WO2003033732A2 - Echtzeitdetektion von dna-amplifikationsprodukten - Google Patents

Echtzeitdetektion von dna-amplifikationsprodukten Download PDF

Info

Publication number
WO2003033732A2
WO2003033732A2 PCT/EP2002/010800 EP0210800W WO03033732A2 WO 2003033732 A2 WO2003033732 A2 WO 2003033732A2 EP 0210800 W EP0210800 W EP 0210800W WO 03033732 A2 WO03033732 A2 WO 03033732A2
Authority
WO
WIPO (PCT)
Prior art keywords
polymerase
dye
oligonucleotide
sybr green
pcr
Prior art date
Application number
PCT/EP2002/010800
Other languages
English (en)
French (fr)
Other versions
WO2003033732A3 (de
Inventor
Christian Drosten
Original Assignee
Bernhard-Nocht-Institut für Tropenmedizin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bernhard-Nocht-Institut für Tropenmedizin filed Critical Bernhard-Nocht-Institut für Tropenmedizin
Publication of WO2003033732A2 publication Critical patent/WO2003033732A2/de
Publication of WO2003033732A3 publication Critical patent/WO2003033732A3/de

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Definitions

  • the present invention relates to a method for real-time detection of deoxyribonucleic acid application products. Furthermore, the application relates in part to double-stranded oligonucleotides which are used in real-time detection, and to kits for carrying out the method.
  • Methods for the amplification of deoxyribonucleic acids enable their exponential duplication and also make small amounts of nucleic acid accessible for qualitative or quantitative detection or further applications.
  • Methods for amplifying DNA are known in the art and include, for example, the polymerase chain reaction (PCR).
  • the initial step of reverse transcription can also be used to amplify ribonucleic acids (RNA) using DNA amplification.
  • RNA ribonucleic acids
  • Suitable methods for the qualitative and / or quantitative determination of amplification products are sufficiently known in the prior art and include, for example, photometric measurement methods or analysis by means of agarose gel electrophoresis.
  • a double fluorescence-labeled DNA probe hybridizes with the PCR product and is digested by the 5 'nuclease activity of the DNA polymerase used.
  • the two fluorophores on the probe are physically separated and there is a detectable reversion of an energy transfer process (Livak, K. et al. "Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization "PCR Methods Appl 4 (1995) 357-362).
  • the detection is based on a new occurrence of energy transfer when two DNA probes hybridize adjacent to one another on a DNA strand (Bernhard, PB and ittwer, CT “Homogeneous amplification and variant detection by fluorescent hybridization probes” Clin Chem 46 (2000) 147 -148).
  • ® SYBR Greenl is an unsymmetrical cyanine dye that intercalates into double-stranded DNA (dsDNA) regardless of the sequence, whereby the dsDNA-bound dye efficiently at approx.
  • Cyanine dyes are e.g. in US 5,436,134, US 5,658,751, WO
  • Gold is an intercalating dye with exceptionally high affinity for dsDNA.
  • Intercalating dyes have the property of being embedded in the "minor groove"("smallfurrow") of double-stranded DNA. This binding amplifies the fluorescence many times over with the same excitation intensity, and a signal is obtained whose intensity is directly proportional to the number of double strands present.
  • ® bound dye SYBR Gold has a main excitation maximum at about 495 nm, another excitation peak
  • the emission maximum of the SYBR gold-nucleic acid complex is around 537 nm.
  • sequence-specific DNA detection probes are required, the synthesis of which is complex and expensive. At the same time, at least the area of the probe binding sites in the nucleic acid to be detected must be highly conserved. Detection of variable sequences is not reliably possible with probes.
  • RNA viruses such as HIV-1 or HCV
  • a reverse transcription polymerase chain reaction (RT-PCR) with real-time detection (real-time RT-PCR) can be carried out for this purpose.
  • RT-PCR reverse transcription polymerase chain reaction
  • real-time RT-PCR real-time detection
  • RNA to be quantified is first transcribed into complementary DNA (cDNA) in a separate reaction using a reverse transcriptase (reverse transcription).
  • cDNA complementary DNA
  • reverse transcriptase reverse transcriptase
  • the resulting cDNA is subsequently amplified in a PCR using a heat-stable DNA polymerase (e.g. Thermus aquaticus polymerase, Taq polymerase).
  • real-time detection of the amplification products can be carried out as part of the amplification of the cDNA.
  • Tth polymerase Thermus thermophilis polymerase
  • Thermus thermophilis polymerase is a DNA polymerase from the thermophilic bacterium Thermus thermophilis, which has an exceptionally high reverse transcriptase side activity. This enables a one-step RT-PCR to be carried out with only one enzyme.
  • the magnesium ions that are physiologically used in the reaction must be replaced by manganese ions.
  • the disadvantage is that RNA is degraded in the presence of manganese ions (Carninci, P. et al.
  • thermolabile enzymes by trehalose and its application for the synthesis of fill length cDNA. Proc. Natl. Acad. Sci USA 95 (1998) 520-524), which explains the generally limited sensitivity of this method.
  • reverse transcriptase and Taq DNA polymerase are also possible to use in the same reaction.
  • This method variant enables a high sensitivity and is therefore preferred in qualitative diagnostics for pathogen detection.
  • the reverse transcriptases used come from the two retroviruses Moloney Murine Leukemia Virus (MMuLV) or Avian Myeloma Mirus (AMV).
  • RNA viruses represent a core area of application of RT-PCR in molecular diagnostics.
  • Human immunodeficiency virus-1 (HIV-1) and hepatitis C virus (HCV) in particular must be detected quantitatively, for example in order to increase the viral load in patients under therapy observe. Direct therapeutic indications result from the result of this proof.
  • the quantitative detection of other variable RNA viruses, such as the Lassavirus can also provide information about a prognosis and the response of the therapy.
  • the detection of highly variable viruses ie viruses in which there are changes in the viral nucleic acid sequences in the course of an infection, so-called "Vius variability" poses in particular the problem of detectability with probes mentioned above.
  • probe binding sites must be identified that are conserved. For many of the viruses mentioned, however, this is only possible to a limited extent or not at all.
  • An alternative to the use of probes is sequence-independent detection using DNA-binding dyes
  • RNA is first transcribed reverse in a one-step reaction, the resulting complementary DNA (cDNA) is amplified, and the DNA amplification products (DNA amplificates) are detected independently of the sequence, the efficiency and sensitivity of the enzyme used for reverse transcription are not or not significantly influenced.
  • cDNA complementary DNA
  • DNA amplificates DNA amplification products
  • the object is achieved according to the invention by a method for carrying out a nucleic acid amplification action, in which RNA is reverse transcribed in a one-step reaction, the complementary DNA (cDNA) formed is amplified and the amplified products formed are detected in real time independently of the sequence, one being used for detection thermostable dye that selectively binds to double-stranded deoxyribonucleic acid (dsDNA).
  • dsDNA double-stranded deoxyribonucleic acid
  • the dye is immobilized prior to reverse transcription. Before the amplification, the dye is released again so that it is available for binding to the amplificates.
  • the dye-bound amplificates are detected qualitatively and / or quantitatively.
  • a dye which binds selectively to dsDNA is understood here to mean a dye which binds exclusively or predominantly to double-stranded DNA, but not or only to a small extent to single-stranded DNA (ssDNA).
  • the main advantages of the method according to the invention are that the method has a higher sensitivity than previously known methods for the amplification of nucleic acids with real-time detection, which corresponds to that of an optimized method, such as an RT-PCR without real-time detection of the resulting PCR products.
  • the present method allows sequence-independent detection of the pathogen, ie detection of the amplified products without the need for sequence-specific DNA probes.
  • the uncertainty of probe detection methods used in the prior art for highly variable sequences has already been explained in detail at the beginning. Base mismatches at the probe binding site can not only lead to incorrect results in the quantification, but in extreme cases, false negative test results can result (for example in the diagnostic detection of HIV or hemorrhagic fever viruses).
  • a real-time detection probe is relatively high. For a small synthesis scale (sufficient for approx. 1000 reactions), they currently amount to around DM 500 to DM 1000. A probe also only allows the quantification of a single target sequence. So if about 20 to 30 different cellular RNA species are to be examined for expression studies, such an investigation would cost about DM 14,000 to DM 21,000. These costs exceed the financial possibilities of most institutional or university working groups.
  • the method according to the invention allows the production of a universal detection reagent kit which comprises a partially double-stranded oligonucleotide and a thermostable dye which is selective for dsDNA.
  • the costs are extremely low compared to probe detection.
  • any target sequence can be determined due to the absence of sequence-specific probes, since the detection is sequence-independent, i.e. regardless of a specific nucleotide sequence within the sequence region to be amplified.
  • RT reverse transcription
  • RNA-dependent DNA polymerase an RNA-dependent DNA polymerase
  • the resulting cDNA serves as a starting molecule (template) for a subsequent amplification reaction.
  • the amplification reaction used to multiply the cDNA is preferably a polymerase chain reaction (PCR), but it is also conceivable to amplify with the aid of a NASBA ("nucleic acid sequence based amplification") - Vandamme, AM et al "Detection of HIV-1 RNA in plasma and serum samples using the NASBA amplification system compared to RNA-PCR". J. Virol. Methods 52 (1995) 121-132) or a TMA ("transcription mediated amplification"; Pasternack, R. et al. "Evaluation of the gene sample Chlamydia trachomatis transcription-mediated amplification assay with urine specimens from women" J. Clin. Microbiol. 35 (1997) 676-678).
  • PCR polymerase chain reaction
  • the entire amplification reaction according to the invention corresponds to an RT-PCR.
  • An RT-PCR can basically be carried out as a one-step or two-step reaction.
  • single-stage reaction is understood to mean a reaction or a reaction method in which reverse transcription and DNA amplification take place in succession in the same reaction batch, without the reaction vessel in which the reaction batch is contained being in the course of the Reaction must be opened to add further reaction components.
  • a "two-stage reaction” is understood to mean a reaction or a reaction method in which reverse transcription and DNA amplification take place in succession in two different reaction batches.
  • a reverse transcription is usually first carried out in a small reaction volume in which the conditions for the reverse transcription can be optimally set. After completion of the reverse transcription, all or part of the batch is used in an amplification reaction.
  • the disadvantage of this procedure is an increased risk of contamination and a significantly lower analytical precision due to additional pipetting steps. This disadvantage is avoided by the method according to the invention.
  • the two enzymatic reactions can each be catalyzed by one or more enzymes contained in the reaction mixture.
  • thermostable refers to the property of the dyes to remain functional even at the high temperatures caused by the thermal amplification profile.
  • the dyes are also included
  • the dye used for detection selectively binds to double-stranded DNA.
  • “Selectively bind” is understood to mean the property of the dyes to bind to double-stranded DNA with a significantly higher affinity than to single-stranded DNA.
  • the dye ethidium bromide which is suitable according to the invention not only binds to double-stranded DNA but also to a small extent to single-stranded DNA, but the affinity of the dye used for double-stranded DNA is many times higher than the affinity for single-stranded DNA.
  • the Dyes suitable according to the invention comprise both molecules which bind selectively to dsDNA and which can be detected qualitatively and / or quantitatively either alone or as a dye-nucleic acid complex.
  • a preferred dye according to the invention is the asymmetrical
  • ® Dyes such as SYBR Green or ethidium bromide can be detected using a fluorescence measurement, for example.
  • the binding of the dye to the DNA can be due to various mechanisms. It can be a covalent bond or a non-covalent interaction between the dye molecules and the double-stranded DNA molecules.
  • intercalating dyes are used which penetrate into the spaces between adjacent base pairs of a nucleic acid sequence. Such dyes are
  • the dye is released by the elevated reaction temperatures of the reverse transcription and diffuses into the reaction solution. The rate of diffusion of the dye solution is sufficiently low that the enzyme which catalyzes this reaction step is not inhibited, or is not significantly inhibited, during the reverse transcription.
  • the solvent is dimethyl sulfoxide
  • the dye is immobilized by letting it bind to an at least partially double-stranded oligonucleotide, the melting temperature of which is above the temperature required for carrying out the reverse transcription but below that for
