predicted major band at about 132kDa was observed in both the Coomassie Blue stained gels and Western blots (data not shown).
  • Amylose resin and MonoQ preparations containing several MIP- related polypeptides including precursor (132kDa), slowly migrating species (180kDa apparent molecular mass), products of cleavage at a single splice junction (103kDa and 89kDa), and small amounts of ⁇ spliced and excised products (72kDa and 60kDa) were heat-treated at
  • CIVPS fusions but that it is also possible to obtain single cleavage products. Further manipulation of the CIVPS junctions can favor cleavage at either splice junctions without ligation.
  • Example 9 an MIP fusion (see Example 9) with replaceable cassettes at both splice junctions and modification of the CIVPS by cassette substitution was constructed.
  • modified CIVPSs are capable of cleavage at predominantly a single splice junction in a thermal inducible manner.
  • Example 9 we described a three part fusion, MIP, that can be generated with the following properties: a CIVPS, a binding domain which can be easily purified (MBP) and a gene of interest (Paramyosin ⁇ Sal). Splicing of the purified fusion protein yielded two major products, the ligated protein domains, MBP-paramyosin ⁇ Sal, and the excised CIVPS (or l-Pspl). We reasoned that some modifications in the CIVPS may result in inhibition of the ligation reaction and enhancement of cleavage at one splice junction.
  • MBP binding domain which can be easily purified
  • Paramyosin ⁇ Sal a gene of interest
  • Example 8 we have shown that cleavage at one splice junction can be enhanced by modification of CIVPS3 (substitution of the C-terminal Ser by Thr or Cys) and that these changes reduce or prevent splicing or cleavage at the other junction.
  • CIVPS3 substitution of the C-terminal Ser by Thr or Cys
  • Example 9 we describe how the original MIP fusion of Example 9 has been modified to contain two unique restriction sites flanking each splice junction. In a cassette replacement, following restriction digestion, the short stretch of DNA between the two unique restriction sites at one of the splice junctions can be replaced by another short DNA cassette.
  • the pMIP17 fusion described in Example 9 to contain two unique restriction sites at each junction: a Xnol site and a Kpnl site flanking the amino splice junction and a BamHI site and a Sful site flanking the carboxyl splice junction (see Figure 14).
  • the MIP fusion with splice junction cassettes is constructed in two steps.
  • the BamHI and Sful sites were introduced as follows. 4 ⁇ g of pMIP17 (Example 9) was digested in 1x EcoRI buffer (NEB) with 0.5 units of EcoRI (NEB) in 50 ⁇ l at 37°C for 10 min. After electrophoretic separation in an 1% agarose gel, linearized pMIP17 plasmid DNA (8.8 Kb) was purified by using a Genecleanll kit (BIO101).
  • the purified pMIP17 DNA was digested in 1x BamHI buffer (NEB) supplemented with 100 ⁇ g/ml BSA, 40 units of BamHI (NEB) at 37°C for 3 hours and then extracted with phenol and chloroform. DNA was precipitated in 0.3 M NaAcetate (pH5.2) and 60% 2-propanol at -20°C for 2 hours. DNA was recovered by spinning for 10 min at 10,000 rpm in a microfuge, dried and resuspended in 20 ⁇ l sterile water.
  • MIP301F 5'-GATCCCTCTATGCACATAATTCAGGCCTC-3' (SEQ ID NO:46)
  • MIP302R ⁇ '-AATTGAGGCCTGAATTATGTGCATAGAG G-3' (SEQ ID NO:47)
  • 50 pmols of oligomers MIP301 F and MIP302R were incubated in 1 x T4 DNA ligase buffer (NEB) at 68°C for 15 min and slowly cooled to 20°C-30°C.
  • pMIP18 The upstream Xnol and Kpnl sites were introduced into pMIP18 as follows. 2 ⁇ g of pMIP18 was digested at 37°C for 4 hours in 100 ⁇ l of 1x Buffer 2 (NEB), 100 ⁇ g/ml BSA and 20 units of Kpnl (NEB). Following electrophoretic separation, linear pMIP18 DNA was purified by using the Genecleanll kit (BIO101).
  • MIP621 F ⁇ '-GCTCGAGGCTAGCATTTTACCGGAAGAATGGGTAC-3' (SEQ ID NO:48)
  • MIP622R ⁇ '-CCATTCTTCCGGTAAAATGCTAG CCTCGAGCGTAC-3' (SEQ ID NO:49)
  • 60 pmols of oligomers MIP301F and MIP302R were incubated in 1x T4 DNA ligase buffer (NEB) at 7 ⁇ °C for 1 ⁇ min and slowly cooled to 20°C-30°C.
  • pMIP21 contains two unique restriction sites at each splice junction. There is a Xnol site and a Kpnl site surrounding the N-terminal splice junction and a BamHI site and a Stul site surrounding the
  • the amino splice junction cassette includes 8 amino acid residues between the Xnol and Kpnl sites and the carboxyl splice junction cassette contains a sequence 0 coding for 6 amino acid residues between the BamHI and Sful sites.
  • Splice junctions can be changed by replacing either the N-terminal Xhol-Kpnl cassette or the C-terminal BamHI-Sful cassette.
  • C-terminal cassette replacement pMIP21 is first digested with BamHI and Sful.
  • Complementary primers containing desired mutations are ⁇ substituted for the original BamHI-Sful cassette.
  • two different junction cassettes were substituted for the MIP21 BamHI-Sful cassette.
  • Complementary oligomers MIP303F (5'-GATCCCTCTATAAGCAT AATTCAGG-3' (SEQ ID NO:50) and MIP304R (5'-CCTGAATTATGCT TATAGAGG-3' (SEQ ID NO: ⁇ 1 )) were used to substitute residue Alas35 ⁇ by Lys.
  • Complementary oligomers MIP311 F ( ⁇ '-GATCCCTCTATGCACT
  • GAATTCAGG-3' (SEQ ID NO:52)
  • MIP312R ⁇ '-CCTGAATTCAGTG CATAGAGG-3' (SEQ ID NO:53) were used to substitute HiS536 by Leu.
  • the BamHI-digested pMIP21 DNA was then digested with 40 units of Sful (NEB) in 100 ⁇ l 1x Buffer 2 (NEB) at 37°C for 3 hours, extracted with chloroform, precipitated in 0.3 M NaAcetate (pH ⁇ .2) and 60% 2-propanol at -20°C for overnight.
  • pMIP21 DNA was recovered by spinning for 10 5 min at 10,000 rpm in a microfuge, dried and resuspended in 30 ⁇ l sterile water.
  • 0.1 ⁇ g BamHI-Sful digested DNA was ligated at 23°C for 6 hours with 6 pmols of linker MIP303F/MIP304R or MIP311F/MIP312R in 10 ul of 1x T4 DNA ligase buffer (NEB) in the presence of 40 units of T4 DNA ligase (NEB).
  • the ligated DNA was used to transform E. coli RR1.
  • 0 pMIP23 contains the Ala535 to Lys substitution and pMIP28 contains the
  • fusion proteins were purified by amylose resin columns.
