WO2003033732A2 - Echtzeitdetektion von dna-amplifikationsprodukten - Google Patents

Echtzeitdetektion von dna-amplifikationsprodukten Download PDF

Info

Publication number
WO2003033732A2
WO2003033732A2 PCT/EP2002/010800 EP0210800W WO03033732A2 WO 2003033732 A2 WO2003033732 A2 WO 2003033732A2 EP 0210800 W EP0210800 W EP 0210800W WO 03033732 A2 WO03033732 A2 WO 03033732A2
Authority
WO
WIPO (PCT)
Prior art keywords
polymerase
dye
oligonucleotide
pcr
reaction
Prior art date
Application number
PCT/EP2002/010800
Other languages
English (en)
French (fr)
Other versions
WO2003033732A3 (de
Inventor
Christian Drosten
Original Assignee
Bernhard-Nocht-Institut für Tropenmedizin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10150121.8 external-priority
Application filed by Bernhard-Nocht-Institut für Tropenmedizin filed Critical Bernhard-Nocht-Institut für Tropenmedizin
Publication of WO2003033732A2 publication Critical patent/WO2003033732A2/de
Publication of WO2003033732A3 publication Critical patent/WO2003033732A3/de

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

Die Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Amplifikaten. Ferner betrifft die Anmeldung partiell doppelsträngige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens.