  • Detection of PCR products suitable temperature (80-90 ° C) is.
  • the dye is released by increasing the temperature before or to carry out the amplification.
  • a single-stranded oligonucleotide to which the dye no longer binds is formed from the double-stranded oligonucleotide to which the dye was bound before reverse transcription.
  • oligonucleotides refer to single-stranded DNA molecules, which are preferably about 10 in length have up to 500 base pairs.
  • an “at least partially double-stranded oligonucleotide” is understood to mean a (single-stranded) oligonucleotide in which at least certain regions are present as a DNA double strand due to intramolecular base pairing.
  • the base pairings are preferably formed by inverted sequence repetitions at the 5 'end and and 3' end of the oligonucleotide strand and are therefore specific to one another.
  • the melting temperature of the oligonucleotide is in the range from approximately 45 ° C. to approximately 85 ° C.
  • the “melting temperature” of the oligonucleotide is the temperature that is necessary to convert a completely or partially double-stranded oligonucleotide into a single-stranded oligonucleotide by dissolving the base pairings.
  • the oligonucleotide can be a hairpin-loop oligonucleotide (hairpin oligonucleotide).
  • hairpin oligonucleotide is understood to mean an oligonucleotide which consists of a stem formed by specific base pairing of inverted nucleotide sequence repeats and an open loop. The structural structure is shown schematically in FIG. 2 using the example of a preferred embodiment.
  • the strain largely determines the melting temperature of a hairpin loop oligonucleotide, the melting temperature depending, among other things, on the G / C content and the length of the oligonucleotide as well as on the type of nucleic acid (DNA, RNA or PNA oligonucleotide) and the salt content of the reaction mixture.
  • sequence repeats also play a role.
  • loop denotes the area of an oligonucleotide that is located between two areas that form the base structure of the oligonucleotide through specific base pairing.
  • strain or “strain structure” of the oligonucleotide is understood to mean a double-stranded region of the oligonucleotide which arises from specific base pairing of inverted nucleotide sequence repeats.
  • the hairpin loop oligonucleotide preferably has the general structure shown in FIG. 2.
  • the molecule preferably has a non-basic (abasic) loop sequence which lies between the sequence sections lying at the 5 'end and at the 3' end of the oligonucleotide and capable of forming double strands.
  • abasic abasic loop sequence
  • the conditions and properties mentioned with regard to the hairpin loop oligonucleotide must also apply to the two complementary oligonucleotides.
  • abasic sequence (also referred to as “abasic spacer”) is understood to mean a sequence section which consists of a sequence of non-basic nucleotides (ie of nucleotides which do not contain a base).
  • non-basic nucleotides In contrast to the building blocks typical for nucleic acids, non-basic nucleotides have no purine, pyrimidine or other bases known to the person skilled in the art from nucleic acids and thus consist only of ribose phosphate (eg non-pairing base analogs and universal pairing base analogs, such as poly-inosine).
  • Non-basic nucleotides are well known to the person skilled in the art from oligonucleotide synthesis.
  • the use of non-basic nucleotides in the area of the loop structure of the hairpin oligonucleotide prevents the formation of unspecific base pairs in the area of the loop structure, which can influence the melting point of the oligonucleotide.
  • the hairpin oligonucleotide has the advantage over the oligonucleotides that are freely in solution that the two parent parts rehybridize better due to the spatial proximity to one another, there is only one instead of two free 3 ′ - OH groups, and there is steric hybridization - obstacle to the loop.
  • the hairpin loop oligonucleotide can have a phosphate group instead of the 3 '- OH group.
  • a phosphate group By replacing the 3 'terminal OH group with a phosphate group, interference of the oligonucleotide with the nucleic acid amplification reaction can be prevented.
  • any other substitution can be used which prevents esterification, i.e. e.g. Fluorescein labeling, iodination, biotinylation, etc.
  • the extension of the oligonucleotide during PCR can be prevented, since the DNA polymerase only has the ester bond necessary for the connection of nucleotides between a 5 'phosphate group and a 3' -OH group, but is not able to catalyze between two phosphate groups.
  • Methods for phosphorylation of the 3 'terminus of nucleic acids are well known to those skilled in the art.
  • the complementary sequence sections of the hairpin-loop oligonucleotide have the SEQ ID NO: 1 and SEQ ID NO: 2 shown
  • oligonucleotide sequences on (“SEQ ID NO” stands for the im Sequence listing each key figures “ ⁇ 400>” according to WIPO Standard ST.25).
  • the oligonucleotide sequences are preferably connected by a spacer sequence with a length of 3 to 500, preferably 10 to 60, abasic nucleotides, in particular ribose phosphate residues. A length of 20 ribose phosphate residues is particularly preferred.
  • This molecule with the (nucleic acid) sequence ACAGTAACCTGTACAGACCT-TAGT11111111111111111ACTAAGGTCTGTACAGGTTACTGT (corresponding to ⁇ SEQ ID ID NO: 7>, where "A” for adenine, "C” for cytosine, “T” for thymine, and “G” for guan “stands for ribose phosphate) is referred to in the present case as” SGS3 ".
  • the structure of SGS3 is shown in FIG. 2.
  • the invention further relates to oligonucleotide-dye complexes consisting of an above-mentioned hairpin-loop oligonucleotide (preferably with the sequence ⁇ SEQ ID NO: 6> - 11111111111111111- ⁇ SEQ ID NO: 7>), and a selectively double-stranded deoxyribonucleic acid (dsDNA ) binding
  • the dye is according to one
  • the polymerases which can be used according to the invention in reverse transcription are preferably selected from the following group: DNA polymerase from Thermus fchermophilis (Tth polymerase), reverse transcriptase from Moloney Murine Leukemia Virus (MMuLV-RT) and reverse transcriptase from Avian Myeloma Virus (AMV-RT), reverse transcriptase from Rous Associated Virus (RAV2-RT) and other reverse transcriptases of retroviral origin.
  • Tth polymerase DNA polymerase from Thermus fchermophilis
  • MMuLV-RT Moloney Murine Leukemia Virus
  • AMV-RT Avian Myeloma Virus
  • RAV2-RT Rous Associated Virus
  • the amplification following reverse transcription is cation of the cDNA for a polymerase chain reaction (PCR).
  • a DNA polymerase (s) from the following group is preferably used to carry them out: Thermus aquaticus polymerase (Taq polymerase), Thermus flavus polymerase (Tf1 polymerase), Thermotoga maritima polymerase (Tma polymerase) and Pyococcus furiosus polymerase (fu polymerase).
  • Tfl, Tma and Pfu polymerase are preferred because these polymerases are proofreading enzymes (3 '-5' exonuclease activity) which have a lower error rate than the Taq polymerase.
  • a mixture of several polymerases can also be used, traditionally Pfu and Taq.
  • the present invention further relates to kits for use in or for carrying out the method according to the invention.
  • such a kit contains an at least partially double-stranded oligonucleotide, the melting temperature of which is above the temperature (80-90 ° C.) suitable for the detection of reverse transcription but below the temperature suitable for the detection of PCR products, a dye which is selective to double-stranded DNA binds.
  • the kits preferably contain an oligonucleotide-dye complex mentioned above.
  • the kits optionally contain further reagents and auxiliaries which are usually required to carry out a nucleic acid amplification, in which RNA is reverse transcribed in a one-step reaction, the complementary DNA (cDNA) formed is amplified and in which the amplificates formed
  • reagents can be, for example, reaction buffers act that ensure a concentration of certain ions required for the reaction, such as magnesium (Mg 2+ ) or manganese ions (Mn 2+ ). Furthermore, they can be reagents that inhibit the formation of secondary structures of the RNA and thus 5 increase the efficiency of reverse transcription. It can also be RNAse-free water for preparing the amplification reaction batches or RNAse inhibitors which inhibit enzymatic degradation of the starting RNA by contaminating RNAsen in the reaction batch. 10 In addition, the reagents and auxiliaries for performing nucleic acid amplification can also comprise solutions of the deoxynucleotide triphosphates dATP, dCTP, dGTP and dTTP.
  • kits With regard to the components of the kits, reference is made to the 15 statements above regarding the enzymes, oligonucleotides and dyes used in the method according to the invention and their properties.
  • the kit contains a combination of the enzymes MMuLV-RT and Taq-
  • Lassavirus (Demby, A. et al. "Early diagnosis of Lassa fever by reverse transcription PCR” J. Clin. Microbiol. 32 (1994) 2898-
  • the procedure amounted to approximately 20 copies of RNA transcribed in vitro per reaction.
  • the enzymes used were an MMuLV reverse transcriptase and a Taq DNA polymerase.
  • a Taq DNA polymerase from another manufacturer was also used to test DNA amplification alone
  • Detection of PCR products is 0.001% v / v in the
  • Seconds 56 ° C for 10 seconds, 72 ° C for 25 seconds.
  • RT-PCR inhibits RT but not Taq DNA polymerase
  • amplifications of a small amount of Lassa DNA cloned in a plasmid were performed using a Taq polymerase.
  • Fig. 3 shows the result of the experiment. As can be seen from the figure, the Taq DNA polymerase was in the presence of
  • Fig. 6 shows the simultaneous detection of the last stages of the amplified
  • DMSO in batch row A was apparently long enough to allow efficient reverse transcriptase function.
  • a hairpin oligonucleotide was produced which has a stem-loop structure.
  • the stem-loop structure had a melting point that was above the working temperature of the reverse transcriptase, but below the extension temperature
  • Reverse transcription is immobilized, but is available for detection during the PCR.
  • SGS1 SGS for "SYBR Green suppressor ".
  • SGS SGS for "SYBR Green suppressor ".
  • the sequence of SGS1 is reproduced in the sequence listing under SEQ ID NO: 5, the structure is shown in FIG. 7.
  • SGS1 had an inhibitory effect on the RT-PCR at a concentration of 50 nM.
  • Example 5 The experiment described in Example 5 was repeated using the oligonucleotide SGS3. 10 shows that the inhibition effect only occurs at a concentration of 100 nM SGS3 per reaction.
  • lane 1 shows that the chosen concentration of the dye completely inhibits the amplification of even the highest amounts of RNA (lane 1, 10 9 copies per reaction).
  • a concentration of 50 nM SGS3 was suitable for releasing the inhibition.
  • Higher and lower concentrations of the oligonucleotide were suboptimal, either due to SGS-bound PCR interference (see Example 7)
  • Example 9 Comparison of the sensitivity of the method according to the invention with a conventional, maximally optimized, single-stage RT-PCR
  • the melting point of the SGS3 stem-loop structure had previously been determined experimentally and was 72 ° C, i.e. above
  • the extension step was reduced from 72 ° C to 65 ° C in order to keep the dye in the oligonucleotide bond even during the working temperature of the DNA polymerase. Then the
  • Detection temperature increased from 72 ° C to 82 ° C to a maximum
  • Reaction double strands 60 ° C for 20 seconds (for re-hybridization of all double strands in the reaction, slow heating (0.1 ° C / second) with continuous fluorescence measurement to determine the
  • Fig. 1 Fluorescence excitation and fluorescence emission spectra
  • Fig. 4 Ebola RNA in vitro transcript (10 9-10 6 copies per
  • Lanes 2 and 7 10 9 copies per reaction
  • Lanes 3 and 8 10 8 copies per reaction
  • Lanes 4 and 9 10 7 copies per reaction
  • Fig. 7 Structure sketch of the molecule SGSl. Single-stranded loop segment (37 base random sequence), 30 base pairs of double-stranded parent structure. In contrast to SGS3, the free 3 'OH is present.
  • Fig. 9 Amplification of approximately 10,000 molecules of Ebola RNA with increasing concentration SGSl per reaction, without
  • Lane 1 No SGS; Lane 2: 50 nM; Lane 3:
  • Lane 4 100 nM; Lane 4: 200 nM; Lane 5: 400 nM; Lane 6: 800 nM; Lane 7: 1600 nM; Lane 8: 3200 nM
  • Fig. 10 Amplification of approximately 10,000 molecules of Ebola RNA with the specified concentration SGS3 per reaction, without Sybr
  • Fig. 12 Parallel 1-step RT-PCR amplification of an Ebola RNA
  • Lane 1 negative control
  • Lanes 2 and 6 10 6
  • Lanes 5 and 9 10 3 copies of RNA per reaction.
  • Fig. 13 Associated real-time fluorescence kinetics to Fig. 12. The course of the fluorescence signal is shown, which in reactions 1 to 5 (see label of
  • Fluorescence profiles cf. same position numbers in Fig. 12 was measured during the reaction.
  • the picture corresponds to the usual fluorescence curve of a real-time PCR.
  • Fig. 14 Melting curve analysis of the PCR products in Fig. 12 / Fig. 13; Reactions 1 to 5: same name here. The procedure is described in Example No. 10. 1: melting peak in the negative first derivative of the directly measured fluorescence at 77.5 ° C., corresponding to a primer-dimer artifact. This is not recorded in the real-time kinetics used for the quantification (FIG. 13), since the fluorescence of the reaction is read above 77.5 ° C. 2-5: Reactions 2 to 5 from Fig. 12 / Fig. 13. Clear melting peak at

Abstract

Die Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Amplifikaten. Ferner betrifft die Anmeldung partiell doppelsträngige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens.

Description

Echtzeitdetektion von DNA-Amplifikationsprodukten
Die vorliegende Erfindung betrifft ein Verfahren zur Echtzeitdetektion von Desoxyribonukleinsäure-Aplifikationsprodukten. Ferner betrifft die Anmeldung partiell doppelstrangige Oligonukleotide, die im Rahmen der Echtzeitdetektion Anwendung finden, sowie Kits zur Durchführung des Verfahrens .
Verfahren zur Amplifikation von Desoxyribonukleinsäuren (DNA) ermöglichen deren exponentielle Vervielfältigung und machen auch geringe Nukleinsäuremengen einem qualitativen oder quantitativen Nachweis bzw. weitergehenden Applikationen zugänglich. Verfahren zur Amplifikation von DNA sind im Stand der Technik bekannt und schließen beispielsweise die Polymera- sekettenreaktion (PCR) ein.
Durch den initialen Schritt einer Reversen Transkription (RT) lassen sich auch Ribonukleinsäuren (RNA) mittels DNA-Amplifikation vervielfältigen. In der Regel werden die Produkte solcher Amplifikationsverfahren nach Abschluß der Reaktion durch eine Endpunktanalyse bestimmt. Geeignete Verfahren zur qualitativen und/oder quantitativen Bestimmung von Amplifikationsprodukten sind im Stand der Technik hinreichend bekannt und umfassen beipielsweise photometrische Messmethoden oder die Analyse mittels Agarose-Gelelektrophorese.
Bei DNA-Amplifikationsverfahren wie der PCR ist es auch möglich, bereits während der Amplifikation der DNA die entsprechenden Produkte nachzuweisen. Der im Verlauf der PCR erfolgende Nachweis von PCR-Amplifikationsprodukten ermöglicht die Erhebung einer Reaktionskinetik, womit eine verläßliche Quantifizierung der in die PCR eingebrachten Menge an DNA verbunden ist (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193) . Dieses PCR- Verfahren mit Echtzeitdetektion der PCR-Produkte (auch "real- time PCR" genannt) ist seit mehreren Jahren etabliert und erfährt derzeit einen enormen Zuwachs hinsichtlich seiner Anwendungsgebiete, insbesondere in den Bereichen der molekula- ren Erregerdiagnostik und der Genexpressionsanalyse (Bustin, S. "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays" J Mol Endocrinol 25 (2000) 169-193) . Zum Nachweis des entstehenden PCR-Produktes während der Reaktion kommen dabei verschiedene technische Detektionsprinzipien zur Anwendung:
1. 5'-Nuklease PCR ("TaqMan-PCR")
Eine doppelt fluoreszenzmarkierte DNA-Sonde hybridisiert mit dem PCR-Produkt und wird durch die 5 ' -Nukleaseaktivitat der verwendeten DNA-Polymerase verdaut. Es kommt dabei zur physikalischen Trennung der beiden auf der Sonde befindlichen Fluorophore und zu einer detektierbaren Reversion eines Energietransferprozesses (Livak, K. et al. "Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization" PCR Methods Appl 4 (1995) 357-362).
2. Molecular Beacons
Diesem Verfahren liegt das gleiche Prinzip zugrunde, jedoch erfolgt die Reversion des Energietransfers hier über eine sterische Konformationsänderung in der Sekundärstruktur der Sonde, die durch den Hybridisierungsvorgang ausgelöst wird. Ein Verdau der Sonde ist nicht nötig (Tan, . et al. "Molecular beacons: a novel DNA probe for nucleic acid and protein studies" Chemistry 6 (2000) 1107-1111) .
3. Hybridization Probes
Bei diesem Verfahren beruht die Detektion auf einem Neuauftreten von Energietransfer, wenn zwei DNA-Sonden benachbart an einem DNA-Strang hybridisieren (Bernhard, P. B. und ittwer, C. T. "Homogenous amplification and variant detection by fluorescent hybridization probes" Clin Chem 46 (2000) 147-148) .
®
4. Sequenzunspezifischer Nachweis mit SYBR Green I
® SYBR Greenl ist ein unsymmetrischer Cyanin-Farbstoff, der un- abhängig von der Sequenz in doppelstrangige DNA (dsDNA) inter- kaliert, wobei der dsDNA-gebundene Farbstoff effizient bei ca.
488 nm und ca. 254 nm angeregt weden kann. Durch seine
® Thermostabilität ermöglicht SYBR Green I einen real-time
Nachweis von PCR-Produkten (Wittwer, C. T. et al. "Continuous fluorescence monitoring of rapid cycle DNA amplification"
Biotechniques 22 (1997) 130-138) . Zahlreiche unsymmetrische
Cyanin-Frabstoffe sind z.B. in US 5,436,134, US 5,658,751, WO
® ®
94/24213 und WO 96/13552 offenbart. Bei SYBR Green I und SYBR
Gold handelt es sich um interkalierende Farbstoffe mit außergewöhnlich hoher Affinität zu dsDNA. Interkalierende Farbstoffe besitzen die Eigenschaft, sich in die "Minor Groove" ("kleine Furche") von doppelsträngiger DNA einzulagern. Durch diese Bindung wird die Fluoreszenz bei gleicher Anregungs- intensität um ein vielfaches verstärkt, und man erhält ein Signal, dessen Intensität direkt proportional zu der Zahl der vorhandenen Doppelstränge ist. Der dsDNA-gebundene Farbstoff
® SYBR Green I besitzt eine Haupt-Anregungsbande bei 497 nm
(weitere Anregungsmaxima liegen bei etwa 290 nm und etwa 380
® nm) , das Emissionsmaximum des SYBR Green I-Nukleinsäure-
® komplexes liegt bei etwa 520 nm. SYBR Green I kann effizient bei ca. 488 nm und ca. 254 nm angeregt weden. Der dsDNA-
® gebundene Farbstoff SYBR Gold weist einen Haupt-Anregungsmaximum bei etwa 495 nm auf, ein weiterer Anregungspeak liegt
® bei etwa 300 nm, und das Emissionsmaximum des SYBR Gold-Nu- kleinsäurekomplexes liegt bei etwa 537 nm. Die Fluoreszenz-
® Anregungs- und Fluoreszenz-Emissionsspektren von SYBR Green I
® und SYBR Gold sind in Fig. 1 dargestellt.
Bei den unter 1. bis 3. oben genannten Verfahren sind sequenz- spezifische DNA-Detektionssonden erforderlich, deren Synthese aufwendig und teuer ist . Gleichzeitig muß in der nachzuweisenden Nukleinsäure zumindest der Bereich der Sondenbindungsstellen hochgrading konserviert sein. Ein Nachweis variabler Sequenzen ist mit Sonden nicht zuverlässig möglich.
In vielen Bereichen der Molekularbiologie, vor allem bei der Analyse von Genexpression und beim Nachweis von RNA-Viren wie HIV-1 oder HCV, ist die Amplifikation und Quantifizierung von RNA durch die PCR wünschenswert. Hierzu kann prinzipiell eine Reverse Transkription-Polymerasekettenreaktion (RT-PCR) mit Echtzeitdetektion (real-time RT-PCR) durchgeführt werden. Eine RT-PCR kann generell mittels zweier unterschiedlicher Verfahren erfolgen.
Bei der zweistufigen RT-PCR (2-Step RT-PCR) wird die zu quantifizierende RNA zunächst in einer separaten Reaktion mit Hilfe einer Reversen Transkriptase in komplementäre DNA (cDNA) transkribiert (Reverse Transkription) . Die entstandene cDNA wird im folgenden in einer PCR mittels einer hitzestabilen DNA- Polymerase (z.B. Thermus aquaticus Polymerase, Taq-Polymerase) amplifizert.
Bei der einstufigen RT-PCR (1-Step RT-PCR) erfolgen Reverse Transkription und Amplifikation unmittelbar hintereinander in derselben Reaktion. Diese Variante bietet drei wesentliche Vorteile: (i) deutlich höhere analytische Präzision in der Quantifizierung durch Wegfall eines Pipettierschrittes; (ii) verringerte Kontaminationsgefahr in der qualitativen Diagnostik durch weniger Manipulationsschritte (Kwok, S. und Higuchi, R. "Avoiding false positives with PCR" Nature 339 (1989) 237-238) ; (iii) erhöhte Sensitivität in beiden Anwendungsbereichen durch Wegfall eines Verdünnungsfaktors zwischen RT und PCR.
Sowohl bei der einstufigen als auch die zweistufigen RT-PCR kann im Rahmen der Amplifikation der cDNA eine Echtzeitdetektion der Amplifikationsprodukte durchgeführt werden.
Die Durchführung von einstufigen RT-PCR Reaktionen kann mit Hilfe einer einzelnen Thermus thermophilis Polymerase (Tth- Polymerase) oder mittels Enzymkombinationen erfolgen. Die Tth Polymerase ist eine DNA Polymerase aus dem thermophilen Bakterium Thermus thermophilis, die eine außergewöhnlich hohe Reverse Transkriptase-Nebenaktivität besitzt. Dadurch kann eine einstufige RT-PCR mit nur einem Enzym realisiert werden. Zur Entwicklung einer maximalen RT-Aktivität bei Verwendung der Tth-Polymerase müssen dabei die physiologischerweise in der Reaktion verwendeten Magnesiumionen durch Manganionen ersetzt werden. Nachteilig wirkt sich aber aus, daß RNA in Gegenwart von Manganionen degradiert wird (Carninci, P. et al. "Thermo- stabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of füll length cDNA. Proc. Natl. Acad. Sei. USA 95 (1998) 520-524) . Dies erklärt die generell limitierte Sensitivität dieses Verfahrens.
Durch Optimierung der Pufferbedingungen ist es auch möglich, Reverse Transkriptase und Taq DNA-Polymerase in derselben Reaktion zu verwenden. Diese Verfahrensvariante ermöglicht eine hohe Sensitivität und wird daher in der qualitativen Diagnostik zum Erregernachweis bevorzugt. Die verwendeten Reversen Trans- kriptasen stammen dabei aus den beiden Retroviren Moloney Murine Leukemia Virus (MMuLV) oder Avian Myeloma Mirus (AMV) .
Der Nachweis hochvariabler RNA-Viren stellt einen Kernanwendungsbereich der RT-PCR in der Molekulardiagnostik dar. Insbesondere Humanes Immundefizienz Virus-1 (HIV-1) und Hepatitis C Virus (HCV) müssen quantitativ nachgewiesen werden, etwa um die Viruslast bei Patienten unter Therapie zu beobachten. Aus dem Ergebnis dieses Nachweises ergeben sich direkte Therapieindikationen. Auch der quantitative Nachweis anderer variabler RNA-Viren, wie etwa des Lassavirus, kann über eine Prognose und das Ansprechen der Therapie Auskunft geben. Beim Nachweis hochvariabler Viren (d.h. Viren, bei denen es im Verlauf einer Infektion zu Änderungen der viralen Nukleinsäuresequenzen kommt, sogen. "Viusvariabilität") stellt sich insbesondere das oben angesprochene Problem der Nachweisbarkeit mit Sonden. Soll die PCR mit Echtzeitdetektion zur Quantifizierung dieser Viren ausgenutzt werden, müssen Sondenbindungsstellen identifiziert werden, die konserviert sind. Dies ist bei vielen der angesprochenen Viren jedoch nur eingeschränkt oder gar nicht möglich. Eine Alternative zur Verwendung von Sonden stellt die sequenz- unabhängige Detektion mit Hilfe von DNA-bindenden Farbstoffen
® wie SYBR Green I (s.o.) dar. Dieses Verfahren ist zum gegen- wärtigen Zeitpunkt noch nicht zufriedenstellend realisiert, da die retroviralen Reversen Transkriptasen, die in der
® Erregerdiagnostik eingesetzt werden, extrem stark durch SYBR
Green I gehemmt werden, und zwar bereits bei relativ niedrigen
Konzentrationen, die für eine Detektion gerade noch ausreichen (0,001% v/v). Dieser Umstand erzwingt eine Trennung von
