EP0586667A1 - Repliement et purification de facteurs de croissance i ressemblant a l'insuline - Google Patents

Repliement et purification de facteurs de croissance i ressemblant a l'insuline

Info

Publication number
EP0586667A1
EP0586667A1 EP93907573A EP93907573A EP0586667A1 EP 0586667 A1 EP0586667 A1 EP 0586667A1 EP 93907573 A EP93907573 A EP 93907573A EP 93907573 A EP93907573 A EP 93907573A EP 0586667 A1 EP0586667 A1 EP 0586667A1
Authority
EP
European Patent Office
Prior art keywords
igf
biologically active
solution
met
reducing agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93907573A
Other languages
German (de)
English (en)
Inventor
George N. Cox
Martin J. Mcdermott
Tom M. Gleason
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Boulder Inc
Original Assignee
Synergen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Synergen Inc filed Critical Synergen Inc
Publication of EP0586667A1 publication Critical patent/EP0586667A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C07K1/113—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides without change of the primary structure
    • C07K1/1133—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides without change of the primary structure by redox-reactions involving cystein/cystin side chains
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to the field of biotechnology processing, more particularly refolding and purification of polypeptides, and even more particularly to the refolding and purification of insulin-like growth factor I.
  • the insulin gene family comprised of insulin, relaxin, insulin-like growth factors I and II, and possibly the beta subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged as reported in Dull, et al., Nature 310:777-781 (1984).
  • IGF-I Insulin-like growth factor I
  • somatomedin C Insulin-like growth factor I
  • IGF-II permits both to bind to IGF receptors.
  • Two IGF receptors are known to exist. IGF-I and IGF-II bind to the IGF type I receptor, while insulin binds with less affinity to this receptor.
  • the type I receptor preferentially binds IGF-I and is believed to transduce the mitogenic effects of IGF-I and IGF-II.
  • IGF-II binds to the type I receptor with a 10-fold lower affinity than IGF-I.
  • the second or type II IGF receptor preferentially binds IGF-II.
  • IGFBP-1 IGFBP-6
  • IGFBP-6 IGF binding proteins
  • IGFBP-6 IGFBP-6
  • IGFBP-6 IGF binding proteins
  • the binding of IGF-I and IGF-II to binding proteins reduces the action of these IGFs on cells by inhibiting IGF binding to cell surface receptors.
  • IGF-I is mitogenic for a large number of cell types, including fibroblasts, keratinocytes, endothelial cells and osteoblasts (bone-forming cells) . IGF-I also stimulates differentiation of many cell types, e.g., synthesis and secretion of collagens by osteoblasts. IGF-I exerts its mitogenic and cell differentiating effects by binding to the specific IGF cell surface receptors. IGF-I also has been shown to inhibit protein catabolism in vivo- to stimulate glucose uptake by cells and to promote survival of isolated neurons in culture. These properties have led to IGF-I being tested as a therapeutic agent for a variety of disease indications as reported in Froesch et al. , Trends in Endocrinology and Metabolism. 254-260 (May/ une 1990) and Cotterill, Clinical Endocrinology. 37:11-16 (1992).
  • IGF-I has long been studied for its role in the growth of various tissues.
  • a marked rise in serum type III procollagen, a marker of bone formation occurred after one week of administration of recombinantly produced IGF-I to patients with dwarfism otherwise non-responsive to growth hormone.
  • the effects of the infusion of IGF-I in a child with Laron Dwarfism were described in Walker et al., The New England Journal of Medicine. 324(21) :1483-1488 (1991).
  • IGF-I Increased weight gain, nitrogen retention and muscle protein synthesis following treatment of diabetic rats with IGF-I or a truncated form of IGF-I having a deletion of the first three a ino acids ordinarily found in IGF-I (referred to as • ⁇ (desl-3)IGF-I”) were demonstrated by Tomas et al., as reported in Biochem. J. 276:547-554 (1991). Growth restoration in insulin-deficient diabetic rats by administration of recombinantly produced human IGF-I was reported in Scheiwiller et al., Nature, 323:169 (1986).
  • IGF-I and (desl-3)IGF-I ' enhanced growth in rats after gut resection, as reported in Lemmey et al., Am. J. Physiol. 260 (Endocrinol. Metab. 23) E213-E219 (1991).
  • the synergistic effects of platelet-derived growth factor and IGF-I in wound healing were reported in Lynch et al., Proc. Natl. Acad. Sci. 84:7696-7700 (1987).
  • IGF-I and growth hormone were set forth in Scheven and Hamilton, Acta Endocrinologica (Copenhagen) 124:602- 607 (1991) .
  • IGF-I In vivo actions of IGF-I on bone formation and resorption in rats were shown in Spencer et al., Bone 12:21-26 (1991) .
  • the use of IGF-I and IGF-II for enhancing the survival of non-mitotic, cholinergic neuronal cells in a mammal was described in U.S. Patent 5,093,317 to Lewis et al.
  • PCT Application Publication No. WO 92/11865 published on July 23, 1992, describes the use of IGF-I for the treatment of cardiac disorders.
  • IGF-I insulin growth factor-I
  • proteins purified from human plasma may be contaminated by pathogenic organisms such as viruses including the hepatitis viruses and the AIDS virus.
  • An alternative method for producing large uantities of IGF-I cheaply is to produce it by recombinant DNA methods.
  • DNA sequences encoding IGF-I are cloned into a prokaryotic expression vector, for example, pT3XI-2 (described in WO 91/08285) , that is capable of directing high level expression of the recombinant proteins in bacteria, particularly Escherichia coli (E. coli.) .
  • European Patent Application Publication No. 0130166 describes expression of IGF-I in E_j_ coli. This reference does not teach purification nor how to render the protein biologically active.
  • European Patent Application Publication No. 0155655 describes synthesis, bacterial expression and purification of IGF-I fused to other proteins. No data are presented in this reference which demonstrated the activity of this molecule.
  • European Patent Application Publication No. 0128733 describes bacterial production of IGF-I fused to other proteins. The fusion protein so produced was cleaved with proteases to release IGF-I. Again, no data was presented in this reference demonstrating the activity of this protein. Fusion proteins yielding five incorrectly folded biologically inactive forms of IGF-I were described in S. Hober et al. , Biochemistry 31:1749-1756 (1992) .
  • 0286345 describes production of human IGF-I in bacteria using a vector in which expression was controlled by a lambda phage promotor and a temperature sensitive repressor protein. The biological activity of the material produced was not demonstrated. Not taught was how to purify the protein, nor whether the N-terminal ethionine was cleaved from the protein. IGF-I not having the N-terminal methionine cleaved is referred to as met-IGF-I.
  • PCT Application Publication No. WO91/02807 describes synthesis, expression in bacteria, and refolding of IGF-I fused to charged a ino acids at the N-terminus of the protein.
  • the charged amino acids were added to facilitate refolding of IGF-I; refolding of IGF-I was found to be less than optimal without the charged amino acids.
  • the protein of this reference was refolded and subsequently treated with proteases to remove the extra charged amino acids.
  • the charged amino acids were chosen so that they would be recognized as cleavage sites by diaminopeptidase, beef spleen Cathepsin C.
  • the method of refolding of the present invention does not require the construction of fusion proteins or the use of charged amino acids attached to the N- terminus of the protein to produce biologically active IGF-I.
  • the present invention provides methods whereby inactive met- IGF-I expressed in bacteria can be refolded into its proper conformation.
  • the proteins produced by the instant invention are indicated as being correctly refolded by evidence of their biological activity when compared to a commercially available standard.
  • the present invention also provides a method for purifying correctly refolded IGF-I from incorrectly refolded IGF-I.
  • the present invention also provides a method for converting met-IGF-I to IGF-I.
  • compositions comprising IGF-I and methods of using the IGF-I to treat a patient having or potentially having an IGF associated condition.
  • acceptable pharmaceutical carrier refers to a physiologically-compatible, aqueous or non-aqueous solvent.
  • IGF-I refers to a protein having the same amino acid sequence as naturally occurring IGF-I, or a protein having the same amino acid sequence as naturally occurring IGF-I with the addition of an N-terminal methionine, unless otherwise specified.
  • IGF associated condition refers to an existing or potential adverse physiological condition which results from an over-production or underproduction of IGF, IGF binding protein or
  • IGF receptor inappropriate or inadequate binding of IGF to binding proteins or receptors and any disease in which IGF administration alleviates disease symptoms.
  • An IGF associated condition also refers to a condition in which administration of IGF to a normal patient has a desired effect.
  • patient refers to any animal, including humans, in need of treatment for an IGF associated condition.
  • denaturing agent refers to any material which will cause a change in the conformation of a protein that results in a loss of biological activity.
  • Acceptable denaturing agents include, but are not limited to, guanidine and urea.
  • oxidizing agent refers to any material which is capable of removing an electron from the compound being oxidized.
  • Acceptable oxidizing agents include, but are not limited to, oxidizing agents which are capable of aiding in the formation of mixed disulfide bonds, for example, oxidized glutathione and cystine.
  • reducing agent refers to any material which is capable of adding an electron to a compound.
  • Acceptable reducing agents include any reducing agent capable of the disruption of the molecular disulfide bonds.
  • Acceptable reducing agents include, but are not limited to, dithiothreitol (DTT) , 2-mercaptoethanol, and dithioerythritol.
  • thiol-containing reducing reagent refers to a reducing agent which contains a sulfhydryl group.
  • examples include, but are not limited to, dithiothreitol (DTT) , 2- mercaptoethanol, dithioerythritol, cysteine, cystamine, and reducing agents containing added disulfide containing compounds, such as sodium borohydride or any of the Group VIA hydrides containing added cystine, oxidized glutathione or any cysteine- containing dipeptide.
  • biologically active refers to the ability to stimulate proliferation of UMR106 rat ostesarcoma cell line, as described in Example 6.
  • the biological activity of a correctly refolded protein stimulates proliferation of the UMR106 cell line at an ED 50 of about 1 - 30 ng/ml, preferably about 2 - 10 ng/ml and more preferably at about 7 - 8 ng/ml.
  • IGF-I stimulates proliferation of UMR106 rat ostesarcoma cell line with an ED 50 greater than 30 ng/ml, which for purposes of the present invention is considered “biologically inactive".
  • ED 50 refers to the concentration which causes one- half maximal *H. incorporation into the DNA of cells.
  • the recombinant proteins of the present invention were refolded, purified and subsequently treated with an aminopeptidase to remove the extra N-terminal methionine.
  • Aminopeptidases useful for this purpose include, but are not limited to, diaminopeptidase, from beef spleen Cathepsin C, and aminopeptidase from Aeromonas proteolvtica.
  • the examples below set forth the procedures used to construct the IGF-I gene, which was done by forming a gene fusion with a secretory leader sequence for J . coli. From this, a second construct was formed to express met-IGF-I without the secretory leader sequence. The plasmid thus created was used to transform E_- coli to express the met-IGF-I. The yield of met-IGF-I expresse exceeds 10% of total cell protein. The protein thus expressed wa purified after disrupting the E_j_ coli cells. The insolubl biologically inactive met-IGF-I was rendered soluble an biologically active by use of a refolding procedure. Properl refolded IGF-I was isolated from improperly refolded IGF-I by us of several column chromatography procedures.
  • the instant invention resides in the refolding an purification of the resultant recombinant protein to rende biologically active IGF-I.
  • recombinan IGF-I may be refolded by using the following steps:
  • any intramolecular or intermolecular disulfide bond and/or any noncovalent interactions which have occurred involvin the mature IGF-I produced in a microorganism are first disrupted.
  • the protein is exposed to sufficien denaturant (for example, guanidine hydrochloride or urea) an sufficient reducing agent (for example, beta-mercaptoethanol, dithiothreitol, or cysteine) to denature the protein, disrup noncovalent interactions, and reduce disulfide bonds.
  • sufficien denaturant for example, guanidine hydrochloride or urea
  • an sufficient reducing agent for example, beta-mercaptoethanol, dithiothreitol, or cysteine
  • the denaturant and oxidizing agent are then diluted to a defined concentration and a then second reducing agent, also known as a thiol-containing reducing reagent, is added to catalyze disulfide interchange.
  • a then second reducing agent also known as a thiol-containing reducing reagent
  • the objective is to produce an environment in which the denaturant is sufficiently reduced to allow the IGF-I to assume various 3-dimensional configurations and in which the oxidization/reduction potential is adjusted to allow the formation and breaking of disulfide bonds. It is believed that the proper 3- dimensional structure and disulfide bonding pattern of the mature IGF-I is energetically more stable than other possible conformations.
  • any interfering cyanate that may form can be removed by passing the urea solution over an anion exchange column, such as DOWEX 1-X8(BioRad) . Cyanate can modify amino groups in the protein (Stark, Methods in Enzymology 11:125 1967).
  • the optimal concentration and choice of denaturant, oxidizing agent, thiol-containing reducing reagent and their concentrations in the final refolding solution are determined experimentally by monitoring the proportion of IGF-I properly refolded and biologically active.
  • the objective in the final refolding solution is to provide a controlled environment in which disulfide interchange and conformational changes can occur in the IGF-I until the favored conformation and disulfide bonding pattern is achieved.
  • the IGF-I is substantially purified from soluble proteins prior to refolding.
  • An alternative embodiment is contemplated whereby the IGF-I is substantially purified from soluble and insoluble proteins prior to refolding.
  • Substantially purified in this context means the solution is substantially free of host cell proteins that interfere with the rate or efficiency of IGF-I refolding.
  • the correctly refolded IGF-I is separated from the incorrectly refolded IGF-I by means of various column chromatography techniques, including, for example, the techniques described below in Example 4.
  • the first step is dialysis to decrease the amount and concentration of reducing agent and denaturing agent used in the refolding process.
  • the second step utilizes an ion exchange column which separates protein isomers according to charge.
  • Example 4 teaches the use of an S-sepharose column for this purpose, those skilled in the art can readily determine other cation exchange columns that could be used for this purpose.
  • This S-sepharose chromatography procedure of Example 4 yielded two major peaks.
  • the peak corresponding to correctly folded protein was identified by comparison to a commercial standard.
  • the ED 50 of this peak (Peak B) was 7-8 ng/ml when measured by the UMR106 cell assay described in Example 6.
  • the ED 50 of the other peak (Peak A) was 30 - 40 ng/ml when measured by the same assay. Peak A was determined to be incorrectly folded protein.
  • the final step for separating correctly folded protein from incorrectly folded protein can be reverse phase HPLC, which is particularly useful for small scale experiments.
  • a hydrophobic interaction column can be used in the final step.
  • the hydrophobic interaction column separates the proteins based on their hydrophobicity. Any hydrophobic interaction chromatography column, such as, for example, Toyopearl Butyl-650S, can be used for this purpose.
  • the isolated, correctly folded protein can then be analyzed using reverse phase HPLC, if desired.
  • IGF-I having an N-terminal ethionione exhibits biological activity comparable to IGF-I as demonstrated in the bioassays described below (Example 6) , it may be desirable to cleave the N-terminal methionine from the IGF-I. Since naturally occurring IGF-I has no N-terminal methionine, met-IGF-I may give rise to an immune response in some circumstances. For that reason, the present invention also provides a method for converting met- IGF-I to IGF-I. This is accomplished by reacting the met-IGF-I with an aminopeptidase, for example, an aminopeptidase from Aeromonas proteolvtica.
  • an aminopeptidase for example, an aminopeptidase from Aeromonas proteolvtica.
  • the reaction is stopped by lowering the pH of the solution to below pH 5. This can be accomplished by the addition of any of several acids. Suitable acids for this purpose include, but are not limited to, trifluroacetic acid (TFA) , acetic acid, and hydrochloric acid. This reaction can also be stopped by lowering the temperature to below 4°C.
  • TFA trifluroacetic acid
  • acetic acid acetic acid
  • hydrochloric acid hydrochloric acid
  • the present invention further provides a pharmaceutical composition containing IGF-I in a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used.
  • the carrier and the ' IGF-I constitute a physiologically-compatible, slow-release formulation.
  • the primary solvent in such a carrier may be either aqueous or non-aqueous in nature.
  • the carrier may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the IGF-I.
  • excipients are those substances usually and customarily employed to formulate dosages for administration in either unit dose or multi-dose form.
  • the pharmaceutical composition may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder.
  • Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration.
  • the storage of such formulations can be at temperatures at least as low as 4°C and preferably at -70°C.
  • Formulations containing IGF-I can also be stored and administered at or near physiological pH. It is presently believed that storage and administration in a formulation at a high pH (i.e. greater than 9) or at a low pH (i.e. less than 2) is undesirable.
  • the pharmaceutical composition of the present invention can be used to treat a patient having or potentially having an IGF associated condition. Some of these conditions may include, for example, dwarfism, diabetes, cachexia, peripheral neuropathy, renal disease, impaired wound healing, amyotrophic lateral sclerosis (ALS) , stroke, periodontal disease and osteoporosis.
  • the pharmaceutical composition of the present invention can also be used to treat a condition in which administration of IGF to a normal patient has a desired effect; for example, using IGF-I to enhance growth of a patient of normal stature.
  • the manner of administering the formulations containing IGF-I can be via an intraarticular, subcutaneous, intramuscular or intravenous injection or infusion, suppositories, enema, inhaled aerosol, or oral or topical routes.
  • intraarticular, subcutaneous, intramuscular or intravenous injection or infusion, suppositories, enema, inhaled aerosol, or oral or topical routes may be administered.
  • repeated subcutaneous or intramuscular injections may be administered. Both of these methods are intended to create a preselected concentration range of IGF-I in the patient's blood stream. It is believed that the maintenance of circulating concentrations of IGF-I of less than 0.01 ng per ml of plasma may not be effective, while the prolonged maintenance of circulating levels in excess of 100 ⁇ q per ml may be undesirable.
  • the frequency of dosing will depend on phar acokinetic parameters of the IGF-I in the formulation used. The following examples are intended to illustrate but not limit the present invention
  • IGF-I gene was assembled in two stages. Initially, the DNA sequence encoding the mature IGF-I protein was joined to DNA sequences encoding the secretory leader sequence of the E coli OmpA protein (ompA L ) . This gene fusion was constructed in order to determine whether IGF-I could be efficiently secreted from E ⁇ coli. A second construct, in which IGF-I is expressed as an intracellular protein, was created by deleting DNA sequences encoding the OmpA leader sequence and replacing them with appropriate DNA sequences for intracellular expression of IGF-I.
  • OmpAlU SEQ ID NO:l
  • OmpA2U SEQ ID NO:2
  • OmpAlL SEQ ID NO:3
  • OmpA2L SEQ ID NO:4
  • the resulting BamHI/Haelll restriction fragment coding for a translational start signal and the first 21 amino acids of the o pA signal sequence was purified.
  • This DNA fragment was mixed with BamHI + Pstl-digested pUC18 DNA (Boehringer Mannhein Biochemicals, Indianapolis, IN) and the two synthetic oligonucleotides [IGF-I (1-14) U + L] (SEQ ID NO:5 and SEQ ID NO:6) were ligated together.
  • the ligation mixture was transformed into E_ ⁇ coli strain JM109 (New England Biolabs, Beverly, MA) and individual colonies isolated.
  • These plasmids (OmpA L IGF-IpUC18) have a translational start signal followed by DNA sequences encoding the OmpA signal sequence and the first 14 amino acids of IGF-I.
  • An M13 phage containing DNA sequences encoding amino acids 15 through 70 of IGF-I was created by ligating together the two complementary pairs of oligonucleotides (IGF1U + 1L and IGF2U + 2L) (SEQ ID NO:7 and SEQ ID NO:8) and cloning the DNA fragment into PstI + Hindlll-digested M13 mpl9 DNA (New England Biolabs, Beverly, MA) . Double-stranded DNA was purified from a phage clone and the Pstl/Hindlll fragment encoding amino acids 15-70 of the IGF-I protein were isolated.
  • This DNA fragment was ligated together with PstI + Hindlll-digested plasmid OmpA L IGF-IpUC18 DNA and used to transform E_j_ coli strain JM107 (GIBCO BRL, Gaithersburg, MD) .
  • the BamHI/Hindlll fragment containing the IGF-I gene fused to the OmpA L sequence was isolated and cloned into the BamHI + Hindlll generated site of plasmid pT3XI-2.
  • the completed plasmid containing the OmpA L -IGF-I gene fusion is called pT3XI-2 ⁇ lO c (TC3)ompA L IGF-I.
  • the BamHI/Hindlll fragment containing the OmpA L -IGF-I gene described above was purified from plasmid pT3XI-2 ⁇ l0 c (TC3)ompA L IGF-I and digested with Hinfl.
  • the approximate 200 bp HinfI/Hindlll DNA fragment was mixed with the annealed, complementary synthetic oligonucleotides (MetlGFl ⁇ + IL) (SEQ ID-NO:9 and SEQ ID NO:10) and ligated with BamHI + Hindlll-digested plasmid pT3XI2 DNA, and used to transform E coli JM107.
  • the completed plasmid construct is called ⁇ lO c (TC3)IGF-IpT3XI-2 and contains an extra alanine residue at the beginning of the IGF-I sequence.
  • the BamHI/Hindlll fragment containing the mutant IGF-I gene was isolated and ligated into the BamHI + Hindlll generated site of plasmid pT5T (described in Nature. Vol. 343, No. 6256, pp. 341-346).
  • the ligation mixture was used to transform E ⁇ . coli BL21/DE3 (US Patent 4,952,496) and individual colonies isolated. This construct was named 01O c (TC3)IGF-IpT5T.
  • Plasmid ⁇ l0 c (TC3)IGF-IpT3XI-2 was digested with BamHI + Hindlll and the -200 bp DNA fragment containing the mutant IGF-I gene was purified and cloned into the BamHI and Hindlll sites of plasmid M13 mpl9.
  • In vitro mutagenesis was performed using a Muta-Gene kit (Bio-Rad Laboratories, Richmond, CA) . The procedure followed was described in the instructions that accompany the kit.
  • Uracil- containing single-stranded template DNA was prepared following propagation of the phage in E ⁇ _ coli strain CJ236 (supplied with Muta-Gene Kit, Bio-Rad Laboratories, Richmond, CA) .
  • the oligonucleotide used for mutagenesis had the sequence: 5 1 - GATGATTAAATGGGTCCGGAGACT - 3' (SEQ ID NO:11).
  • the mutagenesis reaction product was transformed into ⁇ J_ coli strain JM109 and individual plagues picked. Double-stranded replicative form phage DNA was isolated, digested with BamHI + Hindlll and the -200 bp fragment containing the IGF-I gene purified.
  • the purified DNA was cloned into the BamHI + Hindlll generated site of plasmid pT5T and used to transform E ⁇ . coli strain BL21/DE3.
  • One bacterial colony with the correct plasmid was named ⁇ l0(TC3)mutIGF-IpT5T.
  • Several isolates were sequenced, and all were correct. D. Expression of Met-IGF-I in bacteria
  • an overnight culture of E_j_ coli strain containing 010(TC3)mutIGF-IpT5T was diluted 1:100 into 800 ml of Luria Broth (10 g/liter tryptone, 5 g/liter yeast extract and 10 g/liter NaCl, pH 7.5) medium containing 15 ⁇ g/ml tetracycline and grown at 37° until the optical density at 600 nm was 0.7-0.9.
  • IPTG isopropyl-/3-D-thiogalactopyranoside, Sigma Chemical Company, St. Louis, MO
  • the cells were harvested by centrifugation.
  • the cell pellet was washed once with ice-cold buffer A (50 mM Tris-HCl pH 7.5/ 25 mM NaCl/1 mM DTT) and stored at -70°C or resuspended in buffer A and used immediately.
  • E_;_ coli strain ⁇ lO(TC3)mutIGF- IpT5T was grown in a 10 1 fermenter at 37°C in complex media (40 g/1 NZ amine HD, 2 g/1 KH 2 P0 4 , 1 g/1 MgS0 4 • 7H 2 0, 1 g/1 Na 2 S0 4 , 1 g/1 Na 3 citrate • 2H 2 0, 50 g/1 glycerol, 0.1 ml/1 Macol 19::GE60, 2 ml/1 trace minerals, 20 mg/1 thia ine HC1, and 15 mg/1 tetracycline HC1, pH 7) .
  • IPTG was added to a final concentration of 0.1 mM.
  • Bacteria were grown for an additional 2-8 hours, harvested by centrifugation and the cell pellet stored at -70°C until use.
  • E. coli cells were suspended in Buffer A (50 mM Tris, pH 7.5,
  • EXAMPLE 3 Refolding of Met-IGF-I
  • the reduced met-IGF-I from Example 2 was subjected to a three-step refolding protocol. 1) The oxidizing agent, oxidized glutathione (GSSG) , was added to the supernatant from Example 2 to a final concentration of 25 mM, and incubated at room temperature for 15 minutes.
  • GSSG oxidized glutathione
  • Cysteine was added to a final concentration of 5 mM to aid in disulfide exchange.
  • step (3) The solution from step (2) was incubated overnight at 4°C to allow completion of disulfide exchange, and then centrifuged at 20,000 x g for 15 minutes. SDS-PAGE analysis of the pellet and the supernatant showed that the supernatant was composed of relatively homogeneous met-IGF-I.
  • Peak I Peak I at 56.5 minutes
  • Peak II Peak II at 58.2 minutes
  • a minor peak was present at 60 minutes
  • a broad peak 75-79 minutes containing improperly refolded met-IGF-I species.
  • Peak I and Peak II represented approximately 25% and 30% of the crude met-IGF-I protein loaded onto the reverse phase column, respectively.
  • N-terminal sequence analysis of Peak I and Peak II gave the sequence MetGlyProGluThrLeu... (SEQ ID NO:12), which matches the N-terminal amino acid sequence of human IGF-I except for the extra methionine residue at the N-terminus.
  • Peak II represents correctly refolded met-IGF-I, as evidenced by retention time identical to the purchased standard as well as biological activity identical to the purchased standard.
  • IGF-I which has not been correctly refolded exhibits reduced or no biological activity. Correctly refolded IGF-I is evidenced by ED 50 of 10 ng/ml or less when tested on the UMR106 cell line. This assay is described in Example 6.
  • EXAMPLE 4 Isolation of Correctly Refolded IGF-I The following is a description of the preparation of IGF-I from 305 g of cell paste.
  • the supernatant from the refolding procedure (6700 ml) was concentrated 10-fold and dialyzed to completion against 20 mM HEPES, pH 7.5.
  • the dialyzed sample was centrifuged 20,000 X g for 15 minutes to remove precipitated proteins, passed through a 0.2 ⁇ m filter (Corning, Corning, NY) and loaded onto an S-Sepharose column (5.0 X 40 cm, Pharmacia LKB, Piscataway, NJ) previously equilibrated with the same buffer, at a flow rate of 40 ml/minute.
  • the bound IGF-I was eluted with a 5000 ml linear gradient to 0.5 M NaCl at a flow rate of 40 ml/minute. 25 ml fractions were collected. Two symmetrical peaks were resolved: Peak A eluting at 0.12 M NaCl, and Peak B eluting at 0.15 M NaCl. SDS-PAGE analysis of aliquots of Peaks A and B showed that they contained relatively homogeneous IGF-I (> 90% homogeneous) ; however, several high molecular weight J _ coli proteins were still present. The S-Sepharose fractions corresponding to Peaks A and B were pooled separately.
  • the S-Sepharose pool B was made to 2 M NaCl, 20 mM HEPES, pH 7.5, and loaded at a flow rate of 30 ml/minute onto a Toyopearl Butyl-650S (Supelco, Beliefonte, PA) hydrophobic interaction column previously equilibrated with 20 mM HEPES, pH 7.5, 2M NaCl.
  • the bound protein was eluted with a 1250 ml linear gradient to 20 mM HEPES, pH 7.5, 20 % ethanol at a flow rate of 40 ml/minute. 25 ml fractions were collected.
  • a major peak eluted at approximately 17.5 % ethanol, as well as a minor peak at 13-15 % ethanol.
  • an aminopeptidase isolated from Aeromonas proteolytica using a modification of a previously described method (Lorand, L. , 1976, Meth. Enzymol. 45:530-543), incorporated herein by reference, was used to remove the N-terminal methionine.
  • Recombinant met-IGF- I was incubated in the presence of the purified aminopeptidase in a 100 ⁇ l reaction mixture containing 120 ⁇ g met-IGF-I, 20 mM Tricine, pH 8.0, and 1 ⁇ g aminopeptidase for 30 minutes at 25°C. The reaction was stopped by the addition of 1 ml 0.05% TFA in water.
  • EXAMPLE 6 Biological Activities of Recombinant Met-IGF-I A. In vitro Activities The in vitro biological activities of purified recombinant met-IGF-I were tested in cell proliferation assays using mouse 3T3 fibroblasts, and on rat osteosarcoma UMR106 cells. The cell proliferation assay used is set forth below.
  • a crystal violet dye assay was used to measure cell proliferation. Assays were performed in 96 well gelatin-coated plates. Balb/c 3T3 fibroblasts (available from American Type Culture Collection, Rockville, MD, Accession #CCL 163) were plated at 25,000 cells/well in 200 ⁇ l of serum-free DMEM (Dulbecco s Modification of Eagle's Medium, Mediatech, Herndon, VA) containing 0.03 M glycerol and 0-1,000 ng/ml met-IGF-I. Cells were incubated for 72 hours at 37°C. At this time, the media was replaced with 150 ⁇ l of 0.2% crystal violet, 10% formaldehyde, 10 mM potassium phosphate pH 7.0.
  • the mitogenic (growth stimulating) activity of the refolded met-IGF-I was measured by the amount of 3 H-thymidine incorporated into rat osteosarcoma cells when the met-IGF-I was incubated with these cells under serum free conditions.
  • the rat osteosarcoma cells (the UMR106 cell line; American Type Culture Collection, Accession No CRL-1661, Rockville, Maryland) were plated at 5-6 X lO 4 cells in 0.5 ml of Ham's F12 (Cat.
  • met-IGF-I stimulates proliferation of rat UMR106 cells in a dose dependent manner.
  • the ED 50 of refolded met-IGF-I was 2 - 20 ng/ml.
  • IGF-I possesses both growth-promoting and metabolic properties similar to those of insulin (L. Rossetti. Diabetes 40:444-448, 1991) .
  • met-IGF-I possesses both growth-promoting and metabolic effects and is therefore bioactive. 1. Growth of hypophvsectomized rats is promoted bv the subcutaneous injection of Met-IGF-I
  • hypophysecto ized rats are deficient in both growth hormone (GH) and IGF-I.
  • GH growth hormone
  • IGF-I growth hormone
  • GH is believed to stimulate growth indirectly by inducing synthesis of IGF-I which then acts directly on tissues to regulate growth.
  • the hypophysectomized rat is stunted, growth can be stimulated by the administration of either IGF-I or GH.
  • Subcutaneous infusion of IGF-I purified from natural sources stimulates an increase in body weight and tibial epiphyseal width (Schoenle, E. Nature 296:252-253, 1982).
  • Male Sprague Dawley rats which were surgically hypophysectomized at 120-130 grams of body weight were obtained from a commercial source (Charles River, Wilmington, MA) . The body weights of these rats were monitored for three weeks before the beginning of the experiment in order to verify completeness of the h pophysectomy. Rats gaining more than 2 grams per week were excluded from the study.
  • the rats were divided into two groups containing four rats in each.
  • One group was injected subcutaneously at the nape of the neck with recombinant met-IGF-I produced as set forth above (80 ⁇ g/rat/injection) twice a day at 9:00 a.m. and 8:00 p.m. for nine consecutive days.
  • the other group of four rats was injected with an equal volume of vehicle (0.2 ml) .
  • Body weights were measured daily at the time of the morning injection. Twelve hours after the last injection, the rats were killed, and the right and left tibias were removed.
  • the formalin-fixed tibias were split at the proximal end in a sagittal plane and stained with silver nitrate (Greenspan, F.S., Endocrinology 45:455-463, 1949).
  • the calcified tissue was stained dark brown and the proliferating zone of cartilage appeared as a clearly defined white band.
  • the cartilaginous epiphyseal plate was measured with a stereomicroscope with a calibrated micrometer eyepiece. Approximately ten individual readings were made across the width of the epiphysis. The mean of the combined readings from the right and left tibias was calculated for each rat.
  • the met-IGF-I-treated rats gained an average of 8.3 ⁇ 0.5 grams of body weight per rat; whereas, the body weights of the vehicle-treated rats remained stabilized with a change of only 1.0 ⁇ 1.2 grams on average per rat.
  • the difference between the two group is statistically significant (p ⁇ 0.05 using an unpaired t test) .
  • the width of the epiphyseal cartilage of the met-IGF-I-treated rats was greater than that of the vehicle-treated rats.
  • the epiphyseal widths were 0.20 ⁇ 0.01 mm in met-IGF-I-treated rats and 0.14 ⁇ 0.01 in vehicle-treated rats. The difference between the two groups is statistically significant (p ⁇ 0.005 using an unpaired t test) .
  • Hvpoglvce ia is induced bv the intravenous injection of recombinant Met-IGF-I

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé de repliement de facteurs de croissance I produits par recombinaison exprimés dans des cellules procaryotes, en particulier des bactéries, afin de rendre lesdits facteurs de croissance I biologiquement actifs. L'invention se rapporte également à des procédés d'isolation de facteurs de croissance I correctement repliés à partir de facteurs de croissance-I incorrectement repliés. Des compositions pharmaceutiques contenant des facteurs de croissance I, et des procédés de traitement d'un patient souffrant d'une affection associée aux facteurs de croissance sont également décrits, ainsi que le procédé de conversion du facteur de croissance met-I en facteur de croissance I.
EP93907573A 1992-03-24 1993-03-19 Repliement et purification de facteurs de croissance i ressemblant a l'insuline Withdrawn EP0586667A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US85816692A 1992-03-24 1992-03-24
US858161 1992-03-24

Publications (1)

Publication Number Publication Date
EP0586667A1 true EP0586667A1 (fr) 1994-03-16

Family

ID=25327654

Family Applications (1)

Application Number Title Priority Date Filing Date
EP93907573A Withdrawn EP0586667A1 (fr) 1992-03-24 1993-03-19 Repliement et purification de facteurs de croissance i ressemblant a l'insuline

Country Status (4)

Country Link
EP (1) EP0586667A1 (fr)
AU (1) AU3812993A (fr)
CA (1) CA2109820A1 (fr)
WO (1) WO1993019084A1 (fr)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5663304A (en) * 1993-08-20 1997-09-02 Genentech, Inc. Refolding of misfolded insulin-like growth factor-I
SE9303784D0 (sv) * 1993-11-16 1993-11-16 Kabi Pharmacia Ab Igf
US5650496A (en) * 1995-04-14 1997-07-22 Cephalon, Inc. IGF-I purification process
US6756484B1 (en) 1995-04-14 2004-06-29 Cephalon, Inc. IGF-I purification process
US7193042B1 (en) 1995-06-07 2007-03-20 Chiron Corporation Methods for purifying authentic IGF from yeast hosts
US5789547A (en) * 1995-06-07 1998-08-04 Celtrix Pharmaceuticals, Inc. Method of producing insulin-like growth factor-I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3) with correct folding and disulfide bonding
US7071313B1 (en) 1995-06-07 2006-07-04 Cephalon, Inc. Methods of purifying authentic IGF from yeast hosts
JP2002514890A (ja) * 1995-06-07 2002-05-21 カイロン コーポレイション 酵母宿主から真性のｉｇｆを精製するための方法
US6008013A (en) * 1996-07-05 1999-12-28 University Of Rochester Chondrocyte proteins
KR20020074749A (ko) * 2001-03-21 2002-10-04 한국생명공학연구원 재조합 인슐린 유사성장인자-1의 대량 생산방법
EP1988154B1 (fr) * 2007-04-30 2013-08-21 Ajinomoto Co., Inc. Procédé de fabrication de facteur de croissance de type insuline

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE8303626D0 (sv) * 1983-06-23 1983-06-23 Kabigen Ab A recombinant plasmid a transformant microorganism, a polydoxyrebonucleotide segment, a process for producing a biologically active protein, and the protein thus produced
WO1985000831A1 (fr) * 1983-08-10 1985-02-28 Amgen Expression microbienne d'un facteur de croissance semblable a l'insuline
DE3537708A1 (de) * 1985-10-23 1987-04-23 Boehringer Mannheim Gmbh Verfahren zur aktivierung von t-pa nach expression in prokaryonten
DE68905203T2 (de) * 1988-02-05 1993-07-22 Ciba Geigy Ag Verwendung von igf i zur herstellung eines praeparates fuer die behandlung von nierenkrankheiten.
WO1990002815A1 (fr) * 1988-09-13 1990-03-22 The General Hospital Corporation Isolation, purification et caracterisation des aminopeptidases mas ii et mas iii
DE3835350A1 (de) * 1988-10-17 1990-04-19 Boehringer Mannheim Gmbh Aktivierung von gentechnologisch hergestellten, in prokaryonten exprimierten antikoerpern

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9319084A1 *

Also Published As

Publication number Publication date
AU3812993A (en) 1993-10-21
CA2109820A1 (fr) 1993-09-30
WO1993019084A1 (fr) 1993-09-30

Similar Documents

Publication Publication Date Title
EP0518587B1 (fr) Proinsuline A-C-B, méthode de préparation, et d'utilisation, et intermédiaires dans la production d'insuline
KR100546225B1 (ko) 신속한 작용개시를 나타내는 인슐린 유도체
CA2033176C (fr) Proteines de fusion d'hormones de croissance
AU6048294A (en) Modified insulin-like growth factors
JPH01156998A (ja) 血清担体タンパク質との結合力が減少しているヒトインスリン様成長因子類以体及び酵母におけるそれらの産生
KR100393508B1 (ko) 인간 인터루킨 4의 안타고니스트 또는 부분적 아고니스트로서의 신규hIL-4 변이단백질
EP0756494A1 (fr) Facteurs de croissance proches de l'insuline modifies
UA65549C2 (uk) Спосіб регулювання ожиріння шляхом периферійного введення аналогів та похідних glp-1 (варіанти) та фармацевтична композиція
KR20010015711A (ko) 폴리펩티드, 그 폴리펩티드를 암호화하는 ｃＤＮＡ 및그들의 용도
CN113265007B (zh) 一种治疗代谢疾病的融合蛋白及其制备方法和应用
EP0586667A1 (fr) Repliement et purification de facteurs de croissance i ressemblant a l'insuline
EP0625163B1 (fr) Fragments de parathormone, leur fabrication et medicaments les contenant
JPH08301899A (ja) Ｉｇｆ−１スーパーアゴニスト
KR100649339B1 (ko) 아연 결합이 향상된 인슐린 동족체
EP0384731A2 (fr) Facteurs de croissance ostéogéniques identifiés à partir de moelle osseuse régénératrice
AU6093794A (en) Wound healing composition
KR19980064258A (ko) 항비만 단백질
JPH02207099A (ja) ＰＴＨｒＰ関連ペプチド、その製造法及び用途
CA2224867A1 (fr) Intermediaires de proteines contre l'obesite, leur preparation et leur utilisation
Smith et al. Production and biological activity of hybrid growth hormone-releasing hormone propeptides
JPS62502305A (ja) ポリペプチドの産生を向上する方法
KR100508616B1 (ko) 염기성 아미노산 첨가를 통한 활성이 증가된 단일사슬 인슐린 아날로그
RU2119800C1 (ru) Аналог пептида фактора гормона роста (фгр), способ стимулирования секреции гормона роста и композиция для стимулирования секреции
JP2682738B2 (ja) 成長ホルモン融合蛋白質
CA2113815A1 (fr) Purification du facteur neurotrophique ciliaire recombinant, facteur neurotrophique ciliaire a extremite c-terminale tronquee et methodes de traitement des lesions neurales peripheriques

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17P Request for examination filed

Effective date: 19940328

17Q First examination report despatched

Effective date: 19961030

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19970510