Description

Echtzeitdetektion von DNA-Amplifikationsprodukten
Die vorliegende Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Aplifikationsprodukten. Ferner betrifft die Anmeldung partiell doppelstrangige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens .
Verfahren zur Amplifikation von Desoxyribonukleinsäuren (DNA) ermöglichen deren exponentielle Vervielfältigung und machen auch geringe Nukleinsäuremengen einem qualitativen oder quantitativen Nachweis bzw. weitergehenden Applikationen zugänglich. Verfahren zur Amplifikation von DNA sind im Stand der Technik bekannt und schließen beispielsweise die Polymera- sekettenreaktion (PCR) ein.
Durch den initialen Schritt einer Reversen Transkription (RT) lassen sich auch Ribonukleinsäuren (RNA) mittels DNA-Amplifikation vervielfältigen. In der Regel werden die Produkte solcher Amplifikationsverfahren nach Abschluß der Reaktion durch eine Endpunktanalyse bestimmt. Geeignete Verfahren zur qualitativen und/oder quantitativen Bestimmung von Amplifikationsprodukten sind im Stand der Technik hinreichend bekannt und umfassen beipielsweise photometrische Messmethoden oder die Analyse mittels Agarose-Gelelektrophorese.
Bei DNA-Amplifikationsverfahren wie der PCR ist es auch möglich, bereits während der Amplifikation der DNA die entsprechenden Produkte nachzuweisen. Der im Verlauf der PCR erfolgende Nachweis von PCR-Amplifikationsprodukten ermöglicht die Erhebung einer Reaktionskinetik, womit eine verläßliche Quantifizierung der in die PCR eingebrachten Menge an DNA verbunden ist (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193) . Dieses PCR- Verfahren mit Echtzeitdetektion der PCR-Produkte (auch "real- time PCR" genannt) ist seit mehreren Jahren etabliert und erfährt derzeit einen enormen Zuwachs hinsichtlich seiner Anwendungsgebiete, insbesondere in den Bereichen der molekula- ren Erregerdiagnostik und der Genexpressionsanalyse (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193) . Zum Nachweis des entstehenden PCR-Produktes während der Reaktion kommen dabei verschiedene technische Detektionsprinzipien zur Anwendung:
1. 5'-Nuklease PCR ("TaqMan-PCR")
Eine doppelt fluoreszenzmarkierte DNA-Sonde hybridisiert mit dem PCR-Produkt und wird durch die 5 ' -Nukleaseaktivitat der verwendeten DNA-Polymerase verdaut. Es kommt dabei zur physikalischen Trennung der beiden auf der Sonde befindlichen Fluorophore und zu einer detektierbaren Reversion eines Energietransferprozesses (Livak, K. et al. "Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization" PCR Methods Appl 4 (1995) 357-362).
2. Molecular Beacons
Diesem Verfahren liegt das gleiche Prinzip zugrunde, jedoch erfolgt die Reversion des Energietransfers hier über eine sterische Konformationsänderung in der Sekundärstruktur der Sonde, die durch den Hybridisierungsvorgang ausgelöst wird. Ein Verdau der Sonde ist nicht nötig (Tan, . et al. "Molecular beacons: a novel DNA probe for nucleic acid and protein studies" Chemistry 6 (2000) 1107-1111) .
3. Hybridization Probes
Bei diesem Verfahren beruht die Detektion auf einem Neuauftreten von Energietransfer, wenn zwei DNA-Sonden benachbart an einem DNA-Strang hybridisieren (Bernhard, P. B. und ittwer, C. T. "Homogenous amplification and variant detection by fluorescent hybridization probes" Clin Chem 46 (2000) 147-148) .
®
4. Sequenzunspezifischer Nachweis mit SYBR Green I
® SYBR Greenl ist ein unsymmetrischer Cyanin-Farbstoff, der un- abhängig von der Sequenz in doppelstrangige DNA (dsDNA) inter- kaliert, wobei der dsDNA-gebundene Farbstoff effizient bei ca.
488 nm und ca. 254 nm angeregt weden kann. Durch seine
® Thermostabilität ermöglicht SYBR Green I einen real-time
Nachweis von PCR-Produkten (Wittwer, C. T. et al. "Continuous fluorescence monitoring of rapid cycle DNA amplification"
Biotechniques 22 (1997) 130-138) . Zahlreiche unsymmetrische
Cyanin-Frabstoffe sind z.B. in US 5,436,134, US 5,658,751, WO
® ®
94/24213 und WO 96/13552 offenbart. Bei SYBR Green I und SYBR
Gold handelt es sich um interkalierende Farbstoffe mit außergewöhnlich hoher Affinität zu dsDNA. Interkalierende Farbstoffe besitzen die Eigenschaft, sich in die "Minor Groove" ("kleine Furche") von doppelsträngiger DNA einzulagern. Durch diese Bindung wird die Fluoreszenz bei gleicher Anregungs- intensität um ein vielfaches verstärkt, und man erhält ein Signal, dessen Intensität direkt proportional zu der Zahl der vorhandenen Doppelstränge ist. Der dsDNA-gebundene Farbstoff
® SYBR Green I besitzt eine Haupt-Anregungsbande bei 497 nm
(weitere Anregungsmaxima liegen bei etwa 290 nm und etwa 380
® nm) , das Emissionsmaximum des SYBR Green I-Nukleinsäure-
® komplexes liegt bei etwa 520 nm. SYBR Green I kann effizient bei ca. 488 nm und ca. 254 nm angeregt weden. Der dsDNA-
® gebundene Farbstoff SYBR Gold weist einen Haupt-Anregungsmaximum bei etwa 495 nm auf, ein weiterer Anregungspeak liegt
® bei etwa 300 nm, und das Emissionsmaximum des SYBR Gold-Nu- kleinsäurekomplexes liegt bei etwa 537 nm. Die Fluoreszenz-
® Anregungs- und Fluoreszenz-Emissionsspektren von SYBR Green I
® und SYBR Gold sind in Fig. 1 dargestellt.
Bei den unter 1. bis 3. oben genannten Verfahren sind sequenz- spezifische DNA-Detektionssonden erforderlich, deren Synthese aufwendig und teuer ist . Gleichzeitig muß in der nachzuweisenden Nukleinsäure zumindest der Bereich der Sondenbindungsstellen hochgrading konserviert sein. Ein Nachweis variabler Sequenzen ist mit Sonden nicht zuverlässig möglich.
In vielen Bereichen der Molekularbiologie, vor allem bei der Analyse von Genexpression und beim Nachweis von RNA-Viren wie HIV-1 oder HCV, ist die Amplifikation und Quantifizierung von RNA durch die PCR wünschenswert. Hierzu kann prinzipiell eine Reverse Transkription-Polymerasekettenreaktion (RT-PCR) mit Echtzeitdetektion (real-time RT-PCR) durchgeführt werden. Eine RT-PCR kann generell mittels zweier unterschiedlicher Verfahren erfolgen.
Bei der zweistufigen RT-PCR (2-Step RT-PCR) wird die zu quantifizierende RNA zunächst in einer separaten Reaktion mit Hilfe einer Reversen Transkriptase in komplementäre DNA (cDNA) transkribiert (Reverse Transkription) . Die entstandene cDNA wird im folgenden in einer PCR mittels einer hitzestabilen DNA- Polymerase (z.B. Thermus aquaticus Polymerase, Taq-Polymerase) amplifizert.
Bei der einstufigen RT-PCR (1-Step RT-PCR) erfolgen Reverse Transkription und Amplifikation unmittelbar hintereinander in derselben Reaktion. Diese Variante bietet drei wesentliche Vorteile: (i) deutlich höhere analytische Präzision in der Quantifizierung durch Wegfall eines Pipettierschrittes; (ii) verringerte Kontaminationsgefahr in der qualitativen Diagnostik durch weniger Manipulationsschritte (Kwok, S. und Higuchi, R. "Avoiding false positives with PCR" Nature 339 (1989) 237-238) ; (iii) erhöhte Sensitivität in beiden Anwendungsbereichen durch Wegfall eines Verdünnungsfaktors zwischen RT und PCR.
Sowohl bei der einstufigen als auch die zweistufigen RT-PCR kann im Rahmen der Amplifikation der cDNA eine Echtzeitdetektion der Amplifikationsprodukte durchgeführt werden.
Die Durchführung von einstufigen RT-PCR Reaktionen kann mit Hilfe einer einzelnen Thermus thermophilis Polymerase (Tth- Polymerase) oder mittels Enzymkombinationen erfolgen. Die Tth Polymerase ist eine DNA Polymerase aus dem thermophilen Bakterium Thermus thermophilis, die eine außergewöhnlich hohe Reverse Transkriptase-Nebenaktivität besitzt. Dadurch kann eine einstufige RT-PCR mit nur einem Enzym realisiert werden. Zur Entwicklung einer maximalen RT-Aktivität bei Verwendung der Tth-Polymerase müssen dabei die physiologischerweise in der Reaktion verwendeten Magnesiumionen durch Manganionen ersetzt werden. Nachteilig wirkt sich aber aus, daß RNA in Gegenwart von Manganionen degradiert wird (Carninci, P. et al. "Thermo- stabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of füll length cDNA. Proc. Natl. Acad. Sei. USA 95 (1998) 520-524) . Dies erklärt die generell limitierte Sensitivität dieses Verfahrens.
Durch Optimierung der Pufferbedingungen ist es auch möglich, Reverse Transkriptase und Taq DNA-Polymerase in derselben Reaktion zu verwenden. Diese Verfahrensvariante ermöglicht eine hohe Sensitivität und wird daher in der qualitativen Diagnostik zum Erregernachweis bevorzugt. Die verwendeten Reversen Trans- kriptasen stammen dabei aus den beiden Retroviren Moloney Murine Leukemia Virus (MMuLV) oder Avian Myeloma Mirus (AMV) .
Der Nachweis hochvariabler RNA-Viren stellt einen Kernanwendungsbereich der RT-PCR in der Molekulardiagnostik dar. Insbesondere Humanes Immundefizienz Virus-1 (HIV-1) und Hepatitis C Virus (HCV) müssen quantitativ nachgewiesen werden, etwa um die Viruslast bei Patienten unter Therapie zu beobachten. Aus dem Ergebnis dieses Nachweises ergeben sich direkte Therapieindikationen. Auch der quantitative Nachweis anderer variabler RNA-Viren, wie etwa des Lassavirus, kann über eine Prognose und das Ansprechen der Therapie Auskunft geben. Beim Nachweis hochvariabler Viren (d.h. Viren, bei denen es im Verlauf einer Infektion zu Änderungen der viralen Nukleinsäuresequenzen kommt, sogen. "Viusvariabilität") stellt sich insbesondere das oben angesprochene Problem der Nachweisbarkeit mit Sonden. Soll die PCR mit Echtzeitdetektion zur Quantifizierung dieser Viren ausgenutzt werden, müssen Sondenbindungsstellen identifiziert werden, die konserviert sind. Dies ist bei vielen der angesprochenen Viren jedoch nur eingeschränkt oder gar nicht möglich. Eine Alternative zur Verwendung von Sonden stellt die sequenz- unabhängige Detektion mit Hilfe von DNA-bindenden Farbstoffen
® wie SYBR Green I (s.o.) dar. Dieses Verfahren ist zum gegen- wärtigen Zeitpunkt noch nicht zufriedenstellend realisiert, da die retroviralen Reversen Transkriptasen, die in der
® Erregerdiagnostik eingesetzt werden, extrem stark durch SYBR
Green I gehemmt werden, und zwar bereits bei relativ niedrigen
Konzentrationen, die für eine Detektion gerade noch ausreichen (0,001% v/v). Dieser Umstand erzwingt eine Trennung von
Reverser Transkription und PCR mit den bereits erwähnten