Reverser Transkription und PCR mit den bereits erwähnten
Nachteilen. Das heißt, eine einstufige RT-PCT (1-Step RT-PCR) ist bislang unter Verwendung retroviraler Reverser
Transkriptasen nur sehr eingeschränkt möglich.
® Da DNA-Polymerasen durch SYBR Green I nicht gehemmt werden, kann eine einstufige RT-PCR mit Tth DNA-Polymerase in Gegenwart
® von SYBR Green I jedoch durchgeführt werden, indem man die
Reverse Transkriptase-Nebenaktivität der Tth Polymerase ausnutzt.
Tth Polymerase-enthaltende einstufige RT-PCR-Systeme für
® Detektionen mit SYBR Green I sind im Stand der Technik bekannt
(Fa. Röche) ; sie weisen jedoch den bereits erwähnten Nachteil einer geringen Sensitivität auf.
Aufgabe der vorliegenden Erfindung ist es daher, ein Echtzeit- Detektionsverfahren bereitzustellen, bei dem man in einer einstufigen Reaktion RNA zunächst revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert, und man die DNA-Amplifikationsprodukte (DNA-Amplifikate) sequenzunabhängig detektiert, wobei Effizienz und Sensitivität des zur Reversen Transkription verwendeten Enzyms nicht oder nicht signifikant beeinflußt werden. Insbesondere ist es Aufgabe der Erfindung ein sensitives 1-Step RT-PCR-Verfahren mit (vorzugsweise sequenzunabhängiger) Echtzeit-Detektion der Amplifikate bereitzustellen. Vorzugsweise weist dieses Verfahren eine Sensitivität auf, die es erlaubt weniger as 1000 Kopien eines RNA-Moleküls nachzuweisen.
Die Aufgabe wird erfindungsgemäß durch ein Verfahren zur Durchführung einer Nukleinsäureamplifikaktion gelöst, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, man die gebildete komplementäre DNA (cDNA) amplifiziert und man die gebildeten Amplifikate sequenzunabhängig in Echtzeit detek- tiert, wobei man zur Detektion einen thermostabilen Farbstoff verwendet, der selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindet. Um eine Hemmung des Enzyms, das die reverse Transkription katalysiert, zu vermeiden, wir der Farbstoff vor der reversen Transkription immobilisiert. Vor der Amplifikation wird der Farbstoff wieder freigesetzt, damit er zur Bindung an die Amplifikate zur Verfügung steht. Die Farbstoff-gebundenen Amplifikate werden erfindungsgemäß qualitativ und/oder quantitativ nachgewiesen.
Unter einem selektiv an dsDNA bindenden Farbstoff wird vorliegend ein Farbstoff verstanden, der ausschließlich oder überwiegend an doppelstrangige DNA, jedoch nicht oder nur in geringem Umfang an einzelsträngige DNA (ssDNA) bindet.
Die wesentlichen Vorteile des erfindungsgemäßen Verfahrens bestehen darin, daß das Verfahren gegenüber bislang bekannten Verfahren zur Amplifikation von Nukleinsäuren mit Echtzeitdetektion eine höhere Sensitivität aufweist, die der eines optimierten Verfahrens, wie beispielsweise einer RT-PCR ohne Echtzeitdetektion der entstehenden PCR-Produkte, entspricht. Gleichzeitig erlaubt das vorliegende Verfahren einen sequenzunabhängigen Erregernachweis, d.h. eine Detektion der Amplifikate ohne die Notwendigkeit sequenzspezifischer DNA- Sonden. Die Unsicherheit von im Stand der Technik eingesetzten Sondendetektionsverfahren bei hochvariablen Sequenzen wurde eingangs bereits ausführlich erläutert . Basenfehlpaarungen an der Sondenbindungsstelle können nicht nur zu falschen Ergebnissen bei der Quantifizierung führen, sondern im Extremfall können sich falsch negative Testergebnisse ergeben (beispielsweise beim diagnostischen Nachweis von HIV oder hämorrhagisehen Fieberviren) . Ferner sind die Kosten für eine Echtzeitdetektionssonde relativ hoch. Sie belaufen sich für einen kleinen Synthesemaßstab (ausreichend für ca. 1000 Reaktionen) derzeit auf etwa DM 500,- bis DM 1000,-. Auch erlaubt eine Sonde immer nur die Quantifizierung einer einzigen Zielsequenz. Sollen also für Expressionsstudien etwa 20 bis 30 verschiedene zelluläre RNA-Spezies untersucht werden, kostete eine solche Untersuchung etwa DM 14000,- bis DM 21000,-. Diese Kosten übersteigen die finanziellen Möglichkeiten der meisten institutionellen bzw. universitären Arbeitsgruppen.
Demgegenüber erlaubt das erfindungsgemäße Verfahren die Herstellung eines universellen Detektionsreagenz-Kits, das ein teilweise doppelsträngiges Oligonukleotid und einen thermostabilen, für dsDNA selektiven Farbstoff umfasst. Die Kosten sind Vergleich zu einer Sondendetektion äußerst niedrig. Gleich- zeitig kann aufgrund des Verzichts auf sequenzspezifische Sonden jede beliebige Zielsequenz bestimmt werden, da die Detektion sequenzunabhängig, d.h. unabhängig von einer bestimmten Nukleotidsequenz innerhalb des zu amplifizierenden Sequenzbereichs, erfolgt.
Im Rahmen der vorliegenden Erfindung wird unter "Reverser Transkription" (RT) eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem RNA als Matritze für die Bildung komplementärer DNA (cDNA) verwendet wird. Der Vorgang der cDNA- Synthese kann dabei von einer RNA-abhängigen DNA-Polymerase katalysiert werden, die vorliegend auch als "Reverse Trans- kriptase" bezeichnet wird.
Die entstandene cDNA dient einer nachfolgenden Amplifikationsreaktion als Ausgangsmolekül (Templat) . Bei der zur Vermehrung der cDNA angewendeten Amplifikationsreaktion handelt es sich vorzugsweise um eine Polymerase-Ketten-Reaktion (PCR) , es ist jedoch auch denkbar, die Amplifikation mit Hilfe einer NASBA ("nucleic acid sequence based amplification" ,- Vandamme, A.M. et al. "Detection of HIV-1 RNA in plasma and serum samples using the NASBA amplification System compared to RNA-PCR" . J. Virol . Methods 52 (1995) 121-132) oder einer TMA ( "transcription mediated amplification" ; Pasternack, R. et al. "Evaluation of the Gen-probe Chlamydia trachomatis transcription-mediated amplification assay with urine specimens from women" J. Clin. Microbiol. 35 (1997) 676-678) durchzuführen.
Erfolgt die Amplifikation mit Hilfe einer PCR, so entspricht die gesamte erfindungsgemäße Amplikationsreaktion einer RT-PCR. Eine RT-PCR ist grundsätzlich als einstufige oder zweistufige Reaktion durchführbar.
Im Rahmen der vorliegenden Erfindung wird unter dem Begriff "einstufige Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation unmittelbar hintereinander in demselben Reaktionsansatz erfolgen, ohne daß das Reaktionsgefäß, in dem der Reaktionsansatz enthalten ist, im Verlauf der Reaktion geöffnet werden muß, um weitere Reaktionskomponenten zuzufügen.
Im Gegensatz dazu wird unter einer "zweistufigen Reaktion" eine Reaktion oder ein Reaktionsverfahren verstanden, bei dem Reverse Transkription und DNA-Amplifikation hintereinander in zwei verschiedenen Reaktionsansätzen erfolgen. Dazu wird in der Regel zunächst eine Reverse Transkription in einem kleinen Reaktionsvolumen durchgeführt, in dem die Bedingungen der für die Reverse Transkription optimal eingestellt werden können. Nach Abschluß der reversen Transkription wird der gesamte Ansatz oder ein Teil desselben in eine Amplifikationsreaktion eingesetzt. Der Nachteil dieser Vorgehensweise besteht in einem erhöhten Kontaminationsrisiko sowie einer deutlich geringeren analytischen Präzision durch zusätzliche Pipettierschritte. Dieser Nachteil wird durch das erfindungsgemäße Verfahren vermieden.
Im Rahmen der vorliegenden Erfindung können die beiden enzymatischen Reaktionen (Reverse Transkription und Amplifikation) von jeweils einer oder von mehreren im Reaktionsansatz enthaltenen Enzymen katalysiert werden.
Die im Rahmen der Erfindung vewendeten Farbstoffe sind thermostabil. Der Begriff "thermostabil" bezeichnet vorliegend die Eigenschaft der Farbstoffe, auch bei den durch das thermische Amplifikationsprofil bedingten hohen Temperaturen funktionstüchtig zu bleiben. Die Farbstoffe sind auch bei
Detektionstemperaturen von über 80°C in der Lage, an doppelstrangige DNA zu binden. Durch Erhitzen auf Temperaturen von über 90°C darf außerdem keinerlei irreversible Strukturänderung des Farbstoff-Moleküls erfolgen, der eine nachträgliche Beeinträchtigung der Fuhktonalität bei einer für die Detektion übliche Temperatur zur Folge hat.
Der zur Detektion verwendete Farbstoff bindet selektiv an doppelstrangige DNA. Unter "selektiv binden" wird dabei die Eigenschaft der Farbstoffe verstanden, mit deutlich höherer Affinität an doppelstrangige DNA zu binden als an einzelsträngige DNA. So bindet beispielsweise der erfindungsgemäß geeignete Farbstoff Ethidiumbromid zwar nicht ausschließlich an doppelstrangige DNA, sondern auch in geringem Maße an einzelsträngige DNA, doch ist die Affinität des verwendeten Farbstoffs zu doppelsträngiger DNA um ein Vielfaches höher als die Affinität zu einzelsträngiger DNA. Die erfindungsgemäß geeigneten Farbstoffe umfassen sowohl selektiv an dsDNA bindende Moleküle, die entweder allein oder als Farbstoff-Nukleinsäure-Komplex qualitativ und/oder quantitativ nachweisbar sind.
Ein erfindungsgemäß bevorzugter Farbstoff ist der unsymmetri-
® sehe Cyaninfarbstoff SYBR Green I.
® Der Nachweis von Farbstoffen wie SYBR Green oder Ethidiumbromid kann beispielsweise über eine Fluoreszenzmessung erfolgen.
Die Bindung des Farbstoffs an die DNA kann auf verschiedene Mechanismen zurückzuführen sein. Es kann sich um eine kovalente Bindung oder eine nicht-kovalente Interaktion zwischen den Farbstoff-Molekülen und den doppeisträngigen DNA-Molekülen handeln. So werden gemäß einer erfindungsgemäß bevorzugten Ausführungsform beispielsweise interkalierende Farbstoffe verwendet, die in die Zwischenräume benachbarter Basenpaare einer Nukleinsäuresequenz eindringen. Derartige Farbstoffe sind
® dem Fachmann gut bekannt und umfassen u.a. SYBR Green und
Ethidiumbromid. Die Bindung dieser Farbstoffe beruht auf einer
Wechselwirkung der aromatischen Ringsysteme mit den planaren
Heterocyclen der Nukleinsäure-Basen.
Gemäß einer bevorzugten Ausführungsform der Erfindung wird der
® ®
Farbstoff aus der Gruppe bestehend aus SYBR Green I, SYBR Green
II und Ethidiumbromid ausgewählt. Ferner sind die Farbstoffe
PicoGreen (vgl. E.L. Romppanen et al . , Anal. Biochem. 279
(2000) 111-114), Y0-PR0-1 (vgl. I.D. Johnson et al., Biophys . J. 61 (1992) A314, Abstract Nr. 1806), YOYO-1 (H.S. Rye et al.,
Anal. Biochem. 208 (1993) 144-150) und Hoechst 33258 (4- [5- (4-
Methyl-1-piperazinyl) [2,5' -bis-lH-benzimidazol] -2 ' -yl] -phenol- trihydrochlorid; Chemical Abstracts Registry Nr. 23491-45-4; vgl. R. Rago et al., Anal. Biochem. 191 (1990) 31-34) geeignet. Im Rahmen der vorliegenden Erfindung wird der Farbstoff vor der
Reversen Transkription immobilisiert. Gemäß einer bevorzugten
Ausführungsform erfolgt das Immobilisieren, indem man den Farbstoff in einem Lösungsmittel mit einem Schmelzpunkt im
Bereich von 10°C bis 40°C löst und man die Farbstofflösung am Boden des Reaktionsgefäßes "festfriert" . das Festfrieren kann in handelsüblichen Behältnissen, wie beispielsweise PCR- Reaktionsbehältern erfolgen. Dabei wird der Farbstoff durch die erhöhten Reaktionstemperaturen der Reversen Transkription freigesetzt und diffundiert in die Reaktionslösung. Die Diffusionsgeschwindigkeit der Farbstofflösung ist ausreichend gering, um während der Reversen Transkription das Enzym, welches diesen Reaktionsschritt katalysiert, nicht oder nicht wesentlich zu inhibieren.
Gemäß einer besonders bevorzugten Ausführungsform der Erfindung handelt es sich bei dem Lösungsmittel um Dimethylsulfoxid
(DMSO) , welches einen Schmelzpunkt von 18,45°C aufweist.
Gemäß einer weiteren Ausführungsform der Erfindung immobilisiert man den Farbstoff, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden läßt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur aber unterhalb der zur
Detektion von PCR-Produkten geeigneten Temperatur (80-90°C) liegt. Der Farbstoff wird dadurch freigesetzt, daß man die Temperatur vor bzw. zur Durchführung der Amplifikation erhöht. Dabei wird aus dem doppelsträngigen Oligonukleotid, an das der Farbstoff vor der Reversen Transkription gebunden war, ein einzelsträngiges Oligonukleotid gebildet, an das der Farbstoff nicht mehr bindet.
Als "Oligonukleotide" werden vorliegend einzelsträngige DNA- Moleküle bezeichnet, die vorzugsweise eine Länge von etwa 10 bis 500 Basenpaaren aufweisen.
Unter einem "zumindest teilweise doppelsträngigen Oligonukleotid" versteht man im Rahmen der vorliegenden Erfindung ein (einzelsträngiges) Oligonukleotid, bei dem zumindest bestimmte Bereiche durch intramolekulare Basenpaarung als DNA-Doppelstrang vorliegen. Die Basenpaarungen kommen dabei vorzugsweise durch invertierte Sequenzwiederholungen am 5 ' -Ende und und 3 ' -Ende des Oligonukleotidstrangs zustande und sind somit zueinander spezifisch.
Gemäß einer besonders bevorzugten Ausführungsform der vorliegenden Erfindung liegt die Schmelztemperatur des Oligonukleotids im Bereich von etwa 45°C bis etwa 85°C. Als "Schmelz- temperatur" des Oligonukleotids wird erfindungsgemäß diejenige Temperatur bezeichnet, die notwendig ist, um ein vollständig oder teilweise doppelsträngiges Oligonukleotid durch Auflösen der Basenpaarungen in ein einzelsträngiges Oligonukleotid zu überführen.
Erfindungsgemäß kann es sich bei dem Oligonukleotid um ein Haarnadelschleifen-Oligonukleotid (Hairpin-Oligonukleotid) handeln. Unter "Haarnadelschleifen-Oligonukleotid" wird in diesem Zusammenhang ein Oligonukleotid verstanden, welches aus einem durch spezifische Basenpaarung invertierter Nukleotidsequenz-Wiederholungen gebildeten Stamm und einer offenen Schleife besteht. Der strukturelle Aufbau ist in Fig. 2 schematisch am Beispiel einer bevorzugten Ausführungsform dargestellt. Der Stamm bestimmt maßgeblich die Schmelztemperatur eines Haarnadelschleife-Oligonukleotids, wobei die Schmelztemperatur unter anderem vom G/C-Gehalt und der Länge des Oligonukleotids sowie von der Art der Nukleinsäure (DNA- , RNA oder PNA-Oligonukleotid) und dem Salzgehalt der Reaktionsmischung abhängt. Bei Oligonukleotiden mit einer Länge von ≥ 5 bp spielen auch Sequenzwiederholungen eine Rolle. Diese Faktoren sind dem Fachmann wohlbekannt, und die Einstellung der Schmelztemperatur ist daher auf relativ einfache Weise möglich (vgl. z.B. F. Schaeffer et al., EMBO J. 1 (1982) 99-105; J. De Ley, J. Bacteriol . 101 (1970) 738-754; T. Latham et al . DNA 8 (1989) 223-231).
Der Begriff "Schleife" bezeichnet dabei den Bereich eines Oligonukleotids, der zwischen zwei Bereichen lokalisiert ist, die durch spezifische Basenpaarung die Stamm-Struktur des Oligonukleotids bilden. Unter "Stamm" oder "Stamm-Struktur" des Olignukleotids wird erfindungsgemäß ein doppelsträngiger Bereich des Oligonukleotids verstanden, der durch spezifische Basenpaarung invertierter Nukleotidsequenz-Wiederholungen entsteht.
Bevorzugt besitzt das Haarnadelschleifen-Oligonukleotid die in Fig. 2 dargestellte allgemeine Struktur. Vorzugsweise weist das Molekül eine nicht-basische (abasische) Schleifen-Sequenz auf, die zwischen den am 5 ' -Ende und am 3 ' -Ende des Oligonukleotids liegenden und zur Doppelstrangbildung befähigten Sequenz- abschnitten liegt. Im Rahmen der vorliegenden Erfindung können anstelle des Haarnadelschleifen-Oligonukleotids auch zwei einzelne, revers komplementäre Oligonukleotide verwendet werden, die am 3 ' -OH-Ende phosphoryliert sind. Die in Bezug auf das Haarnadelschleifen-Oligonukleotid genannten Bedingungen und Eigenschaften müssen auch für die beiden komplementären Oligonukleotide gelten.
Unter "abasischer Sequenz" (auch als "abasischer Spacer" bezeichnet) wird im Rahmen der vorliegenden Erfindung ein Sequenzabschnitt verstanden, der aus einer Abfolge nichtbasischer Nukleotide besteht (d.h. aus Nukleotiden, die keine Base enthalten) . Im Gegensatz zu den für Nukleinsäuren typischen Bausteinen besitzen nicht-basische Nukleotide keine Purin-, Pyrimidin- oder andere, dem Fachmann aus Nukleinsäuren bekannte Basen und bestehen somit lediglich aus Ribosephosphat (z.B. nicht-paarende Basenanaloga und universell paarende Basenanaloga, wie poly-Inosin) . Nicht-basische Nukleotide sind dem Fachmann aus der Oligonukleotid-Synthese hinreichend bekannt. Die Verwendung nicht-basischer Nukleotide im Bereich der Schleifen-Struktur (loop-Struktur) des Hairpin- Oligonukleotids verhindert die Ausbildung unspezifischer Basenpaarungen im Bereich der Schleife-Struktur, die den Schmelzpunkt des Oligonukleotids beeinflußen können. Das Hairpin-Oligonukleotid weist gegenüber den frei in Lösung befindlichen Oligonukleotiden den Vorteil auf, daß die beiden Stammteile infoge der räumlichen Nähe zueinander besser rehybridisieren, es liegt nur eine anstelle von zwei freien 3 ' - OH-Gruppen vor, und es besteht ein sterisches Hybridisierungs- hindernis für den Loop.
Zusätzlich zu der abasischen Spacer-Sequenz kann das Haarnadelschleifen-Oligonukleotid eine Phosphatgruppe anstelle der 3 ' - OH-Gruppe aufweisen. Durch den Austausch der 3 ' -terminalen OH- Gruppe durch eine Phosphatgruppe kann man eine Interferenz des Oligonukleotids mit der Nukleinsäureamplifikationsreaktion verhindern. Anstelle der Phosphorylierung am 3 ' -terminalen Ende kann auch jede sonstige Substitution eingesetzt werden, die eine Esterifizierung verhindert, d.h. z.B. Fluorescein- Markierung, Iodierung, Biotinylierung, etc. Durch den Austausch der Hydroxylgruppe kann die Verlängerung des Oligonukleotids bei der PCR verhindert werden, da die DNA-Polymerase die für die Verknüpfung von Nukleotiden notwendige Esterbindung nur zwischen einer 5 ' -Phosphatgruppe und einer 3 ' -OH-Gruppe, nicht aber zwischen zwei Phosphatgruppen zu katalysieren vermag. Verfahren zur Phosphorylierung des 3 ' -Terminus von Nukleinsäuren sind dem Fachmann wohlbekannt.
Gemäß einer besonderen Ausführungsform der Erfindung weisen die komplementären Sequenzabschnitte des Haarnadelschleifen- Oligonukleotids die SEQ ID NO:l und SEQ ID NO: 2 dargestellten
Nukleotidsequenzen auf ("SEQ ID NO" steht für die im Sequenzprotokoll jeweils enthaltenen Kennzahlen "<400>" gemäß WIPO Standard ST.25) . Die Oligonukleotid-Sequenzen sind vorzugsweise durch eine Spacer-Sequenz einer Länge von 3 bis 500, vorzugsweise 10 bis 60 abasischen Nukleotiden, insbesondere Ribose-Phosphatresten, verbunden. Eine Länge von 20 Ribose-Phosphatresten ist besonders bevorzugt. Dieses Molekül mit der (Nukleinsäure-) Sequenz ACAGTAACCTGTACAGACCT- TAGT11111111111111111111ACTAAGGTCTGTACAGGTTACTGT (entsprechend <SEQ ID ID NO:7>, wobei "A" für Adenin, "C" für Cytosin, "T" für Thymin, "G" für Guanin und "1" für Ribosephosphat steht) wird vorliegend mit "SGS3" bezeichnet. Die Struktur von SGS3 ist in Fig. 2 wiedergegeben.
Gegenstand der Erfindung sind ferner Oligonuleotid-Farbstoff- Komplexe bestehend aus einem oben genannten Haarnadelschleifen- Oligonukleotid (vorzugsweise mit der Sequenz <SEQ ID NO:6>- 11111111111111111111-<SEQ ID NO:7>), und einem selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindenden
Farbstoff. Bei dem Farbstoff handelt es sich gemäß einer
® ® bevorzugten Ausführungsform um SYBR Green I, SYBR Green II oder
Ethidiumbromid.
Die Polymerasen, die erfindungsgemäß bei der Reversen Transkription Anwendung finden können, sind vorzugsweise aus der folgenden Gruppe ausgewählt: DNA-Polymerase aus Thermus fchermo- philis (Tth-Polymerase) , Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT) und Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT) , Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und andere Reverse Transkriptasen retroviralen Ursprungs. Erfindungsgemäß können ein oder mehrere Enzyme aus dieser Gruppe für die Reverse Transkription verwendet werden.
Gemäß einer weiteren Ausführungsform der Erfindung handelt es sich bei der auf die Reverse Transkription folgenden Amplifi- kation der cDNA um eine Polymerasekettenreaktion (PCR) . Zu deren Durchführung verwendet man vorzugsweise eine DNA-Polyme- rase(n) aus der folgenden Gruppe: Thermus aquaticus-Polymerase (Taq-Polymerase) , Thermus flavus-Polymerase (Tf1-Polymerase) , Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase ( fu-Polymerase) . Gemäß einer besonderen Ausführungsform sind Tfl-, Tma- und Pfu-Polymerase bevorzugt, da diese Polymerasen proofreading-Enzyme (3 ' -5 ' -Exonuclease Aktivität) sind, die eine geringere Fehlerrate als die Taq- Polymerase aufweisen. Es kann auch eine Mischung aus mehreren Polymerasen verwendet werden, klassischerweise Pfu und Taq.
Gemäß einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens verwendet man zur Nukleinsäureamplifikation eine Kombination von MMuLV-RT und
® Taq-Polymerase und für die Detektion SYBR Green I als
Farbstoff .
Die vorliegende Erfindung betrifft ferner Kits zur Verwendung in oder zur Durchführung des erfindungsgemäßen Verfahrens.
Gemäß einer Ausführungsform enthält ein solches Kit ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelztemperatur oberhalb der zur Durchführung der Reversen Transkription aber unterhalb der zur Detektion von PCR- Produkten geeigneten Temperatur (80-90°C) liegt, einen Farbstoff, der selektiv an doppelstrangige DNA bindet. Vorzugsweise enthalten die Kits einen oben genannten Oligonukleotid-Farbstoff-Komplex. Die Kits enthalten gegebenenfalls weitere Reagenzien und Hilfsmittel, die man üblicherweise zur Durchführung einer Nukleinsäureamplifikation benötigt, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate
(sequenzunabhängig) in Echtzeit detektiert. Bei diesen Reagenzien kann es sich beispielsweise um Reaktionspuffer handeln, die eine für die Reaktion erforderliche Konzentration bestimmter Ionen, wie Magnesium- (Mg2+) oder Manganionen (Mn2+) , gewährleisten. Weiterhin kann es sich um Reagenzien handeln, die eine Ausbildung von Sekundärstrukturen der RNA hemmen und 5 somit die Effizienz der Reversen Transkription erhöhen. Es kann sich ferner um RNAse-freies Wasser zum Ansetzen der Amplifikations-Reaktionsansätze oder um RNAse-Inhibitoren handeln, die eine enzymatische Degradation der Ausgangs-RNA durch kontaminierende RNAsen im Reaktionsansatz inhibieren. 10 Darüber hinaus können die Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation auch Lösungen der Desoxynukleotidtriphosphate dATP, dCTP, dGTP und dTTP umfassen.
Bezüglich der Bestandteile der Kits wird im übrigen auf die 15 obigen Ausführungen zur den bei dem erfindungsgemäßen Verfahren eingesetzten Enzyme, Oligonukleotide und Farbstoffe und deren Eigenschaften verwiesen.
Gemäß einer besonders bevorzugten Ausführungsform der Erfindung
20 enthält das Kit eine Kombination der Enzyme MMuLV-RT und Taq-
® Polymerase sowie SYBR Green I als Farbstoff .
Die Erfindung wird nachfolgend anhand von Beispielen, Figuren und einem Sequenzprotokoll näher beschrieben. 25
Beispiele
Material und Methoden 30
Als Modell-PCR-Systeme zur Etablierung einer einstufiger RT-PCR
® mit SYBR Green I-Detektion wurden etablierte Assays für
Lassavirus (Demby, A. et al . "Early diagnosis of Lassa fever by reverse transcription PCR" J. Clin. Microbiol. 32 (1994) 2898-
35 2903) und Ebolavirus (Sanchez, A. et al . "Detection and molecular characterization of Ebola viruses causing disase in human and nonhuman primates" J. Infect. Dis. 179 (1999) Suppl 1
S164-169) verwendet. Die veröffentlichten Primer waren jeweils
® mit Hilfe des Superscript II/Platinum One-Step RT-PCR System (Life Technologies, Karlsruhe, Deutschland) in das einstufiger
RT-PCR Format überführt worden. Die Sensitivität beider
Verfahren belief sich auf ca. 20 Kopien in vitro transkribierter RNA pro Reaktion. Die verwendeten Enzyme waren eine MMuLV Reverse Transkriptase und eine Taq DNA-Polymerase. Zur Testung von alleiniger DNA-Amplifikation wurde außerdem eine Taq DNA-Polymerase eines anderen Herstellers verwendet
® (AmpliTaq Gold, Perkin-Elmer, Weiterstadt, Deutschland) . Der
® Farbstoff SYBR Green I (z.B. kommerziell von der Fa. Röche,
Mannheim, Deutschland, erhältlich als 10000X Konzentrat in DMSO) wurde in allen Experimenten in Dimethylsufoxid (DMSO)
® verdünnt. Die Mindestkonzentration von SYBR Green I zur
Detektion von PCR-Produkten liegt bei 0,001% v/v in der
Reaktion. Soweit nicht anders angegeben, wurde in den folgenden
Experimenten diese Konzentration eingesetzt. Sämtliche RT-PCR-
® und PCR-Amplifikationen wurden in einem LightCycler (Röche) durchgeführt .
Durchführungsprotokoll für Ebola-Virus:
Eine Reaktion enthielt 10 μl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 μg Rinderserumalbumin (BSA, Fa. Sigma, München), 0,75mM Magnesiumsulfat, 1 μM Primer Filo A: (atcggaatttttctttctcatt, SEQ ID NO:l), 1 μM Primer Filo B: (atgtggtgggttataataatcactgacatg, SEQ ID NO: 2) und 0,4 μl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe) . Dem Reaktionsvolumen von 18 ul wurden noch 2 μl RNA-Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt . Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10 Zyklen:
95°C für 5 Sekunden, 60°C für 5 Sekunden (Temperaturdekrement l°C/Zyklus) , 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5
Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
Durchführungsprotokoll für Lassa-Virus :
Eine Reaktion enthielt 10 μl Superscript/Platinum RT-PCR Reaktionsmix (Fa. Life-Technologie, Karlsruhe), 0,8 μg Rinderserumalbumin (BSA, Fa. Sigma, München), 2,5 M Magnesiumsulfat, 300 μM Primer 36E2: (accggggatcctaggcattt, SEQ ID NO: 3), 1 μM Primer 80F2: (atataatgatgactgttgttctttgtgca, SEQ ID NO: 4) , und 0,4 μl Superscript/Platinum Enzymmischung (Fa. Life-Technologie, Karlsruhe) . Dem Reaktionsvolumen von 18 ul wurden noch 2 μl RNA-Extrakt, gewonnen mit dem Qiamp Viral RNA Kit (Fa. Qiagen, Hilden) beigefügt. Folgendes Temperaturprofil wurde durchlaufen: 50°C für 20 Minuten, 95°C für 5 Minuten, 10
Zyklen: 95°C für 5 Sekunden, 60°C für 5 Sekunden
(Temperaturdekrement l°C/Zyklus) , 72°C für 25 Sekunden, 40 Zyklen: 95°C für 5 Sekunden, 56°C für 10 Sekunden, 72°C für 25 Sekunden.
Beispiel 1: Hemmung der Taq DNA-Polymerase
Um zu zeigen, daß in der RT-PCR die RT, nicht jedoch die Taq DNA-Polymerase gehemmt wird, wurden Amplifikationen einer geringen Menge von Lassa DNA, die kloniert in einem Plasmid vorlag, unter Verwendung einer Taq Polymerase durchgeführt. Fig. 3 zeigt das Ergebnis des Versuches. Wie der Figur zu entnehmen ist, wurde die Taq DNA-Polymerase in Gegenwart von
® SYBR Green I in einer Konzentration von 0,001% nicht gehemmt. ® Beispiel 2: Hemmung der RT-PCR durch SYBR Green I
® Um eine Hemmung der RT-PCR durch SYBR Green I zu demonstrieren, wurden absteigende Mengen in vitro transkribierter Ebola RNA mit der oben unter "Material und Methoden" zitierten, für Ebola anwendbaren einstufigen RT-PCR amplifiziert, und der Reaktion
® wurde SYBR Green I zugesetzt. Die Menge an DMSO, welches als
® Trägerlösung von SYBR Green I notwendig war, wurde dabei konstant gehalten. Fig. 4 zeigt das Ergebnis des Versuchs. Es
® ließ sich feststellen, daß eine Konzentration von 0,001% SYBR
Green I die RT-PCR inhibiert, die PCR hingegen nicht beeinflußt.
® Beispiel 3 : Immobilisierung von SYBR Green I
Es wurde ferner überprüft, ob die Hemmung der RT durch SYBR Green I dadurch vermieden werden kann, daß der Farbstoff zu Beginn der RT-PCR vom eigentlichen Reaktionsvolumen getrennt wird. Zum Zeitpunkt, an dem die eigentliche Reverse Transkription abläuft, wird der Farbstoff noch nicht für eine Detektion benötigt. Um eine physikalische Trennung zu erreichen, wurde die benötigte Menge an Farbstoff (0,001% entsprechend) in 1 μl DMSO gelöst, und dieses Volumen wurde am
® Boden von LightCycler -Reaktionsgefäßen bei einer Temperatur von -20°C festgefroren. Durch den hohen Schmelzpunkt von DMSO
(18,45°C) blieb es dort während des gesamten Ansatzprozesses der RT-PCR fixiert und wurde erst beim Erwärmen des Reaktionsansatzes auf die Reaktionstemperatur der Reversen Transkriptase (50°C) freigesetzt. Um die Auswirkungen dieses Verfahrens auf die Sensitivität der RT-PCR zu untersuchen, wurden Amplifikationen von Lassa RNA in vitro-Transkript in einer Verdünnungsreihe unter den beschriebenen Bedingungen sowie in Parallelansätzen unter normalen Bedingungen durchgeführt .
Fig. 5 zeigt das Ergebnis der Amplifikationen. Fig. 6 zeigt die gleichzeitige Detektion der letzten Stufen der amplifizerten
® RNA-Verdünnungsreihe des Ansatzreihe A im LightCycler .
Es bestand kein Unterschied zwischen beiden Ansatzreihen im Hinblick auf die Sensitivität. In beiden Ansatzreihen konnten
200 Kopien Lassa RNA nachgwiesen werden, wobei die Immobilisie-
® rung von SYBR Green I gleichzeitig eine real-time
Quantifizierung des Produkts erlaubte. Die Diffusionszeit des
DMSO in Ansatzreihe A war offenbar lang genug, um eine effiziente Funktion der Reversen Transkriptase zu ermöglichen.
Beispiel 4 : Immobilisierung des Farbstoffs an ein Oligonukleotid
Da die in Beispiel 3 beschriebene Immobilisierungsmethode hinsichtlich der Vorbereitung relativ aufwendig ist, wurde
® versucht, SYBR Green I an ein partiell doppelsträngiges DNA-
® Oligonukleotid zu binden. Dabei wurde ausgenutzt, daß SYBR G- reen I spezifisch an doppelstrangige DNA, praktisch jedoch nicht an einzelsträngige DNA bindet. Es wurde ein Haarnadel- Oligonukleotid hergestellt, welches eine Stamm-Schleife- Struktur aufweist. Die Stamm-Schleife-Struktur wies einen Schmelzpunkt auf, der zwar über der Arbeitstemperatur der Reversen Transkriptase, jedoch unter der Extensionstemperatur
® der PCR lag. Auf diese Weise sollte SYBR Green I während der
Reversen Transkription immobilisert vorliegen, während der PCR jedoch für die Detektion zur Verfügung stehen. Das
® Oligonukleotid erhielt die Bezeichnung SGS1 (SGS für "SYBR Green Suppressor") . Die Sequenz von SGSl ist im Sequenzprotokoll unter SEQ ID NO: 5 wiedergegeben, die Struktur ist in Fig. 7 dargestellt.
Es wurden aufsteigende Konzentrationen von SGSl mit einer
® konstante Menge von 0,001% (v/v) SYBR Green I versetzt, und die resultierende Fluoreszenz wurde bei einer Temperatur von 50°C
® gemessen. Fig. 8 zeigt die Bindung von SYBR Green I an SGSl. Es ließ sich ein deutlich konzentrationsabhängiger Bindungseffekt mit Sättigungskinetik feststellen.
Beispiel 5: SGSl in der RT-PCR und Modifikation von SGSl
® Um in der RT-PCR als SYBR Green I-Immobilisator zu fungieren, durfte das SGSl-Molekül nicht mit der RT-PCR interferieren.
Es wurden etwa 10000 Moleküle Ebola RNA in vitro-Transkript in
® Gegenwart von aufsteigenden Konzentrationen SGSl (ohne SYBR
Green I-Zusatz) amplifiziert. Wie Fig. 9 zeigt, wirkte SGSl bereits in einer Konzentration von 50 nM hemmend auf die RT- PCR.
Beispiel 6: Herstellung und Bindungskinetik von SGS3
Es wurde versucht, die starke Interferenz des Oligonukleotids mit der RT-PCR durch Modifikationen des Moleküls zu beseitigen, die die Adsorption des Farbstoffs möglichst unbeeinflußt lassen sollten. Um eine Extension des SGSl in der PCR zu verhindern, wurde die 3 ' -OH des SGSl durch eine Phosphatgruppe ersetzt. Weiterhin wurde die Loop-Region des SGSl durch ein abasisches ssDNA-Segment ersetzt, um unspezifische DNA-Bindung in diesem Bereich zu verhindern. Die erhaltene Sequenz erhielt die Bezeichnung SGS3. Die durch das abasische ssDNA-Segment verbundenen Oligonukleotidabschnitte von SGS3 sind in SEQ ID NO: 6 und 7 wiedergegeben, die Struktur ist in Fig. 2 gezeigt. Die Bindungskinetik von SGS3 entsprach der von SGSl (siehe Beispiel 4) und ist hier nicht gesondert dargestellt.
Beispiel 7: SGS3 in der RT-PCR
Das in Beispiel 5 beschriebene Experiment wurde unter Verwendung des Oligonukleotids SGS3 wiederholt. Fig. 10 zeigt, daß der Inhibitionseffekt erst bei einer Konzentration von 100 nM SGS3 pro Reaktion auftritt.
® Beispiel 8: Immobilisierung von SYBR Green I an SGS3 in der RT- PCR
Um die Immobilisierung von SYBR Green I an SGS3 sowie dessen Freisetzung zur Detektion während der RT-PCR zu überprüfen, mußte die optimale Konzentration von SGS3 ermittelt werden, die
® das SYBR Green I noch effizient bindet, die Reaktion jedoch unbeeinflußt läßt. Es wurden Amplifikationen von etwa 109 Kopien Ebola RNA in vitro-Transkript in Gegenwart von aufsteigenden Konzentrationen SGS3 durchgeführt. Diese hohe RNA Menge wurde ausgewählt, um die Reversion der Inhibition durch unterschiedliche Konzentrationen SGS3 zu untersuchen. Die
® Konzentration von SYBR Green I betrug dabei konstant 0,001% v/v. Die Positivkontrolle (Spur 6) enthielt weder SGS3 noch
SYBR Green I.
Fig. 11 zeigt das Ergebnis der Amplifikationsreaktionen. insbesondere zeigt Spur 1, daß die gewählte Konzentration des Farbstoffs die Amplifikation auch höchster Mengen an RNA (Spur 1, 109 Kopien pro Reaktion) vollständig inhibiert. Wie Fig. 11 ferner zu entnehmen ist, war eine Konzentration von 50 nM SGS3 dazu geeignet, die Inhibition aufzuheben. Dabei waren höhere und niedrigere Konzentrationen des Oligonukleotids suboptimal, entweder durch SGS-bindingte PCR-Interferenz (siehe Beispiel 7)
® oder durch mangelnde SYBR Green I-Immobilisierung.
Beispiel 9: Vergleich der Sensitivität des erfindungsgemäßen Verfahrens mit einer konventionellen, maximal optimierten, einstufigen RT-PCR
Zur weiteren Verbesserung der Sensitivität des erfindungsgemäßen Verfahrens wurde das thermische
Amplifikationsprofil der Reaktion dahingehend modifiziert, daß
® das an SGS3 gebundene SYBR Green I erst zur
Detektionstemperatur jedes Zyklus freigesetzt wurde. Der
Schmelzpunkt der Stamm-Schleife-Struktur von SGS3 war zuvor experimentell ermittelt worden und betrug 72°C, d.h. oberhalb
® von 72°C wird SYBR Green I aus der Bindung an das Oligonukleotid freigesetzt. Im Thermocycler-Profil wurde der Extensionsschritt von 72°C auf 65°C abgesenkt, um auch während der Arbeitstemperatur der DNA-Polymerase den Farbstoff in der Oligonukleotidbindung zu halten. Anschließend wurde die
Detektionstemperatur von 72°C auf 82°C erhöht, um eine maximale
® Freisetzung von SYBR Green I während der Detektion zu gewährleisten. Dies hatte gleichzeitig den Vorteil, daß unspezifische Nebenprodukte der PCR, wie Primer-Dimere, deren
Schmelztemperatur immer unter 80°C lag (empirischer Wert, gilt für fast jede RT-PCR) , nicht unerwünscht mitdetektiert wuden. Zum Sensitivitätsvergleich wurde eine Verdünnungsreihe Ebola RNA in vitro-Transkript in einer konventionellen, mit diesem Thermoprofil maximal optimierten, einstufigen RT-PCR ohne Möglichkeit der real-time-Quantifizierung wie unter Routinetestbedingungen amplifizert. Die gleichen Proben wurden
® unter den gefundenen Bedingungen (0,001% SYBR Green I, 50 nM
SGS3) bei sonst gleicher Formulierung der Reaktionsansätze amplifiziert. Dabei wurde in diesen Proben gleichzeitig die Fluoreszenz während der Reaktion gemessen. Wie aus Fig. 12 ersichtlich, ist die Sensitivität beider Verfahren annähernd gleich. Fig. 13 zeigt die entsprechende real-time Fluoreszenz- kinetik, die während der Reaktion erhoben wurde. Es sind extrem regelmäßige Log-Stufen Abstände sichtbar, wie sie erfahrungsgemäß sonst nur mit Hilfe von Sondendetektion zu erzielen sind.
Beispiel 10: Schmelzpunktanalyse
In der Schmelzkurvenanalyse wird folgendes Temperaturprofil durchlaufen: 95°C für 10 Sekunden (zum Schmelzen aller in der
Reaktion befindlichen Doppelstränge) , 60°C für 20 Sekunden (zur Rehybridisierung aller in der Reaktion befindlichen Doppel- stränge, langsames Aufheizen (0, 1°C/Sekunde) mit kontinuierlicher Fluoreszenzmessung zur Ermittlung der
Schmelztemperatur (d.h. , der Temperatur, bei der die
® Doppelstränge schmelzen, Sybr Green in Lösung geht und somit nicht mehr emittiert) . Fig. 13 zeigt die dabei erhobene Fluoreszenz (y-Achse) in Abhängigkeit von der Temperatur. Die in Fig. 14 errechnete negative erste Ableitung des Signals ergibt die dargestellten Schmelzpeaks (Punkt der maximal negativen Steigung der Fluoreszenzreversion) . Dieser Punkt entspricht der Temperatur, zu der 50% aller Doppelstränge in den einzelsträngigen Zustand übergehen ("Schmelzpunkt").
Fig. 14 zeigt das Ergebnis der Schmelzpunktanalyse von SGS3. Es läßt sich ein sehr scharf definierter spezifischer Schmelzpunkt bei 85°C nachweisen. Der Schmelzpunkt in der Negativkontrolle liegt bei ca. 77°C und entspricht einem Primer-Dimer, das auf Grund der oben erläuterten erhöhten Detektionstemperatur nicht in der real-time Kinetik erfaßt wird. Dies wäre auch für die Quantifizierung störend.
Beispiel 11: Übertragbarkeit des Verfahrens auf andere Viren
Das oben beschriebene Verfahren (insbesondere Kombination der
® angegebenen Konzentrationen an SGS3 und SYBR Green I mit dem modifizierten PCR-Profil) wurde u.a. erfolgreich in folgende einstufiger RT-PCR Verfahren implementiert:
Lassa RT-PCR; Ebola RT-PCR; LCMV RT-PCR; HIV-1 RT-PCR.
Legende der Figuren:
Fig. l: Fluoreszenz-Anregungs- und Fluoreszenz-Emissionsspek-
® ® tren von SYBR Green I und SYBR Gold
Fig. 2: Strukurskizze eines erfindungsgemäßen Haarnadelschlei- fen-Oligonukleotids am Beispiel des Moleküls SGS3. Einzelsträngiges abasisches Schleifensegment (20 Basen) und doppelstrangige Stammstruktur (24
Basenpaare) . Das freie 3 ' -OH ist gegen eine Phosphatgruppe (P) ausgetauscht.
Fig. 3: Amplifikation einer geringen Menge Lassa cDNA (klo- niert) mit einer normalen Taq DNA Polymerase. Spuren
1,4 und 7: ca. 2000 Kopien DNA; Spuren 3,6 und 9: ca.
20 Kopien DNA; Spuren 2,5 und 8: Wasser. A: 0,001%
® ®
Sybr Green, 5% DMSO; B: kein Sybr Green, 5% DMSO; C:
® kein Sybr Green, kein DMSO.
Fig. 4: Ebola RNA in-vitro Transkript (109 - 106 Kopien pro
Reaktion) wurde mit (Reaktionen 6-10) und ohne (Reak-
® tionen 1-5) 0,001% Sybr Green in einer 1-Step RT-PCR
® amplifiziert. Sybr Green hemmt in dieser Konzentration die RT-PCR, jedoch nicht die PCR (vgl. Fig. 3) . Spuren
1 und 6: Negativkontrolle; Spuren 2 und 7: 109 Kopien pro Reaktion; Spuren 3 und 8: 108 Kopien pro Reaktion;
Spuren 4 und 9: 107 Kopien pro Reaktion; Spuren 5 und
10: 106 Kopien pro Reaktion.
Fig. 5: Amplifikation einer Verdünnungsreihe Lassa-RNA in- vitro Transkript; die Menge an RNA Kopien pro Reaktion ist oben angegeben. A: Amplifikation in Gegenwart von
® 0,001% Sybr Green, vor der Reaktion am Reagenzgefäßbo- den angefroren. Die Zahlen über den jeweiligen Gelspuren bezeichnen die Anzahl der RNA-Kopien pro Reaktion (ab 1000 Kopien in Exponentialschreibweise) .
® B: Kontrollansatzreihe ohne Sybr Green.
Fig. 6: Online-Fluoreszenzdetektion der Reihe A aus Fig. 5. Dargestellt sind der Übersicht wegen nur die letzten drei positiv detektierten Stufen der Verdünnungsreihe und die Negativkontrolle.
Fig. 7: Strukurskizze des Moleküls SGSl. Einzelsträngiges Schleifensegment (37 Basen Zufallssequenz) , 30 Basenpaare doppelstrangige Stammstruktur. Das freie 3 ' -OH ist im Gegensatz zu SGS3 vorhanden.
® Fig. 8: Bindung von Sybr Green an SGSl. Die Reaktionen
® enthielten konstant 0,001% Sybr Green und die unten angegebenen Konzentrationen an SGSl in μM. Die Fluoreszenz wurde bei 50°C (RT-Temperatur) gemessen. >>>: Extremer Überschuß SGSl; -SGS: Kontrolle ohne
® SGS, mit 0,001% Sybr Green; -SYBR: Kontrolle ohne Sybr
® Green, aber mit 1600 nM SGSl.
Fig. 9: Amplifikation von ca. 10000 Molekülen Ebola-RNA mit aufsteigender Konzentration SGSl pro Reaktion, ohne
® Sybr Green. Spur 1: Kein SGS; Spur 2: 50 nM; Spur 3:
100 nM; Spur 4: 200 nM; Spur 5: 400 nM; Spur 6: 800 nM; Spur 7: 1600 nM; Spur 8: 3200 nM
Fig. 10: Amplifikation von ca. 10000 Molekülen Ebola-RNA mit angegebener Konzentration SGS3 pro Reaktion, ohne Sybr
® Green. Im Vergleich zu der in Fig. 9 dargestellten
Reaktion toleriert die Reaktion höhere Konzentrationen des modifizierten SGS-Moleküls.
Fig. 11: Amplifikation von 109 Kopien Ebola-RNA in-vitro Trans-
® kript in Gegenwart von 0,001% Sybr Green und SGS3 in den angegebenen Konzentrationen. 109 Kopien waren ohne
® SGS3 in Gegenwart dieser Sybr Green-Konzentration nicht zu amplifizieren (vgl. Fig. 4). Spur 1: kein
SGS3; Spuren 2-5: wie beschriftet; Spur 6: 106 Kopien
® Ebola-RNA ohne SGS3 und Sybr Green (+Ctrl) .
Fig. 12: Parallele 1-Step RT-PCR Amplifikation einer Ebola-RNA
® Verdünnungsreihe mit und ohne 50 nM SGS3/0,001% Sybr
Green. Spur 1: Negativkontrolle; Spuren 2 und 6: 106
Kopien RNA pro Reaktion; Spuren 3 und 7: 105 Kopien RNA pro Reaktion; Spuren 4 und 8: 104 Kopien RNA pro
Reaktion; Spuren 5 und 9: 103 Kopien RNA pro Reaktion.
Fig. 13: Zugehörige real-time Fluoreszenzkinetik zu Fig. 12. Dargestellt ist der Verlauf des Fluoreszenzsignals, das in den Reaktionen 1 bis 5 (siehe Beschriftung der
Fluoreszenzverlaufe, vgl. gleiche Positionsnummern in Fig. 12) während der Reaktion gemessen wurde. Das Bild entspricht dem üblichen Fluoreszenzverlauf einer real- time PCR.
Fig. 14: Schmelzkurvenanalyse der PCR-Produkte in Fig. 12/Fig. 13; Reaktionen 1 bis 5: hier gleiche Bezeichnung. Das Vorgehen ist im Beispiel Nr. 10 beschrieben. 1: Schmelzpeak in der negativen ersten Ableitung der direkt gemessenen Fluoreszenz bei 77,5°C, entsprechend einem Primer-Dimer Artefakt . Dies wird in der zur Quantifizierung herangezogenen Echtzeitkinetik (Fig. 13) nicht erfaßt, da die Fluoreszenz der Reaktion oberhalb von 77,5°C gelesen wird. 2-5: Reaktionen 2 bis 5 aus Fig. 12/Fig. 13. Deutlicher Schmelzpeak bei
85°C für das spezifische PCR-Produkt mit äußerst geringer Variabilität zwischen den Einzelreaktionen.

Claims

Patentansprüche:
1. Verfahren zur Durchführung einer Nukleinsäureamplifik- aktion, bei dem man in einer einstufigen Reaktion RNA revers transkribiert, die gebildete komplementäre DNA (cDNA) amplifiziert und die gebildeten Amplifikate sequenzunabhängig in Echtzeit detektiert, wobei man zur Detektion einen Farbstoff verwendet, der selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindet, dadurch gekennzeichnet, daß man den Farbstoff vor der reversen Transkription immobilisiert, um eine Hemmung der reversen Transkription zu vermeiden, man ihn vor der Amplifikation wieder freisetzt und damit zur Bindung an die Amplifikate zur Verfügung stellt, wobei man die Farbstoff-gebundenen Amplifikate qualitativ und/oder quantitativ nachweist .
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, daß man den Farbstoff immobilisiert, indem man ihn in einem Lösungsmittel mit einem Schmelzpunkt im Bereich von 10°C bis
40°C löst und man die Farbstofflösung am Boden des Reaktionsgefäßes festfriert, wobei der Farbstoff durch die erhöhten Reaktionstemperaturen der reversen Transkription freigesetzt wird und in die Reaktionslösung diffundiert.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, daß das Lösungsmittel Dimethylsulfoxid (DMSO) ist.
4. Verfahren nach Anspruch 1, dadurch gekennzeichnet, daß man den Farbstoff immobilisiert, indem man ihn an ein zumindest teilweise doppelsträngiges Oligonukleotid binden läßt, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und man den Farbstoff freisetzt, indem man die Temperatur vor der Amplifikation erhöht, um ein einzelsträngiges Oligonukleotid zu bilden, an das der Farbstoff nicht mehr bindet.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, daß der Schmelzbereich des Oligonukleotids im Bereich von etwa 45°C bis etwa 85°C liegt.
6. Verfahren nach Anspruch 4 oder 5, dadurch gekennzeichnet, daß es sich bei dem Oligonukleotid um ein Haarnadelschlei- fen-Oligonukleotid handelt.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, daß das Oligonukleotid die allgemeine Struktur
Figure imgf000035_0001
aufweist, wobei das Molekül eine abasische Loop-Sequenz aufweist .
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, daß das Molekül ferner eine Phosphatgruppe anstelle der 3 ' -OH- Gruppe aufweist .
9. Verfahren nach den Ansprüchen 6 bis 8, dadurch gekennzeichnet, daß das Oligonukleotid die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
10. Verfahren nach den Ansprüchen 1 bis 9, dadurch gekennzeichnet, daß man zur reversen Transkription ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase) , Reverse Transkriptase aus Moloney Murine Leukemia Virus (MMuLV-RT) , Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT) , Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen Ursprungs verwendet .
11. Verfahren nach den Ansprüchen 1 bis 10, dadurch gekennzeichnet, daß es sich bei Amplifikation der komplementären DNA (cDNA) eine Polymerasekettenreaktion (PCR) handelt.
12. Verfahren nach den Ansprüchen 1 bis 11, dadurch gekennzeichnet, daß man für die Polymerasekettenreaktion (PCR) eine oder mehrere DNA-Polymerase (n) aus der Gruppe bestehend aus Thermus aquaticus-Polymerase (Taq- Polymerase) , Thermus flavus-Polymerase (Tf1-Polymerase) , Thermotoga mari tima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase) verwendet.
13. Verfahren nach den Ansprüchen 1 bis 12, dadurch gekennzeichnet, daß man den Farbstoff aus der Gruppe bestehend
® ® aus SYBR Green I, SYBR Green II und Ethidiumbromid auswählt .
14. Verfahren nach den Ansprüchen 12 und 13 , dadurch gekennzeichnet, daß man zur Nukleinsäureamplifikation eine Kombination von MMuLV-RT und Taq-Polymerase verwendet und man
® als Farbstoff SYBR Green I verwendet.
15. Oligonukleotid der allgemeinen Struktur
Figure imgf000037_0001
das eine abasische Loopsequenz aufweist und eine Phosphatgruppe anstelle der 3 ' -OH-Gruppe aufweist.
16. Oligonukleotid, dadurch gekennzeichnet, daß es die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
17. Oligonuleotid-Farbstoff-Komplex bestehend aus einem Oligonukleotid nach Anspruch 15 oder 16 und einem selektiv an doppelstrangige Desoxyribonukleinsäure (dsDNA) bindenden Farbstoff .
18. Komplex nach Anspruch 17, dadurch gekennzeichnet, daß der
® ®
Farbstoff SYBR Green I, SYBR Green II oder Ethidiumbromid ist.
19. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, daß es ein zumindest teilweise doppelsträngiges Oligonukleotid, dessen Schmelztemperatur oberhalb der zur Durchführung der reversen Transkription erforderlichen Temperatur liegt, und einen Farbstoff, der selektiv an doppelstrangige DNA bindet, enthält .
20. Kit nach Anspruch 19, dadurch gekennzeichnet, daß die Schmelztemperatur des Oligonukleotids im Bereich von 45°C bis 85°C liegt.
21. Kit nach Anspruch 19 oder 20, dadurch gekennzeichnet, daß es sich bei dem Oligonukleotid um ein Haarnadelschleifen- Oligonukleotid handelt.
22. Kit nach Anspruch 21, dadurch gekennzeichnet, daß das Oligonukleotid die allgemeine Struktur
Figure imgf000038_0001
aufweist, wobei das Molekül eine abasische Loopsequenz und eine Phosphatgruppe anstelle der 3 ' -OH-Gruppe aufweist.
23. Kit nach den Ansprüchen 19 oder 20, dadurch gekennzeichnet, daß das Oligonukleotid die Sequenz
ACAGTAACCTGTACAGACCTTAGT11111111111111111111ACTAAGGTCTGTA- CAGGTTACTGT
aufweist, wobei "1" für Ribosephosphat steht.
24. Kit nach den Ansprüchen 19 bis 23, dadurch gekennzeichnet,
® ® daß der Farbstoff SYBR Green I, SYBR Green II oder
Ethidiumbromid ist .
25. Kit zur Durchführung eines Verfahrens nach den Ansprüchen 1 bis 14, dadurch gekennzeichnet, daß es einen Oligonuleotid- Farbstoff-Komplex nach Anspruch 17 oder 18 enthält.
26. Kit nach den Ansprüchen 19 bis 25, dadurch gekennzeichnet, daß es ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus thermophilis (Tth-Polymerase) , Reverse Transkriptase aus Moloney Murine Leύkemia Virus
(MMuLV-RT) , Reverse Transkriptase aus Avian Myeloma Virus (AMV-RT) , Reverse Transkriptase aus Rous Associated Virus (RAV2-RT) und anderen Reversen Transkriptasen retroviralen
Ursprungs zur Durchführung der reversen Transkription enthält .
27. Kit nach den Ansprüchen 19 bis 26, dadurch gekennzeichnet, daß es ein oder mehrere Enzyme aus der Gruppe bestehend aus DNA-Polymerase aus Thermus aquaticus (Taq-Polymerase) , Thermus flavus-Polymerase (Tf1-Polymerase) , Thermotoga maritima-Polymerase (Tma-Polymerase) und Pyococcus furiosus-Polymerase (Pfu-Polymerase) zur Durchführung einer Polyerasekettenreaktion enthält .
28. Kit nach den Ansprüchen 19 bis 27, dadurch gekennzeichnet, daß es eine Kombination von MMuLV-RT und Taq-Polymerase und
® als Farbstoff SYBR Green I enthält.
29. Kit nach den Ansprüche 19 bis 28, dadurch gekennzeichnet, daß es weitere Reagenzien und Hilfsmittel zur Durchführung einer Nukleinsäureamplifikation enthält, bei der man in einer einstufigen Reaktion RNA revers transkribiert, man die entstandene komplementäre DNA (cDNA) amplifiziert und bei der man die gebildeten Amplifikate (sequenzunabhängig) in Echtzeit detektiert.
PCT/EP2002/010800 2001-10-11 2002-09-26 Echtzeitdetektion von dna-amplifikationsprodukten WO2003033732A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10150121A DE10150121B4 (de) 2001-10-11 2001-10-11 Echtzeitdetektion von DNA-Amplifikationsprodukten
DE10150121.8 2001-10-11

Publications (2)

Publication Number Publication Date
WO2003033732A2 true WO2003033732A2 (de) 2003-04-24
WO2003033732A3 WO2003033732A3 (de) 2003-11-13

Family

ID=7702130

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/010800 WO2003033732A2 (de) 2001-10-11 2002-09-26 Echtzeitdetektion von dna-amplifikationsprodukten

Country Status (2)

Country Link
DE (1) DE10150121B4 (de)
WO (1) WO2003033732A2 (de)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1735465A2 (de) * 2004-03-22 2006-12-27 Isis Pharmaceticals, Inc. Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5824557A (en) * 1996-04-02 1998-10-20 Panvera Corporation Method for detecting and quantitating nucleic acid impurities in biochemical preparations
EP0900805A2 (de) * 1990-07-27 1999-03-10 Chiron Corporation Einführung selektiv spaltbarer und/oder abasischer Stellen in Oligonukleotidketten und Reagenzien dafür

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1602725A3 (de) * 1993-09-02 2006-03-29 Sirna Therpeutics, Inc. Enzymatische Nukleinsäure die Abasische Nukleotide enthaltet

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0900805A2 (de) * 1990-07-27 1999-03-10 Chiron Corporation Einführung selektiv spaltbarer und/oder abasischer Stellen in Oligonukleotidketten und Reagenzien dafür
US5824557A (en) * 1996-04-02 1998-10-20 Panvera Corporation Method for detecting and quantitating nucleic acid impurities in biochemical preparations

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BUSTIN S A: "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays." JOURNAL OF MOLECULAR ENDOCRINOLOGY, Bd. 25, Nr. 2, Oktober 2000 (2000-10), Seiten 169-193, XP002251381 ISSN: 0952-5041 in der Anmeldung erw{hnt *
DROSTEN CHRISTIAN ET AL: "Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR." JOURNAL OF CLINICAL MICROBIOLOGY, Bd. 40, Nr. 7, Juli 2002 (2002-07), Seiten 2323-2330, XP002251382 ISSN: 0095-1137 *
FREEMAN WILLARD M ET AL: "Quantitative RT-PCR: Pitfalls and potential" BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, Bd. 26, Nr. 1, Januar 1999 (1999-01), Seiten 112-118,120-122,124-12, XP002143860 ISSN: 0736-6205 *
PEOC'H D ET AL: "Efficient chemical synthesis of oligonucleotides containing a true abasic site" TETRAHEDRON LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, Bd. 32, Nr. 2, 1991, Seiten 207-210, XP002171022 ISSN: 0040-4039 *
WITTWER C T ET AL: "CONTINUOUS FLUORESCENCE MONITORING OF RAPID CYCLE DNA AMPLIFICATION" BIOTECHNIQUES, EATON PUBLISHING, NATICK, US, Bd. 22, Nr. 1, 1997, Seiten 130-131,134-138, XP000683698 ISSN: 0736-6205 in der Anmeldung erw{hnt *

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
EP1735465A2 (de) * 2004-03-22 2006-12-27 Isis Pharmaceticals, Inc. Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
EP1735465A4 (de) * 2004-03-22 2008-03-12 Isis Pharmaceticals Inc Zusammensetzungen zur verwendung bei der bestimmung von hämorrhagischen fieberviren
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification

Also Published As

Publication number Publication date
DE10150121A1 (de) 2003-04-30
DE10150121B4 (de) 2005-12-01
WO2003033732A3 (de) 2003-11-13

Similar Documents

Publication Publication Date Title
DE10150121B4 (de) Echtzeitdetektion von DNA-Amplifikationsprodukten
DE69829328T2 (de) Strangverdrängungsamplifikation von RNA
DE60034878T2 (de) Verfahren zur Amplifizierung einer Nukleinsäuresequenz unter Verwendung eines chimären Primers
DE69333242T2 (de) Verfahren, reagenz und salz zum nachweis und amplifikation von nukleinsäuresequenzen
EP0705905B1 (de) Verfahren zum sensitiven Nachweis von Nukleinsäuren
EP2052086B1 (de) VERFAHREN ZUR SYNTHESE EINER cDNA IN EINER PROBE IN EINER ENZYMATISCHEN REAKTION
EP3504338B1 (de) Verfahren zur amplifikation von nukleinsäuren und verwendung eines kits zu dessen durchführung
EP1165841A1 (de) Detektion von nukleinsäure-amplifikaten
DE3929030A1 (de) Verfahren zur vermehrung von nukleinsaeuren
DE60209617T2 (de) Quantitative Multiplex-PCR mit grossem Dynamikbereich
EP1926831B1 (de) Verfahren zur aktivierung einer nukleinsäure für eine polymerase-reaktion
EP0437774B1 (de) Verfahren zur Herstellung von modifizierten Nukleinsäuren
DE4132133A1 (de) Verfahren zur spezifischen herstellung von ribonukleinsaeuren
WO2011020588A1 (de) Verfahren zum nachweis von zielnukleinsäuren
EP0552203B1 (de) Verfahren zum empfindlichen nachweis von nukleinsäuren
DE602004002485T2 (de) In gegenwart von collagen und disacchariden lyophilisierte nukleinsäuren umfassende zusammensetzung
WO2009021757A1 (de) Verfahren zur synthese einer cdna in einer probe in einer enzymatischen reaktion
EP0839917A1 (de) Primer und Sonden zum Nachweis von HIV
EP3530755B1 (de) Verfahren zum anzeigen des fortschrittes der amplifikation von nukleinsäuren und kit zu dessen durchführung
DE4238699A1 (de) Einfaches Nukleinsäurevermehrungsverfahren
DE4106473C2 (de) Verfahren zur Herstellung in vitro replizierbarer Nukleinsäuren
DE69914942T2 (de) Kennzeichnung einer substanz mittels eines reportergens und sequenzen, die für die in vitro expression des reportergens notwendig sind
WO2011161239A1 (de) Verfahren zum nachweis von ribonukleinsäuren
EP2191008B1 (de) Verfahren zur synthese einer cdna in einer probe in einer enzymatischen reaktion
WO2019162530A1 (de) Agverfahren zur amplifikation einer nukleinsäure mit verbesserter spezifität

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP