DE10150121A1 - Echtzeitdetektion von DNA-Amplifikationsprodukten - Google Patents

Echtzeitdetektion von DNA-Amplifikationsprodukten

Info

Publication number
DE10150121A1
DE10150121A1 DE10150121A DE10150121A DE10150121A1 DE 10150121 A1 DE10150121 A1 DE 10150121A1 DE 10150121 A DE10150121 A DE 10150121A DE 10150121 A DE10150121 A DE 10150121A DE 10150121 A1 DE10150121 A1 DE 10150121A1
Authority
DE
Germany
Prior art keywords
polymerase
dye
oligonucleotide
sybr
green
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
DE10150121A
Other languages
English (en)
Other versions
DE10150121B4 (de
Inventor
Christian Drosten
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BERNHARD NOCHT INST fur TROPE
Original Assignee
BERNHARD NOCHT INST fur TROPE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BERNHARD NOCHT INST fur TROPE filed Critical BERNHARD NOCHT INST fur TROPE
Priority to DE10150121A priority Critical patent/DE10150121B4/de
Publication of DE10150121A1 publication Critical patent/DE10150121A1/de
Application granted granted Critical
Publication of DE10150121B4 publication Critical patent/DE10150121B4/de
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

Die Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Amplifikaten. Ferner betrifft die Anmeldung partiell doppelsträngige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens.