Nachteilen. Das heißt, eine einstufige RT-PCT (1-Step RT-PCR) ist bislang unter Verwendung retroviraler Reverser
Transkriptasen nur sehr eingeschränkt möglich.
® Da DNA-Polymerasen durch SYBR Green I nicht gehemmt werden, kann eine einstufige RT-PCR mit Tth DNA-Polymerase in Gegenwart
® von SYBR Green I jedoch durchgeführt werden, indem man die
Reverse Transkriptase-Nebenaktivität der Tth Polymerase ausnutzt.
Tth Polymerase-enthaltende einstufige RT-PCR-Systeme für
® Detektionen mit SYBR Green I sind im Stand der Technik bekannt
(Fa. Röche) ; sie weisen jedoch den bereits erwähnten Nachteil einer geringen Sensitivität auf.
Aufgabe der vorliegenden Erfindung ist es daher, ein Echtzeit- Detektionsverfahren bereitzustellen, bei dem man in einer einstufigen Reaktion RNA zunächst revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert, und man die DNA-Amplifikationsprodukte (DNA-Amplifikate) sequenzunabhängig detektiert, wobei Effizienz und Sensitivität des zur Reversen Transkription verwendeten Enzyms nicht oder nicht signifikant beeinflußt werden. Insbesondere ist es Aufgabe der Erfindung ein sensitives 1-Step RT-PCR-Verfahren mit (vorzugsweise sequenzunabhängiger) Echtzeit-Detektion der Amplifikate bereitzustellen. Vorzugsweise weist dieses Verfahren eine Sensitivität auf, die es erlaubt weniger as 1000 Kopien eines RNA-Moleküls nachzuweisen.
Die Aufgabe wird erfindungsgemäß durch ein Verfahren zur Durchführung einer Nukleinsäureamplifikaktion gelöst, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, man die gebildete komplementäre DNA (cDNA) amplifiziert und man die gebildeten Amplifikate sequenzunabhängig in Echtzeit detek- tiert, wobei man zur Detektion einen thermostabilen Farbstoff verwendet, der selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindet. Um eine Hemmung des Enzyms, das die reverse Transkription katalysiert, zu vermeiden, wir der Farbstoff vor der reversen Transkription immobilisiert. Vor der Amplifikation wird der Farbstoff wieder freigesetzt, damit er zur Bindung an die Amplifikate zur Verfügung steht. Die Farbstoff-gebundenen Amplifikate werden erfindungsgemäß qualitativ und/oder quantitativ nachgewiesen.
Unter einem selektiv an dsDNA bindenden Farbstoff wird vorliegend ein Farbstoff verstanden, der ausschließlich oder überwiegend an doppelstrangige DNA, jedoch nicht oder nur in geringem Umfang an einzelsträngige DNA (ssDNA) bindet.
Die wesentlichen Vorteile des erfindungsgemäßen Verfahrens bestehen darin, daß das Verfahren gegenüber bislang bekannten Verfahren zur Amplifikation von Nukleinsäuren mit Echtzeitdetektion eine höhere Sensitivität aufweist, die der eines optimierten Verfahrens, wie beispielsweise einer RT-PCR ohne Echtzeitdetektion der entstehenden PCR-Produkte, entspricht. Gleichzeitig erlaubt das vorliegende Verfahren einen sequenzunabhängigen Erregernachweis, d.h. eine Detektion der Amplifikate ohne die Notwendigkeit sequenzspezifischer DNA- Sonden. Die Unsicherheit von im Stand der Technik eingesetzten Sondendetektionsverfahren bei hochvariablen Sequenzen wurde eingangs bereits ausführlich erläutert . Basenfehlpaarungen an der Sondenbindungsstelle können nicht nur zu falschen Ergebnissen bei der Quantifizierung führen, sondern im Extremfall können sich falsch negative Testergebnisse ergeben (beispielsweise beim diagnostischen Nachweis von HIV oder hämorrhagisehen Fieberviren) . Ferner sind die Kosten für eine Echtzeitdetektionssonde relativ hoch. Sie belaufen sich für einen kleinen Synthesemaßstab (ausreichend für ca. 1000 Reaktionen) derzeit auf etwa DM 500,- bis DM 1000,-. Auch erlaubt eine Sonde immer nur die Quantifizierung einer einzigen Zielsequenz. Sollen also für Expressionsstudien etwa 20 bis 30 verschiedene zelluläre RNA-Spezies untersucht werden, kostete eine solche Untersuchung etwa DM 14000,- bis DM 21000,-. Diese Kosten übersteigen die finanziellen Möglichkeiten der meisten institutionellen bzw. universitären Arbeitsgruppen.
Demgegenüber erlaubt das erfindungsgemäße Verfahren die Herstellung eines universellen Detektionsreagenz-Kits, das ein teilweise doppelsträngiges Oligonukleotid und einen thermostabilen, für dsDNA selektiven Farbstoff umfasst. Die Kosten sind Vergleich zu einer Sondendetektion äußerst niedrig. Gleich- zeitig kann aufgrund des Verzichts auf sequenzspezifische Sonden jede beliebige Zielsequenz bestimmt werden, da die Detektion sequenzunabhängig, d.h. unabhängig von einer bestimmten Nukleotidsequenz innerhalb des zu amplifizierenden Sequenzbereichs, erfolgt.
Im Rahmen der vorliegenden Erfindung wird unter "Reverser Transkription" (RT) eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem RNA als Matritze für die Bildung komplementärer DNA (cDNA) verwendet wird. Der Vorgang der cDNA- Synthese kann dabei von einer RNA-abhängigen DNA-Polymerase katalysiert werden, die vorliegend auch als "Reverse Trans- kriptase" bezeichnet wird.
Die entstandene cDNA dient einer nachfolgenden Amplifikationsreaktion als Ausgangsmolekül (Templat) . Bei der zur Vermehrung der cDNA angewendeten Amplifikationsreaktion handelt es sich vorzugsweise um eine Polymerase-Ketten-Reaktion (PCR) , es ist jedoch auch denkbar, die Amplifikation mit Hilfe einer NASBA ("nucleic acid sequence based amplification" ,- Vandamme, A.M. et al. "Detection of HIV-1 RNA in plasma and serum samples using the NASBA amplification System compared to RNA-PCR" . J. Virol . Methods 52 (1995) 121-132) oder einer TMA ( "transcription mediated amplification" ; Pasternack, R. et al. "Evaluation of the Gen-probe Chlamydia trachomatis transcription-mediated amplification assay with urine specimens from women" J. Clin. Microbiol. 35 (1997) 676-678) durchzuführen.
Erfolgt die Amplifikation mit Hilfe einer PCR, so entspricht die gesamte erfindungsgemäße Amplikationsreaktion einer RT-PCR. Eine RT-PCR ist grundsätzlich als einstufige oder zweistufige Reaktion durchführbar.
Im Rahmen der vorliegenden Erfindung wird unter dem Begriff "einstufige Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation unmittelbar hintereinander in demselben Reaktionsansatz erfolgen, ohne daß das Reaktionsgefäß, in dem der Reaktionsansatz enthalten ist, im Verlauf der Reaktion geöffnet werden muß, um weitere Reaktionskomponenten zuzufügen.
Im Gegensatz dazu wird unter einer "zweistufigen Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation hintereinander in zwei verschiedenen Reaktionsansätzen erfolgen. Dazu wird in der Regel zunächst eine Reverse Transkription in einem kleinen Reaktionsvolumen durchgeführt, in dem die Bedingungen der für die Reverse Transkription optimal eingestellt werden können. Nach Abschluß der reversen Transkription wird der gesamte Ansatz oder ein Teil desselben in eine Amplifikationsreaktion eingesetzt. Der Nachteil dieser Vorgehensweise besteht in einem erhöhten Kontaminationsrisiko sowie einer deutlich geringeren analytischen Präzision durch zusätzliche Pipettierschritte. Dieser Nachteil wird durch das erfindungsgemäße Verfahren vermieden.
Im Rahmen der vorliegenden Erfindung können die beiden enzymatischen Reaktionen (Reverse Transkription und Amplifikation) von jeweils einer oder von mehreren im Reaktionsansatz enthaltenen Enzymen katalysiert werden.
Die im Rahmen der Erfindung vewendeten Farbstoffe sind thermostabil. Der Begriff "thermostabil" bezeichnet vorliegend die Eigenschaft der Farbstoffe, auch bei den durch das thermische Amplifikationsprofil bedingten hohen Temperaturen funktionstüchtig zu bleiben. Die Farbstoffe sind auch bei
Detektionstemperaturen von über 80°C in der Lage, an doppelstrangige DNA zu binden. Durch Erhitzen auf Temperaturen von über 90°C darf außerdem keinerlei irreversible Strukturänderung des Farbstoff-Moleküls erfolgen, der eine nachträgliche Beeinträchtigung der Fuhktonalität bei einer für die Detektion übliche Temperatur zur Folge hat.
Der zur Detektion verwendete Farbstoff bindet selektiv an doppelstrangige DNA. Unter "selektiv binden" wird dabei die Eigenschaft der Farbstoffe verstanden, mit deutlich höherer Affinität an doppelstrangige DNA zu binden als an einzelsträngige DNA. So bindet beispielsweise der erfindungsgemäß geeignete Farbstoff Ethidiumbromid zwar nicht ausschließlich an doppelstrangige DNA, sondern auch in geringem Maße an einzelsträngige DNA, doch ist die Affinität des verwendeten Farbstoffs zu doppelsträngiger DNA um ein Vielfaches höher als die Affinität zu einzelsträngiger DNA. Die erfindungsgemäß geeigneten Farbstoffe umfassen sowohl selektiv an dsDNA bindende Moleküle, die entweder allein oder als Farbstoff-Nukleinsäure-Komplex qualitativ und/oder quantitativ nachweisbar sind.
Ein erfindungsgemäß bevorzugter Farbstoff ist der unsymmetri-
® sehe Cyaninfarbstoff SYBR Green I.
® Der Nachweis von Farbstoffen wie SYBR Green oder Ethidiumbromid kann beispielsweise über eine Fluoreszenzmessung erfolgen.
Die Bindung des Farbstoffs an die DNA kann auf verschiedene Mechanismen zurückzuführen sein. Es kann sich um eine kovalente Bindung oder eine nicht-kovalente Interaktion zwischen den Farbstoff-Molekülen und den doppeisträngigen DNA-Molekülen handeln. So werden gemäß einer erfindungsgemäß bevorzugten Ausführungsform beispielsweise interkalierende Farbstoffe verwendet, die in die Zwischenräume benachbarter Basenpaare einer Nukleinsäuresequenz eindringen. Derartige Farbstoffe sind
® dem Fachmann gut bekannt und umfassen u.a. SYBR Green und
Ethidiumbromid. Die Bindung dieser Farbstoffe beruht auf einer
Wechselwirkung der aromatischen Ringsysteme mit den planaren
Heterocyclen der Nukleinsäure-Basen.
Gemäß einer bevorzugten Ausführungsform der Erfindung wird der
® ®
Farbstoff aus der Gruppe bestehend aus SYBR Green I, SYBR Green
II und Ethidiumbromid ausgewählt. Ferner sind die Farbstoffe
PicoGreen (vgl. E.L. Romppanen et al . , Anal. Biochem. 279
(2000) 111-114), Y0-PR0-1 (vgl. I.D. Johnson et al., Biophys . J. 61 (1992) A314, Abstract Nr. 1806), YOYO-1 (H.S. Rye et al.,
Anal. Biochem. 208 (1993) 144-150) und Hoechst 33258 (4- [5- (4-
Methyl-1-piperazinyl) [2,5' -bis-lH-benzimidazol] -2 ' -yl] -phenol- trihydrochlorid; Chemical Abstracts Registry Nr. 23491-45-4; vgl. R. Rago et al., Anal. Biochem. 191 (1990) 31-34) geeignet. Im Rahmen der vorliegenden Erfindung wird der Farbstoff vor der