  • RR1 ⁇ harboring pMIP23 or pMIP28 were cultured in 1 liter of LB medium supplemented with 100 ⁇ g/ml ampicillin at 30°C until OD ⁇ rjOnm reached O. ⁇ . After the cultures were cooled on ice to about 1 ⁇ °C, IPTG was added to a final concentration of 0.3 mM, and the cultures were grown at 12°C-14°C for 12 additional hours. Cells were pelleted, immediately 0 frozen at -70°C and stored at -20°C.
  • the gel shows that with an increase in temperature MIP23 does not form the ligated product (MP) or the excised product (I), as the original construct does but instead accumulates the C-terminal cleavage products (Ml, 103 kD and P, 29 kD).
  • a three-part fusion protein composed of a binding domain for easy purification, a splicing domain (CIVPS3), and a target protein (paramyosin), was constructed as described in Example 9.
  • This 0 construct was purified and shown to be able to splice by thermal activation.
  • paramyosin in the MIP construct was replaced by the chitin binding domain (CBD) from the Saccharomyces cerevisiae chitinase gene (Kuranda and Robbins, J. Biological Chem., 266(29) :19768-19767 ⁇ (1991 )).
  • CBD chitin binding domain
  • the chitin binding domain can be used as an alternate binding protein for protein purification.
  • a chitin binding domain was synthesized by PCR as described in the previous examples, with the following modifications.
  • the PCR 6 mixture contained Vent DNA polymerase buffer (NEB), 200 ⁇ M of each dNTP, lOpmoles of each primer, 20ng of plasmid DNA and 1 unit of Vent DNA polymerase in 100 ⁇ l.
  • Amplification was carried out using a Perkin-Elmer thermal cycler at 9 ⁇ °C for 30 sec, ⁇ 5°C for 30 sec, and 72°C for 30 sec for 20 cycles.
  • the chitin binding domain was 0 synthesized from pCT30, a plasmid containing the Saccharomyces cerevisiae chitinase gene (Kuranda and Robbins, J. Biological Chem., 266(29):19758-19767 (1991 )).
  • the forward primer, primer 99-02, 5'-GTCAGGCCTCTCAGACAGT 5 ACAGCTCGTACAT-3' (SEQ ID NO:54) has a Sful site (AGGCCT (SEQ ID NO: ⁇ )) at the ⁇ ' end. 22 bases at the 3' end of the primer are identical to the ⁇ * end of the chitin binding domain of the chitinase gene.
  • the reverse primer, primer 99-03, ⁇ '-CCCCTGCAGTTAAAAGTAATTGC TTTCCAAATAAG-3' (SEQ ID NO:56) has a Psfl site (CTGCAG (SEQ ID NO:57)) at the ⁇ ' end.
  • the PCR sample was extracted with phenol-chloroform (1 :1 mixture) and the DNA was precipitated in 0.5M NaCI and 2 volumes isopropanol at -20°C for 30 min.
  • the DNA was spun down, dried and resuspended in 40 ⁇ l TE buffer. (10mM Tris-HCI, 0.1 mM EDTA, ph 7. ⁇ )
  • a digest containing 20 ⁇ l of the resuspended DNA, 21 ⁇ l distilled water, ⁇ l 10X NEB Buffer #2, 40 units Psfl (NEB) and 20 units Sful (NEB) was then carried out at 37°C for two hours in a ⁇ O ⁇ l volume.
  • the reaction was loaded on a 1.8% low melt agarose gel for electrophoresis.
  • the 0.25kb Psti/Stul digested product was excised from the gel and incubated at 6 ⁇ °C until the gel melted.
  • 0.2 ⁇ ml TE buffer at 6 ⁇ °C was added and the sample was phenol-chloroform extracted (1 :1 mixture).
  • the DNA was precipitated in O. ⁇ M NaCI and 2 volumes isopropanol at -20°C for 30 min, spun down, dried and resuspended in 40 ⁇ l TE buffer.
  • a PsA/Stu double digest separates the paramyosin coding region from the remainder of the pMIP21 , described in Example 10.
  • Two samples of 5 ⁇ g each of pMIP21 were digested with 60 units Psfl (NEB) and 30 units Sful (NEB), ⁇ l of NEB buffer #2, and 34 ⁇ l distilled water in a ⁇ O ⁇ l volume at 37°C for two hours. The reactions were loaded onto a
  • MIP21 as follows to create MBP-Deep Vent IVPS1-CBD constructs (MIC). 1 ⁇ l of 8.1 kb pMIP21 fragment, 10 ⁇ l of chitin binding domain (both prepared as described above) were combined with 9. ⁇ l distilled water, 2.5 ⁇ l of 10X T4 DNA ligase buffer (NEB), and 800 units of T4 DNA ligase 0 (NEB) and incubated at 16°C for 4 hours in a 25 ⁇ l volume.
  • E. coli strain RR1 tonA was transformed by (1 ) mixing 100 ⁇ l of competent RR1 tonA cells with ⁇ l of ligation sample and 100 ⁇ l of a 1 :2 mix 0.1MCaCl2 and 1XSSC(0.1 ⁇ M NaCI, 1 ⁇ mM NaCitrate) on ice ⁇ for 5 min., (2) heating at 42°C for 3 min., (3) chilling in ice for 5 min and
  • Alkaline lysis mini-prep DNA (Sambrook, supra) was utilized to 0 screen for clones that carry recombinant plasmids with the chitin binding domain. When digested with Psfl and Sful, the positive clones had a band corresponding to chitin binding domain and a band corresponding to the vector.
  • the restriction enzyme digests were carried out by mixing 10 ⁇ l miniprep DNA, 2. ⁇ l NEB buffer #2, 8.5 ⁇ l distilled water, 40 units 5 Psfl (NEB) and 20 units Sful (NEB) in a 25 ⁇ l volume at 37°C for 2 hours.
  • Protein samples from induced cultures were prepared as follows. After cooling the cultures to 12°C, IPTG was added to a final concentration of 1mM and the cultures were grown at 12°C for ⁇ additional hours. After 2 hours of induction, a 1.6ml sample was taken and after 5 hours of induction a 3ml sample was taken. Samples were 5 pelleted, resuspended in ⁇ O ⁇ l 5X protein sample buffer, frozen at -20°C for 16 hours, and then, thawed and boiled for ⁇ minutes. The protein products were analyzed by Coomassie Blue stained gels and Western blots using anti-MBP antibody (NEB).
  • the samples were electrophoresed on 4-20%SDS gels (ISS, Daichi, Tokyo, Japan) with 0 prestained markers (BRL), transferred to nitrocellulose, probed with anti-MBP antibody, and detected using alkaline phosphate-linked anti-rabbit secondary antibody as described by the manufacturer (Promega).
  • a predicted major band at about 110kDa for the MIC fusion protein was observed in both the Coomassie Blue stained gels and ⁇ Western blots.
  • Fusion protein was eluted with maltose (as described by the manufacturer) and 0 examined on an SDS-PAGE gel.
  • the amylose resin eluate was further purified by chromatography on FPLC MonoQ anion exchange resin (Pharmacia).
  • the column was washed with 0.2M NaCI, 10mM Tris-HCI pH8. ⁇ and eluted with a linear gradient of NaCI from 0.2 to 1.0M NaCI in 10mM Tris-HCI,pH8. ⁇ . Protein eluted between 0.4-0.6M NaCI.
  • the MIC 5 and MIP protein fusion products purified similarily on both the amylose resin and the MonoQ resin.
  • This Example demonstrates that in vitro splicing can occur in trans between halves of a precursor protein.
  • the position at which to split MIP (Example 9 and Xu et al., Cell, 75:1371-1377 (1993), the disclosure of which is hereby incorporated by reference herein) was chosen immediately upstream of a methionine residue in the native CIVPS3, although other sites might work equally well, including sites which result in gaps or overlapping CIVPS sequences.
  • one of the MIP half proteins was insoluble and splicing in trans was therefore performed in urea.
  • Partial or full denaturation should not be construed as a requirement in general, since other separation points may result in solubility of both halves and since the insoluble half can be rendered soluble for trans -splicing experiments under non-denaturing conditions.
  • a fusion of the malE gene (encoding MBP) with the first 249 amino acids of the CIVPS3 gene was synthesized by polymerase chain reaction (PCR) from pMIP21 (Example 10 and Xu et al., supra (1993) carrying a fusion between malE, CIVPS3 and D. immitis paramyosin ⁇ Sal genes using the forward primer 5'-GGAATTCCATATGAAAATCG AAGAAGGT-3' (SEQ ID NO:58) (Nde I site underlined) and the reverse primer ⁇ '-CGGGATCCCGTTATAGTGAGATAACGTCCC G-3' (SEQ ID NO:58) (Nde I site underlined) and the reverse primer ⁇ '-CGGGATCCCGTTATAGTGAGATAACGTCCC G-3' (SEQ ID NO:58) (Nde I site underlined) and the reverse primer ⁇ '-CGGGATCCCGTTATAGTGAGATAACGTCCC G-3' (SEQ ID NO:
  • PCR reaction mixtures contained Vent DNA polymerase buffer (New England Biolabs, Inc.; Beverly, Massachusetts), 400 mM each dNTP, 0.84 mM primers, 5 mg/ml plasmid DNA, and 20 U/ml Vent Exo + DNA polymerase (New England Biolabs, Inc.; Beverly, Massachusetts) in 60 ⁇ l.
  • Amplification was carried out using a Perkin-Elmer Cetus thermal cycler at 94°C for 30 seconds (s), 52°C for 30 s, and 72°C for 13 ⁇ s for 15 cycles. Restriction enzyme digests were performed as described by the manufacturer (New England Biolabs, Inc.; Beverly, Massachusetts). Gel purified Ndel/BamHI digested PCR products were ligated directly into gel purified
  • a fusion of the last 288 amino acids of the CIVPS3 gene with the D. immitis paramyosin ⁇ Sal gene was synthesized by PCR from pMIP21 (Xu et al., supra (1993)) using the forward primer 5'-GGAATTCCATATG CCAGAGGAAGAACTG-3' (SEQ ID NO:60) (Nde I site underlined) and the reverse primer ⁇ '-ATAGTTTAGCGGCCGCTCACGACGTTGTAA AACG-3' (SEQ ID NO:61) (Not I site underlined). PCR mixtures were as described above, except in 100 ⁇ l.
  • Amplification was carried out using a Perkin-Elmer Cetus thermal cycler at 94°C for 30 s, ⁇ 2°C for 30 s, and 72°C for 10 ⁇ s for 10 cycles.
  • Gel purified Ndel/Notl digested PCR products were ligated directly into gel purified Notl/Ndel digested pPHT- T7 vector to create pl/M260-PH (Sambrook, supra (1989).
  • E.CO// ER2169 pLysS) was transformed with pl/M250-PH to create strain NEB942.
  • the protein produced by NEB942 was called I'P for CIVPS3 C-terminal domain (IVPS) -D. immitis Paramyosin ⁇ Sal-HisTag fusion.
  • the C- terminal domain has no additional amino acids since it begins with a methionine present in CIVPS.
  • IPTG isopropyl ⁇ -D-thiogalactoside
  • I'P protein was expressed in E.coli, approximately 90% was insoluble, which is common with many HisTag (6-10 histidines) fusion proteins. Therefore, I'P samples were solubilized in 6M urea for purification and chromatographed over a Ni 2+ affinity resin.
  • NEB942 was grown at 30°C in LB medium plus 100 ⁇ g/ml ampicillin to an OD600 of «0.5. The culture was induced at 30°C with 0.4 mM IPTG overnight. The cells were harvested at 4°C and stored at
  • Frozen cells from a 1 liter culture were thawed in 130 ml of amylose column buffer (0.2 M NaCI, 0.01 M Tris-HCI pH 8.5, 1.0 mM Na2-EDTA) and broken by sonication. After centrifugation at 20,000 g for
  • the pellet containing insoluble material, including the I'P protein was resuspended in 130 ml of column buffer and centrifuged as before.
  • the washed pellet was resuspended a second time in 130 ml of column buffer and spun as before.
  • the twice washed pellet was finally resuspended in 130 ml of Ni 2+ binding buffer (20 mM Tris-HCI pH 7.9, 500 mM NaCI, 16 mM Imidazole) complemented with 6 M urea.
  • the solubilized pellet was stirred overnight at 4°C, then centrifuged a last time at 31 ,000 g for 1 hour.
  • the mixture was diluted ⁇ O-fold in buffer B (Tris-HCI pH 6, 500 mM NaCI) and renaturation was allowed to occur during the 2 hour concentration step to 0.5-2 mg/ml at 4°C.
  • the mixture was heated in a Perkin-Elmer Cetus thermal cycler at 42°C for 1 hour to induce splicing.
  • samples were collected at time-points and Western blots (Sambrook, supra(1989)) were performed in duplicate with either mouse sera raised against CIVPS3 (anti-PI-Pspl) or paramyosin ⁇ Sal (Steel et al., J.
  • anti-MBP sera (New England Biolabs, Inc.; Beverly, Massachusetts) which reacts with the similarly sized MP and MP, is not diagnostic since as Ml' decreases, MP increases at the same position in the gel. As a result, the anti-MBP sera detects a relatively constant band at 72 kDa.
  • the Western blot with the mouse anti-CIVPS3 sera demonstrates the decay of the substrates (MP and PP) and the formation of the I' products (which are often inseparable during electrophoresis because of their similar molecular masses).
  • Western blots using anti-Paramyosin antibodies show that there is no cross-reactivity, since anti-Paramyosin sera fails to react with Ml' ( Figure
  • Protein splicing of MIP, in cis, is more efficient at high temperatures (up to 65°C) and low pH (6.0) (Xu et al., supra(1994); Xu et al., supra(1993) and Example 11.
  • the splicing reaction for trans -splicing was set at 42°C, pH 6.0, although other temperatures and pH's also work.
  • a time course of trans -splicing is shown in Figure 17A and 17B.
  • the trans -splicing reaction is best monitored by the accumulation of the 72 kDa MP as shown on Western blots using anti-Paramyosin sera and the decrease in MP and PP and the formation of P using anti-CIVPS3 sera (anti-PI-Pspl, Figure 17A).
  • both MP and I'P were exchanged into 7.2 M urea in buffer A using a Microsep concentrator (Filtron Technology Corp.; Northborough, Massachusetts) and mixed at a final concentration of
  • l-Pspl or Pl-Pspl is the same as CIVPS3 or I in this example.
  • the substrate DNA used for l-Pspl digestion is pAKR7, which was generated by subcloning a 714 bp EcoRI fragment from pAKK4 (Perler et al., supra (1992)) into the EcoRI site of Bluescript SK-. This 714 bp fragment contains the coding region surrounding the sites where IVPS1 and IVPS2 were found in the wild type Vent DNA polymerase clone. Cleavage with Xmnl and l-Pspl should give fragments of about 2327 and 1361 bp.
  • Test substrate DNA pAKR7
  • Ml', PP the trans -splicing reaction products or c/s-spliced MIP52
  • Figure 18 pAKR7 was cut with Xmnl to linearize the plasmid at a point near the I- Pspl restriction site, ⁇ g of pAKR7 DNA was digested with 6 Units Xmnl (New England Biolabs, Inc.; Beverly, Massachusetts) in NEB buffer 2 for 100 min at 37°C.
  • MIP52 protein was used as a control.
  • MIP52 is a mutant form of MIP containing an insert of MILVA prior to Ser1 of C1VPS3 and this insertion has no effect on splicing or endonuclease activity.
  • MIP62 was used rather than l-Psp I because the c/s-spliced mixture more closely mimicked the trans -spliced mixture.
  • the MIP62 control sample contained precursor MIP and c/s-spliced MP and I products. Endonuclease activity was only present in the MIP52 enzyme and the trans -spliced mixture, indicating that the above trans -splicing protocol not only re-establishes the ability to splice, but also re ⁇ establishes endonuclease activity in CIVPS3.
  • MP and I'P were added separately to a digestion mixture as above; no digestion was observed ( Figure 18), indicating that both protein fragments are required to restore endonuclease activity.
  • Example 12 we describe cleavage at the C-terminal of CIVPS3 in trans using the MIP fragments described in Example 12 as a starting point.
  • Example 12 we described the construction of MP and I'P, which were used for frans-splicing.
  • this example we replaced the splice junction cassette in pMI/L249 (which encodes M ) with a duplex oligomer which replaces Ile2 of CIVPS3 with Lys.
  • the techniques used are as described in Examples 10 and 12. Briefly, prior to ligation with the vector, pMI L249, two complementary oligomers, DVMIP526FW (5'-TC GAGGCTAGCAAATTACCGGAAGAATGGGTAC-3' (SEQ ID NO:62)) and DVMIP526RV ( ⁇ '-CCATTCTTCCGGTA " TTTGCTAGCC-3' (SEQ ID NO:62)) and DVMIP526RV ( ⁇ '-CCATTCTTCCGGTA " TTTGCTAGCC-3' (SEQ ID NO:62)) and DVMIP526RV ( ⁇ '-CCATTCTTCCGGTA " TTTGCTAGCC-3
  • 0.1 ⁇ g of Xhol-Kpnl-digested pMI/L249 DNA was ligated overnight at 16°C in 10 ⁇ l 1x T4 ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts) with 80 units of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts) and
  • PP was purified as described in Example 12.
  • MP22 was purified as described for MP in Example 12.
  • the initial protocol chosen for this study was as described in Example 12, involved mixing both halves of MIP in urea, incubating at 4°C, rapidly diluting the proteins and then allowing the diluted proteins to refold. This was followed by a standard in vitro splicing protocol (Xu, M., et al., supra (1994); Xu, M., et al., supra (1993)). Variation of the different parameters including initial concentration, urea concentration (or other denaturants), dilution factor, length of incubation and protein ratio, allows the optimization of refolding and frans-cleaving efficiencies.
  • Example 10 we described modification of CIVPS3 in the MIP fusion by cassette replacement which resulted in cleavage at one of the splice junctions instead of splicing.
  • pMIP21 contains two unique restriction sites at each splice junction: an Xhol site and a Kpnl site flanking the N-terminal splice junction and a BamHI site and a Stul site flanking the C-terminal splice junction ( Figure 14, Example 10).
  • the N-terminal splice junction residue(s) can be changed by replacing the Xhol-Kpnl cassette, while the C-terminal splice junction residue (s) can be altered by substituting the BamHI-Stul cassette.
  • pMIP21 is first digested with Xhol and Kpnl.
  • a cassette carrying desired mutations, formed by annealing two complementary primers, is substituted for the original Xhol-Kpnl cassette.
  • Some modifications in the CIVPS may allow activation of cleavage or splicing activity by chemical treatment.
  • substitution of Ser1 by Cys in CIVPS3 results in a chemical-inducible CIVPS in the Ml (a truncated form of MIP) context, which, upon chemical activation with hydroxylamine, results in cleavage of the bond between MBP and cysteine in the modified
  • pMIP21 (Example 10) by substituting a serine with a cysteine at the N-terminal splice junction of 5 CIVPS3 (SerlCys) by cassette replacement to yield pMIP47.
  • 2 ⁇ g of pMIP21 was digested at 37°C for 4 hours in 100 ⁇ l of 1x Buffer 1 (New England Biolabs, Inc.; Beverly, Massachusetts), 100 ⁇ g/ml BSA and 20 units of Xhol and 20 units of Kpnl (New England Biolabs, Inc.; Beverly, Massachusetts).
  • pMIP21 DNA was purified by using the Geneclean II kit (BIO101 ;
  • MIP636FW (5'- TCGAGGCTTGCATTTTACCGGAAGAATGGGTAC-3' (SEQ ID NO:64)
  • MIP536RV 5'-CCATTCTTCCGGTAAAATGCAAGCC-3' (SEQ ID NO:65)
  • MIP536RV were incubated in 50 ⁇ l of 1X T4 DNA ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts) at 65°C for 15 min and slowly cooled to 20-30°C. Approximately 0.1 ⁇ g of the Xhol-Kpnl digested pMIP21 DNA was ligated at 16°C overnight in 10 ⁇ l of 1x T4 0 DNA ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts)),
  • pMI84 was constructed in two steps by the following cassette replacement experiments.
  • pMIP21 was first modified by replacing the C- 0 terminal splice junction cassette with linker MIP353FW/MIP364RV to yield pMIP66.
  • the linker MIP353FW/MIP364RV containing a Sphl recognition sequence, was formed by annealing two complementary oligomers, MIP363FW ( ⁇ '-GATCCCTCTATAAGCATAATATTGGCATG CAGTA-3' (SEQ ID NO:66)) and MIP354RV ( ⁇ '-TACTGCATGCCAATATT ⁇ ATGCTTATAGAGG-3' (SEQ ID NO:67)) as described above.
  • pMIP21 DNA was digested with BamHI (New England Biolabs, Inc.; Beverly, Massachusetts) and StuI (New England Biolabs, Inc.; Beverly, Massachusetts) as described in Example 10.
  • BamHI New England Biolabs, Inc.; Beverly, Massachusetts
  • StuI New England Biolabs, Inc.; Beverly, Massachusetts
  • 0.1 ⁇ g BamHI/Stul digested pMIP21 DNA was ligated at 16°C overnight with 16.6 pmol of linker MIP353FW/MIP364RV in 10 ⁇ l of 1 x T4 DNA ligase buffer (New
  • pMIP66 contains unique BamHI and Sphl sites flanking the C- terminal splice junction, allowing linker replacement following BamHI and Sphl digestion. A stop codon was then inserted after the CIVPS C- terminus to create the Ml truncated fusion. Ser538 was mutated to a translational stop codon (TAA) by replacing the BamHI-Sphl cassette with the linker MIP385FW/MIP386RV. The linker was formed as described above by annealing two complementary oligomers,
  • MIP385FW ( ⁇ '-GATCCCTCTATGCACATAATTAAGGCATG-3' (SEQ ID NO:68)) and MIP386RV (5'-CCTTAATTATGTGCATAGAGG-3'(SEQ ID NO:69)).
  • This mutagenesis cassette contains compatible termini to replace the C-terminal splice junction cassette following BamHI-Sphl cleavage of pMIP66. Approximately 1 ⁇ g of pMIP66 was digested at
  • pMIP66 DNA was purified by the Geneclean II kit (BIO101 ; Vista, California) in 20 ⁇ l of 10 mM Tris-HCI (pH 8.0)/0.1 mM EDTA.
  • Approximately 0.05 ⁇ g of the BamHI-Sphl digested pMIP66 DNA was ligated at 16°C overnight in 10 ml of 1x T4 DNA ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts), 80 units of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts) and 16.6 pmol of the linker MIP ⁇ 3 ⁇ FW/MIP ⁇ 36RV, to yield pMI84.
  • the ligated DNA samples were used to transform E.coli strain ER2426 (NEB974).
  • the translational stop codon (TAA) introduced at the C-terminal splice junction in pMI84 was transferred into pMIP47 to yield pMI94 by ligation of a 6.6 Kb Kpnl-Pstl fragment of pMIP47 and a 2.3 Kb Kpnl-Pstl 0 fragment of pMI84.
  • 1 ⁇ g of each pMIP47 and pMI84 DNA was incubated at 37°C for 4 hours in 30 ⁇ l of 1 x Buffer 1 (New England Biolabs, Inc.; Beverly, Massachusetts), 10 units of Kpnl (New England Biolabs, Inc.; Beverly, Massachusetts) and 10 units of Pstl (New England Biolabs, Inc.; Beverly, Massachusetts).
  • the 6.6 Kb Kpnl-Pstl fragment from the pMIP47 sample and the 2.3 Kb Kpnl-Pstl fragment from the pMI84 sample were purified by the Geneclean II kit (BIO101), each in 20 ⁇ l of 10 mM Tris-HCI (pH 8.0)/0.1 mM EDTA.
  • pMI94 was formed by incubation at 16°C overnight of 1 ⁇ l of the purified 6.6 Kb pMIP47 DNA and 7.8 ⁇ l of the purified 2.3 Kb 0 pMI84 DNA, 1 ⁇ l of 10x T4 DNA ligase buffer (New England Biolabs,
  • pMI94 encodes the Ml fusion protein with the Serf Cys substitution ⁇ which is present in pMI47 in the full MIP fusion context.
  • the pMI94 construct expresses the MBP-CIVPS3 fusion protein, termed MI94, containing a cysteine residue instead of the native serine residue at the N-terminal of CIVPS3.
  • MI94 MBP-CIVPS3 fusion protein
  • ER2426 5 (NEB974) harboring pMI94 was cultured in 2 liters of LB medium supplemented with 100 ⁇ g/ml ampicillin and induced as described in Example 10. Cells were pelleted, sonicated in 100 ml of pH 8.6 column buffer (20 mM NaP04, pH 8.6, 600 mM NaCI) and spun down.
  • the cleared lysate was loaded over a 1 ⁇ ml amylose resin column (New England Biolabs, Inc.; Beverly, Massachusetts). The column was washed with 100 ml of pH 8. ⁇ column buffer and subsequently with 100 ml pH 6 column buffer (20 mM NaP ⁇ 4, pH 6.0, 600 mM NaCI). MI94 was eluted with 10 mM maltose in pH 6 column buffer (as the procedure described in Example 9).
  • NH2OH Hydroxylamine
  • yeast intein Protein splicing activity of IVPS (yeast intein) from Saccharomyces cerevisiae has been described by Hirata et al , supra and Kane et al., supra.
  • the yeast intein fusion system is a 3-part fusion composed of a maltose binding protein (MBP), a genetically engineered yeast intein (Y), a chitin binding domain (B).
  • MBP maltose binding protein
  • Y genetically engineered yeast intein
  • B a chitin binding domain
  • This yeast intein fusion system named MYB fusion, can be induced to cleave at the N-terminal splicing juntion (Cys1 ) between the maltose binding protein and the yeast intein.
  • MBP can be replaced by the target protein in the MYB protein purification system.
  • Yeast IVPS (Gimble, et al., J. Biol. Chem., 268(29)21844- 21853 (1993), the disclosure of which is hereby incorporated by reference herein) was amplified by PCR from the plasmid of pT7VDE and inserted into MIP21 (described in Example 10 ) between the Xhol site and the StuI site to replace the CIVPS3 (or the Pyroccocus IVPS).
  • Primer pairs 5'-GCGCTCGAGGGGTGCTTTGCCAAGGGTACCAAT-3' (SEQ ID NO:70) and 5'-CCTCCGCAATTATGGACGACAACCTGGT-3' (SEQ ID NO:71 ) were used to to synthesize the IVPS fragment by PCR.
  • the PCR mixture contains Vent DNA polymerase buffer (New England Biolabs, Inc; Beverly, Massachusetts), supplemented with 4 mM Magnesium sulfate, 400 uM of each dNTP, 1 uM of each primer, 50 ng pT7VDE DNA and 0.5 units of Vent DNA polymerase in 50 ul.
  • Amplification was carried out by using a Perkin-Elmer/Cetus (Emeryville, California) thermal cycler at 94°C for 30 sec, 50°C for 30 sec and 72°C for 5 min for 20 cycles.
  • the 5 samples were electrophoresed on an 1 % agarose gel and approximately 2 ug of PCR-synthesized 1.3 Kb fragment were recovered in 20 ul of distilled water by Geneclean II kit (BIO101 ; Vista, California).
  • the purified DNA was subjected to digestion in a 100 ul 1 X NEB buffer 2 with 40 units of Xhol (New England Biolabs, Inc.; Beverly, 0 Massachusetts).
  • the digested DNA was extracted with phenol and choroform and precipitated in 0.3 M NaAcetate pH5.2 and 70% ethanol at -20°C overnight. DNA was spun down, dried and resuspended in 40 ul distilled water.
  • O. ⁇ ug of MIP21 DNA was digested by Xhol and StuI and the 7.2 Kb vector DNA was purified from 1% agarose gel by ⁇ Geneclean II (BI0101 ; Vista, California) at O. ⁇ ug/20ul.
  • MYP1 was created by ligation of Xhol-digested IVPS fragment to the 7.2 Kb Xhol-Stul MIP21 fragment.
  • the reaction was carried out at 22°C for ⁇ hours in 10 ul volume with addition of 2 ul of 10X T4 DNA 0 ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts), 0.4 ug IVPS DNA, 0.026 ug MIP21 fragment, and 200 units of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts). Transformation of E. coli strain RR1 with the ligation samples was performed as described in Example 2.
  • Transfomants were cultured in LB medium, supplemented 5 with 100 ug/ml ampicillin, for extraction of plasmid DNA using Qiagen spin column (Qiagen, Inc.; Study City, California). The clones were further examined by their ability to splice to form MP species (71 KDa).
  • MYP1-9 Nine clones carrying MYP1-9 were cultured in LB medium supplemented with 100 ug/ml ampicillin, at 30°C until OD600nm 0 reached about 0.5. Expression of the MYP fusion gene was induced by addition of IPTG to a final concentration of 1 mM at 30°C for 3 additional hours. Cells were spun down and resuspended in O. ⁇ ml LB medium.
  • the first modificaiton of yeast intein was to create two unique restriction sites (BamHI and EcoRI) on the either side of the C-terminal splicing junction. This would facilitate further cassette mutagenesis.
  • the gel slices were mixed and melt at 65°C for 10 min. The mixture was then incubated at 42°C for 10 min before 1 unit of ⁇ -agarase (New England Biolabs, Inc.; Beverly, Massachusetts) was added. After further 1 hr incubation, the mixture was ready for DNA ligation reaction.
  • the ligation was conducted in 1 x T4 DNA ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts) containing 0.5 unit of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts) at 15°C overnight. 15 ⁇ L of the ligation mixture was used to transform E. coli strain ER2267 (New England Biolabs, Inc.; Beverly, Massachusetts).
  • the resulting construct was named pLit-YP, a LITMUS vector containing the yeast intein.
  • pLit-YP was used for the synthesis of the single-stranded DNA and the subsequent Kunkel mutagenesis (Kunkel, T.A., PNAS (1985), 82:488, the disclosure of which is hereby incorporated by reference herein).
  • pLit-YP was first transformed into the competent E. coli strain CJ236 (New England Biolabs, Inc.; Beverly, Massachusetts). A single colony was picked to innoculate 50 ml rich LB medium. The cells were allowed to grow at 37°C for 2-3 hr under vigorous aeration. 50 ⁇ L of M13K07 helper phage (New England Biolabs, Inc.; Beverly, Massachusetts) was then added to the culture.
  • kanamycin was added to the final concentration of 70 ⁇ g per mL culture. After overnight culture, the cells were spun down. 10 mL of 20% PEG containing 2.6 M NaCI was added into the supernatant. The phage which contained the single-stranded Lit-YP DNA (ss pLit-YP) was allowed to precipitated on ice for 1 hr. The supernatant was then centrifuged at 8000 rpm for 10 min. The phage pellet was resuspended in 1.6 mL TE buffer (20 mM Tris, pH 8.0, 1 mM EDTA).
  • MYP(EcoR) ⁇ '- GAATGCGGAATTCAGG CCTCCGCA-3' (SEQ ID NO:72)
  • MYP (Bam) ⁇ '-ATGGACGACAAC
  • CTGGGATCCAAGCAAAAACTGATGATC-3' (SEQ ID NO:73) were first 5' phosphorylated.
  • the mutagenic primers (20 pmol each) were added to a 20 ⁇ L reaction mixture containing 1 x T4 poiynucleotide kinase buffer (New England Biolabs, Inc.; Beverly, Massachusetts), 1 mM ATP, and 1 unit of T4 poiynucleotide kinase (New England Biolabs, Inc.; Beverly, Massachusetts).
  • the reaction was conducted at 37°C for 30 min followed by a 10-min heat inactivation of the T4 poiynucleotide kinase at 6 ⁇ °C.
  • Xho-Pst fragment from pLit-YP' and the digested pMYP were excised from the gel.
  • the gel slices were mixed and melt at 65°C for 10 min.
  • the mixture was then incubated at 42°C for 10 min before 1 unit of ⁇ - agarase (New England Biolabs, Inc.; Beverly, Massachusetts) was 0 added.
  • After further 1 hr incubation, the mixture was ready for DNA ligation reaction.
  • the ligation was conducted in 1 x T4 DNA ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts) containing O. ⁇ unit of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts) at 1 ⁇ °C overnight. 15 ⁇ L of the ligation mixture was used to transform E. -9 ⁇ -
  • the second modification was to replace Asn454 with Ala. This was achieved by cassette mutagenesis.
  • 1 ⁇ g of pMYP' was digested at 37°C for 2 hours in 1 ⁇ ⁇ L of 1x Buffer 1 (New England Biolabs, Inc.; Beverly, Massachusetts), 100 ⁇ g/ml BSA and 1 unit of Xhol and 1 unit of Kpnl (New England Biolabs, Inc.; Beverly, Massachusetts).
  • 1x Buffer 1 New England Biolabs, Inc.; Beverly, Massachusetts
  • BSA bovine serum
  • Kpnl New England Biolabs, Inc.; Beverly, Massachusetts
  • MYP' (N454A)FW ⁇ 'GATCCCAG GTTGTCGTCCATGCATGCGGAGGCCTG-3' (SEQ ID NO:74)
  • MYP'(N454A)RV ⁇ 'AATTCAGGCCTCCGCATGCA TGGACGACAACCTGG-3' (SEQ ID NO:75)
  • the ligated DNA sample was used to transform E.coli strain ER2267.
  • the resulting plasmid was named pMYP'(N454A).
  • yeast intein purification vector employed the chitin-binding domain as the affinity tag for affinity purification. Since pMIC (Example 11) contains the chitin-binding domain and compatible restriction sites for direct cloning, the Xhol-BamHI fragment from pMYP'(N4 ⁇ 4A) was first 5 transfered into pMIC, replacing the original Xhol-BamHI sequence. On the next step, a BamHI-Agel linker insertion was conducted to restore the yeast intein C-terminal splicing junction sequence.
  • the 0 mixture was ready for DNA ligation reaction.
  • the ligation was conducted in 1 x ligase buffer (New England Biolabs, Inc.; Beverly, Massachusetts) containing O. ⁇ unit of T4 DNA ligase (New England Biolabs, Inc.; Beverly, Massachusetts) at 1 ⁇ °C overnight. 15 ⁇ l of the ligation mixture was used to transform E. coli strain ER2267 (New England Biolabs, Inc.; 5 Beverly, Massachusetts). The resulting construct was pMY-IC.
  • 1 ⁇ g of pMY-IC was digested at 37°C for 2 hours in 15 ⁇ L of 1x BamHI buffer (New England Biolabs, Inc.; Beverly, Massachusetts), 1 unit of BamHI (New England Biolabs, Inc.; Beverly, Massachusetts) and 0 1 unit of Agel (New England Biolabs, Inc.; Beverly, Massachusetts).
  • 1x BamHI buffer New England Biolabs, Inc.; Beverly, Massachusetts
  • BamHI New England Biolabs, Inc.; Beverly, Massachusetts
  • Agel New England Biolabs, Inc.; Beverly, Massachusetts
  • MYB(Bam-Age)FW 5' GATCCCAGGTTGT CGTCCATGCATGCGGTGGCCTGA-3' (SEQ ID NO:76)
  • MYB(Bam- Age)RV ⁇ , -CCGGTCAGGCCTCCGCATGCATGGACGACAACCTGG-3 * ⁇ (SEQ ID NO:77)
  • the ligated DNA sample was used to transform E.coli strain ER2267.
  • the resulting 6 plasmid was named pMYB129 ( Figure 21), a sample of which has been deposited under the terms and conditions of the Budapest Treaty with the American Type Culture Collection on December 28, 1996 and received ATCC Accession Number 97398.
  • the pMYB129 construct was used to illustrate the one step ⁇ purification of a target protein.
  • the maltose binding protein is the target protein.
  • the E. coli strain ER2267 harboring pMYB129 was cultured at 37°C in 1 liter of LB medium supplemented with 100 ⁇ g/mL ampicillin. The culture was allowed to grow until the OD at 600 nm reached 0.7. The induction was conducted by adding IPTG to the final 0 concentration of 0.4 mM. The induced culture was grown at 30°C for 3 hr before the cells was harvested by centrifugation at 4000 rpm for 25 min.
  • the cell pellet was resuspended in 50 mL of the column buffer (20 mM HEPES, pH 7.6, 0.5 M NaCI). The cell suspension was sonicated for 6 min and then centrifuged at 13,000 rpm for 30 min to give the clear 5 lysate (around 50 mL). The lysate was directly loaded onto a chitin (Sigma; St. Louis, Missouri) and binding was allowed at 4°C for 30 min. (Other preferred chitin resins which can be employed are described hereinbelow.) The chitin was then washed with 10 volumes of column buffer (20 mM HEPES, pH 7.6, 0.5 M NaCI).
  • the column buffer containing 30 mM dithiothreitol (DTT) was used to elute the MBP protein ( Figure 22A and 22B).
  • the elution was conducted at 4°C for 16 hr. Only the maltose binding protein was eluted from the chitin under these conditions ( Figure 22A and 22B).
  • MYT fusion protein was purified on a amylose resin (NEB Protein fusion and purification system) as described in Example 9.
  • NEB Protein fusion and purification system amylose resin
  • In vitro cleavage experiments have shown that 30 mM ⁇ -mercaptoethanol ( ⁇ - ME) and 30 mM DTT result in approximately 70% and 90% cleavage of MYB, respectively ( Figure 23A and 23B).
  • Sepharose 4B (Pharmacia; Piscataway, New Jersey) (prewashed with 5 volume of water) is suspended in 1 liter of 0.3 M NaOH, 1 liter of 1 ,4-Butanediol diglycidoxy ether and 2 grams of sodium borohydride. The suspension is gently rocked in a closed container at room temperature for 4 hours. The epoxy activated Sepharose 4B beads are washed in a buchner funnel (placed on a side arm flask equipped with vacuum or aspirator) with 3 liters of
  • the bead paste is added to 1.2 liter of 4% (v/v) aqueous acetic acid solution containing 45 grams of chitosan (Pfanstiehl Laboratories; Wauken, Illinois) and 4 grams of sodium cyanoborohydride.
  • the chitosan solution is prepared by autoclaving the carbohydrate polymer in the 4% (v/v) aqueous acetic acid in an autoclave for one hour).
  • the suspension of aldehyde sepharose 4B beads in the chitosan solution is gently rocked in a closed container for 18 hours at room temperature.
  • the resulting chitosan coupled sepharose 4B is washed in a buchner funnel (vacuum 5 assisted or aspirator) with 10 liters of water.
  • the beads are then washed with 1 liter of methanol.
  • the methanol bead paste is suspended into 760 ml of acetic anhdride and gently rocked in a sealed polyethylene container for 18 hours a room temperature.
  • the resulting chitin bound bead suspension is transferred to buchner funnel. After removal of 0 acetic anhydride by filtration (vacuum assisted or aspirator).
  • the beads are washed with 3 liters of methanol followed by 6 liters of deionized water.
  • the beaded form of chitin is prepared by the solidification (precipitation) of chitosan in aqueous solution while the aqueous solution is shaped into beaded droplets.
  • Beaded droplets of the 0 aqueous solution are created by a stirring the aqueous solution with an organic water insoluble layer (pentanol) forming an emulsion which is stabilized by adding a surfactant or stabiliser (Tween 80).
  • the beads of chitosan are formed as the pH is increased and are crosslinked in the reaction with the addition of 1 ,4 butanediol diglycidyl ether.
  • the bead ⁇ quality such as size and shape is directly affected by concentration and length of chitosan, volumes and densities of water and oil layer, shapes and relative dimensions of stirrer and reaction vessel, the amount and chemical type of stabiliser and temperature.
  • the emulsion is maintained at 70°C and 100 ml of 10 M NaOH is added dropwise over a period of 12 minutes.
  • the emulsion is allowed to stir at 300 rpm at 70°C for one hour.
  • the stirring and heating is stopped after one hour and the pentanol layer (top) is allowed to separate from the aqueous bead suspension.
  • the top alcohol layer is siphoned off from the bottom aqueous layer by an aspirator.
  • the aqueous chitosan bead suspension is transferred to a buchner funnel equipped with an aspirator pump and washed with ⁇ liters of water followed by 1.5 liters of methanol.
  • the methanol bead paste is transferred to a polyethylene container and suspended in 200 ml of acetic anhydride.
  • the beads are acetylated in the sealed container at room temperature with gentle rocking for 18 hours.
  • the resulting chitin beads are transferred to a buchner funnel and washed with 2 liters of methanol followed by 4 liters of water. Finally the beads are washed with 1 liter of 0.3 M NaOH.
  • the alkaline beads paste is transferred to a polyethylene container and suspended in 1 liter of 0.3 M NaOH containing 0.5 grams of sodium borohydride.
  • the chitin bead suspension is gently rocked in the sealed polyethylene container for 18 hours at room temperature.
  • the chitin bead suspension is transferred to a buchner funnel and washed with 4 liters deionized water or until the pH of the effluent as neutral.
  • the beads are stored in 500 ml of 30% mt- lanol water ( v/v).
  • NAME WILLIAMS, GREGORY D.
  • GAG AAA GTT TAC GCT CAC GAG ATA GCT GAG GCC TGG GAG ACT GGA AAG 1271 Glu Lys Val Tyr Ala His Glu Ile Ala Glu Ala Trp Glu Thr Gly Lys 290 295 300
  • GCT CCA AAC AAG CCG GAT GAG AGG GAG TAC GAG AGA AGG CTA AGG GAG 1511 Ala Pro Asn Lys Pro Asp Glu Arg Glu Tyr Glu Arg Arg Leu Arg Glu 370 375 380
  • AAG AAA ATG GCT TAT ATC ATC TTT GAG AGC CTT TGT GGG ACT TTG GCA 2903 Lys Lye Met Ala Tyr Ile Ile Phe Glu Ser Leu Cys Gly Thr Leu Ala 835 840 845
  • AGG GAA TAT ATA GAG TTC GTA AGG AAG GAA CTG GAG GAA AAG TTC GGG 3575 Arg Glu Tyr Ile Glu Phe Val Arg Lys Glu Leu Glu Glu Lys Phe Gly 1060 1065 1070
  • CAG AAG ACT AAA CAG ACA GGT CTT ACG GCA TGG CTT AAC ATC AAG AAG 4295 Gin Lys Thr Lys Gin Thr Gly Leu Thr Ala Trp Leu Asn Ile Lys Lys 1300 1305 1310

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP96922498A 1995-06-28 1996-06-19 Modifizierte proteine und methoden fuer ihre produktion Withdrawn EP0835323A4 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP05076460A EP1642980A1 (de) 1995-06-28 1996-06-19 Modifizierte Proteine und Verfahren für ihre Herstellung

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US49624795A 1995-06-28 1995-06-28
US496297 1995-06-28
US58055595A 1995-12-29 1995-12-29
US580555 1995-12-29
PCT/US1996/010545 WO1997001642A1 (en) 1995-06-28 1996-06-19 Modified proteins and methods of their production

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP05076460A Division EP1642980A1 (de) 1995-06-28 1996-06-19 Modifizierte Proteine und Verfahren für ihre Herstellung

Publications (2)

Publication Number Publication Date
EP0835323A1 EP0835323A1 (de) 1998-04-15
EP0835323A4 true EP0835323A4 (de) 1999-08-11

Family

ID=27052049

Family Applications (2)

Application Number Title Priority Date Filing Date
EP96922498A Withdrawn EP0835323A4 (de) 1995-06-28 1996-06-19 Modifizierte proteine und methoden fuer ihre produktion
EP05076460A Withdrawn EP1642980A1 (de) 1995-06-28 1996-06-19 Modifizierte Proteine und Verfahren für ihre Herstellung

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP05076460A Withdrawn EP1642980A1 (de) 1995-06-28 1996-06-19 Modifizierte Proteine und Verfahren für ihre Herstellung

Country Status (4)

Country Link
EP (2) EP0835323A4 (de)
JP (1) JP4476360B2 (de)
CA (1) CA2236948C (de)
WO (1) WO1997001642A1 (de)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9708918D0 (en) * 1997-05-01 1997-06-25 Ppl Therapeutics Scotland Ltd Methods
ATE318894T1 (de) * 1998-12-18 2006-03-15 Penn State Res Found Intein-vermittelte cyclisierung von peptiden
US6365377B1 (en) 1999-03-05 2002-04-02 Maxygen, Inc. Recombination of insertion modified nucleic acids
WO2000071701A1 (en) * 1999-05-24 2000-11-30 New England Biolabs, Inc. Method for generating split, non-transferable genes that are able to express an active protein product
AU6781700A (en) * 1999-08-17 2001-03-13 Health Research Institute Genetic system and self-cleaving inteins derived therefrom, bioseparations and protein purification employing same, and methods for determining critical, generalizable amino acid residues for varying intein activity
BR0307155A (pt) 2002-01-08 2007-06-19 Michael R Raab plantas transgênicas expressando proteìnas modificadas por civps ou inteìnas e método relativo
US9464333B2 (en) 2009-11-06 2016-10-11 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
US8420387B2 (en) 2009-11-06 2013-04-16 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
US10407742B2 (en) 2009-11-06 2019-09-10 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
US10443068B2 (en) 2010-06-25 2019-10-15 Agrivida, Inc. Plants with engineered endogenous genes
US9598700B2 (en) 2010-06-25 2017-03-21 Agrivida, Inc. Methods and compositions for processing biomass with elevated levels of starch
WO2012122308A2 (en) 2011-03-07 2012-09-13 Agrivida, Inc. Consolidated pretreatment and hydrolysis of plant biomass expressing cell wall degrading enzymes
JP2016504417A (ja) 2013-01-11 2016-02-12 ザ テキサス エー アンド エム ユニヴァーシティー システムThe Texas A&M University System インテイン媒介によるタンパク質の精製

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69333667T2 (de) * 1992-12-09 2006-02-02 New England Biolabs, Inc., Beverly Kontrollierbare Zwischensequenzen enthaltende modifizierte Proteine und Verfahren zur deren Herstellung
US5496714A (en) * 1992-12-09 1996-03-05 New England Biolabs, Inc. Modification of protein by use of a controllable interveining protein sequence

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CLARKE N.D.: "A proposed mechanism for the self-splicing of proteins.", PROC. NATL. ACAD. SCI. USA, vol. 91, November 1994 (1994-11-01), pages 11084 - 11088, XP002105838 *
COOPER A.A.: "Protein splicing of the yeast TFP1 intervening protein sequence: a model for self-excision.", EMBO J., vol. 12, no. 6, 1993, pages 2576 - 2583, XP002105837 *
See also references of WO9701642A1 *
XU M -Q ET AL: "IN VITRO PROTEIN SPLICING OF PURIFIED PRECURSOR AND THE INDENTIFICATION OF A BRANCED INTERMEDIATE", CELL, vol. 75, 31 December 1993 (1993-12-31), pages 1371 - 1377, XP000652317 *

Also Published As

Publication number Publication date
EP1642980A1 (de) 2006-04-05
JP2002503944A (ja) 2002-02-05
JP4476360B2 (ja) 2010-06-09
CA2236948A1 (en) 1997-01-16
EP0835323A1 (de) 1998-04-15
WO1997001642A1 (en) 1997-01-16
CA2236948C (en) 2008-10-28

Similar Documents

Publication Publication Date Title
CA2110938C (en) Modified proteins containing controllable intervening sequences and methods of their production
US5834247A (en) Modified proteins comprising controllable intervening protein sequences or their elements methods of producing same and methods for purification of a target protein comprised by a modified protein
EP0602899B1 (de) Kontrollierbare Zwischensequenzen enthaltende modifizierte Proteine und Verfahren zur deren Herstellung
CA2236948C (en) Modified proteins and methods of their production
US6987007B2 (en) Modified chitin-binding domain and use thereof
KR100682599B1 (ko) 폴리펩티드
CA2576110C (en) Polypeptides of botryosphaeria rhodina
JP5881234B2 (ja) 変異型βグルコシダーゼ、バイオマス分解用酵素組成物および糖液の製造方法
CN108239627B (zh) 活性提高的脂肪酶及其应用
US6815191B1 (en) Endo-β-N-acetylglucosaminidase gene
DK2543723T3 (en) A process for the preparation of glycosidase enzyme composition and hydrolyzing biomass process
KR100454174B1 (ko) 엔도글리코세라미데이즈를 암호화하는 유전자
EP3289088B1 (de) Entkopplung von wachstum und proteinherstellung
KR100541202B1 (ko) 엔도글리코세라미다아제 액티베이터를 코딩하는 유전자
JP6350987B2 (ja) GHファミリー3に属する耐熱性β―キシロシダーゼ
KR20050121667A (ko) 안정한 리파제 유전자 변이체
AU702107B2 (en) Orpinomyces xylanase proteins and coding sequences
JP6364662B2 (ja) GHファミリー3に属する耐熱性β―キシロシダーゼ
CA2594178C (en) Methods of production of modified proteins
US20060199225A1 (en) Modified chitin binding domain and uses thereof
JP6286745B2 (ja) 耐熱性β−グルコシダーゼ
JPH0638771A (ja) ヒトプロテインジスルフィドイソメラーゼ遺伝子の発現方法および該遺伝子との共発現によるポリペプチドの製造方法
RU2818353C2 (ru) Мутант фосфолипазы С с высокой ферментативной активностью
CN108103045B (zh) 脂肪酶及其应用
KR20240083164A (ko) 열 안정성을 갖는 리파아제 및 이의 제조방법

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980115

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE FR GB

RIC1 Information provided on ipc code assigned before grant

Free format text: 6C 12N 15/55 A, 6C 12N 15/62 B, 6C 12N 9/22 B, 6C 12N 9/48 B, 6C 07K 1/22 B, 6C 12P 21/00 B

A4 Supplementary search report drawn up and despatched

Effective date: 19990625

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): DE FR GB

17Q First examination report despatched

Effective date: 20010301

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20050705