Description

  • Die vorliegende Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Amplifikationsprodukten. Ferner betrifft die Anmeldung partiell doppelsträngige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens.
  • Verfahren zur Amplifikation von Desoxyribonukleinsäuren (DNA) ermöglichen deren exponentielle Vervielfältigung und machen auch geringe Nukleinsäuremengen einem qualitativen oder quantitativen Nachweis bzw. weitergehenden Applikationen zugänglich. Verfahren zur Amplifikation von DNA sind im Stand der Technik bekannt und schließen beispielsweise die Polymerasekettenreaktion (PCR) ein.
  • Durch den initialen Schritt einer Reversen Transkription (RT) lassen sich auch Ribonukleinsäuren (RNA) mittels DNA-Amplifikation vervielfältigen. In der Regel werden die Produkte solcher Amplifikationsverfahren nach Abschluß der Reaktion durch eine Endpunktanalyse bestimmt. Geeignete Verfahren zur qualitativen und/oder quantitativen Bestimmung von Amplifikationsprodukten sind im Stand der Technik hinreichend bekannt und umfassen beipielsweise photometrische Messmethoden oder die Analyse mittels Agarose-Gelelektrophorese.
  • Bei DNA-Amplifikationsverfahren wie der PCR ist es auch möglich, bereits während der Amplifikation der DNA die entsprechenden Produkte nachzuweisen. Der im Verlauf der PCR erfolgende Nachweis von PCR-Amplifikationsprodukten ermöglicht die Erhebung einer Reaktionskinetik, womit eine verläßliche Quantifizierung der in die PCR eingebrachten Menge an DNA verbunden ist (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193). Dieses PCR-Verfahren mit Echtzeitdetektion der PCR-Produkte (auch "real-time PCR" genannt) ist seit mehreren Jahren etabliert und erfährt derzeit einen enormen Zuwachs hinsichtlich seiner Anwendungsgebiete, insbesondere in den Bereichen der molekularen Erregerdiagnostik und der Genexpressionsanalyse (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193). Zum Nachweis des entstehenden PCR-Produktes während der Reaktion kommen dabei verschiedene technische Detektionsprinzipien zur Anwendung:
  • 1. 5'-Nuklease PCR ("TaqMan-PCR")
  • Eine doppelt fluoreszenzmarkierte DNA-Sonde hybridisiert mit dem PCR-Produkt und wird durch die 5'-Nukleaseaktivität der verwendeten DNA-Polymerase verdaut. Es kommt dabei zur physikalischen Trennung der beiden auf der Sonde befindlichen Fluorophore und zu einer detektierbaren Reversion eines Energietransferprozesses (Livak, K. et al. "Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization" PCR Methods Appl 4 (1995) 357-362).
  • 2. Molecular Beacons
  • Diesem Verfahren liegt das gleiche Prinzip zugrunde, jedoch erfolgt die Reversion des Energietransfers hier über eine sterische Konformationsänderung in der Sekundärstruktur der Sonde, die durch den Hybridisierungsvorgang ausgelöst wird. Ein Verdau der Sonde ist nicht nötig (Tan, W. et al. "Molecular beacons: a novel DNA probe for nucleic acid and protein studies" Chemistry 6 (2000) 1107-1111).
  • 3. Hybridization Probes
  • Bei diesem Verfahren beruht die Detektion auf einem Neuauftreten von Energietransfer, wenn zwei DNA-Sonden benachbart an einem DNA-Strang hybridisieren (Bernhard, P. B. und Wittwer, C. T. "Homogenous amplification and variant detection by fluorescent hybridization probes" Clin Chem 46 (2000) 147-148).
  • 4. Sequenzunspezifischer Nachweis mit SYBR®Green I
  • SYBR®Green I ist ein unsymmetrischer Cyanin-Farbstoff, der unabhängig von der Sequenz in doppelsträngige DNA (dsDNA) interkaliert, wobei der dsDNA-gebundene Farbstoff effizient bei ca. 488 nm und ca. 254 nm angeregt weden kann. Durch seine Thermostabilität ermöglicht SYBR®Green I einen real-time Nachweis von PCR- Produkten (Wittwer, C. T. et al. "Continuous fluorescence monitoring of rapid cycle DNA amplification" Biotechniques 22 (1997) 130-138). Zahlreiche unsymmetrische Cyanin-Frabstoffe sind z. B. in US 5,436,134, US 5,658,751, WO 94/24213 und WO 96/13552 offenbart. Bei SYBR®Green I und SYBR®Gold handelt es sich um interkalierende Farbstoffe mit außergewöhnlich hoher Affinität zu dsDNA. Interkalierende Farbstoffe besitzen die Eigenschaft, sich in die "Minor Groove" ("kleine Furche") von doppelsträngiger DNA einzulagern. Durch diese Bindung wird die Fluoreszenz bei gleicher Anregungsintensität um ein vielfaches verstärkt, und man erhält ein Signal, dessen Intensität direkt proportional zu der Zahl der vorhandenen Doppelstränge ist. Der dsDNA-gebundene Farbstoff SYBR®Green I besitzt eine Haupt-Anregungsbande bei 497 nm (weitere Anregungsmaxima liegen bei etwa 290 nm und etwa 380 nm), das Emissionsmaximum des SYBR®Green I-Nukleinsäurekomplexes liegt bei etwa 520 nm. SYBR®Green I kann effizient bei ca. 488 nm und ca. 254 nm angeregt weden. Der dsDNA-gebundene Farbstoff SYBR®Gold weist einen Haupt-Anregungsmaximum bei etwa 495 nm auf, ein weiterer Anregungspeak liegt bei etwa 300 nm, und das Emissionsmaximum des SYBR®Gold-Nukleinsäurekomplexes liegt bei etwa 537 nm. Die Fluoreszenz-Anregungs- und Fluoreszenz-Emissionsspektren von SYBR®Green I und SYBR®Gold sind in Fig. 1 dargestellt.
  • Bei den unter 1. bis 3. oben genannten Verfahren sind sequenzspezifische DNA-Detektionssonden erforderlich, deren Synthese aufwendig und teuer ist. Gleichzeitig muß in der nachzuweisenden Nukleinsäure zumindest der Bereich der Sondenbindungsstellen hochgrading konserviert sein. Ein Nachweis variabler Sequenzen ist mit Sonden nicht zuverlässig möglich.
  • In vielen Bereichen der Molekularbiologie, vor allem bei der Analyse von Genexpression und beim Nachweis von RNA-Viren wie HIV-1 oder HCV, ist die Amplifikation und Quantifizierung von RNA durch die PCR wünschenswert. Hierzu kann prinzipiell eine Reverse Transkription-Polymerasekettenreaktion (RT-PCR) mit Echtzeitdetektion (real-time RT-PCR) durchgeführt werden. Eine RT-PCR kann generell mittels zweier unterschiedlicher Verfahren erfolgen.
  • Bei der zweistufigen RT-PCR (2-Step RT-PCR) wird die zu quantifizierende RNA zunächst in einer separaten Reaktion mit Hilfe einer Reversen Transkriptase in komplementäre DNA (cDNA) transkribiert (Reverse Transkription). Die entstandene cDNA wird im folgenden in einer PCR mittels einer hitzestabilen DNA-Polymerase (z. B. Thermus aquaticus Polymerase, Taq-Polyuerase) amplifizert.
  • Bei der einstufigen RT-PCR (1-Step RT-PCR) erfolgen Reverse Transkription und Amplifikation unmittelbar hintereinander in derselben Reaktion. Diese Variante bietet drei wesentliche Vorteile: (i) deutlich höhere analytische Präzision in der Quantifizierung durch Wegfall eines Pipettierschrittes; (ii) verringerte Kontaminationsgefahr in der qualitativen Diagnostik durch weniger Manipulationsschritte (Kwok, S. und Higuchi, R. "Avoiding false positives with PCR" Nature 339 (1989) 237-238); (iii) erhöhte Sensitivität in beiden Anwendungsbereichen durch Wegfall eines Verdünnungsfaktors zwischen RT und PCR.
  • Sowohl bei der einstufigen als auch die zweistufigen RT-PCR kann im Rahmen der Amplifikation der cDNA eine Echtzeitdetektion der Amplifikationsprodukte durchgeführt werden.
  • Die Durchführung von einstufigen RT-PCR Reaktionen kann mit Hilfe einer einzelnen Thermus thermophilis Polymerase (Tth-Polymerase) oder mittels Enzymkombinationen erfolgen. Die Tth Polymerase ist eine DNA Polymerase aus dem thermophilen Bakterium Thermus thermophilis, die eine außergewöhnlich hohe Reverse Transkriptase-Nebenaktivität besitzt. Dadurch kann eine einstufige RT- PCR mit nur einem Enzym realisiert werden.
  • Zur Entwicklung einer maximalen RT-Aktivität bei Verwendung der Tth-Polymerase müssen dabei die physiologischerweise in der Reaktion verwendeten Magnesiumionen durch Manganionen ersetzt werden. Nachteilig wirkt sich aber aus, daß RNA in Gegenwart von Manganionen degradiert wird (Carninci, P. et al. "Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cDNA. Proc. Natl. Acad. Sci. USA 95 (1998) 520-524). Dies erklärt die generell limitierte Sensitivität dieses Verfahrens.
  • Durch Optimierung der Pufferbedingungen ist es auch möglich, Reverse Transkriptase und Taq DNA-Polymerase in derselben Reaktion zu verwenden. Diese Verfahrensvariante ermöglicht eine hohe Sensitivität und wird daher in der qualitativen Diagnostik zum Erregernachweis bevorzugt. Die verwendeten Reversen Transkriptasen stammen dabei aus den beiden Retroviren Moloney Murine Leukemia Virus (MMuLV) oder Avian Myeloma Mirus (AMV).
  • Der Nachweis hochvariabler RNA-Viren stellt einen Kernanwendungsbereich der RT-PCR in der Molekulardiagnostik dar. Insbesondere Humanes Immundefizienz Virus-1 (HIV-1) und Hepatitis C Virus (HCV) müssen quantitativ nachgewiesen werden, etwa um die Viruslast bei Patienten unter Therapie zu beobachten. Aus dem Ergebnis dieses Nachweises ergeben sich direkte Therapieindikationen. Auch der quantitative Nachweis anderer variabler RNA- Viren, wie etwa des Lassavirus, kann über eine Prognose und das Ansprechen der Therapie Auskunft geben. Beim Nachweis hochvariabler Viren (d. h. Viren, bei denen es im Verlauf einer Infektion zu Änderungen der viralen Nukleinsäuresequenzen kommt, sogen. "Viusvariabilität") stellt sich insbesondere das oben angesprochene Problem der Nachweisbarkeit mit Sonden. Soll die PCR mit Echtzeitdetektion zur Quantifizierung dieser Viren ausgenutzt werden, müssen Sondenbindungsstellen identifiziert werden, die konserviert sind. Dies ist bei vielen der angesprochenen Viren jedoch nur eingeschränkt oder gar nicht möglich.
  • Eine Alternative zur Verwendung von Sonden stellt die sequenzunabhängige Detektion mit Hilfe von DNA-bindenden Farbstoffen wie SYBR®Green I (s. o.) dar. Dieses Verfahren ist zum gegenwärtigen Zeitpunkt noch nicht zufriedenstellend realisiert, da die retroviralen Reversen Transkriptasen, die in der Erregerdiagnostik eingesetzt werden, extrem stark durch SYBR®Green I gehemmt werden, und zwar bereits bei relativ niedrigen Konzentrationen, die für eine Detektion gerade noch ausreichen (0,001% v/v). Dieser Umstand erzwingt eine Trennung von Reverser Transkription und PCR mit den bereits erwähnten Nachteilen. Das heißt, eine einstufige RT-PCT (1-Step RT-PCR) ist bislang unter Verwendung retroviraler Reverser Transkriptasen nur sehr eingeschränkt möglich.
  • Da DNA-Polymerasen durch SYBR®Green I nicht gehemmt werden, kann eine einstufige RT-PCR mit Tth DNA-Polymerase in Gegenwart von SYBR®Green I jedoch durchgeführt werden, indem man die Reverse Transkriptase-Nebenaktivität der Tth Polymerase ausnutzt.
  • Tth Polymerase-enthaltende einstufige RT-PCR-Systeme für Detektionen mit SYBR®Green I sind im Stand der Technik bekannt (Fa. Roche); sie weisen jedoch den bereits erwähnten Nachteil einer geringen Sensitivität auf.
  • Aufgabe der vorliegenden Erfindung ist es daher, ein Echtzeit- Detektionsverfahren bereitzustellen, bei dem man in einer einstufigen Reaktion RNA zunächst revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert, und man die DNA-Amplifikationsprodukte (DNA-Amplitikate) sequenzunabhängig detektiert, wobei Effizienz und Sensitivität des zur Reversen Transkription verwendeten Enzyms nicht oder nicht signifikant beeinflußt werden. Insbesondere ist es Aufgabe der Erfindung ein sensitives 1-Step RT-PCR-Verfahren mit (vorzugsweise sequenzunabhängiger) Echtzeit-Detektion der Amplifikate bereitzustellen. Vorzugsweise weist dieses Verfahren eine Sensitivität auf, die es erlaubt weniger as 1000 Kopien eines RNA-Moleküls nachzuweisen.
  • Die Aufgabe wird erfindungsgemäß durch ein Verfahren zur Durchführung einer Nukleinsäureamplifikaktion gelöst, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, man die gebildete komplementäre DNA (cDNA) amplifiziert und man die gebildeten Amplifikate sequenzunabhängig in Echtzeit detektiert, wobei man zur Detektion einen thermostabilen Farbstoff verwendet, der selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindet. Um eine Hemmung des Enzyms, das die reverse Transkription katalysiert, zu vermeiden, wir der Farbstoff vor der reversen Transkription immobilisiert. Vor der Amplifikation wird, der Farbstoff wieder freigesetzt, damit er zur Bindung an die Amplifikate zur Verfügung steht. Die Farbstoff-gebundenen Amplifikate werden erfindungsgemäß qualitativ und/oder quantitativ nachgewiesen.
  • Unter einem selektiv an dsDNA bindenden Farbstoff wird vorliegend ein Farbstoff verstanden, der ausschließlich oder überwiegend an doppelsträngige DNA, jedoch nicht oder nur in geringem Umfang an einzelsträngige DNA (ssDNA) bindet.
  • Die wesentlichen Vorteile des erfindungsgemäßen Verfahrens bestehen darin, daß das Verfahren gegenüber bislang bekannten Verfahren zur Amplifikation von Nukleinsäuren mit Echtzeitdetektion eine höhere Sensitivität aufweist, die der eines optimierten Verfahrens, wie beispielsweise einer RT-PCR ohne Echtzeitdetektion der entstehenden PCR-Produkte, entspricht. Gleichzeitig erlaubt das vorliegende Verfahren einen sequenzunabhängigen Erregernachweis, d. h. eine Detektion der Amplifikate ohne die Notwendigkeit sequenzspezifischer DNA-Sonden.
  • Die Unsicherheit von im Stand der Technik eingesetzten Sondendetektionsverfahren bei hochvariablen Sequenzen wurde eingangs bereits ausführlich erläutert. Basenfehlpaarungen an der Sondenbindungsstelle können nicht nur zu falschen Ergebnissen bei der Quantifizierung führen, sondern im Extremfall können sich falsch negative Testergebnisse ergeben (beispielsweise beim diagnostischen Nachweis von HIV oder hämorrhagischen Fieberviren). Ferner sind die Kosten für eine Echtzeitdetektionssonde relativ hoch. Sie belaufen sich für einen kleinen Synthesemaßstab (ausreichend für ca. 1000 Reaktionen) derzeit auf etwa DM 500,- bis DM 1000,-. Auch erlaubt eine Sonde immer nur die Quantifizierung einer einzigen Zielsequenz. Sollen also für Expressionsstudien etwa 20 bis 30 verschiedene zelluläre RNA-Spezies untersucht werden, kostete eine solche Untersuchung etwa DM 14000,- bis DM 21000,-. Diese Kosten übersteigen die finanziellen Möglichkeiten der meisten institutionellen bzw. universitären Arbeitsgruppen.
  • Demgegenüber erlaubt das erfindungsgemäße Verfahren die Herstellung eines universellen Detektionsreagenz-Kits, das ein teilweise doppelsträngiges Oligonukleotid und einen thermostabilen, für dsDNA selektiven Farbstoff umfasst. Die Kosten sind Vergleich zu einer Sondendetektion äußerst niedrig. Gleichzeitig kann aufgrund des Verzichts auf sequenzspezifische Sonden jede beliebige Zielsequenz bestimmt werden, da die Detektion sequenzunabhängig, d. h. unabhängig von einer bestimmten Nukleotidsequenz innerhalb des zu amplifizierenden Sequenzbereichs, erfolgt.
  • Im Rahmen der vorliegenden Erfindung wird unter "Reverser Transkription" (RT) eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem RNA als Matritze für die Bildung komplementärer DNA (cDNA) verwendet wird. Der Vorgang der cDNA-Synthese kann dabei von einer RNA-abhängigen DNA-Polymerase katalysiert werden, die vorliegend auch als "Reverse Transkriptase" bezeichnet wird.
  • Die entstandene cDNA dient einer nachfolgenden Amplifikationsreaktion als Ausgangsmolekül (Templat). Bei der zur Vermehrung der cDNA angewendeten Amplifikationsreaktion handelt es sich vorzugsweise um eine Polymerase-Ketten-Reaktion (PCR), es ist jedoch auch denkbar, die Amplifikation mit Hilfe einer NASBA ("nucleic acid sequence based amplification"; Vandamme, A. M. et al. "Detection of HIV-1 RNA in plasma and serum samples using the NASBA amplification system compared to RNA-PCR". J. Virol. Methods 52 (1995) 121-132) oder einer TMA ("transcription mediated amplification"; Pasternack, R. et al. "Evaluation of the Genprobe Chlamydia trachomatis transcription-mediated amplification assay with urine specimens from women" J. Clin. Microbiol. 35 (1997) 676-678) durchzuführen.
  • Erfolgt die Amplifikation mit Hilfe einer PCR, so entspricht die gesamte erfindungsgemäße Amplikationsreaktion einer RT-PCR. Eine RT-PCR ist grundsätzlich als einstufige oder zweistufige Reaktion durchführbar.
  • Im Rahmen der vorliegenden Erfindung wird unter dem Begriff "einstufige Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation unmittelbar hintereinander in demselben Reaktionsansatz erfolgen, ohne daß das Reaktionsgefäß, in dem der Reaktionsansatz enthalten ist, im Verlauf der Reaktion geöffnet werden muß, um weitere Reaktionskomponenten zuzufügen.
  • Im Gegensatz dazu wird unter einer "zweistufigen Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation hintereinander in zwei verschiedenen Reaktionsansätzen erfolgen. Dazu wird in der Regel zunächst eine Reverse Transkription in einem kleinen Reaktionsvolumen durchgeführt, in dem die Bedingungen der für die Reverse Transkription optimal eingestellt werden können. Nach Abschluß der reversen Transkription wird der gesamte Ansatz oder ein Teil desselben in eine Amplifikationsreaktion eingesetzt. Der Nachteil dieser Vorgehensweise besteht in einem erhöhten Kontaminationsrisiko sowie einer deutlich geringeren analytischen Präzision durch zusätzliche Pipettierschritte. Dieser Nachteil wird durch das erfindungsgemäße Verfahren vermieden.
  • Im Rahmen der vorliegenden Erfindung können die beiden enzymatischen Reaktionen (Reverse Transkription und Amplifikation) von jeweils einer oder von mehreren im Reaktionsansatz enthaltenen Enzymen katalysiert werden.
  • Die im Rahmen der Erfindung verwendeten Farbstoffe sind thermostabil. Der Begriff "thermostabil" bezeichnet vorliegend die Eigenschaft der Farbstoffe, auch bei den durch das thermische Amplifikationsprofil bedingten hohen Temperaturen funktionstüchtig zu bleiben. Die Farbstoffe sind auch bei Detektionstemperaturen von über 80°C in der Lage, an doppelsträngige DNA zu binden. Durch Erhitzen auf Temperaturen von über 90°C darf außerdem keinerlei irreversible Strukturänderung des Farbstoff- Moleküls erfolgen, der eine nachträgliche Beeinträchtigung der Funktonalität bei einer für die Detektion übliche Temperatur zur Folge hat.
  • Der zur Detektion verwendete Farbstoff bindet selektiv an doppelsträngige DNA. Unter "selektiv binden" wird dabei die Eigenschaft der Farbstoffe verstanden, mit deutlich höherer Affinität an doppelsträngige DNA zu binden als an einzelsträngige DNA. So bindet beispielsweise der erfindungsgemäß geeignete Farbstoff Ethidiumbromid zwar nicht ausschließlich an doppelsträngige DNA, sondern auch in geringem Maße an einzelsträngige DNA, doch ist die Affinität des verwendeten Farbstoffs zu doppelsträngiger DNA um ein Vielfaches höher als die Affinität zu einzelsträngiger DNA. Die erfindungsgemäß geeigneten Farbstoffe umfassen sowohl selektiv an dsDNA bindende Moleküle, die entweder allein oder als Farbstoff-Nukleinsäure-Komplex qualitativ und/oder quantitativ nachweisbar sind.
  • Ein erfindungsgemäß bevorzugter Farbstoff ist der unsymmetrische Cyaninfarbstoff SYBR®Green I.
  • Der Nachweis von Farbstoffen wie SYBR®Green oder Ethidiumbromid kann beispielsweise über eine Fluoreszenzmessung erfolgen.
  • Die Bindung des Farbstoffs an die DNA kann auf verschiedene Mechanismen zurückzuführen sein. Es kann sich um eine kovalente Bindung oder eine nicht-kovalente Interaktion zwischen den Farbstoff-Molekülen und den doppelsträngigen DNA-Molekülen handeln. So werden gemäß einer erfindungsgemäß bevorzugten Ausführungsform beispielsweise interkalierende Farbstoffe verwendet, die in die Zwischenräume benachbarter Basenpaare einer Nukleinsäuresequenz eindringen. Derartige Farbstoffe sind dem Fachmann gut bekannt und umfassen u. a. SYBR®Green und Ethidiumbromid. Die Bindung dieser Farbstoffe beruht auf einer Wechselwirkung der aromatischen Ringsysteme mit den planaren Heterocyclen der Nukleinsäure-Basen.
  • Gemäß einer bevorzugten Ausführungsform der Erfindung wird der Farbstoff aus der Gruppe bestehend aus SYBR®Green I, SYBR®Green II und Ethidiumbromid ausgewählt. Ferner sind die Farbstoffe PicoGreen (vgl. E. L. Romppanen et al., Anal. Biochem. 279 (2000) 111-114), YO-PRO-1 (vgl. I. D. Johnson et al., Biophys. J. 61 (1992) A314, Abstract Nr. 1806), YOYO-1 (H. S. Rye et al., Anal. Biochem. 208 (1993) 144-150) und Hoechst 33258 (4-[5-(4-Methyl-1- piperazinyl)[2,5'-bis-1H-benzimidazol]-2'-yl]-phenol-trihydrochlorid; Chemical Abstracts Registry Nr. 23491-45-4; vgl. R. Rago et al., Anal. Biochem. 191 (1990) 31-34) geeignet.
  • Im Rahmen der vorliegenden Erfindung wird der Farbstoff vor der Reversen Transkription immobilisiert. Gemäß einer bevorzugten Ausführungsform erfolgt das Immobilisieren, indem man den Farbstoff in einem Lösungsmittel mit einem Schmelzpunkt im Bereich von 10°C bis 40°C löst und man die Farbstofflösung am Boden des Reaktionsgefäßes "festfriert". das Festfrieren kann in handelsüblichen Behältnissen, wie beispielsweise PCR-Reaktionsbehältern erfolgen. Dabei wird der Farbstoff durch die erhöhten Reaktionstemperaturen der Reversen Transkription freigesetzt und diffundiert in die Reaktionslösung. Die Diffusionsgeschwindigkeit der Farbstofflösung ist ausreichend gering, um während der Reversen Transkription das Enzym, welches diesen Reaktionsschritt katalysiert, nicht oder nicht wesentlich zu inhibieren.
  • Gemäß einer besonders bevorzugten Ausführungsform der Erfindung handelt es sich bei dem Lösungsmittel um Dimethylsulfoxid (DMSO), welches einen Schmelzpunkt von 18,45°C aufweist.
  • Gemäß einer weiteren Ausführungsform der Erfindung immobilisiert man den Farbstoff, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden läßt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur aber unterhalb der zur Detektion von PCR-Produkten geeigneten Temperatur (80-90°C) liegt. Der Farbstoff wird dadurch freigesetzt, daß man die Temperatur vor bzw. zur Durchführung der Amplifikation erhöht. Dabei wird aus dem doppelsträngigen Oligonukleotid, an das der Farbstoff vor der Reversen Transkription gebunden war, ein einzelsträngiges Oligonukleotid gebildet, an das der Farbstoff nicht mehr bindet.
  • Als "Oligonukleotide" werden vorliegend einzelsträngige DNA- Moleküle bezeichnet, die vorzugsweise eine Länge von etwa 10 bis 500 Basenpaaren aufweisen.
  • Unter einem "zumindest teilweise doppelsträngigen Oligonukleotid" versteht man im Rahmen der vorliegenden Erfindung ein (einzelsträngiges) Oligonukleotid, bei dem zumindest bestimmte Bereiche durch intramolekulare Basenpaarung als DNA-Doppelstrang vorliegen. Die Basenpaarungen kommen dabei vorzugsweise durch invertierte Sequenzwiederholungen am 5'-Ende und 3'-Ende des Oligonukleotidstrangs zustande und sind somit zueinander spezifisch.
  • Gemäß einer besonders bevorzugten Ausführungsform der vorliegenden Erfindung liegt die Schmelztemperatur des Oligonukleotids im Bereich von etwa 45°C bis etwa 85°C. Als "Schmelztemperatur" des Oligonukleotids wird erfindungsgemäß diejenige Temperatur bezeichnet, die notwendig ist, um ein vollständig oder teilweise doppelsträngiges Oligonukleotid durch Auflösen der Basenpaarungen in ein einzelsträngiges Oligonukleotid zu überführen.
  • Erfindungsgemäß kann es sich bei dem Oligonukleotid um ein Haarnadelschleifen-Oligonukleotid (Hairpin-Oligonukleotid) handeln. Unter "Haarnadelschleifen-Oligonukleotid" wird in diesem Zusammenhang ein Oligonukleotid verstanden, welches aus einem durch spezifische Basenpaarung invertierter Nukleotidsequenz- Wiederholungen gebildeten Stamm und einer offenen Schleife besteht. Der strukturelle Aufbau ist in Fig. 2 schematisch am Beispiel einer bevorzugten Ausführungsform dargestellt. Der Stamm bestimmt maßgeblich die Schmelztemperatur eines Haarnadelschleife-Oligonukleotids, wobei die Schmelztemperatur unter anderem vom G/C-Gehalt und der Länge des Oligonukleotids sowie von der Art der Nukleinsäure (DNA-, RNA oder PNA-Oligonukleotid) und dem Salzgehalt der Reaktionsmischung abhängt. Bei Oligonukleotiden mit einer Länge von ≥ 5 bp spielen auch Sequenzwiederholungen eine Rolle. Diese Faktoren sind dem Fachmann wohlbekannt, und die Einstellung der Schmelztemperatur ist daher auf relativ einfache Weise möglich (vgl. z. B. F. Schaeffer et al., EMBO J. 1 (1982) 99-105; J. De Ley, J. Bacteriol. 101 (1970) 738-754; T. Latham et al. DNA 8 (1989) 223-231).
  • Der Begriff "Schleife" bezeichnet dabei den Bereich eines Oligonukleotids, der zwischen zwei Bereichen lokalisiert ist, die durch spezifische Basenpaarung die Stamm-Struktur des Oligonukleotids bilden. Unter "Stamm" oder "Stamm-Struktur" des Olignukleotids wird erfindungsgemäß ein doppelsträngiger Bereich des Oligonukleotids verstanden, der durch spezifische Basenpaarung invertierter Nukleotidsequenz-Wiederholungen entsteht.
  • Bevorzugt besitzt das Haarnadelschleifen-Oligonukleotid die in Fig. 2 dargestellte allgemeine Struktur. Vorzugsweise weist das Molekül eine nicht-basische (abasische) Schleifen-Sequenz auf, die zwischen den am 5'-Ende und am 3'-Ende des Oligonukleotids liegenden und zur Doppelstrangbildung befähigten Sequenzabschnitten liegt. Im Rahmen der vorliegenden Erfindung können anstelle des Haarnadelschleifen-Oligonukleotids auch zwei einzelne, revers komplementäre Oligonukleotide verwendet werden, die am 3'-OH-Ende phosphoryliert sind. Die in Bezug auf das Haarnadelschleifen- Oligonukleotid genannten Bedingungen und Eigenschaften müssen auch für die beiden komplementären Oligonukleotide gelten.
  • Unter "abasischer Sequenz" (auch als "abasischer Spacer" bezeichnet) wird im Rahmen der vorliegenden Erfindung ein Sequenzabschnitt verstanden, der aus einer Abfolge nicht-basischer Nukleotide besteht (d. h. aus Nukleotiden, die keine Base enthalten). Im Gegensatz zu den für Nukleinsäuren typischen Bausteinen besitzen nicht-basische Nukleotide keine Purin-, Pyrimidin- oder andere, dem Fachmann aus Nukleinsäuren bekannte Basen und bestehen somit lediglich aus Ribosephosphat (z. B. nicht-paarende Basenanaloga und universell paarende Basenanaloga, wie poly-Inosin). Nicht-basische Nukleotide sind dem Fachmann aus der Oligonukleotid-Synthese hinreichend bekannt. Die Verwendung nicht-basischer Nukleotide im Bereich der Schleifen-Struktur (loop-Struktur) des Hairpin-Oligonukleotids verhindert die Ausbildung unspezifischer Basenpaarungen im Bereich der Schleife- Struktur, die den Schmelzpunkt des Oligonukleotids beeinflußen können. Das Hairpin-Oligonukleotid weist gegenüber den frei in Lösung befindlichen Oligonukleotiden den Vorteil auf, daß die beiden Stammteile infolge der räumlichen Nähe zueinander besser rehybridisieren, es liegt nur eine anstelle von zwei freien 3'- OH-Gruppen vor, und es besteht ein sterisches Hybridisierungshindernis für den Loop.
  • Zusätzlich zu der abasischen Spacer-Sequenz kann das Haarnadelschleifen-Oligonukleotid eine Phosphatgruppe anstelle der 3'-OH- Gruppe aufweisen. Durch den Austausch der 3'-terminalen OH-Gruppe durch eine Phosphatgruppe kann man eine Interferenz des Oligonukleotids mit der Nukleinsäureamplifikationsreaktion verhindern. Anstelle der Phosphorylierung am 3'-terminalen Ende kann auch jede sonstige Substitution eingesetzt werden, die eine Esterifizierung verhindert, d. h. z. B. Fluorescein-Markierung, Iodierung, Biotinylierung, etc. Durch den Austausch der Hydroxylgruppe kann die Verlängerung des Oligonukleotids bei der PCR verhindert werden, da die DNA-Polymerase die für die Verknüpfung von Nukleotiden notwendige Esterbindung nur zwischen einer 5'- Phosphatgruppe und einer 3'-OH-Gruppe, nicht aber zwischen zwei Phosphatgruppen zu katalysieren vermag. Verfahren zur Phosphorylierung des 3'-Terminus von Nukleinsäuren sind dem Fachmann wohlbekannt.
  • Gemäß einer besonderen Ausführungsform der Erfindung weisen die komplementären Sequenzabschnitte des Haarnadelschleifen-Oligonukleotids die SEQ ID NO: 1 und SEQ ID NO: 2 dargestellten Nukleotidsequenzen auf ("SEQ ID N0" steht für die im Sequenzprotokoll jeweils enthaltenen Kennzahlen "<400>" gemäß WIPO Standard ST.25). Die Oligonukleotid-Sequenzen sind vorzugsweise durch eine Spacer-Sequenz einer Länge von 3 bis 500, vorzugsweise 10 bis 60 abasischen Nukleotiden, insbesondere Ribose-Phosphatresten, verbunden. Eine Länge von 20 Ribose-Phosphatresten ist besonders bevorzugt. Dieses Molekül mit der (Nukleinsäure-)Sequenz ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTACAGGT- TACTGT (entsprechend <SEQ ID NO: 6>-11111111111111111111-<SEQ ID NO: 7>, wobei "A" für Adenin, "C" für Cytosin, "T" für Thymin, "G" für Guanin und "1" für Ribosephosphat steht) wird vorliegend mit "SGS3" bezeichnet. Die Struktur von SGS3 ist in Fig. 2 wiedergegeben.
  • Gegenstand der Erfindung sind ferner Oligonuleotid-Farbstoff- Komplexe bestehend aus einem oben genannten Haarnadelschleifen- Oligonukleotid (vorzugsweise mit der Sequenz <SEQ ID NO: 6>- 11111111111111111111-<SEQ ID NO: 7>), und einem selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindenden Farbstoff. Bei dem Farbstoff handelt es sich gemäß einer bevorzugten Ausführungsform um SYBR®Green I, SYBR®Green II oder Ethidiumbromid.
  • Die Polymerasen, die erfindungsgemäß bei der Reversen Transkription Anwendung finden können, sind vorzugsweise aus der folgenden Gruppe ausgewählt: DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase), Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT) und Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT), Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und andere Reverse Transkriptasen retroviralen Ursprungs. Erfindungsgemäß können ein oder mehrere Enzyme aus dieser Gruppe für die Reverse Transkription verwendet werden.
  • Gemäß einer weiteren Ausführungsform der Erfindung handelt es sich bei der auf die Reverse Transkription folgenden Amplifikation der cDNA um eine Polymerasekettenreaktion (PCR). Zu deren Durchführung verwendet man vorzugsweise eine DNA-Polymerase(n) aus der folgenden Gruppe: Thermus aquaticus-Polymerase (Taq- Polymerase), Thermus flavus-Polymerase (Tfl-Polymerase), Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase). Gemäß einer besonderen Ausführungsform sind Tfl-, Tma- und Pfu-Polymerase bevorzugt, da diese Polymerasen proofreading-Enzyme (3'-5'-Exonuclease Aktivität) sind, die eine geringere Fehlerrate als die Taq- Polymerase aufweisen. Es kann auch eine Mischung aus mehreren Polymerasen verwendet werden, klassischerweise Pfu und Taq.
  • Gemäß einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens verwendet man zur Nukleinsäureamplifikation eine Kombination von MMuLV-RT und Taq-Polymerase und für die Detektion SYBR®Green I als Farbstoff.
  • Die vorliegende Erfindung betrifft ferner Kits zur Verwendung in oder zur Durchführung des erfindungsgemäßen Verfahrens. Gemäß einer Ausführungsform enthält ein solches Kit ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelztemperatur oberhalb der zur Durchführung der Reversen Transkription aber unterhalb der zur Detektion von PCR-Produkten geeigneten Temperatur (80-90°C) liegt, einen Farbstoff, der selektiv an doppelsträngige DNA bindet. Vorzugsweise enthalten die Kits einen oben genannten Oligonukleotid-Farbstoff-Komplex. Die Kits enthalten gegebenenfalls weitere Reagenzien und Hilfsmittel, die man üblicherweise zur Durchführung einer Nukleinsäureamplifikation benötigt, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate (sequenzunabhängig) in Echtzeit detektiert. Bei diesen Reagenzien kann es sich beispielsweise um Reaktionspuffer handeln, die eine für die Reaktion erforderliche Konzentration bestimmter Ionen, wie Magnesium-(Mg2+) oder Manganionen (Mn2+), gewährleisten. Weiterhin kann es sich um Reagenzien handeln, die eine Ausbildung von Sekundärstrukturen der RNA hemmen und somit die Effizienz der Reversen Transkription erhöhen. Es kann sich ferner um RNAse-freies Wasser zum Ansetzen der Amplifikations-Reaktionsansätze oder um RNAse-Inhibitoren handeln, die eine enzymatische Degradation der Ausgangs-RNA durch kontaminierende RNAsen im Reaktionsansatz inhibieren. Darüber hinaus können die Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation auch Lösungen der Desoxynukleotidtriphosphate dATP, dCTP, dGTP und dTTP umfassen.
  • Bezüglich der Bestandteile der Kits wird im übrigen auf die obigen Ausführungen zur den bei dem erfindungsgemäßen Verfahren eingesetzten Enzyme, Oligonukleotide und Farbstoffe und deren Eigenschaften verwiesen.
  • Gemäß einer besonders bevorzugten Ausführungsform der Erfindung enthält das Kit eine Kombination der Enzyme MMuLV-RT und Taq- Polymerase sowie SYBR®Green I als Farbstoff.
  • Die Erfindung wird nachfolgend anhand von Beispielen, Figuren und einem Sequenzprotokoll näher beschrieben.
  • Beispiele Material und Methoden
  • Als Modell-PCR-Systeme zur Etablierung einer einstufiger RT-PCR mit SYBR®Green I-Detektion wurden etablierte Assays für Lassavirus (Demby, A. et al. "Early diagnosis of Lassa fever by reverse transcription PCR" J. Clin. Microbiol. 32 (1994) 2898-2903) und Ebolavirus (Sanchez, A. et al. "Detection and molecular characterization of Ebola viruses causing disase in human and nonhuman primates" J. Infect. Dis. 179 (1999) Suppl 1 S164-169) verwendet. Die veröffentlichten Primer waren jeweils mit Hilfe des Superscript II/Platinum® One-Step RT-PCR System (Life Technologies, Karlsruhe, Deutschland) in das einstufiger RT-PCR Format überführt worden. Die Sensitivität beider Verfahren belief sich auf ca. 20 Kopien in vitro transkribierter RNA pro Reaktion. Die verwendeten Enzyme waren eine MMuLV Reverse Transkriptase und eine Taq DNA-Polymerase. Zur Testung von alleiniger DNA-Amplifikation wurde außerdem eine Taq DNA-Polymerase eines anderen Herstellers verwendet (AmpliTaq®Gold, Perkin-Elmer, Weiterstadt, Deutschland). Der Farbstoff SYBR®Green I (z. B. kommerziell von der Fa. Roche, Mannheim, Deutschland, erhältlich als 10 000 × Konzentrat in DMSO) wurde in allen Experimenten in Dimethylsufoxid (DMSO) verdünnt. Die Mindestkonzentration von SYBR®Green I zur Detektion von PCR-Produkten liegt bei 0,001% v/v in der Reaktion. Soweit nicht anders angegeben, wurde in den folgenden Experimenten diese Konzentration eingesetzt. Sämtliche RT-PCR- und PCR-Amplifikationen wurden in einem LightCycler® (Roche) durchgeführt.
  • Durchführungsprotokoll für Ebola-Virus
  • Eine Reaktion enthielt 10 µl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 µg Rinderserumalbumin (BSA, Fa. Sigma, München), 0,75 mM Magnesiumsulfat, 1 µM Primer Filo A: (atcggaatttttctttctcatt, SEQ ID NO: 1), 1 µM Primer Filo B: (atgtggtgggttataataatcactgacatg, SEQ ID NO: 2) und 0,4 µl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe). Dem Reaktionsvolumen von 18 ul wurden noch 2 µl RNA- Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt. Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10 Zyklen: 95°C für 5 Sekunden, 60°C für 5 Sekunden (Temperaturdekrement 1°C/Zyklus), 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5 Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
  • Durchführungsprotokoll für Lassa-Virus
  • Eine Reaktion enthielt 10 µl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 µg Rinderserumalbumin (BSA, Fa. Sigma, München), 2,5 mM Magnesiumsulfat, 300 µM Primer 36E2: (accggggatcctaggcattt, SEQ ID NO: 3), 1 µM Primer 80F2: (atataatgatgactgttgttctttgtgca, SEQ ID NO: 4), und 0,4 µl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe). Dem Reaktionsvolumen von 18 ul wurden noch 2 µl RNA- Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt. Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10 Zyklen: 95°C für 5 Sekunden, 60°C für 5 Sekunden (Temperaturdekrement 1°C/Zyklus), 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5 Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
  • Beispiel 1 Hemmung der Taq DNA-Polymerase
  • Um zu zeigen, daß in der RT-PCR die RT, nicht jedoch die Taq DNA- Polymerase gehemmt wird, wurden Amplifikationen einer geringen Menge von Lassa DNA, die kloniert in einem Plasmid vorlag, unter Verwendung einer Taq Polymerase durchgeführt. Fig. 3 zeigt das Ergebnis des Versuches. Wie der Figur zu entnehmen ist, wurde die Taq DNA-Polymerase in Gegenwart von SYBR®Green I in einer Konzentration von 0,001% nicht gehemmt.
  • Beispiel 2 Hemmung der RT-PCR durch SYBR®Green I
  • Um eine Hemmung der RT-PCR durch SYBR®Green I zu demonstrieren, wurden absteigende Mengen in vitro transkribierter Ebola RNA mit der oben unter "Material und Methoden" zitierten, für Ebola anwendbaren einstufigen RT-PCR amplifiziert, und der Reaktion wurde SYBR®Green I zugesetzt. Die Menge an DMSO, welches als Trägerlösung von SYBR®Green I notwendig war, wurde dabei konstant gehalten. Fig. 4 zeigt das Ergebnis des Versuchs. Es ließ sich feststellen, daß eine Konzentration von 0,001% SYBR®Green I die RT-PCR inhibiert, die PCR hingegen nicht beeinflußt.
  • Beispiel 3 Immobilisierung von SYBR®Green I
  • Es wurde ferner überprüft, ob die Hemmung der RT durch SYBR®Green I dadurch vermieden werden kann, daß der Farbstoff zu Beginn der RT-PCR vom eigentlichen Reaktionsvolumen getrennt wird. Zum Zeitpunkt, an dem die eigentliche Reverse Transkription abläuft, wird der Farbstoff noch nicht für eine Detektion benötigt. Um eine physikalische Trennung zu erreichen, wurde die benötigte Menge an Farbstoff (0,001% entsprechend) in 1 µl DMSO gelöst, und dieses Volumen wurde am Boden von LightCycler®-Reaktionsgefäßen bei einer Temperatur von -20°C festgefroren. Durch den hohen Schmelzpunkt von DMSO (18,45°C) blieb es dort während des gesamten Ansatzprozesses der RT-PCR fixiert und wurde erst beim Erwärmen des Reaktionsansatzes auf die Reaktionstemperatur der Reversen Transkriptase (50°C) freigesetzt. Um die Auswirkungen dieses Verfahrens auf die Sensitivität der RT-PCR zu untersuchen, wurden Amplifikationen von Lassa RNA in vitro-Transkript in einer Verdünnungsreihe unter den beschriebenen Bedingungen sowie in Parallelansätzen unter normalen Bedingungen durchgeführt.
  • Fig. 5 zeigt das Ergebnis der Amplifikationen. Fig. 6 zeigt die gleichzeitige Detektion der letzten Stufen der amplifizerten RNA- Verdünnungsreihe des Ansatzreihe A im LightCycler®.
  • Es bestand kein Unterschied zwischen beiden Ansatzreihen im Hinblick auf die Sensitivität. In beiden Ansatzreihen konnten 200 Kopien Lassa RNA nachgewiesen werden, wobei die Immobilisierung von SYBR®Green I gleichzeitig eine real-time Quantifizierung des Produkts erlaubte. Die Diffusionszeit des DMSO in Ansatzreihe A war offenbar lang genug, um eine effiziente Funktion der Reversen Transkriptase zu ermöglichen.
  • Beispiel 4 Immobilisierung des Farbstoffs an ein Oligonukleotid
  • Da die in Beispiel 3 beschriebene Immobilisierungsmethode hinsichtlich der Vorbereitung relativ aufwendig ist, wurde versucht, SYBR®Green I an ein partiell doppelsträngiges DNA-Oligonukleotid zu binden. Dabei wurde ausgenutzt, daß SYBR®Green I spezifisch an doppelsträngige DNA, praktisch jedoch nicht an einzelsträngige DNA bindet. Es wurde ein Haarnadel-Oligonukleotid hergestellt, welches eine Stamm-Schleife-Struktur aufweist. Die Stamm- Schleife-Struktur wies einen Schmelzpunkt auf, der zwar über der Arbeitstemperatur der Reversen Transkriptase, jedoch unter der Extensionstemperatur der PCR lag. Auf diese Weise sollte SYBR®Green I während der Reversen Transkription immobilisert vorliegen, während der PCR jedoch für die Detektion zur Verfügung stehen. Das Oligonukleotid erhielt die Bezeichnung SGS1 (SGS für "SYBR®Green Suppressor"). Die Sequenz von SGS1 ist im Sequenzprotokoll unter SEQ ID NO: 5 wiedergegeben, die Struktur ist in Fig. 7 dargestellt.
  • Es wurden aufsteigende Konzentrationen von SGS1 mit einer konstante Menge von 0,001% (v/v) SYBR®Green I versetzt, und die resultierende Fluoreszenz wurde bei einer Temperatur von 50°C gemessen. Fig. 8 zeigt die Bindung von SYBR®Green I an SGS1. Es ließ sich ein deutlich konzentrationsabhängiger Bindungseffekt mit Sättigungskinetik feststellen.
  • Beispiel 5 SGS1 in der RT-PCR und Modifikation von SGS1
  • Um in der RT-PCR als SYBR®Green I-Immobilisator zu fungieren, durfte das SGS1-Molekül nicht mit der RT-PCR interferieren. Es wurden etwa 10 000 Moleküle Ebola RNA in vitro-Transkript in Gegenwart von aufsteigenden Konzentrationen SGS1 (ohne SYBR®Green I-Zusatz) amplifiziert. Wie Fig. 9 zeigt, wirkte SGS1 bereits in einer Konzentration von 50 nM hemmend auf die RT-PCR.
  • Beispiel 6 Herstellung und Bindungskinetik von SGS3
  • Es wurde versucht, die starke Interferenz des Oligonukleotids mit der RT-PCR durch Modifikationen des Moleküls zu beseitigen, die die Adsorption des Farbstoffs möglichst unbeeinflußt lassen sollten. Um eine Extension des SGS1 in der PCR zu verhindern, wurde die 3'-OH des SGS1 durch eine Phosphatgruppe ersetzt. Weiterhin wurde die Loop-Region des SGS1 durch ein abasisches ssDNA-Segment ersetzt, um unspezifische DNA-Bindung in diesem Bereich zu verhindern. Die erhaltene Sequenz erhielt die Bezeichnung SGS3. Die durch das abasische ssDNA-Segment verbundenen Oligonukleotidabschnitte von SGS3 sind in SEQ ID NO: 6 und 7 wiedergegeben, die Struktur ist in Fig. 2 gezeigt. Die Bindungskinetik von SGS3 entsprach der von SGS1 (siehe Beispiel 4) und ist hier nicht gesondert dargestellt.
  • Beispiel 7 SGS3 in der RT-PCR
  • Das in Beispiel 5 beschriebene Experiment wurde unter Verwendung des Oligonukleotids SGS3 wiederholt. Fig. 10 zeigt, daß der Inhibitionseffekt erst bei einer Konzentration von 100 nM SGS3 pro Reaktion auftritt.
  • Beispiel 8 Immobilisierung von SYBR®Green I an SGS3 in der RT- PCR
  • Um die Immobilisierung von SYBR®Green I an SGS3 sowie dessen Freisetzung zur Detektion während der RT-PCR zu überprüfen, mußte die optimale Konzentration von SGS3 ermittelt werden, die das SYBR®Green I noch effizient bindet, die Reaktion jedoch unbeeinflußt läßt. Es wurden Amplifikationen von etwa 109 Kopien Ebola RNA in vitro-Transkript in Gegenwart von aufsteigenden Konzentrationen SGS3 durchgeführt. Diese hohe RNA Menge wurde ausgewählt, um die Reversion der Inhibition durch unterschiedliche Konzentrationen SGS3 zu untersuchen. Die Konzentration von SYBR®Green I betrug dabei konstant 0,001% v/v. Die Positivkontrolle (Spur 6) enthielt weder SGS3 noch SYBR®Green I.
  • Fig. 11 zeigt das Ergebnis der Amplifikationsreaktionen. Insbesondere zeigt Spur 1, daß die gewählte Konzentration des Farbstoffs die Amplifikation auch höchster Mengen an RNA (Spur 1, 109 Kopien pro Reaktion) vollständig inhibiert. Wie Fig. 11 ferner zu entnehmen ist, war eine Konzentration von 50 nM SGS3 dazu geeignet, die Inhibition aufzuheben. Dabei waren höhere und niedrigere Konzentrationen des Oligonukleotids suboptimal, entweder durch SGS-bindingte PCR-Interferenz (siehe Beispiel 7) oder durch mangelnde SYBR®Green I-Immobilisierung.
  • Beispiel 9 Vergleich der Sensitivität des erfindungsgemäßen Verfahrens mit einer konventionellen, maximal optimierten, einstufigen RT-PCR
  • Zur weiteren Verbesserung der Sensitivität des erfindungsgemäßen Verfahrens wurde das thermische Amplifikationsprofil der Reaktion dahingehend modifiziert, daß das an SGS3 gebundene SYBR®Green I erst zur Detektionstemperatur jedes Zyklus freigesetzt wurde. Der Schmelzpunkt der Stamm-Schleife-Struktur von SGS3 war zuvor experimentell ermittelt worden und betrug 72°C, d. h. oberhalb von 72°C wird SYBR®Green I aus der Bindung an das Oligonukleotid freigesetzt. Im Thermocycler-Profil wurde der Extensionsschritt von 72°C auf 65°C abgesenkt, um auch während der Arbeitstemperatur der DNA-Polymerase den Farbstoff in der Oligonukleotidbindung zu halten. Anschließend wurde die Detektionstemperatur von 72°C auf 82°C erhöht, um eine maximale Freisetzung von SYBR®Green I während der Detektion zu gewährleisten. Dies hatte gleichzeitig den Vorteil, daß unspezifische Nebenprodukte der PCR, wie Primer- Dimere, deren Schmelztemperatur immer unter 80°C lag (empirischer Wert, gilt für fast jede RT-PCR), nicht unerwünscht mitdetektiert wurden. Zum Sensitivitätsvergleich wurde eine Verdünnungsreihe Ebola RNA in vitro-Transkript in einer konventionellen, mit diesem Thermoprofil maximal optimierten, einstufigen RT-PCR ohne Möglichkeit der real-time-Quantifizierung wie unter Routmetestbedingungen amplifizert. Die gleichen Proben wurden unter den gefundenen Bedingungen (0,001% SYBR®Green I, 50 nM SGS3) bei sonst gleicher Formulierung der Reaktionsansätze amplifiziert. Dabei wurde in diesen Proben gleichzeitig die Fluoreszenz während der Reaktion gemessen. Wie aus Fig. 12 ersichtlich, ist die Sensitivität beider Verfahren annähernd gleich. Fig. 13 zeigt die entsprechende real-time Fluoreszenzkinetik, die während der Reaktion erhoben wurde. Es sind extrem regelmäßige Log-Stufen Abstände sichtbar, wie sie erfahrungsgemäß sonst nur mit Hilfe von Sondendetektion zu erzielen sind.
  • Beispiel 10 Schmelzpunktanalyse
  • In der Schmelzkurvenanalyse wird folgendes Temperaturprofil durchlaufen: 95°C für 10 Sekunden (zum Schmelzen aller in der Reaktion befindlichen Doppelstränge), 60°C für 20 Sekunden (zur Rehybridisierung aller in der Reaktion befindlichen Doppelstränge, langsames Aufheizen (0,1°C/Sekunde) mit kontinuierlicher Fluoreszenzmessung zur Ermittlung der Schmelztemperatur (d. h., der Temperatur, bei der die Doppelstränge schmelzen, Sybr®Green in Lösung geht und somit nicht mehr emittiert). Fig. 13 zeigt die dabei erhobene Fluoreszenz (y-Achse) in Abhängigkeit von der Temperatur. Die in Fig. 14 errechnete negative erste Ableitung des Signals ergibt die dargestellten Schmelzpeaks (Punkt der maximal negativen Steigung der Fluoreszenzreversion). Dieser Punkt entspricht der Temperatur, zu der 50% aller Doppelstränge in den einzelsträngigen Zustand übergehen ("Schmelzpunkt").
  • Fig. 14 zeigt das Ergebnis der Schmelzpunktanalyse von SGS3. Es läßt sich ein sehr scharf definierter spezifischer Schmelzpunkt bei 85°C nachweisen. Der Schmelzpunkt in der Negativkontrolle liegt bei ca. 77°C und entspricht einem Primer-Dimer, das auf Grund der oben erläuterten erhöhten Detektionstemperatur nicht in der real-time Kinetik erfaßt wird. Dies wäre auch für die Quantifizierung störend.
  • Beispiel 11 Übertragbarkeit des Verfahrens auf andere Viren
  • Das oben beschriebene Verfahren (insbesondere Kombination der angegebenen Konzentrationen an SGS3 und SYBR®Green I mit dem modifizierten PCR-Profil) wurde u. a. erfolgreich in folgende einstufiger RT-PCR Verfahren implementiert:
    Lassa RT-PCR;
    Ebola RT-PCR;
    LCMV RT-PCR;
    HIV-1 RT-PCR.
  • Legende der Figuren
  • Fig. 1 Fluoreszenz-Anregungs- und Fluoreszenz-Emissionsspektren von SYBR®Green I und SYBR®Gold
  • Fig. 2 Strukurskizze eines erfindungsgemäßen Haarnadelschleifen-Oligonukleotids am Beispiel des Moleküls SGS3. Einzelsträngiges abasisches Schleifensegment (20 Basen) und doppelsträngige Stammstruktur (24 Basenpaare). Das freie 3'-OH ist gegen eine Phosphatgruppe (P) ausgetauscht.
  • Fig. 3 Amplifikation einer geringen Menge Lassa cDNA (kloniert) mit einer normalen Taq DNA Polymerase. Spuren 1,4 und 7: ca. 2000 Kopien DNA; Spuren 3,6 und 9: ca. 20 Kopien DNA; Spuren 2,5 und 8: Wasser. A: 0,001% Sybr®Green, 5% DMSO; B: kein Sybr®Green, 5% DMSO; C: kein Sybr®Green, kein DMSO.
  • Fig. 4 Ebola RNA in-vitro Transkript (109-106 Kopien pro Reaktion) wurde mit (Reaktionen 6-10) und ohne (Reaktionen 1-5) 0,001% Sybr®Green in einer 1-Step RT-PCR amplifiziert. Sybr®Green hemmt in dieser Konzentration die RT-PCR, jedoch nicht die PCR (vgl. Fig. 3). Spuren 1 und 6: Negativkontrolle; Spuren 2 und 7: 109 Kopien pro Reaktion; Spuren 3 und 8: 108 Kopien pro Reaktion; Spuren 4 und 9: 107 Kopien pro Reaktion; Spuren 5 und 10: 106 Kopien pro Reaktion.
  • Fig. 5 Amplifikation einer Verdünnungsreihe Lassa-RNA in-vitro Transkript; die Menge an RNA Kopien pro Reaktion ist oben angegeben. A: Amplifikation in Gegenwart von 0,001% Sybr®Green, vor der Reaktion am Reagenzgefäßboden angefroren. Die Zahlen über den jeweiligen Gelspuren bezeichnen die Anzahl der RNA-Kopien pro Reaktion (ab 1000 Kopien in Exponentialschreibweise). B: Kontrollansatzreihe ohne Sybr®Green.
  • Fig. 6 Online-Fluoreszenzdetektion der Reihe A aus Fig. 5. Dargestellt sind der Übersicht wegen nur die letzten drei positiv detektierten Stufen der Verdünnungsreihe und die Negativkontrolle.
  • Fig. 7 Strukurskizze des Moleküls SGS1. Einzelsträngiges Schleifensegment (37 Basen Zufallssequenz), 30 Basenpaare doppelsträngige Stammstruktur. Das freie 3'-OH ist im Gegensatz zu SGS3 vorhanden.
  • Fig. 8 Bindung von Sybr®Green an SGS1. Die Reaktionen enthielten konstant 0,001% Sybr®Green und die unten angegebenen Konzentrationen an SGS1 in µM. Die Fluoreszenz wurde bei 50°C (RT-Temperatur) gemessen. >>>: Extremer Überschuß SGS1; -SGS: Kontrolle ohne SGS, mit 0,001% Sybr®Green; -SYBR: Kontrolle ohne Sybr®Green, aber mit 1600 nM SGS1.
  • Fig. 9 Amplifikation von ca. 10 000 Molekülen Ebola-RNA mit aufsteigender Konzentration SGS1 pro Reaktion, ohne Sybr®Green. Spur 1: Kein SGS; Spur 2: 50 nM; Spur 3: 100 nM; Spur 4: 200 nM; Spur 5: 400 nM; Spur 6: 800 nM; Spur 7: 1600 nM; Spur 8: 3200 nM
  • Fig. 10 Amplifikation von ca. 10 000 Molekülen Ebola-RNA mit angegebener Konzentration SGS3 pro Reaktion, ohne Sybr®Green. Im Vergleich zu der in Fig. 9 dargestellten Reaktion toleriert die Reaktion höhere Konzentrationen des modifizierten SGS-Moleküls.
  • Fig. 11 Amplifikation von 109 Kopien Ebola-RNA in-vitro Transkript in Gegenwart von 0,001% Sybr®Green und SGS 3 in den angegebenen Konzentrationen. 109 Kopien waren ohne SGS3 in Gegenwart dieser Sybr®Green-Konzentration nicht zu amplifizieren (vgl. Fig. 4). Spur 1: kein SGS3; Spuren 2-5: wie beschriftet; Spur 6: 106 Kopien Ebola- RNA ohne SGS3 und Sybr®Green (+Ctrl).
  • Fig. 12 Parallele 1-Step RT-PCR Amplifikation einer Ebola-RNA Verdünnungsreihe mit und ohne 50 nM SGS3/0,001% Sybr®Green. Spur 1: Negativkontrolle; Spuren 2 und 6: 106 Kopien RNA pro Reaktion; Spuren 3 und 7: 105 Kopien RNA pro Reaktion; Spuren 4 und 8: 104 Kopien RNA pro Reaktion; Spuren 5 und 9: 103 Kopien RNA pro Reaktion.
  • Fig. 13 Zugehörige real-time Fluoreszenzkinetik zu Fig. 12. Dargestellt ist der Verlauf des Fluoreszenzsignals, das in den Reaktionen 1 bis 5 (siehe Beschriftung der Fluoreszenzverläufe, vgl. gleiche Positionsnummern in Fig. 12) während der Reaktion gemessen wurde. Das Bild entspricht dem üblichen Fluoreszenzverlauf einer real- time PCR.
  • Fig. 14 Schmelzkurvenanalyse der PCR-Produkte in Fig. 12/Fig. 13; Reaktionen 1 bis 5: hier gleiche Bezeichnung. Das Vorgehen ist im Beispiel Nr. 10 beschrieben. 1: Schmelzpeak in der negativen ersten Ableitung der direkt gemessenen Fluoreszenz bei 77,5°C, entsprechend einem Primer-Dimer Artefakt. Dies wird in der zur Quantifizierung herangezogenen Echtzeitkinetik (Fig. 13) nicht erfaßt, da die Fluoreszenz der Reaktion oberhalb von 77,5°C gelesen wird. 2-5: Reaktionen 2 bis 5 aus Fig. 12/Fig. 13. Deutlicher Schmelzpeak bei 85°C für das spezifische PCR-Produkt mit äußerst geringer Variabilität zwischen den Einzelreaktionen. SEQUENZPROTOKOLL



Claims (29)

1. Verfahren zur Durchführung einer Nukleinsäureamplifikaktion, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, die gebildete komplementäre DNA (cDNA) amplifiziert und die gebildeten Amplifikate sequenzunabhängig in Echtzeit detektiert, wobei man zur Detektion einen Farbstoff verwendet, der selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindet, dadurch gekennzeichnet, daß man den Farbstoff vor der reversen Transkription immobilisiert, um eine Hemmung der reversen Transkription zu vermeiden, man ihn vor der Amplifikation wieder freisetzt und damit zur Bindung an die Amplifikate zur Verfügung stellt, wobei man die Farbstoff-gebundenen Amplifikate qualitativ und/oder quantitativ nachweist.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, daß man den Farbstoff immobilisiert, indem man ihn in einem Lösungsmittel mit einem Schmelzpunkt im Bereich von 10°C bis 40°C löst und man die Farbstofflösung am Boden des Reaktionsgefäßes festfriert, wobei der Farbstoff durch die erhöhten Reaktionstemperaturen der reversen Transkription freigesetzt wird und in die Reaktionslösung diffundiert.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, daß das Lösungsmittel Dimethylsulfoxid (DMSO) ist.
4. Verfahren nach Anspruch 1, dadurch gekennzeichnet, daß man den Farbstoff immobilisiert, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden läßt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und man den Farbstoff freisetzt, indem man die Temperatur vor der Amplifikation erhöht, um ein einzelsträngiges Oligonukleotid zu bilden, an das der Farbstoff nicht mehr bindet.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, daß der Schmelzbereich des Oligonukleotids im Bereich von etwa 45°C bis etwa 85°C liegt.
6. Verfahren nach Anspruch 4 oder 5, dadurch gekennzeichnet, daß es sich bei dem Oligonukleotid um ein Haarnadelschleifen-Oligonukleotid handelt.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, daß das Oligonukleotid die allgemeine Struktur


aufweist, wobei das Molekül eine abasische Loop-Sequenz aufweist.
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, daß das Molekül ferner eine Phosphatgruppe anstelle der 3'-OH-Gtuppe aufweist.
9. Verfahren nach den Ansprüchen 6 bis 8, dadurch gekennzeichnet, daß das Oligonukleotid die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
10. Verfahren nach den Ansprüchen 1 bis 9, dadurch gekennzeichnet, daß man zur reversen Transkription ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase), Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT), Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT), Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen Ursprungs verwendet.
11. Verfahren nach den Ansprüchen 1 bis 10, dadurch gekennzeichnet, daß es sich bei Amplifikation der komplementären DNA (cDNA) eine Polymerasekettenreaktion (PCR) handelt.
12. Verfahren nach den Ansprüchen 1 bis 11, dadurch gekennzeichnet, daß man für die Polymerasekettenreaktion (PCR) eine oder mehrere DNA-Polymerase(n) aus der Gruppe bestehend aus Thermus aquaticus-Polymerase (Taq-Polymerase), Thermus flavus-Polymerase (Tfl-Polymerase), Thermotoga maritima- Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase) verwendet.
13. Verfahren nach den Ansprüchen 1 bis 12, dadurch gekennzeichnet, daß man den Farbstoff aus der Gruppe bestehend aus SYBR®Green I, SYBR®Green II und Ethidiumbromid auswählt.
14. Verfahren nach den Ansprüchen 12 und 13, dadurch gekennzeichnet, daß man zur Nukleinsäureamplifikation eine Kombination von MNuLV-RT und Taq-Polymerase verwendet und man als Farbstoff SYBR®Green I verwendet.
15. Oligonukleotid der allgemeinen Struktur


das eine abasische Loopsequenz aufweist und eine Phosphatgruppe anstelle der 3'-OH-Gruppe aufweist.
16. Oligonukleotid, dadurch gekennzeichnet, daß es die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
17. Oligonuleotid-Farbstoff-Komplex bestehend aus einem Oligonukleotid nach Anspruch 15 oder 16 und einem selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindenden Farbstoff.
18. Komplex nach Anspruch 17, dadurch gekennzeichnet, daß der Farbstoff SYBR®Green I, SYBR®Green II oder Ethidiumbromid ist.
19. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, daß es ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und einen Farbstoff, der selektiv an doppelsträngige DNA bindet, enthält.
20. Kit nach Anspruch 19, dadurch gekennzeichnet, daß die Schmelztemperatur des Oligonukleotids im Bereich von 45°C bis 85°C liegt.
21. Kit nach Anspruch 19 oder 20, dadurch gekennzeichnet, daß es sich bei dem Oligonukleotid um ein Haarnadelschleifen-Oligonukleotid handelt.
22. Kit nach Anspruch 21, dadurch gekennzeichnet, daß das Oligonukleotid die allgemeine Struktur


aufweist, wobei das Molekül eine abasische Loopsequenz und eine Phosphatgruppe anstelle der 3'-OH-Gruppe aufweist.
23. Kit nach den Ansprüchen 19 oder 20, dadurch gekennzeichnet, daß das Oligonukleotid die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
24. Kit nach den Ansprüchen 19 bis 23, dadurch gekennzeichnet, daß der Farbstoff SYBR®Green I, SYBR®Green II oder Ethidiumbromid ist.
25. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, daß es einen Oligonuleotid- Farbstoff-Komplex nach Anspruch 17 oder 18 enthält.
26. Kit nach den Ansprüchen 19 bis 25, dadurch gekennzeichnet, daß es Pin oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase), Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT), Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT), Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen Ursprungs zur Durchführung der reversen Transkription enthält.
27. Kit nach den Ansprüchen 19 bis 26, dadurch gekennzeichnet, daß es ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus aquaticus (Taq-Polymerase), Thermus flavus-Polymerase (Tfl-Polymerase), Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus- Polymerase (Pfu-Polymerase) zur Durchführung einer Polyerasekettenreaktion enthält.
28. Kit nach den Ansprüchen 19 bis 27, dadurch gekennzeichnet, daß es eine Kombination von MMuLV-RT und Taq-Polymerase und als Farbstoff SYBR®Green I enthält.
29. Kit nach den Ansprüche 19 bis 28, dadurch gekennzeichnet, daß es weitere Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation enthält, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate (sequenzunabhängig) in Echtzeit detektiert.
DE10150121A 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten Expired - Fee Related DE10150121B4 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE10150121A DE10150121B4 (de) 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10150121A DE10150121B4 (de) 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten
PCT/EP2002/010800 WO2003033732A2 (de) 2001-10-11 2002-09-26 Echtzeitdetektion von dna-amplifikationsprodukten

Publications (2)

Publication Number Publication Date
DE10150121A1 true DE10150121A1 (de) 2003-04-30
DE10150121B4 DE10150121B4 (de) 2005-12-01

Family

ID=7702130

Family Applications (1)

Application Number Title Priority Date Filing Date
DE10150121A Expired - Fee Related DE10150121B4 (de) 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten

Country Status (2)

Country Link
DE (1) DE10150121B4 (de)
WO (1) WO2003033732A2 (de)

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20040121335A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7226739B2 (en) 2001-03-02 2007-06-05 Isis Pharmaceuticals, Inc Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US20120122103A1 (en) 2003-09-11 2012-05-17 Rangarajan Sampath Compositions for use in identification of bacteria
US20030027135A1 (en) 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US7217510B2 (en) 2001-06-26 2007-05-15 Isis Pharmaceuticals, Inc. Methods for providing bacterial bioagent characterizing information
EP1578399A4 (de) 2002-12-06 2007-11-28 Isis Pharmaceuticals Inc Verfahren für die rasche identifikation von pathogenen bei tier und mensch
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US7312036B2 (en) * 2004-03-22 2007-12-25 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses
WO2005117270A2 (en) 2004-05-24 2005-12-08 Isis Pharmaceuticals, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
WO2006135400A2 (en) 2004-08-24 2006-12-21 Isis Pharmaceuticals, Inc. Methods for rapid identification of recombinant organisms
EP1869180B1 (de) 2005-03-03 2013-02-20 Ibis Biosciences, Inc. Zusammensetzung zur Verwendung bei der Identifikation von Polyomaviren
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
WO2007014045A2 (en) 2005-07-21 2007-02-01 Isis Pharmaceuticals, Inc. Methods for rapid identification and quantitation of nucleic acid variants
WO2008143627A2 (en) 2006-09-14 2008-11-27 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
WO2008104002A2 (en) 2007-02-23 2008-08-28 Ibis Biosciences, Inc. Methods for rapid forensic dna analysis
WO2008151023A2 (en) 2007-06-01 2008-12-11 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
EP2344893B1 (de) 2008-09-16 2014-10-15 Ibis Biosciences, Inc. Mikroplatten-handhabungssysteme und verfahren
EP2347254A2 (de) 2008-09-16 2011-07-27 Ibis Biosciences, Inc. Probenverarbeitungseinheiten, -systeme und damit verbundene verfahren
EP2396803A4 (de) 2009-02-12 2016-10-26 Ibis Biosciences Inc Ionisationssondenanordnungen
WO2011008971A1 (en) 2009-07-17 2011-01-20 Ibis Biosciences, Inc. Lift and mount apparatus
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
EP2957641B1 (de) 2009-10-15 2017-05-17 Ibis Biosciences, Inc. Multiple-displacement-amplifikation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891683A (en) * 1993-09-02 1999-04-06 Ribozyme Pharmaceuticals, Inc. Non-nucleotide containing enzymatic nucleic acid

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5430136A (en) * 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5824557A (en) * 1996-04-02 1998-10-20 Panvera Corporation Method for detecting and quantitating nucleic acid impurities in biochemical preparations

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891683A (en) * 1993-09-02 1999-04-06 Ribozyme Pharmaceuticals, Inc. Non-nucleotide containing enzymatic nucleic acid

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Internetdokument, Adresse www.alab.com.pl/pdf/life/10928034%20superscript%20one%20step%20rt-pcr%20 system%20with%20platinum.pdf zu: SuperScriptTM One-Step RT-PCR with Platinumî Taq [recherchiert am *
Internetdokument, Adresse www.qiagen.com/litera- ture handbooks/pcr/rt/1011390 rto 499.pdf zu: SensiscriptTM Reverse Transcriptase Handbook [recherchiert am 27.05.2002] (gutachtlich) *
Internetdokument, Adresse www.qiagen.com/litera- ture handbooks/pcr/rt/1011391 rto 499.pdf zu: OmniscriptTM Reverse Transcriptase Handbook [recherchiert am 27.05.2002] (gutachtlich) *
Internetdokument, Adresse www.qiagen.com/litera- ture/handbooks/pcr/RT_PCR_QT/1020027HB_RTPCR 032002.pdf, zu: QuantiTectTM SYBRî Green RT-PCR Handbook [rech. am 27.05.2002] (gutachtlich) *
Internetdokument, Adresse www.roche-applied- science.com/pack-insert/3064760a.pdf zu: LightCycler-RNA Master SYBR Green I [recherchiert am 27.05.2002] (gutachtlich) *

Also Published As

Publication number Publication date
WO2003033732A2 (de) 2003-04-24
DE10150121B4 (de) 2005-12-01
WO2003033732A3 (de) 2003-11-13

Similar Documents

Publication Publication Date Title
JP6480511B2 (ja) 試料中の核酸配列を定量するための組成物および方法
US9988660B2 (en) Compositions and methods for cDNA synthesis
DE69034232T2 (de) Primer und Kit für den Nachweis von Chlamydia trachomatis
EP0743367B2 (de) Verfahren zur Genexpressionsanalyse
TWI583695B (zh) 引子組與使用該引子組之標的核酸序列擴增方法及突變核酸檢測方法
EP2181196B1 (de) Nicking- und verlängerungs-amplifikationsreaktion zur exponentiellen amplifikation von nukleinsäuren
DE69827060T2 (de) Modifizierte Primer
JP3007477B2 (ja) 核酸増幅および検出のための均質的方法
DE69636658T2 (de) Verbesserte ortsspezifische mutagenese in circulärer dna
DE69531542T2 (de) Ligase/polymerase-vermittelte analyse genetischer elemente von einzelnukleotid-polymorphismen und ihre verwendung in der genetischen analyse
DE69837125T2 (de) Nachweis von Nukleinsäuren durch Aufhebung der Fluoreszenz
DE69816488T2 (de) Pcr-primerkonstruktionen für ein integriertes signalsystem
DE212017000062U1 (de) Verwendung zum Nachweis einer einzelsträngigen Target-RNA
CA2294470C (en) Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
DE69531133T2 (de) Verfahren zur Dämpfung der Fluoreszene in Lösung von Fluoreszenzmarkierten Oligonucleotidsonden
DE69725861T2 (de) Katalytische nukleinsäuren und deren medizinische verwendung
RU2149186C1 (ru) Способ обнаружения изменения длины олигонуклеотида, меченного светоиспускающей меткой
EP0597006B1 (de) Neues verfahren zur sequenzierung von nukleinsäuren
DE68915202T3 (de) Verfahren zur Vermehrung und zum Nachweis von Nukleinsäuresequenzen.
DE69034177T2 (de) Verfahren zur Amplifikation von Nukleinsäuresequenzen
DE69937223T2 (de) Verfahren zur synthese von nukleinsäuren
DE69233458T2 (de) Nukleinsäuretypisierung durch polymeraseverlängerung von oligonukleotiden unter verwendung von terminator-mischungen
EP0324474B1 (de) Verfahren zum Nachweis von Nukleinsäuren
US5639606A (en) Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
DE69334092T2 (de) Nachweis von Mycobacterium tuberculosis durch Vervielfältigung von Nukleinsäuresequenzen

Legal Events

Date Code Title Description
OP8 Request for examination as to paragraph 44 patent law
8364 No opposition during term of opposition
R119 Application deemed withdrawn, or ip right lapsed, due to non-payment of renewal fee

Effective date: 20110502