Reversen Transkription immobilisiert. Gemäß einer bevorzugten
Ausführungsform erfolgt das Immobilisieren, indem man den Farbstoff in einem Lösungsmittel mit einem Schmelzpunkt im
Bereich von 10°C bis 40°C löst und man die Farbstofflösung am Boden des Reaktionsgefäßes "festfriert" . das Festfrieren kann in handelsüblichen Behältnissen, wie beispielsweise PCR- Reaktionsbehältern erfolgen. Dabei wird der Farbstoff durch die erhöhten Reaktionstemperaturen der Reversen Transkription freigesetzt und diffundiert in die Reaktionslösung. Die Diffusionsgeschwindigkeit der Farbstofflösung ist ausreichend gering, um während der Reversen Transkription das Enzym, welches diesen Reaktionsschritt katalysiert, nicht oder nicht wesentlich zu inhibieren.
Gemäß einer besonders bevorzugten Ausführungsform der Erfindung handelt es sich bei dem Lösungsmittel um Dimethylsulfoxid
(DMSO) , welches einen Schmelzpunkt von 18,45°C aufweist.
Gemäß einer weiteren Ausführungsform der Erfindung immobilisiert man den Farbstoff, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden läßt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur aber unterhalb der zur
Detektion von PCR-Produkten geeigneten Temperatur (80-90°C) liegt. Der Farbstoff wird dadurch freigesetzt, daß man die Temperatur vor bzw. zur Durchführung der Amplifikation erhöht. Dabei wird aus dem doppelsträngigen Oligonukleotid, an das der Farbstoff vor der Reversen Transkription gebunden war, ein einzelsträngiges Oligonukleotid gebildet, an das der Farbstoff nicht mehr bindet.
Als "Oligonukleotide" werden vorliegend einzelsträngige DNA- Moleküle bezeichnet, die vorzugsweise eine Länge von etwa 10 bis 500 Basenpaaren aufweisen.
Unter einem "zumindest teilweise doppelsträngigen Oligonukleotid" versteht man im Rahmen der vorliegenden Erfindung ein (einzelsträngiges) Oligonukleotid, bei dem zumindest bestimmte Bereiche durch intramolekulare Basenpaarung als DNA-Doppelstrang vorliegen. Die Basenpaarungen kommen dabei vorzugsweise durch invertierte Sequenzwiederholungen am 5 ' -Ende und und 3 ' -Ende des Oligonukleotidstrangs zustande und sind somit zueinander spezifisch.
Gemäß einer besonders bevorzugten Ausführungsform der vorliegenden Erfindung liegt die Schmelztemperatur des Oligonukleotids im Bereich von etwa 45°C bis etwa 85°C. Als "Schmelz- temperatur" des Oligonukleotids wird erfindungsgemäß diejenige Temperatur bezeichnet, die notwendig ist, um ein vollständig oder teilweise doppelsträngiges Oligonukleotid durch Auflösen der Basenpaarungen in ein einzelsträngiges Oligonukleotid zu überführen.
Erfindungsgemäß kann es sich bei dem Oligonukleotid um ein Haarnadelschleifen-Oligonukleotid (Hairpin-Oligonukleotid) handeln. Unter "Haarnadelschleifen-Oligonukleotid" wird in diesem Zusammenhang ein Oligonukleotid verstanden, welches aus einem durch spezifische Basenpaarung invertierter Nukleotidsequenz-Wiederholungen gebildeten Stamm und einer offenen Schleife besteht. Der strukturelle Aufbau ist in Fig. 2 schematisch am Beispiel einer bevorzugten Ausführungsform dargestellt. Der Stamm bestimmt maßgeblich die Schmelztemperatur eines Haarnadelschleife-Oligonukleotids, wobei die Schmelztemperatur unter anderem vom G/C-Gehalt und der Länge des Oligonukleotids sowie von der Art der Nukleinsäure (DNA- , RNA oder PNA-Oligonukleotid) und dem Salzgehalt der Reaktionsmischung abhängt. Bei Oligonukleotiden mit einer Länge von ≥ 5 bp spielen auch Sequenzwiederholungen eine Rolle. Diese Faktoren sind dem Fachmann wohlbekannt, und die Einstellung der Schmelztemperatur ist daher auf relativ einfache Weise möglich (vgl. z.B. F. Schaeffer et al., EMBO J. 1 (1982) 99-105; J. De Ley, J. Bacteriol . 101 (1970) 738-754; T. Latham et al . DNA 8 (1989) 223-231).
Der Begriff "Schleife" bezeichnet dabei den Bereich eines Oligonukleotids, der zwischen zwei Bereichen lokalisiert ist, die durch spezifische Basenpaarung die Stamm-Struktur des Oligonukleotids bilden. Unter "Stamm" oder "Stamm-Struktur" des Olignukleotids wird erfindungsgemäß ein doppelsträngiger Bereich des Oligonukleotids verstanden, der durch spezifische Basenpaarung invertierter Nukleotidsequenz-Wiederholungen entsteht.
Bevorzugt besitzt das Haarnadelschleifen-Oligonukleotid die in Fig. 2 dargestellte allgemeine Struktur. Vorzugsweise weist das Molekül eine nicht-basische (abasische) Schleifen-Sequenz auf, die zwischen den am 5 ' -Ende und am 3 ' -Ende des Oligonukleotids liegenden und zur Doppelstrangbildung befähigten Sequenz- abschnitten liegt. Im Rahmen der vorliegenden Erfindung können anstelle des Haarnadelschleifen-Oligonukleotids auch zwei einzelne, revers komplementäre Oligonukleotide verwendet werden, die am 3 ' -OH-Ende phosphoryliert sind. Die in Bezug auf das Haarnadelschleifen-Oligonukleotid genannten Bedingungen und Eigenschaften müssen auch für die beiden komplementären Oligonukleotide gelten.
Unter "abasischer Sequenz" (auch als "abasischer Spacer" bezeichnet) wird im Rahmen der vorliegenden Erfindung ein Sequenzabschnitt verstanden, der aus einer Abfolge nichtbasischer Nukleotide besteht (d.h. aus Nukleotiden, die keine Base enthalten) . Im Gegensatz zu den für Nukleinsäuren typischen Bausteinen besitzen nicht-basische Nukleotide keine Purin-, Pyrimidin- oder andere, dem Fachmann aus Nukleinsäuren bekannte Basen und bestehen somit lediglich aus Ribosephosphat (z.B. nicht-paarende Basenanaloga und universell paarende Basenanaloga, wie poly-Inosin) . Nicht-basische Nukleotide sind dem Fachmann aus der Oligonukleotid-Synthese hinreichend bekannt. Die Verwendung nicht-basischer Nukleotide im Bereich der Schleifen-Struktur (loop-Struktur) des Hairpin- Oligonukleotids verhindert die Ausbildung unspezifischer Basenpaarungen im Bereich der Schleife-Struktur, die den Schmelzpunkt des Oligonukleotids beeinflußen können. Das Hairpin-Oligonukleotid weist gegenüber den frei in Lösung befindlichen Oligonukleotiden den Vorteil auf, daß die beiden Stammteile infoge der räumlichen Nähe zueinander besser rehybridisieren, es liegt nur eine anstelle von zwei freien 3 ' - OH-Gruppen vor, und es besteht ein sterisches Hybridisierungs- hindernis für den Loop.
Zusätzlich zu der abasischen Spacer-Sequenz kann das Haarnadelschleifen-Oligonukleotid eine Phosphatgruppe anstelle der 3 ' - OH-Gruppe aufweisen. Durch den Austausch der 3 ' -terminalen OH- Gruppe durch eine Phosphatgruppe kann man eine Interferenz des Oligonukleotids mit der Nukleinsäureamplifikationsreaktion verhindern. Anstelle der Phosphorylierung am 3 ' -terminalen Ende kann auch jede sonstige Substitution eingesetzt werden, die eine Esterifizierung verhindert, d.h. z.B. Fluorescein- Markierung, Iodierung, Biotinylierung, etc. Durch den Austausch der Hydroxylgruppe kann die Verlängerung des Oligonukleotids bei der PCR verhindert werden, da die DNA-Polymerase die für die Verknüpfung von Nukleotiden notwendige Esterbindung nur zwischen einer 5 ' -Phosphatgruppe und einer 3 ' -OH-Gruppe, nicht aber zwischen zwei Phosphatgruppen zu katalysieren vermag. Verfahren zur Phosphorylierung des 3 ' -Terminus von Nukleinsäuren sind dem Fachmann wohlbekannt.
Gemäß einer besonderen Ausführungsform der Erfindung weisen die komplementären Sequenzabschnitte des Haarnadelschleifen- Oligonukleotids die SEQ ID NO:l und SEQ ID NO: 2 dargestellten
Nukleotidsequenzen auf ("SEQ ID NO" steht für die im Sequenzprotokoll jeweils enthaltenen Kennzahlen "<400>" gemäß WIPO Standard ST.25) . Die Oligonukleotid-Sequenzen sind vorzugsweise durch eine Spacer-Sequenz einer Länge von 3 bis 500, vorzugsweise 10 bis 60 abasischen Nukleotiden, insbesondere Ribose-Phosphatresten, verbunden. Eine Länge von 20 Ribose-Phosphatresten ist besonders bevorzugt. Dieses Molekül mit der (Nukleinsäure-) Sequenz ACAGTAACCTGTACAGACCT- TAGT11111111111111111111ACTAAGGTCTGTACAGGTTACTGT (entsprechend <SEQ ID ID NO:7>, wobei "A" für Adenin, "C" für Cytosin, "T" für Thymin, "G" für Guanin und "1" für Ribosephosphat steht) wird vorliegend mit "SGS3" bezeichnet. Die Struktur von SGS3 ist in Fig. 2 wiedergegeben.
Gegenstand der Erfindung sind ferner Oligonuleotid-Farbstoff- Komplexe bestehend aus einem oben genannten Haarnadelschleifen- Oligonukleotid (vorzugsweise mit der Sequenz <SEQ ID NO:6>- 11111111111111111111-<SEQ ID NO:7>), und einem selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindenden
Farbstoff. Bei dem Farbstoff handelt es sich gemäß einer
® ® bevorzugten Ausführungsform um SYBR Green I, SYBR Green II oder
Ethidiumbromid.
Die Polymerasen, die erfindungsgemäß bei der Reversen Transkription Anwendung finden können, sind vorzugsweise aus der folgenden Gruppe ausgewählt: DNA-Polymerase aus Thermus fchermo- philis (Tth-Polymerase) , Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT) und Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT) , Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und andere Reverse Transkriptasen retroviralen Ursprungs. Erfindungsgemäß können ein oder mehrere Enzyme aus dieser Gruppe für die Reverse Transkription verwendet werden.
Gemäß einer weiteren Ausführungsform der Erfindung handelt es sich bei der auf die Reverse Transkription folgenden Amplifi- kation der cDNA um eine Polymerasekettenreaktion (PCR) . Zu deren Durchführung verwendet man vorzugsweise eine DNA-Polyme- rase(n) aus der folgenden Gruppe: Thermus aquaticus-Polymerase (Taq-Polymerase) , Thermus flavus-Polymerase (Tf1-Polymerase) , Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase ( fu-Polymerase) . Gemäß einer besonderen Ausführungsform sind Tfl-, Tma- und Pfu-Polymerase bevorzugt, da diese Polymerasen proofreading-Enzyme (3 ' -5 ' -Exonuclease Aktivität) sind, die eine geringere Fehlerrate als die Taq- Polymerase aufweisen. Es kann auch eine Mischung aus mehreren Polymerasen verwendet werden, klassischerweise Pfu und Taq.
Gemäß einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens verwendet man zur Nukleinsäureamplifikation eine Kombination von MMuLV-RT und
® Taq-Polymerase und für die Detektion SYBR Green I als
Farbstoff .
Die vorliegende Erfindung betrifft ferner Kits zur Verwendung in oder zur Durchführung des erfindungsgemäßen Verfahrens.
Gemäß einer Ausführungsform enthält ein solches Kit ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelztemperatur oberhalb der zur Durchführung der Reversen Transkription aber unterhalb der zur Detektion von PCR- Produkten geeigneten Temperatur (80-90°C) liegt, einen Farbstoff, der selektiv an doppelstrangige DNA bindet. Vorzugsweise enthalten die Kits einen oben genannten Oligonukleotid-Farbstoff-Komplex. Die Kits enthalten gegebenenfalls weitere Reagenzien und Hilfsmittel, die man üblicherweise zur Durchführung einer Nukleinsäureamplifikation benötigt, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate
(sequenzunabhängig) in Echtzeit detektiert. Bei diesen Reagenzien kann es sich beispielsweise um Reaktionspuffer handeln, die eine für die Reaktion erforderliche Konzentration bestimmter Ionen, wie Magnesium- (Mg2+) oder Manganionen (Mn2+) , gewährleisten. Weiterhin kann es sich um Reagenzien handeln, die eine Ausbildung von Sekundärstrukturen der RNA hemmen und 5 somit die Effizienz der Reversen Transkription erhöhen. Es kann sich ferner um RNAse-freies Wasser zum Ansetzen der Amplifikations-Reaktionsansätze oder um RNAse-Inhibitoren handeln, die eine enzymatische Degradation der Ausgangs-RNA durch kontaminierende RNAsen im Reaktionsansatz inhibieren. 10 Darüber hinaus können die Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation auch Lösungen der Desoxynukleotidtriphosphate dATP, dCTP, dGTP und dTTP umfassen.
Bezüglich der Bestandteile der Kits wird im übrigen auf die 15 obigen Ausführungen zur den bei dem erfindungsgemäßen Verfahren eingesetzten Enzyme, Oligonukleotide und Farbstoffe und deren Eigenschaften verwiesen.
Gemäß einer besonders bevorzugten Ausführungsform der Erfindung
20 enthält das Kit eine Kombination der Enzyme MMuLV-RT und Taq-
® Polymerase sowie SYBR Green I als Farbstoff .
Die Erfindung wird nachfolgend anhand von Beispielen, Figuren und einem Sequenzprotokoll näher beschrieben. 25
Beispiele
Material und Methoden 30
Als Modell-PCR-Systeme zur Etablierung einer einstufiger RT-PCR
® mit SYBR Green I-Detektion wurden etablierte Assays für
Lassavirus (Demby, A. et al . "Early diagnosis of Lassa fever by reverse transcription PCR" J. Clin. Microbiol. 32 (1994) 2898-
35 2903) und Ebolavirus (Sanchez, A. et al . "Detection and molecular characterization of Ebola viruses causing disase in human and nonhuman primates" J. Infect. Dis. 179 (1999) Suppl 1
S164-169) verwendet. Die veröffentlichten Primer waren jeweils
® mit Hilfe des Superscript II/Platinum One-Step RT-PCR System (Life Technologies, Karlsruhe, Deutschland) in das einstufiger
RT-PCR Format überführt worden. Die Sensitivität beider
Verfahren belief sich auf ca. 20 Kopien in vitro transkribierter RNA pro Reaktion. Die verwendeten Enzyme waren eine MMuLV Reverse Transkriptase und eine Taq DNA-Polymerase. Zur Testung von alleiniger DNA-Amplifikation wurde außerdem eine Taq DNA-Polymerase eines anderen Herstellers verwendet
® (AmpliTaq Gold, Perkin-Elmer, Weiterstadt, Deutschland) . Der
® Farbstoff SYBR Green I (z.B. kommerziell von der Fa. Röche,
Mannheim, Deutschland, erhältlich als 10000X Konzentrat in DMSO) wurde in allen Experimenten in Dimethylsufoxid (DMSO)
® verdünnt. Die Mindestkonzentration von SYBR Green I zur
Detektion von PCR-Produkten liegt bei 0,001% v/v in der
Reaktion. Soweit nicht anders angegeben, wurde in den folgenden
Experimenten diese Konzentration eingesetzt. Sämtliche RT-PCR-
® und PCR-Amplifikationen wurden in einem LightCycler (Röche) durchgeführt .
Durchführungsprotokoll für Ebola-Virus:
Eine Reaktion enthielt 10 μl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 μg Rinderserumalbumin (BSA, Fa. Sigma, München), 0,75mM Magnesiumsulfat, 1 μM Primer Filo A: (atcggaatttttctttctcatt, SEQ ID NO:l), 1 μM Primer Filo B: (atgtggtgggttataataatcactgacatg, SEQ ID NO: 2) und 0,4 μl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe) . Dem Reaktionsvolumen von 18 ul wurden noch 2 μl RNA-Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt . Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10 Zyklen:
95°C für 5 Sekunden, 60°C für 5 Sekunden (Temperaturdekrement l°C/Zyklus) , 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5
Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
Durchführungsprotokoll für Lassa-Virus :
Eine Reaktion enthielt 10 μl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 μg Rinderserumalbumin (BSA, Fa. Sigma, München), 2,5 M Magnesiumsulfat, 300 μM Primer 36E2: (accggggatcctaggcattt, SEQ ID NO: 3), 1 μM Primer 80F2: (atataatgatgactgttgttctttgtgca, SEQ ID NO: 4) , und 0,4 μl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe) . Dem Reaktionsvolumen von 18 ul wurden noch 2 μl RNA-Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt. Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10
Zyklen: 95°C für 5 Sekunden, 60°C für 5 Sekunden
(Temperaturdekrement l°C/Zyklus) , 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5 Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
Beispiel 1: Hemmung der Taq DNA-Polymerase
Um zu zeigen, daß in der RT-PCR die RT, nicht jedoch die Taq DNA-Polymerase gehemmt wird, wurden Amplifikationen einer geringen Menge von Lassa DNA, die kloniert in einem Plasmid vorlag, unter Verwendung einer Taq Polymerase durchgeführt. Fig. 3 zeigt das Ergebnis des Versuches. Wie der Figur zu entnehmen ist, wurde die Taq DNA-Polymerase in Gegenwart von
® SYBR Green I in einer Konzentration von 0,001% nicht gehemmt. ® Beispiel 2: Hemmung der RT-PCR durch SYBR Green I
® Um eine Hemmung der RT-PCR durch SYBR Green I zu demonstrieren, wurden absteigende Mengen in vitro transkribierter Ebola RNA mit der oben unter "Material und Methoden" zitierten, für Ebola anwendbaren einstufigen RT-PCR amplifiziert, und der Reaktion
® wurde SYBR Green I zugesetzt. Die Menge an DMSO, welches als
® Trägerlösung von SYBR Green I notwendig war, wurde dabei konstant gehalten. Fig. 4 zeigt das Ergebnis des Versuchs. Es
® ließ sich feststellen, daß eine Konzentration von 0,001% SYBR
Green I die RT-PCR inhibiert, die PCR hingegen nicht beeinflußt.
® Beispiel 3 : Immobilisierung von SYBR Green I
Es wurde ferner überprüft, ob die Hemmung der RT durch SYBR Green I dadurch vermieden werden kann, daß der Farbstoff zu Beginn der RT-PCR vom eigentlichen Reaktionsvolumen getrennt wird. Zum Zeitpunkt, an dem die eigentliche Reverse Transkription abläuft, wird der Farbstoff noch nicht für eine Detektion benötigt. Um eine physikalische Trennung zu erreichen, wurde die benötigte Menge an Farbstoff (0,001% entsprechend) in 1 μl DMSO gelöst, und dieses Volumen wurde am
® Boden von LightCycler -Reaktionsgefäßen bei einer Temperatur von -20°C festgefroren. Durch den hohen Schmelzpunkt von DMSO
(18,45°C) blieb es dort während des gesamten Ansatzprozesses der RT-PCR fixiert und wurde erst beim Erwärmen des Reaktionsansatzes auf die Reaktionstemperatur der Reversen Transkriptase (50°C) freigesetzt. Um die Auswirkungen dieses Verfahrens auf die Sensitivität der RT-PCR zu untersuchen, wurden Amplifikationen von Lassa RNA in vitro-Transkript in einer Verdünnungsreihe unter den beschriebenen Bedingungen sowie in Parallelansätzen unter normalen Bedingungen durchgeführt .
Fig. 5 zeigt das Ergebnis der Amplifikationen. Fig. 6 zeigt die gleichzeitige Detektion der letzten Stufen der amplifizerten
® RNA-Verdünnungsreihe des Ansatzreihe A im LightCycler .
Es bestand kein Unterschied zwischen beiden Ansatzreihen im Hinblick auf die Sensitivität. In beiden Ansatzreihen konnten
200 Kopien Lassa RNA nachgwiesen werden, wobei die Immobilisie-
® rung von SYBR Green I gleichzeitig eine real-time
Quantifizierung des Produkts erlaubte. Die Diffusionszeit des
DMSO in Ansatzreihe A war offenbar lang genug, um eine effiziente Funktion der Reversen Transkriptase zu ermöglichen.
Beispiel 4 : Immobilisierung des Farbstoffs an ein Oligonukleotid
Da die in Beispiel 3 beschriebene Immobilisierungsmethode hinsichtlich der Vorbereitung relativ aufwendig ist, wurde
® versucht, SYBR Green I an ein partiell doppelsträngiges DNA-
® Oligonukleotid zu binden. Dabei wurde ausgenutzt, daß SYBR G- reen I spezifisch an doppelstrangige DNA, praktisch jedoch nicht an einzelsträngige DNA bindet. Es wurde ein Haarnadel- Oligonukleotid hergestellt, welches eine Stamm-Schleife- Struktur aufweist. Die Stamm-Schleife-Struktur wies einen Schmelzpunkt auf, der zwar über der Arbeitstemperatur der Reversen Transkriptase, jedoch unter der Extensionstemperatur
® der PCR lag. Auf diese Weise sollte SYBR Green I während der
Reversen Transkription immobilisert vorliegen, während der PCR jedoch für die Detektion zur Verfügung stehen. Das
® Oligonukleotid erhielt die Bezeichnung SGS1 (SGS für "SYBR Green Suppressor") . Die Sequenz von SGSl ist im Sequenzprotokoll unter SEQ ID NO: 5 wiedergegeben, die Struktur ist in Fig. 7 dargestellt.
Es wurden aufsteigende Konzentrationen von SGSl mit einer
® konstante Menge von 0,001% (v/v) SYBR Green I versetzt, und die resultierende Fluoreszenz wurde bei einer Temperatur von 50°C
® gemessen. Fig. 8 zeigt die Bindung von SYBR Green I an SGSl. Es ließ sich ein deutlich konzentrationsabhängiger Bindungseffekt mit Sättigungskinetik feststellen.
Beispiel 5: SGSl in der RT-PCR und Modifikation von SGSl
® Um in der RT-PCR als SYBR Green I-Immobilisator zu fungieren, durfte das SGSl-Molekül nicht mit der RT-PCR interferieren.
Es wurden etwa 10000 Moleküle Ebola RNA in vitro-Transkript in
® Gegenwart von aufsteigenden Konzentrationen SGSl (ohne SYBR
Green I-Zusatz) amplifiziert. Wie Fig. 9 zeigt, wirkte SGSl bereits in einer Konzentration von 50 nM hemmend auf die RT- PCR.
Beispiel 6: Herstellung und Bindungskinetik von SGS3
Es wurde versucht, die starke Interferenz des Oligonukleotids mit der RT-PCR durch Modifikationen des Moleküls zu beseitigen, die die Adsorption des Farbstoffs möglichst unbeeinflußt lassen sollten. Um eine Extension des SGSl in der PCR zu verhindern, wurde die 3 ' -OH des SGSl durch eine Phosphatgruppe ersetzt. Weiterhin wurde die Loop-Region des SGSl durch ein abasisches ssDNA-Segment ersetzt, um unspezifische DNA-Bindung in diesem Bereich zu verhindern. Die erhaltene Sequenz erhielt die Bezeichnung SGS3. Die durch das abasische ssDNA-Segment verbundenen Oligonukleotidabschnitte von SGS3 sind in SEQ ID NO: 6 und 7 wiedergegeben, die Struktur ist in Fig. 2 gezeigt. Die Bindungskinetik von SGS3 entsprach der von SGSl (siehe Beispiel 4) und ist hier nicht gesondert dargestellt.
Beispiel 7: SGS3 in der RT-PCR
Das in Beispiel 5 beschriebene Experiment wurde unter Verwendung des Oligonukleotids SGS3 wiederholt. Fig. 10 zeigt, daß der Inhibitionseffekt erst bei einer Konzentration von 100 nM SGS3 pro Reaktion auftritt.
® Beispiel 8: Immobilisierung von SYBR Green I an SGS3 in der RT- PCR
Um die Immobilisierung von SYBR Green I an SGS3 sowie dessen Freisetzung zur Detektion während der RT-PCR zu überprüfen, mußte die optimale Konzentration von SGS3 ermittelt werden, die
® das SYBR Green I noch effizient bindet, die Reaktion jedoch unbeeinflußt läßt. Es wurden Amplifikationen von etwa 109 Kopien Ebola RNA in vitro-Transkript in Gegenwart von aufsteigenden Konzentrationen SGS3 durchgeführt. Diese hohe RNA Menge wurde ausgewählt, um die Reversion der Inhibition durch unterschiedliche Konzentrationen SGS3 zu untersuchen. Die
® Konzentration von SYBR Green I betrug dabei konstant 0,001% v/v. Die Positivkontrolle (Spur 6) enthielt weder SGS3 noch
SYBR Green I.
Fig. 11 zeigt das Ergebnis der Amplifikationsreaktionen. insbesondere zeigt Spur 1, daß die gewählte Konzentration des Farbstoffs die Amplifikation auch höchster Mengen an RNA (Spur 1, 109 Kopien pro Reaktion) vollständig inhibiert. Wie Fig. 11 ferner zu entnehmen ist, war eine Konzentration von 50 nM SGS3 dazu geeignet, die Inhibition aufzuheben. Dabei waren höhere und niedrigere Konzentrationen des Oligonukleotids suboptimal, entweder durch SGS-bindingte PCR-Interferenz (siehe Beispiel 7)
® oder durch mangelnde SYBR Green I-Immobilisierung.
Beispiel 9: Vergleich der Sensitivität des erfindungsgemäßen Verfahrens mit einer konventionellen, maximal optimierten, einstufigen RT-PCR
Zur weiteren Verbesserung der Sensitivität des erfindungsgemäßen Verfahrens wurde das thermische
Amplifikationsprofil der Reaktion dahingehend modifiziert, daß
® das an SGS3 gebundene SYBR Green I erst zur
Detektionstemperatur jedes Zyklus freigesetzt wurde. Der
Schmelzpunkt der Stamm-Schleife-Struktur von SGS3 war zuvor experimentell ermittelt worden und betrug 72°C, d.h. oberhalb
® von 72°C wird SYBR Green I aus der Bindung an das Oligonukleotid freigesetzt. Im Thermocycler-Profil wurde der Extensionsschritt von 72°C auf 65°C abgesenkt, um auch während der Arbeitstemperatur der DNA-Polymerase den Farbstoff in der Oligonukleotidbindung zu halten. Anschließend wurde die
Detektionstemperatur von 72°C auf 82°C erhöht, um eine maximale
® Freisetzung von SYBR Green I während der Detektion zu gewährleisten. Dies hatte gleichzeitig den Vorteil, daß unspezifische Nebenprodukte der PCR, wie Primer-Dimere, deren
Schmelztemperatur immer unter 80°C lag (empirischer Wert, gilt für fast jede RT-PCR) , nicht unerwünscht mitdetektiert wuden. Zum Sensitivitätsvergleich wurde eine Verdünnungsreihe Ebola RNA in vitro-Transkript in einer konventionellen, mit diesem Thermoprofil maximal optimierten, einstufigen RT-PCR ohne Möglichkeit der real-time-Quantifizierung wie unter Routinetestbedingungen amplifizert. Die gleichen Proben wurden
® unter den gefundenen Bedingungen (0,001% SYBR Green I, 50 nM
SGS3) bei sonst gleicher Formulierung der Reaktionsansätze amplifiziert. Dabei wurde in diesen Proben gleichzeitig die Fluoreszenz während der Reaktion gemessen. Wie aus Fig. 12 ersichtlich, ist die Sensitivität beider Verfahren annähernd gleich. Fig. 13 zeigt die entsprechende real-time Fluoreszenz- kinetik, die während der Reaktion erhoben wurde. Es sind extrem regelmäßige Log-Stufen Abstände sichtbar, wie sie erfahrungsgemäß sonst nur mit Hilfe von Sondendetektion zu erzielen sind.
Beispiel 10: Schmelzpunktanalyse
In der Schmelzkurvenanalyse wird folgendes Temperaturprofil durchlaufen: 95°C für 10 Sekunden (zum Schmelzen aller in der
Reaktion befindlichen Doppelstränge) , 60°C für 20 Sekunden (zur Rehybridisierung aller in der Reaktion befindlichen Doppel- stränge, langsames Aufheizen (0, 1°C/Sekunde) mit kontinuierlicher Fluoreszenzmessung zur Ermittlung der
Schmelztemperatur (d.h. , der Temperatur, bei der die
® Doppelstränge schmelzen, Sybr Green in Lösung geht und somit nicht mehr emittiert) . Fig. 13 zeigt die dabei erhobene Fluoreszenz (y-Achse) in Abhängigkeit von der Temperatur. Die in Fig. 14 errechnete negative erste Ableitung des Signals ergibt die dargestellten Schmelzpeaks (Punkt der maximal negativen Steigung der Fluoreszenzreversion) . Dieser Punkt entspricht der Temperatur, zu der 50% aller Doppelstränge in den einzelsträngigen Zustand übergehen ("Schmelzpunkt").
Fig. 14 zeigt das Ergebnis der Schmelzpunktanalyse von SGS3. Es läßt sich ein sehr scharf definierter spezifischer Schmelzpunkt bei 85°C nachweisen. Der Schmelzpunkt in der Negativkontrolle liegt bei ca. 77°C und entspricht einem Primer-Dimer, das auf Grund der oben erläuterten erhöhten Detektionstemperatur nicht in der real-time Kinetik erfaßt wird. Dies wäre auch für die Quantifizierung störend.
Beispiel 11: Übertragbarkeit des Verfahrens auf andere Viren
Das oben beschriebene Verfahren (insbesondere Kombination der
® angegebenen Konzentrationen an SGS3 und SYBR Green I mit dem modifizierten PCR-Profil) wurde u.a. erfolgreich in folgende einstufiger RT-PCR Verfahren implementiert:
Lassa RT-PCR; Ebola RT-PCR; LCMV RT-PCR; HIV-1 RT-PCR.
Legende der Figuren:
Fig. l: Fluoreszenz-Anregungs- und Fluoreszenz-Emissionsspek-
® ® tren von SYBR Green I und SYBR Gold
Fig. 2: Strukurskizze eines erfindungsgemäßen Haarnadelschlei- fen-Oligonukleotids am Beispiel des Moleküls SGS3. Einzelsträngiges abasisches Schleifensegment (20 Basen) und doppelstrangige Stammstruktur (24
Basenpaare) . Das freie 3 ' -OH ist gegen eine Phosphatgruppe (P) ausgetauscht.
Fig. 3: Amplifikation einer geringen Menge Lassa cDNA (klo- niert) mit einer normalen Taq DNA Polymerase. Spuren
1,4 und 7: ca. 2000 Kopien DNA; Spuren 3,6 und 9: ca.
20 Kopien DNA; Spuren 2,5 und 8: Wasser. A: 0,001%
® ®
Sybr Green, 5% DMSO; B: kein Sybr Green, 5% DMSO; C:
® kein Sybr Green, kein DMSO.
Fig. 4: Ebola RNA in-vitro Transkript (109 - 106 Kopien pro
Reaktion) wurde mit (Reaktionen 6-10) und ohne (Reak-
® tionen 1-5) 0,001% Sybr Green in einer 1-Step RT-PCR
® amplifiziert. Sybr Green hemmt in dieser Konzentration die RT-PCR, jedoch nicht die PCR (vgl. Fig. 3) . Spuren
1 und 6: Negativkontrolle; Spuren 2 und 7: 109 Kopien pro Reaktion; Spuren 3 und 8: 108 Kopien pro Reaktion;
Spuren 4 und 9: 107 Kopien pro Reaktion; Spuren 5 und
10: 106 Kopien pro Reaktion.
Fig. 5: Amplifikation einer Verdünnungsreihe Lassa-RNA in- vitro Transkript; die Menge an RNA Kopien pro Reaktion ist oben angegeben. A: Amplifikation in Gegenwart von
® 0,001% Sybr Green, vor der Reaktion am Reagenzgefäßbo- den angefroren. Die Zahlen über den jeweiligen Gelspuren bezeichnen die Anzahl der RNA-Kopien pro Reaktion (ab 1000 Kopien in Exponentialschreibweise) .
® B: Kontrollansatzreihe ohne Sybr Green.
Fig. 6: Online-Fluoreszenzdetektion der Reihe A aus Fig. 5. Dargestellt sind der Übersicht wegen nur die letzten drei positiv detektierten Stufen der Verdünnungsreihe und die Negativkontrolle.
Fig. 7: Strukurskizze des Moleküls SGSl. Einzelsträngiges Schleifensegment (37 Basen Zufallssequenz) , 30 Basenpaare doppelstrangige Stammstruktur. Das freie 3 ' -OH ist im Gegensatz zu SGS3 vorhanden.
® Fig. 8: Bindung von Sybr Green an SGSl. Die Reaktionen
® enthielten konstant 0,001% Sybr Green und die unten angegebenen Konzentrationen an SGSl in μM. Die Fluoreszenz wurde bei 50°C (RT-Temperatur) gemessen. >>>: Extremer Überschuß SGSl; -SGS: Kontrolle ohne
® SGS, mit 0,001% Sybr Green; -SYBR: Kontrolle ohne Sybr
® Green, aber mit 1600 nM SGSl.
Fig. 9: Amplifikation von ca. 10000 Molekülen Ebola-RNA mit aufsteigender Konzentration SGSl pro Reaktion, ohne
® Sybr Green. Spur 1: Kein SGS; Spur 2: 50 nM; Spur 3:
100 nM; Spur 4: 200 nM; Spur 5: 400 nM; Spur 6: 800 nM; Spur 7: 1600 nM; Spur 8: 3200 nM
Fig. 10: Amplifikation von ca. 10000 Molekülen Ebola-RNA mit angegebener Konzentration SGS3 pro Reaktion, ohne Sybr
® Green. Im Vergleich zu der in Fig. 9 dargestellten
Reaktion toleriert die Reaktion höhere Konzentrationen des modifizierten SGS-Moleküls.
Fig. 11: Amplifikation von 109 Kopien Ebola-RNA in-vitro Trans-
® kript in Gegenwart von 0,001% Sybr Green und SGS3 in den angegebenen Konzentrationen. 109 Kopien waren ohne
® SGS3 in Gegenwart dieser Sybr Green-Konzentration nicht zu amplifizieren (vgl. Fig. 4). Spur 1: kein
SGS3; Spuren 2-5: wie beschriftet; Spur 6: 106 Kopien
® Ebola-RNA ohne SGS3 und Sybr Green (+Ctrl) .
Fig. 12: Parallele 1-Step RT-PCR Amplifikation einer Ebola-RNA
® Verdünnungsreihe mit und ohne 50 nM SGS3/0,001% Sybr
Green. Spur 1: Negativkontrolle; Spuren 2 und 6: 106
Kopien RNA pro Reaktion; Spuren 3 und 7: 105 Kopien RNA pro Reaktion; Spuren 4 und 8: 104 Kopien RNA pro
Reaktion; Spuren 5 und 9: 103 Kopien RNA pro Reaktion.
Fig. 13: Zugehörige real-time Fluoreszenzkinetik zu Fig. 12. Dargestellt ist der Verlauf des Fluoreszenzsignals, das in den Reaktionen 1 bis 5 (siehe Beschriftung der
Fluoreszenzverlaufe, vgl. gleiche Positionsnummern in Fig. 12) während der Reaktion gemessen wurde. Das Bild entspricht dem üblichen Fluoreszenzverlauf einer real- time PCR.
Fig. 14: Schmelzkurvenanalyse der PCR-Produkte in Fig. 12/Fig. 13; Reaktionen 1 bis 5: hier gleiche Bezeichnung. Das Vorgehen ist im Beispiel Nr. 10 beschrieben. 1: Schmelzpeak in der negativen ersten Ableitung der direkt gemessenen Fluoreszenz bei 77,5°C, entsprechend einem Primer-Dimer Artefakt . Dies wird in der zur Quantifizierung herangezogenen Echtzeitkinetik (Fig. 13) nicht erfaßt, da die Fluoreszenz der Reaktion oberhalb von 77,5°C gelesen wird. 2-5: Reaktionen 2 bis 5 aus Fig. 12/Fig. 13. Deutlicher Schmelzpeak bei
85°C für das spezifische PCR-Produkt mit äußerst geringer Variabilität zwischen den Einzelreaktionen.

Claims

Patentansprüche : 1. Verfahren zur Durchführung einer Nukleinsäureamplifik- aktion, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, die gebildete komplementäre DNA (cDNA) amplifiziert und die gebildeten Amplifikate sequen- zunabhängig in Echtzeit detektiert, wobei man zur Detektion einen Farbstoff verwendet, der selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindet, dadurch gekennzeich- net, dass man den Farbstoff vor der reversen Transkription immobilisiert, um eine Hemmung der reversen Transkription zu vermeiden, man ihn vor der Amplifikation wieder frei- setzt und damit zur Bindung an die Amplifikate zur Ver- fügung stellt, wobei man die Farbstoff-gebundenen Amplifi- kate qualitativ und/oder quantitativ nachweist.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man den Farbstoff immobilisiert, indem man ihn in einem Lö- sungsmittel mit einem Schmelzpunkt im Bereich von 10 C bis 40 C löst und man die Farbstofflösung am Boden des Reak- tionsgefässes festfriert, wobei der Farbstoff durch die erhöhten Reaktionstemperaturen der reversen Transkription freigesetzt wird und in die Reaktionslösung diffundiert.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass das Lösungsmittel Dimethylsulfoxid (DMSO) ist.
4. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man den Farbstoff immobilisiert, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden lässt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und man den Farbstoff freisetzt, indem man die Temperatur vor der Amplifikation erhöht, um ein einzelsträngiges Oligonu- kleotid zu bilden, an das der Farbstoff nicht mehr bindet. <Desc/Clms Page number 34>
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass der Schmelzbereich des Oligonukleotids im Bereich von etwa 45 C bis etwa 85 C liegt.
6. Verfahren nach Anspruch 4 oder 5, dadurch gekennzeichnet, dass es sich bei dem Oligonukleotid um ein Haarnadelschlei- fen-Oligonukleotid handelt.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, dass das Oligonukleotid die allgemeine Struktur EMI34.1 aufweist, wobei das Molekül eine abasische Loop-Sequenz aufweist.
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, dass das Molekül ferner eine Phosphatgruppe anstelle der 3'-OH- Gruppe aufweist.
9. Verfahren nach den Ansprüchen 6 bis 8, dadurch gekennzeich- net, dass das Oligonukleotid die Sequenz ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT aufweist, wobei"1"für Ribosephosphat steht. <Desc/Clms Page number 35>
10. Verfahren nach den Ansprüchen 1 bis 9, dadurch gekenn- zeichnet, dass man zur reversen Transkription ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase), Reverse Trans- kriptase aus Moloney Murine Leukemia Virus (MMuLV-RT), Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT), Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen Ursprungs verwendet.
11. Verfahren nach den Ansprüchen 1 bis 10, dadurch gekenn- zeichnet, dass es sich bei Amplifikation der komplementären DNA (cDNA) eine Polymerasekettenreaktion (PCR) handelt.
12. Verfahren nach den Ansprüchen 1 bis 11, dadurch gekenn- zeichnet, dass man für die Polymerasekettenreaktion (PCR) eine oder mehrere DNA-Polymerase (n) aus der Gruppe bestehend aus Thermus aquaticus-Polymerase (Taq- Polymerase), Thermus flavus-Polymerase (Tfl-Polymerase), Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase) verwendet.
13. Verfahren nach den Ansprüchen 1 bis 12, dadurch gekenn- zeichnet, dass man den Farbstoff aus der Gruppe bestehend 0 0 aus SYBR Green I, SYBR Green II und Ethidiumbromid auswählt.
14. Verfahren nach den Ansprüchen 12 und 13, dadurch gekenn- zeichnet, dass man zur Nukleinsäureamplifikation eine Kom- bination von MMuLV-RT und Taq-Polymerase verwendet und man als Farbstoff SYBR#Green I verwendet. <Desc/Clms Page number 36>
15. Oligonukleotid der allgemeinen Struktur EMI36.1 das eine abasische Loopsequenz aufweist und eine Phosphat- gruppe anstelle der 3'-OH-Gruppe aufweist.
16. Oligonukleotid, dadurch gekennzeichnet, dass es die Sequenz ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT aufweist, wobei 11111 für Ribosephosphat steht.
17. Oligonuleotid-Farbstoff-Komplex bestehend aus einem Oligonukleotid nach Anspruch 15 oder 16 und einem selektiv an doppelsträngige Desoxyribonukleinsäure (dsDNA) bindenden Farbstoff.
18. Komplex nach Anspruch 17, dadurch gekennzeichnet, dass der 0 0 Farbstoff SYBR Green I, SYBR Green II oder Ethidiumbromid ist.
19. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, dass es ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelz- temperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und einen Farbstoff, der selektiv an doppelsträngige DNA bindet, <Desc/Clms Page number 37> enthält.
20. Kit nach Anspruch 19, dadurch gekennzeichnet, dass die Schmelztemperatur des Oligonukleotids im Bereich von 45 C bis 85 C liegt.
21. Kit nach Anspruch 19 oder 20, dadurch gekennzeichnet, dass es sich bei dem Oligonukleotid um ein Haarnadelschleifen- Oligonukleotid handelt.
22. Kit nach Anspruch 21, dadurch gekennzeichnet, dass das Oligonukleotid die allgemeine Struktur EMI37.1 aufweist, wobei das Molekül eine abasische Loopsequenz und eine Phosphatgruppe anstelle der 3'-OH-Gruppe aufweist.
23. Kit nach den Ansprüchen 19 oder 20, dadurch gekennzeichnet, dass das Oligonukleotid die Sequenz ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT aufweist, wobei"1"fiir Ribosephosphat steht.
24. Kit nach den Ansprüchen 19 bis 23, dadurch gekennzeichnet, (D &commat; dass der Farbstoff SYBR Green I, SYBR Green II oder Ethidiumbromid ist. <Desc/Clms Page number 38>
25. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, dass es einen Oligonuleotid- Farbstoff-Komplex nach Anspruch 17 oder 18 enthält.
26. Kit nach den Ansprüchen 19 bis 25, dadurch gekennzeichnet, dass es ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase), Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT), Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT), Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen Ursprungs zur Durchführung der reversen Transkription enthält.
27. Kit nach den Ansprüchen 19 bis 26, dadurch gekennzeichnet, dass es ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus aquaticus (Taq-Polymerase), Thermus flavus-Polymerase (Tfl-Polymerase), Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase) zur Durchführung einer Polyerasekettenreaktion enthält.
28. Kit nach den Ansprüchen 19 bis 27, dadurch gekennzeichnet, dass es eine Kombination von MMuLV-RT und Taq-Polymerase und 0 als Farbstoff SYBR Green I enthält.
29. Kit nach den Ansprüche 19 bis 28, dadurch gekennzeichnet, dass es weitere Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation enthält, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate (sequenzunabhängig) in Echtzeit detektiert.
PCT/EP2002/010800 2001-10-11 2002-09-26 Echtzeitdetektion von dna-amplifikationsprodukten WO2003033732A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10150121.8 2001-10-11
DE10150121A DE10150121B4 (de) 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten

Publications (2)

Publication Number Publication Date
WO2003033732A2 true WO2003033732A2 (de) 2003-04-24
WO2003033732A3 WO2003033732A3 (de) 2003-11-13

Family

ID=7702130

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/010800 WO2003033732A2 (de) 2001-10-11 2002-09-26 Echtzeitdetektion von dna-amplifikationsprodukten

Country Status (2)

Country Link
DE (1) DE10150121B4 (de)
WO (1) WO2003033732A2 (de)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1735465A2 (de) * 2004-03-22 2006-12-27 Isis Pharmaceticals, Inc. Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5824557A (en) * 1996-04-02 1998-10-20 Panvera Corporation Method for detecting and quantitating nucleic acid impurities in biochemical preparations
EP0900805A2 (de) * 1990-07-27 1999-03-10 Chiron Corporation Einführung selektiv spaltbarer und/oder abasischer Stellen in Oligonukleotidketten und Reagenzien dafür

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0748382B1 (de) * 1993-09-02 2002-11-06 Ribozyme Pharmaceuticals, Inc. Enzymatische nukleiksaüre die nicht-nukleotide enthaltet

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0900805A2 (de) * 1990-07-27 1999-03-10 Chiron Corporation Einführung selektiv spaltbarer und/oder abasischer Stellen in Oligonukleotidketten und Reagenzien dafür
US5824557A (en) * 1996-04-02 1998-10-20 Panvera Corporation Method for detecting and quantitating nucleic acid impurities in biochemical preparations

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BUSTIN S A: "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays." JOURNAL OF MOLECULAR ENDOCRINOLOGY, Bd. 25, Nr. 2, Oktober 2000 (2000-10), Seiten 169-193, XP002251381 ISSN: 0952-5041 in der Anmeldung erw{hnt *
DROSTEN CHRISTIAN ET AL: "Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR." JOURNAL OF CLINICAL MICROBIOLOGY, Bd. 40, Nr. 7, Juli 2002 (2002-07), Seiten 2323-2330, XP002251382 ISSN: 0095-1137 *
FREEMAN WILLARD M ET AL: "Quantitative RT-PCR: Pitfalls and potential" BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, Bd. 26, Nr. 1, Januar 1999 (1999-01), Seiten 112-118,120-122,124-12, XP002143860 ISSN: 0736-6205 *
PEOC'H D ET AL: "Efficient chemical synthesis of oligonucleotides containing a true abasic site" TETRAHEDRON LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, Bd. 32, Nr. 2, 1991, Seiten 207-210, XP002171022 ISSN: 0040-4039 *
WITTWER C T ET AL: "CONTINUOUS FLUORESCENCE MONITORING OF RAPID CYCLE DNA AMPLIFICATION" BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, Bd. 22, Nr. 1, 1997, Seiten 130-131,134-138, XP000683698 ISSN: 0736-6205 in der Anmeldung erw{hnt *

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
EP1735465A2 (de) * 2004-03-22 2006-12-27 Isis Pharmaceticals, Inc. Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
EP1735465A4 (de) * 2004-03-22 2008-03-12 Isis Pharmaceticals Inc Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Also Published As

Publication number Publication date
DE10150121A1 (de) 2003-04-30
WO2003033732A3 (de) 2003-11-13
DE10150121B4 (de) 2005-12-01

Similar Documents

Publication Publication Date Title
DE10150121B4 (de) Echtzeitdetektion von DNA-Amplifikationsprodukten
DE69829328T2 (de) Strangverdrängungsamplifikation von RNA
DE60034878T2 (de) Verfahren zur Amplifizierung einer Nukleinsäuresequenz unter Verwendung eines chimären Primers
EP0705905B1 (de) Verfahren zum sensitiven Nachweis von Nukleinsäuren
DE69333242T2 (de) Verfahren, reagenz und salz zum nachweis und amplifikation von nukleinsäuresequenzen
EP2052086B1 (de) VERFAHREN ZUR SYNTHESE EINER cDNA IN EINER PROBE IN EINER ENZYMATISCHEN REAKTION
EP3504338B1 (de) Verfahren zur amplifikation von nukleinsäuren und verwendung eines kits zu dessen durchführung
DE19915141A1 (de) Detektion von Nucleinsäure-Amplifikaten
EP0718408A2 (de) Verfahren zum besonders sensitiven Nachweis von Nukleinsäuren
DE3929030A1 (de) Verfahren zur vermehrung von nukleinsaeuren
DE60209617T2 (de) Quantitative Multiplex-PCR mit grossem Dynamikbereich
EP0437774B1 (de) Verfahren zur Herstellung von modifizierten Nukleinsäuren
EP1926831B1 (de) Verfahren zur aktivierung einer nukleinsäure für eine polymerase-reaktion
DE4132133A1 (de) Verfahren zur spezifischen herstellung von ribonukleinsaeuren
DE602004002485T2 (de) In gegenwart von collagen und disacchariden lyophilisierte nukleinsäuren umfassende zusammensetzung
EP2467498A1 (de) Verfahren zum nachweis von zielnukleinsäuren
EP1707623A1 (de) Reverse Transkription und Amplifikation von RNA bei simultaner Degradierung von DNA
EP0552203B1 (de) Verfahren zum empfindlichen nachweis von nukleinsäuren
EP0839917A1 (de) Primer und Sonden zum Nachweis von HIV
EP3530755B1 (de) Verfahren zum anzeigen des fortschrittes der amplifikation von nukleinsäuren und kit zu dessen durchführung
DE69914942T2 (de) Kennzeichnung einer substanz mittels eines reportergens und sequenzen, die für die in vitro expression des reportergens notwendig sind
DE4238699A1 (de) Einfaches Nukleinsäurevermehrungsverfahren
DE19614852A1 (de) Verfahren zum quantitativen Nachweis einer Analytnukleinsäure
WO2011161239A1 (de) Verfahren zum nachweis von ribonukleinsäuren
EP2191008B1 (de) Verfahren zur synthese einer cdna in einer probe in einer enzymatischen reaktion

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP