CN114622027A

CN114622027A - One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

Info

Publication number: CN114622027A
Application number: CN202111679808.3A
Authority: CN
Inventors: 潘庆华; 张亚玲; 曾晓珊; 梁志坚; 文健强; 王思; 罗雨薇; 王丽; 张玉; 王玲
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-12-31
Filing date: 2021-12-31
Publication date: 2022-06-14
Anticipated expiration: 2041-12-31
Also published as: CN114622027B

Abstract

The invention discloses a group of two inclusive and precise identification and excavation technical systems for disease-resistant gene families of rice blast Pia and Pii. The technical system consists of 2 sets of disease-resistant functional haplotype-disease-resistant allele detection markers of a self-formed system and the like, and the two levels of detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The technical system can be used for identifying, excavating, cloning and utilizing rice blast Pia and Pii disease-resistant gene family alleles, and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and efficiency of the work of breeding for disease resistance, and improving the diversity and reasonable layout of disease-resistant varieties so as to prolong the service life of the gramineous crops.

Description

One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a set of two inclusive and precise rice blast Pia and Pii disease resistance gene family identification and excavation technology systems.

Background

The blast disease caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious limiting factors in global rice production, and causes a large amount of grain loss every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance depends on direct identification and selection of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and the results of identification and selection are easy to cause errors. In particular, the direct selection of the polymerization phenotype of the same type of target genes is very inefficient or impossible due to the problems of overlapping and overlapping resistance profiles, etc. caused by gene interaction between resistance genes. With the development of molecular marker identification technology, the technology has the advantages of accuracy, reliability, no environmental influence and the like, so that the technology becomes the mainstream technology of plant breeding, and the purpose and the efficiency of breeding work are greatly improved.

On the other hand, in the process of long military competition of the disease-resistant gene of the host plant and the avirulence gene of pathogenic bacteria, the disease-resistant gene generates new disease-resistant specificity in the forms of 'allele family' (each member is positioned at the same gene locus, so that the homozygous diploid individual only contains one member) with the lowest evolution cost and the like, and can keep pace with the rapid variation of the avirulence gene. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a resistant "gene family" used for a long time in breeding programs, it will further differentiate into "alleles" with different disease resistance specificities in functional haplotypes (Zhai et al.2011, New Phytologist,189: 321-334).

In the above two-stage evolution process of "functional haplotype-disease resistance allele", there are obvious and distinct DNA polymorphisms, including Single Nucleotide Polymorphism (SNP) and polynucleotide polymorphism (differentiated genomic region) and Insertion/Deletion polymorphism (InDel). Herein, nucleotide polymorphisms within functional genes are collectively referred to as function-specific nucleotide polymorphisms (simply, function-specificity). Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same "gene family", and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of "gene families". Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1(Pit and Pi37 families), 2(Pib family), 6(Pi2/Pi9 family), 9(Pii family), 11(Pia and Pik family) and 12(Pita family) (Sharma et al 2012, Agricultural Research,1: 37-52; Kalia and Rathuur 2019,3Biotech,9: 209).

In particular, The Pii, Pia and Pik families are paired genes (coupled gene, Pia-1, Pia-2, and so on; The same below) that can express their function when they are present together (Okuyama et al 2011, The Plant Journal 66: 467-.

As described above, The Pia gene family located in The middle region of The short arm of chromosome 11 is one of The most widely used resistance sources in The global rice, particularly japonica rice breeding program (Okuyama et al 2011, The Plant Journal 66: 467-. In order to fully utilize the antigen gene, researchers have developed and utilized only 2 patent markers [ Pia-C _1, Pia-C _2, Panqinghua, etc. ], a rice blast resistance gene Pia-C function-specific molecular marker and a method and application thereof (ZL201210164522.6) ] and 2 scattered molecular markers [ Pia-ID01_2, Kitazawa et al.2019, Breeding Science,69: 68-83; Pia-STS, Yadav et al 2019, Ploss One,14: e0211061) to increase its efficiency of utilization (bold is the marker used).

In particular, only Pia-C could be identified by the 2 patent markers developed by the applicant (see example 8 for details).

On the other hand, Pii gene family located in centromere region of chromosome 9 is also one of the most widely used resistance sources in the global rice, especially japonica rice breeding program (Takagi et al 2013, New Phytologist,200: 276-. To fully utilize the antigen gene, researchers have developed 4 scattered molecular markers [ Pii-ID07, Pii-ID21, Pii-ID24Kitazawaet al 2019, Breeding Science 69: 68-83; 40N23R, Yadav et al 2019, Plos One,14: e0211061) to increase its utilization efficiency.

As described above, since the Pia and Pii gene families are both resistance sources widely used for a long time in rice breeding programs for disease resistance, under the continuous and strong selection pressure of rice blast germs, complex and diverse variations are generated in two-stage evolution levels such as "functional haplotype-disease resistance alleles". However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the reported molecular markers are developed in a scattered manner for specific regions or sites of specific genes, and no clear technical system with comparability, logicality and inclusiveness is formed among the reported molecular markers. For complex genomic regions, complex gene families, 2 outstanding and realistic problems arise from this: (1) any single molecular marker which is not designed based on the evolution hierarchy is difficult to avoid the problem of false positive or false negative due to the technical limitation of the molecular marker; (2) any single molecular marker that is not designed based on its evolutionary hierarchy cannot constitute an inclusive and comparable technical system to continuously mine, identify and name new genes in a complex gene family.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a group of two inclusive and precise technical systems for identifying, excavating and cloning rice blast Pia and Pii disease-resistant gene family alleles. The technical system consists of two-stage detection markers of functional haplotype-disease-resistant allele and the like of 2 sets of self-forming systems, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The method specifically comprises the following steps:

(1) the second purpose of the invention is to provide a set of technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele. Which comprises the following steps:

(a) provides a specific molecular marker of functional haplotype/non-functional haplotype of Pia gene family and an identification method thereof;

(b) provides a specific molecular marker of disease-resistant allele Pia-C of functional haplotype of Pia gene family and an identification method thereof;

(c) the application and the example of the disease-resistant allele Pia-A are identified, excavated and cloned by utilizing the technical system which has the advantages of inclusiveness, accurate identification, excavation and cloning of the rice blast Pia disease-resistant gene family allele;

(d) the application and the example of the sequencing error are screened by utilizing the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of the rice blast Pia disease-resistant gene family allele;

(e) the application and the example of the true and false allele of the rice blast Pia disease-resistant gene family are screened by utilizing the technical system which has the advantages of inclusiveness, accurate identification, excavation and cloning;

(f) the application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice variety resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusiveness, accurate identification, mining and cloning of the rice blast Pia disease-resistant gene family alleles are disclosed;

(g) provides an example for comparing the identification capability of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele with other marking technologies.

(2) The third purpose of the invention is to provide a set of technical system which has inclusion and can accurately identify, mine and clone the rice blast Pii disease-resistant gene family allele. Which comprises the following steps:

(h) provides a specific molecular marker of functional haplotype/non-functional haplotype of Pii gene family and an identification method thereof;

(i) provides a specific molecular marker of disease-resistant allele Pii-F of functional haplotype of Pii gene family and an identification method thereof;

(j) provides a specific molecular marker of disease-resistant allele Pii-M of functional haplotype of Pii gene family and an identification method thereof;

(k) the application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusiveness, accurate identification, mining and cloning of the rice blast Pii disease-resistant gene family alleles are disclosed;

(l) The application and the example of identifying and mining the new and old disease-resistant alleles from the Liaoning rice variety resource population with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification, mining and cloning of the rice blast Pii disease-resistant gene family alleles are disclosed;

(m) providing an example of the comparison of the identification capability of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pii disease-resistant gene family alleles with other marking technologies.

(3) The fourth purpose of the invention is to provide the application and examples of separating and cloning the homologous gene cloning means based on PCR technology and verifying the allele.

The technical solution of the present invention to achieve the above object is as described in the claims and the specific examples.

The invention provides a set of two technical systems which can be used for identifying, excavating and cloning rice blast Pia and Pii disease-resistant allele family alleles and have systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, and improving the diversity and the reasonable layout of disease resistant varieties so as to prolong the service life of the gramineous crops.

Drawings

FIG. 1 shows a set of two schemes for the identification and development of disease-resistant genes of rice blast Pia and Pii.

FIG. 2 sequence comparison of the Pia disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,

cloned Pia (noted as Pia-A in this patent to show differences) [ donor variety Aichi Asahi; okuyama et al.2011 ] has the gene accession numbers for the paired genes: AB604626.1 and AB 60421; for the convenience of sequence alignment analysis, 5 sequencing reference varieties Sasanishiki, CO39, Nipponbare (NPB), Hitomebore, Shennon 265 which are presumed to be target gene carriers are added; and 2 genomic sequences corresponding to the sequencing reference varieties Suijing 18, Koshihikari presumed to be non-target gene carriers;

all validated haplotype and allele-specific SNPs were numbered (in order of marker usage) and labeled in green (see FIGS. 2-4 for details).

In particular, since the reference sequence of the above-mentioned sequenced variety is already disclosed, the figure shows only the first of its paired genes in the following "drawings of the specification" in order to fully understand the specific sequence of the Pia disease-resistant gene family and its marker information in conjunction with FIGS. 3-4.

FIG. 3 development and application of functional/non-functional haplotype-specific molecular markers of the Pia disease-resistant gene family

1 #1 paired Gene haplotype-specific optimal SNP of the Pia family;

3b 1 optimal SNP specific to the haplotype of the #2 paired genes of the Pia family;

3c 2 optimal haplotype specific markers of Pia family [ a-1, upper band, non-functional haplotype; lower band, functional haplotype; # a-2, upper lane, functional haplotype; lower band, non-functional haplotypes ] an example of the identification of 14 first set of reference cultivars of Pia, wherein,

functional haplotype variety: CK1, Aichi Asahi (Pia-A); CK2, Sasanishiki (Pia-A); CK3, Nipponbare (Pia-A); CK4, Shennong265 (Pia-A); CK5, CO39 (Pia-C); CK6, C101LAC (Pia-C); CK7, C101A51 (Pia-C); CK8, Guangchangai (Pia-C);

non-functional haplotype variety: CK9, Shin 2 (Pia-Null); CK10, Fujisaka5 (Pia-Null); CK11, Kusabue (Pia-Null); CK12, Kasalath (Pia-Null); CK13, Koshihikari (Pia-Null); CK14, Suijing 18 (Pia-Null); m, DL-500size marker;

in particular, the test varieties CK3 and CK4 should be of functional haplotype variety due to their sequence errors, which are different from the sequences of the non-functional haplotype varieties Suijing 18 and Koshihikari;

specification of test varieties: the information of the 14 first set of Pia reference varieties is as described above, and if not necessary, it will not be described in detail below.

Description of the labeling: # a-1 and # a-2, which are the numbers of labels, means #1 and #2 labels of Pia; Pia-F/N^G1-303TThe gene symbol is italicized and represents a functional gene; the gene symbol is a positive body and represents a marker; F/N, functional (functional)/non-functional (non-functional); superscript G1-303T, meaning the specific SNP located at position #303 of the #1 paired gene, and so on;

in particular, when the genotypes of the 2 haplotype-specific markers of the specimen variety are all functional haplotypes, the specimen variety can be judged as a functional haplotype variety.

FIG. 4 development and application of functional haplotype disease-resistant allele Pia-C function-specific molecular markers of Pia disease-resistant gene family

4a 1 optimal SNP specific to the #1 paired gene of Pia-C;

4b 1 optimal SNP specific to the #2 paired genes of Pia-C; 4C, 2 Pia-C specific markers [ a-3 and # a-4 ] are added, and non-target genes are added; below, target genes ] are examples of identification of 14 first set of Pia reference varieties, wherein,

the target gene variety: CK5, CO39 (Pia-C); CK6, C101LAC (Pia-C); CK7, C101A51 (Pia-C); CK8, Guangchangai (Pia-C);

non-target gene variety: the remaining 10 Pia first set of reference varieties.

FIG. 5. application and example of identification of disease-resistant allele Pia-A by using the above-mentioned technical system for identification, excavation and cloning of disease-resistant allele of rice blast Pia family

5a 1 haplotype-specific optimal SNPs for the #1 paired genes of the Pia family (see FIG. 3 for further details);

5b 1 optimal SNP of Pia-C in the #2 pair gene specificity (see FIG. 4 for another detail);

5c 2 optimal haplotype specific markers of Pia family [ a-1, upper band, non-functional haplotype; lower band, functional haplotype; # a-2, upper lane, functional haplotype; lower band, non-functional haplotype, is an identification example of 14 first sets of Pia reference varieties, and the result shows that CK 1-4 and CK 5-8 belong to functional haplotype varieties;

5d, 2 Pia-C specific markers [ a-3 and # a-4 ] are added, and non-target genes are added; the lower band, target gene ] identifies 14 first sets of reference varieties of Pia, and the result shows that the genotypes of CK 1-4 and CK 5-8 are different and do not belong to Pia-C;

from the above results, CK 1-4 is inferred to be a Pia-A carrier of functional haplotype. That is to say, the first and second electrodes,

the target gene variety: CK1, Aichi Asahi (Pia-A); CK2, Sasanishiki (Pia-A); CK3, Nipponbare (Pia-A); CK4, Shennong265 (Pia-A);

non-target gene variety: the remaining 10 Pia first set of reference varieties.

FIG. 6 shows the application and example of the above-mentioned technical system for screening sequencing errors by using the allele of rice blast Pia disease-resistant gene family with the advantages of compatibility and accurate identification, mining and cloning

6a, 3 optimal SNPs with the haplotype specificity of the #1 paired genes of the Pia family, wherein # a-1 is a patent marker SNP, and the other 2 are newly added screening marker SNPs in the embodiment;

6b, 1 #2 paired gene haplotype specific optimal SNP of the Pia family as a newly added discrimination marker SNP of the embodiment;

6c, 2 identification examples of the optimal haplotype specific patent markers of the Pia families on a first set of 14 Pia reference varieties (detailed as figure 3), wherein the results show that the sequences of the test varieties such as Nipponbare, Shennong265 and the like are wrong, the sequences are different from the sequences of the non-functional haplotype varieties Suijing 18, and CK 1-8 belong to functional haplotype varieties;

3 d, identifying examples of 14 first sets of Pia reference varieties by the newly added screening markers, wherein the results show that the sequences of test varieties such as Nipponbare, Shennong265 and the like are wrong and different from the sequence of a non-functional haplotype variety Suijing 18, and CK 1-8 belong to functional haplotype varieties;

and (4) conclusion: sequencing varieties such as Nipponbare, Shennong265 and the like have integral sequencing errors in 2 paired genes of the Pia family; that is, in the sequence table, 6 sequenced varieties above Shennong265 are functional haplotype varieties, and the sequences thereof are classified with Aichi Asahi.

FIG. 7 shows the application and example of screening true and false alleles of rice blast Pia disease-resistant gene family by using the technical system with compatibility and accurate identification, mining and cloning

7a 1 Pia family of #1 paired genes for Pia-C allele-specific optimal SNPs, which are patent marker SNPs;

7b 1 Pia-C allele-specific optimal SNP of the #2 paired gene of the Pia family, which is a patent marker SNP;

candidate SNPs specific to alleles of the #2 paired gene of the Pia family, CK2(Sasanishiki) and CK5(CO39), were used as newly added screening marker SNPs in this example;

7d, 2 identification examples of the optimal allele-specific patent markers of Pia-C of Pia families on 14 first reference varieties of Pia, and the results show that CK 5-8 is a Pia-C carrier, and CK 1-4 is inferred to be a Pia-A carrier (see figures 4-5 in detail);

7e identification of 14 first set of Pia reference varieties with 2 newly added screening markers, both of which were deduced as haplotype-specific markers of the Pia family, but not CK2(Sasanishiki) and CK5(CO 39); specifically, SNPs of all functional haplotype varieties above Shennong265 are not enzymatically cleavable CCs, while SNPs of non-functional haplotype varieties such as Suijing 18 are enzymatically cleavable TAs;

and (4) conclusion: the Pia family has so far only 2 alleles, Pia-C and Pia-A.

FIG. 8 shows the application and example of identifying and mining new and old disease-resistant alleles from Guangxi rice variety resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pia disease-resistant gene family alleles with compatibility and accuracy. Wherein the content of the first and second substances,

8a, identifying 52 test varieties based on 2 optimal primary markers, wherein the result shows that only 19 varieties such as Q2634-38, Q2670-71, Q2673, Q2675-77, Q2679-80, Q2687-88, Q2695, Q2704-06 and the like are non-functional haplotype varieties (black color); the remaining 33 varieties were functional haplotype varieties (red);

8b, identifying 52 test varieties based on 2 optimal secondary markers (Pia-C functional specificity), wherein the result shows that only 3 varieties such as Q2684, Q2689, Q2691 and the like are Pia-C carriers (blue); the remaining 30 functional haplotype varieties were Pia-A carriers (green);

wherein, the second set of 3 Pia reference varieties is CK1, Aichi Asahi (Pia-A); CK2, CO39 (Pia-C); CK3, Nipponbare (Pia-A).

FIG. 9 is an example of comparison of the discrimination ability of a technical system for identifying, mining and cloning rice blast Pia disease-resistant gene family alleles with other marker techniques by using a set of the invention

9 a-b, the result of the identification of the first set of reference varieties of 14 Pia by the technical system of the invention shows that CK 1-8 is a functional haplotype variety, wherein CK 1-4 is a Pia-A carrier; CK 5-8 is Pia-C carrier;

9C1 identification of a first set of 14 Pia reference varieties by Pia other party marking technology-1 (Pia-C _1, Pia-C _ 2; ZL201210164522.6), and the results show that the patent marker has similar effect with a two-stage marker of the technical system, can clearly identify Pia-C carriers, but cannot perfectly identify carriers of allele Pia-A and Pia-C on the basis of identifying functional/non-functional haplotypes by the two-stage marker system like the technical system;

9c2 identification of 14 first set of Pia reference varieties by Pia-other marker technology-2 (Pia-ID01_2, Kitazawa et al 2019, Breeding Science,69: 68-83; Pia-STS, Yadav et al 2019, Plos One,14: e0211061), the results show that the 2 markers are similar to One-level markers of the technical system, can clearly identify carriers of the Pia disease-resistant gene family, but can not further identify alleles therein;

and (4) conclusion: compared with the 2 sets of other marking technologies, the technical system of the invention has substantial innovation, rigor and superiority.

FIG. 10 sequence comparison of Pii disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,

2 alleles of the gene family have been isolated and cloned so far, Pii-M (Pi 5; GenBank EU869185.1 and EU 869186.1; Lee et al 2009, Genetics,181: 1627-; Pii-F (═ Pii; GenBank MH490982.1 and MH 490983.1; Takagi et al 2009, New Phytologist,200: 276-. To facilitate sequence alignment analysis, in addition to the 2 donor varieties described above, 2 sequencing reference varieties Minghui 63(MH63), Shuhui 498(SH498) were added, which were presumed to be carriers of the target genes; and 5 genome sequences corresponding to sequencing reference varieties Nipponbare (NPB), Shennong265 (SN265), Suijing 18(SJ18), Tetep (TTP) and IR64 which are presumed to be carriers of non-target genes;

all the validated haplotypes and allele-specific SNPs have been numbered (in order of marker usage) and labeled in green (see FIGS. 10-13 for details);

in particular, since the reference sequence of the above-mentioned sequenced variety is already disclosed, the figure shows only the first of its paired genes in the following "drawings of the specification" in order to fully understand the specific sequence of the Pii disease-resistant gene family and its marker information in conjunction with FIGS. 11-13.

FIG. 11 development and application of functional/non-functional haplotype specific markers for Pii disease resistance allele families.

11a 1 haplotype-specific optimal SNPs for the #1 paired genes of the Pii family;

11b 1 #2 paired gene haplotype specific optimal SNPs of Pii family;

11c 2 Pii optimal haplotype specific markers [ i-1 and # i-2, upper band, non-functional haplotype; lower band, functional haplotype ] identification examples of the first set of 14 Pii reference varieties, wherein,

functional haplotype variety: CK1, Fujisaka5 (Pii-F); CK2, IRBLi-F5 (Pii-F); CK3, IRBL3-CP4 (Pii-F); CK4, IRBL5-M (Pii-M); CK5, C104PKT (Pii-M); CK6, Minghui 63 (Pii-M); CK7, Shuhui 498 (Pii-M);

non-functional haplotype variety: CK8, Shin 2 (Pii-Null); CK9, Aichi Asahi (Pii-Null); CK10, IR64 (Pii-Null); CK11, Tetep (Pii-Null); CK12, Shennong265 (Pii-Null); CK13, Suijing 18 (Pii-Null); CK14, Nipponbare (Pii-Null); m, DL-500size marker;

specification of test varieties: the information of the 14 first Pii reference varieties is as described above, and if unnecessary, it is not repeated herein.

FIG. 12 development and application of disease-resistant allele Pii-F specific molecular markers of functional haplotypes of Pii disease-resistant gene cluster

12 a-b 2 optimal SNPs specific to the #1 paired gene of Pii-F (#2 paired genes none);

12c, 2 Pii-F specific markers [ i-3 and # i-4 ], upper bands and target genes; bottom band, non-target genes identification examples of the first set of 14 Pii reference varieties, wherein,

the target gene variety: CK1, Fujisaka5 (Pii-F); CK2, IRBLi-F5 (Pii-F); CK3, IRBL3-CP4 (Pii-F);

non-target gene variety: the remaining 11 Pii first set of reference varieties.

FIG. 13 development and application of disease-resistant allele Pii-M specific molecular markers of functional haplotypes of the Pii disease-resistant Gene family

13a 1 optimal SNP specific to the #1 paired genes of Pii-M;

13b 1 #2 paired gene specific optimal SNP of Pii-M;

13c, 2 Pii-M specific markers [ i-5 ], upper band and target gene; lower band, non-target gene; # i-6, upper band, non-target gene; lower band, target genes ] identification examples of a first set of 14 Pii reference varieties, wherein,

the target gene variety: CK4, IRBL5-M (Pii-M); CK5, C104PKT (Pii-M); CK6, Minghui 63 (Pii-M); CK7, Shuhui 498 (Pii-M);

non-target gene variety: the remaining 10 Pii first set of reference varieties.

FIG. 14 is an application and an example of identifying and mining new and old disease-resistant alleles from Guangxi rice seed resource populations with unknown target genes by using the technical system which has the advantages of compatibility and accurate identification, mining and cloning of rice blast Pii disease-resistant gene family alleles. Wherein the content of the first and second substances,

14a, identifying 52 test varieties based on 2 optimal primary markers, wherein the results show that 23 varieties such as Q2674-76, Q2678-79, Q2682-83, Q2687-2702 and the like are functional haplotype varieties (red); the other 29 varieties are non-functional haplotype varieties (black color);

14b identification of 52 test varieties based on secondary markers, wherein,

b1 identification of 52 test varieties by 2 optimal Pii-F specific markers, wherein the result shows that no Pii-F carrier exists (blue);

b2, 2 optimal Pii-M specific markers identify 52 test varieties, and the result shows that 18 varieties such as Q2674-76, Q2678-79, Q2683, Q2687-89 and the like are Pii-M carriers (green);

from the above results, it was concluded that 5 varieties such as Q2682, Q2699-2702 had the same genotype and were different from Pii-F and Pii-M, and therefore, they were the carriers of the Pii family novel alleles: Pii-F036 (Q2682; purple).

Wherein, the second set of 3 Pii reference varieties is CK1, Fijisaka 5 (Pii-F); CK2, IRBL5-M (Pii-M); CK3, Nipponbare (Pii-Null).

FIG. 15 shows the application and example of identifying and mining new and old disease-resistant alleles from Liaoning rice variety resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pii disease-resistant gene family alleles with compatibility and accuracy. Wherein the content of the first and second substances,

15a, based on the identification of 58 test varieties by 2 optimal primary markers, the result shows that 20 varieties such as Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like are functional haplotype varieties (red); the rest 38 varieties are non-functional haplotype varieties (black color);

15 b-identification of 58 test varieties based on secondary markers, wherein,

b1 identification of 58 test varieties by 2 optimal Pii-F specific markers, wherein the results show that 18 varieties such as Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-50, Q2753-54, Q2758, Q2760, Q2762, Q2765, Q2771 and the like are Pii-F carriers (blue);

b2 identification of 52 test varieties by 2 optimal Pii-M specific markers, wherein the result shows that only 1 variety such as Q2757 is a Pii-M carrier (green);

based on the above results, it was concluded that 1 variety such as Q2751 is a carrier of the Pii family novel allele (purple), and the variety is named Pii-BJ (Q2751) because its genotype is different from Pii-F, Pii-M and Pii-F036;

the information for the 3 Pii second set of reference cultivars is described above.

FIG. 16 is an example of comparison of the discrimination ability of a technical system for identifying, mining and cloning rice blast Pii disease-resistant gene family alleles with other marker techniques by using a set of the present invention

16 a-b, the result of the identification of the 14 Pii first set of reference varieties by the technical system of the invention shows that CK 1-7 is a functional haplotype variety, wherein CK 1-3 is a Pii-F carrier; CK 4-7 is Pii-M carrier;

16c identification of the first set of 14 Pii reference varieties by Pii other marker technology (Pii-ID07, Pii-ID21, Pii-ID24, Kitazawa et al 2019, Breeding Science,69: 68-83; 40N23R, Yadav et al 2019, Plos One,14: e0211061), the results showed that the detection results of all 4 markers and their combinations do not have comparability and logicality;

and (4) conclusion: the technical system of the invention has substantial innovation, rigor and superiority;

the information for the 14 Pii first set of reference varieties is as described above.

FIG. 17 application and examples of cloning and verifying rice blast Pia and Pii disease-resistant gene family alleles by means of homologous gene cloning based on PCR technology

17a structural diagram and cloning diagram of the Pia major disease resistance allele;

17b, structural diagram and cloning schematic diagram of Pii major disease resistance allele;

17C Pia-C transgenic T₁The line, the donor variety (CO39) and the recipient variety (Fujisaka 5) thereof are inoculated and identified with disease-resistant phenotype, and the result of the genotype coseparation analysis based on the transgene selection marker Hpt shows that the phenotype and the genotype of most of one generation of the line are consistent;

individuals #

7,9,10 were inconsistent and may be involved in vaccination evasion and transgene silencing;

wherein, a commonly used vector pGEM-T (Promerge Corporation, WI, USA) in a laboratory is used for cloning and sequencing a target gene, and a polygene polymerization transformation vector pYLCC 380DTH (Lin et al 2003, PNAS,100: 5962-; r, resistant, disease resistance; s, susceptable, susceptibility.

FIG. 18 shows a set of two experimental graphs (attached to the abstract) of the technical system (two-stage marker system) for identification and mining of alleles of rice blast Pia and Pii disease-resistant gene families

18a detection of a first set of 14 Pia reference varieties by a first grade marker of Pia;

18b detection of a first set of 14 Pia reference varieties by a Pia secondary marker;

18c detection of a first set of 14 Pii reference varieties by a first grade marker of Pii;

18d, detection of a first set of 14 Pii reference varieties by a Pii secondary marker;

the information for the 14 Pia first set of reference cultivars and the 14 Pii first set of reference cultivars is as described above;

in particular, 2 sets of technical systems are indicated in separate colors.

Detailed Description

The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

All rice varieties used in the examples: 14 first Pia reference varieties (containing 2 second Pia reference varieties) and 14 first Pii reference varieties (containing 3 second Pii reference varieties); guangxi germplasm resource populations (Q2631-2706) and Heilongjiang germplasm resource populations (Q2709-2773) of the test varieties are collected and stored in laboratories of the applicant, are commonly used in the research field and are disclosed in the documents including but not limited to Zhai et al.2011, New Phytologist 189: 321-; hua et al.2012, the scientific and Applied Genetics 125:1047-1055,https://www.springer.com/ journal/122(ii) a Snow plum, 2021, master paper at south china university of agriculture (no published labeling of relevant core information); linlisan, 2021, university of south china master paper (no relevant core information for labeling is disclosed); annex charts are available at the respective magazine web sites ].

The technical route diagram developed and applied by the patent is shown in figure 1.

Example 1 sequence comparison of the Rice blast Pia disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 4)

First, experiment method

Cloned Pia-A [ original name: pia; donor variety Aichi Asahi; okuyama et al.2011 in GenBank accession numbers: AB604626.1 and AB 60421; for the convenience of sequence alignment analysis, 5 sequencing reference varieties Sasanishiki, CO39, Nipponbare (NPB), Hitomebore, Shennong265, which are presumed to be carriers of target genes, were added; and 2 genomic sequences corresponding to the sequencing reference varieties Suijing 18, Koshihikari presumed to be non-target gene carriers;

the range of the individual genes ATG to TGA/TAA is annotated with reference to NCBI.

Sequence comparison analysis was performed by conventional bioinformatics methods.

Second, experimental results

The sequence comparison results are shown in FIGS. 2-4, and the results show that:

(1) the sequences of the paired genes of the Pia disease-resistant gene family have obvious genome differentiation (typical positions are shown as the marks # a-1 and # a-2 in figure 3) of functional haplotypes (12 reference sequences of the 6 disease-resistant reference varieties) and non-functional haplotypes (4 reference sequences of the 2 susceptible reference varieties);

(2) functional specific SNPs exist between alleles of the Pia disease resistance gene family (typical positions are shown as markers # a-3 to # a-4 in FIG. 4);

in particular, the reference sequence of 3 varieties such as the sequencing reference variety Nipponbare, Hitomebore, Shennong265 and the like has integral errors and is a functional haplotype variety (see examples 2-6 for details);

in addition, since the 16 reference sequences are already disclosed, the paired genes in the following "figure of the specification" only show the first half of the first gene, so as to fully understand the specific sequences of the Pia disease-resistant gene family and the marker information thereof in combination with FIGS. 3-4.

Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pia disease-resistant gene family (FIG. 3)

First, experiment method

The experimental procedure of this example is described mainly in the paper published by the Applicant (Zhai et al 2011, New Phytologist 189:321- "334; Hua et al 2012, the ecological and Applied Genetics 125: 1047-" 1055).

[ the following references are the same as those mentioned above, and need not be repeated ]

Briefly described, the following steps:

(1) design of haplotype-specific molecular markers (SNP markers): according to the comparison result of the Pia disease-resistant gene family sequence, aiming at 2 haplotype specificity optimal SNPs with clear differentiation of functional/non-functional haplotypes, the primer design of dCAPS (Passive regenerative and genomic polymorphism sequences; Neff et al 2002, Trends in Genetics 18:613-615) marker is carried out by using online software dCAPSFinder 2.0(http:// helix.wustl.edu/dCAPS/dcaps.html); then, the Primer design software Primer 5.0 is used for confirming the mark design;

(2) design of haplotype-specific molecular markers (Indel markers): for insertion/deletion (Indel) polymorphic regions with clear functional/non-functional haplotype differentiation, label design and confirmation are carried out by utilizing Primer design software Primer 5.0 on conserved and specific genome regions at two sides directly;

[ molecular markers and primer design procedures below are the same as those described above, and are not repeated

For descriptive convenience, the symbols are designated as # a-1 and # a-2 (and so on); the primer sequences are as follows:

for the # a-1 marker (upper band, non-functional haplotype; lower band, functional haplotype):

SEQ ID NO.1(Pia-F/N^G1-303T-F；5’-3’)：

ACGACGGCAAGCCCAGA；

SEQ ID NO.2(Pia-F/N^G1-303T-R；5’-3’)：

AGAGCCCTGAGCTCCGCGAT。

for the # a-2 marker (upper band, functional haplotype; lower band, non-functional haplotype):

SEQ ID NO.3(Pia-F/N^{Indel(2-1007)}-F；5’-3’)：

AGGTGCTCGGCGAATTGCT；

SEQ ID NO.4(Pia-F/N^{Indel(2-1007)}-R；5’-3’)：

AGCTGACCAGCATCGGAGT。

(2) PCR amplification of haplotype-specific molecular markers: the 14 first set of Pia reference varieties were subjected to PCR amplification using the 2 sets of primers. The PCR amplification system (20.0. mu.L) was as follows:

[ the following PCR amplification System is the same as that described above, and is not repeated therein ]

The PCR amplification conditions were: pre-denaturing at 94 ℃ for 3min, performing PCR amplification for 25-40 cycles (35 cycles for CAPS/dCAPS marker and 25 cycles for Indel marker; and adjusting the detection object) at 94 ℃ for 30sec, annealing for 30sec (# a-1/57 ℃, and # a-2/60 ℃), extending at 72 ℃ for 25-30 sec (adjusting the detection object) and finally extending at 72 ℃ for 5min, and storing the PCR product in a refrigerator at 4 ℃ for later use.

[ except for annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated

(3) Enzyme digestion of haplotype-specific molecular markers (Indel marker does not need enzyme digestion): for CAPS or dCAPS marker such as the # a-1 marker, the PCR product was first extracted and cleaved with the appropriate restriction enzyme and its optimum temperature (# a-1, HhaI/37 ℃) in the following reaction system (10.0. mu.L):

after 5 hours of digestion, the mixture was stored in a refrigerator at 4 ℃ until use.

[ the enzyme digestion system of PCR amplification products is the same as that described above, and will not be repeated here ]

(4) Detection of haplotype-specific molecular markers:

respectively taking out the CAPS or dCAPS marked enzyme digestion product and Indel marked PCR product, adding 10 mu L of 10x loading into each tube of enzyme digestion product or PCR product, uniformly mixing, and detecting according to the following program;

1.5-2.5 mul of the product is sampled by a microsyringe and electrophoresed on 10% -12% modified polyacrylamide gel (250V, 20-120 min; can be adjusted according to the detection object), and then the molecular marker is photographed and recorded according to the conventional detection method.

[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]

Second, experimental results

The size of each molecular marker is shown in fig. 3, and the results show that the 14 Pia first set of reference varieties present clear genotypes (haplotypes):

non-functional haplotype variety: CK9, Shin 2 (Pia-Null); CK10, Fujisaka5 (Pia-Null); CK11, Kusabue (Pia-Null); CK12, Kasalath (Pia-Null); CK13, Koshihikari (Pia-Null); CK14, Suijing 18 (Pia-Null).

In particular, only when 2 functional/non-functional haplotype-specific molecular markers of the test variety are functional haplotypes, the test variety can be judged as a functional haplotype variety

Example 3: development and application of disease-resistant allele Pia-C function-specific molecular marker of functional haplotype of Pia disease-resistant gene family (figure 4)

First, experiment method

(1) Design of Pia-C function specific molecular markers: according to the comparison result of the Pia disease-resistant gene family sequences, 2 optimal SNPs are selected to be designed into a Pia-C function specific molecular marker Pia-C^T1-2214C(#a-3Marker), Pia-C^{Indel(2-3038)}(# a-4 marker); the primer sequences are as follows:

for the # a-3 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.5(Pia-C^T1-2214C-F1；5’-3’)：

AATAAAGTTTTTGGCTCCGAAGATCAATGTCCT；

SEQ ID NO.6(Pia-C^T1-2214C-F2；5’-3’)：

AATAGAGTTTTTGGATCAGAGCAACAATGTCCT；

SEQ ID NO.7(Pia-C^T1-2214C-R1；5’-3’)：

CGGTTGGCTTCCTAGAAGACCTGCTAT；

SEQ ID NO.8(Pia-C^T1-2214C-R2；5’-3’)：

CGGCAGGCTTGCTAAAAGACCGGCTAT；

for the # a-4 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.9(Pia-C^{Indel(2-3038)}-F；5’-3’)：

GCCTTTCATCTACTAAATTTACAACAGG；

SEQ ID NO.10(Pia-C^{Indel(2-3038)}-R；5’-3’)：

CAAGTAGCTCAAATTACTCAAGGC；

in particular, since the # a-3 marker is located in a region where the genome is significantly differentiated, the marker is optimized as a marker for 4 primer combinations (2F vs 2R) in order to ensure the reliability and accuracy of the detection result.

(2) Detection of Pia-C function specific molecular markers: and (3) carrying out PCR amplification on the first set of 14 Pia reference varieties by using the 2 marked primer combinations according to the PCR amplification system (annealing temperature: # a-3/57 ℃ and # a-4/58 ℃), and then carrying out detection and recording of molecular markers according to the enzyme digestion system (# a-3/MseI/37 ℃; and # a-4 does not need enzyme digestion) and the detection system.

Second, experimental results

The sizes of the molecular markers are shown in FIG. 4, and the results show that the Pia-C function specific molecular marker can distinguish the target gene from all known functional genes of the gene family and non-functional genes:

non-target gene variety: the remaining 10 Pia first set of reference varieties.

Example 4: the application and example of the disease-resistant allele Pia-A are identified by using the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of the disease-resistant allele family of the rice blast Pia (figure 5)

(1) As described in example 2, the results of the detection of 14 first sets of Pia reference varieties by 2 functional/non-functional haplotype-specific molecular markers indicate that CK 1-8 are functional haplotype varieties (carriers of Pia disease-resistant gene family alleles);

(2) as described in example 3, the results of the detection of 14 first sets of Pia reference varieties by 2 Pia-C function specific molecular markers indicate that CK 5-8 are carriers of Pia-C, and CK 1-4 pairs have the same genotype as non-functional haplotype variety pairs;

(3) from the above results, it was concluded that CK 5-8 should be carriers of Pia-A because they are functional haplotype varieties and CK1 among them is the donor variety of Pia-A.

This example illustrates: although the alleles of the Pia disease-resistant gene family are relatively simple (only 2 alleles are found at present), the technical system has remarkable inclusiveness and the capability of accurately identifying and mining the alleles.

Example 5: the application and the example of the sequencing error are discriminated by utilizing the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele (figure 6)

As described in example 2, the results of the detection of 14 Pia first set of reference varieties by 2 functional/non-functional haplotype-specific molecular markers indicate that CK 1-8 is a functional haplotype variety (carriers of Pia disease-resistant gene family alleles) and CK 9-14 is a non-functional haplotype variety (carriers of non-Pia disease-resistant gene family alleles). This result is clearly inconsistent with the results of sequencing, since the latter result indicates that Nipponbare, Shennong265, etc. should be a non-functional haplotype variety (FIG. 6 c). In order to confirm whether the sequencing errors of the Pia disease-resistant gene loci of the Nipponbare, Shennong265 and other varieties are individual or integral, 3 screening markers are further developed in the embodiment, and more genome segments of the Pia disease-resistant gene loci are detected and confirmed.

First, experiment method

(1) Designing a sequencing error screening marker of a Pia disease-resistant gene family: according to the comparison result of the Pia disease-resistant gene family sequence, further randomly selecting optimal 2 SNPs and 1 Indel to design as functional haplotype/non-functional haplotype specific molecular marker Pia-F/N^T1-68C(# screen a-1 marker, SEQ ID NO.33-34 for sequence), Pia-F/N^T1-200A(# distinguishes a-2 marker, the sequence is shown in SEQ ID NO. 35-36), Pia-F/N^{Indel(2-3489)}(# screen a-3 marker, sequence shown in SEQ ID NO. 37-38);

in particular, since the screening marker is not in the scope of protection of the present patent (a marker that is not sufficiently necessary for a patent), the primer sequence thereof is arranged in the "screening marker" series following the "patent marker" series, and is only referred to (the same below).

(2) Detection of sequencing error screening markers of the Pia disease-resistant gene family: and performing PCR amplification on 14 first Pia reference varieties according to the PCR amplification system (annealing temperature: the annealing temperature is from # screening a to 1/54 ℃, the annealing temperature is from # screening a to 2/58 ℃, and the annealing temperature is from # screening a to 3/56 ℃) by using the 3 marked primer combinations, and then performing detection and recording of molecular markers according to the enzyme digestion system (# screening a-1 and # screening a-2/Bsr I/65 ℃; the enzyme digestion is not needed for # screening a-3) and the detection system.

Second, experimental results

The 3 discrimination markers exhibited results completely consistent with the 2 functional/non-functional haplotype-specific molecular markers (# a-1 and # a-2). Thus, it was demonstrated that sequencing errors of the Pia resistance gene locus of Nipponbare, Shennong265, etc. varieties are global (FIG. 6 d);

the example proves that the technical system has strong inclusion and reliability, not only can accurately identify the functional/non-functional haplotypes and alleles thereof of the Pia disease-resistant gene family, but also can reliably identify the sequencing errors existing in the reference sequence, even the Nipponbare reference sequence with the highest quality.

Example 6: application and example of screening true and false alleles by using the technical system which is inclusive and can accurately identify, mine and clone the alleles of the Pia disease-resistant gene family (figure 7)

First, experiment method

(1) To develop a function-specific molecular marker for Pia-A, only 2 candidate SNPs (T2-624C, A2-627C) were found in the reference sequences of the Pia anti-disease gene family (including the #1 and #2 paired genes) (FIG. 7C), with possible polymorphisms between Aichi Asahi (Pia-A) and CO39(Pia-C) (FIG. 7C);

in particular, the above-mentioned Pia-C function-specific molecular marker (Pia-C) was used as a control for comparative analysis (FIG. 7 d);

(2) 2 SNPs were developed as function-specific molecular markers for Pia-A according to the above procedure: Pia-A^T2-624C(# screening a-4, SEQ ID NO. 39-40) sequence, Pia-A^A2-627C(# screening a-5, sequence shown in SEQ ID NO. 41-42), the primer sequence of which is arranged in a "screening marker" series after a "patent marker" series for reference only;

(3) detection of the 2 discrimination markers: and (2) utilizing the 2 marked primer combinations to perform PCR amplification on 14 first sets of Pia reference varieties according to the PCR amplification system (annealing temperature: a-4/62 ℃ for # and a-5/62 ℃) and then performing detection and recording of molecular markers according to the enzyme digestion system (# a-4/XcmI/37 ℃ for # and a-5/TaqI/65 ℃) and the detection system.

Second, experimental results

The results show that both are deduced as haplotype specific markers for the Pia family, but not as markers specific for CK2(Sasanishiki) and CK5(CO 39); specifically, SNPs of all functional haplotype varieties above Shennong265 are not cleavable CCs, while SNPs of non-functional haplotype varieties such as Suijing 18 are cleavable TAs (FIG. 7 c);

and (4) conclusion: the Pia family has so far only 2 alleles, Pia-C and Pia-A, and they can only be identified with precision by the patented technical system (see example 8 below for details).

Example 7 application and example of identifying and mining new and old disease-resistant alleles from Guangxi rice variety resource population with unknown target genes by using the above-mentioned technical system for identifying, mining and cloning alleles of rice blast Pia disease-resistant gene family with inclusion and accuracy (FIG. 8)

(1) The Pia technology system of the present invention is composed of 4 basic specific markers of two-stage detection markers, such as 'functional haplotype-disease-resistant allele'. Wherein, the detection of functional/non-functional haplotypes needs to be advanced preferentially to detect disease-resistant alleles. The detection procedures and schemes of the entire technical system are as described above (fig. 3-4; examples 2-3), and are not repeated.

(2) Utilizing the technical system to identify and mine 44 randomly selected Guangxi rice seed resource groups [ leaf snow plum, 2021, Master thesis of southern China agriculture university (relevant core information is not disclosed) for Pia disease-resistant gene family alleles;

3 varieties CK1, Aichi Asahi (Pia-A); CK2, CO39 (Pia-C); CK3, Nipponbare (Pia-A) was also included in the trial as a second set of reference varieties of Pia.

Second, experimental results

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 52 test varieties were classified (FIG. 8 a):

functional haplotype varieties (red marker): 33 varieties such as Q2631-33, Q2663-69, Q2672, Q2674, Q2678, Q2681-86, Q2689-94, Q2696-2703 and the like are functional haplotype varieties;

non-functional haplotype variety (black marker): 19 varieties such as Q2634-38, Q2670-71, Q2673, Q2675-77, Q2679-80, Q2687-88, Q2695, Q2704-06 and the like are non-functional haplotype varieties.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 6b), 33 functional haplotype test varieties were further identified as:

the target gene Pia-C carries the variety (blue indication): only 3 varieties such as Q2684, Q2689 and Q2691;

(3) combining the detection results of the primary and secondary markers (FIG. 6b), 33 functional haplotype test varieties were further identified as:

the target gene Pia-A carries the species (green designation): 30 varieties of Q2631-33, Q2663-69, Q2672, Q2674, Q2678, Q2681-83, Q2685-86, Q2690, Q2692-94, Q2696-2703 and the like;

the example demonstrates that the technical system has strong compatibility and reliability, because 33 functional haplotype varieties are firstly identified in 52 Guangxi rice seed resource groups with unknown target genes; then identifying carriers of 3 novel target genes Pia-C; combining the detection results of the primary marker and the secondary marker, 30 carriers of known allele Pia-A are further identified.

Implementation 8: an example of the present invention is a set of functional gene with compatibility and accurate identification, excavation and cloning rice blast Pia and other marker technology identification ability comparison (figure 9)

(1) Although The rice blast Pia disease-resistant gene family is one of The most widely applied resistance sources in The global rice Breeding program for rice, especially japonica rice (Okuyama et al 2011, The Plant Journal 66: 467-; Pia-STS (# other party a-4), Yadav et al 2019, Ploss One,14: e 0211061);

in particular, the Pia other-party markers a-1 to a-4 are not necessary markers of the technical system and are only used as references, the primer sequences are respectively shown as SEQ ID NO.43 to 44,45 to 46,47 to 48 and 49 to 50, and the detection procedures are described in the literature;

(2) the first set of 14 Pia reference varieties was used as the test subjects for identification and comparison by the Pia-other marker technique-1 and the Pia-other marker technique-2 (FIG. 9). The results show that compared with the Pia other party marking technology, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects:

(a) firstly, functional/non-functional haplotype analysis is performed by using 2 optimal primary markers of the technical system, and clear functional haplotype boundaries are marked for the subsequent excavation and identification of functional genes (red boxes; fig. 9 a). In this example, CK 1-8 were identified as functional haplotype varieties and CK 9-14 were non-functional haplotype varieties in the 14 Pia first set of reference varieties tested. This is one of the incomparable benefits of Pia other party marking technology;

(b) on the basis, disease-resistant allele analysis is carried out by utilizing 2 optimal secondary markers of the technical system, and clear and comparable allele boundaries are marked for the identification of the disease-resistant allele Pia-C (blue boxes; figure 8 b). In this example, 4 functional haplotype varieties CK 5-8 were carried by the Pia-C;

(c) further, on the basis, the results of the primary marker and the secondary marker detection are integrated, and the carriers of the other 4 functional haplotype varieties CK 1-4 by Pia-A are inferred. This is one of the incomparable beneficial effects of Pia other party marking technology;

(d) the detection effect of the Pia other party marking technology-1: 2 granted patents is similar to that of the two-stage marking of the patent, so that the Pia-C carriers can be clearly identified, but the carriers of the alleles Pia-A and Pia-C cannot be perfectly identified on the basis of identifying functional/non-functional haplotypes by a two-stage marking system like the technical system (FIG. 9C 1);

(e) pia other-party marking technology-2. the 2 markers are similar to the first-level markers of the technical system, can clearly identify the carriers of the Pia disease-resistant gene family, but can not further identify the alleles therein (FIG. 9c2)

And (4) conclusion: the technical system of the invention has substantial innovation, rigor and superiority.

Example 9 sequence comparison of Pii disease resistance Gene families and identification of their specific sequences (FIGS. 10 to 13)

First, experiment method

This gene family is composed of 2 functional genes to date: Pii-F (formerly: Pii; donor variety Fujisaka 5; Lin et al 2007; GenBank of paired genes: MH490982.1, MH490983.1), Pii-M (formerly: Pi 5; recombinant inbred line RIL260 of donor variety Morobekan; Takagi et al 2013; GenBank of paired genes: EU869185.1, EU 869186.1); in order to facilitate the sequence alignment analysis, in addition to the above 2 donor varieties, 2 sequencing reference varieties Minghui 63, Shuhui 498 presumed as carriers of the target genes were added; and 5 genome sequences corresponding to the sequencing reference varieties Nipponbare, Shennong265, Suijing 18, Tetep, IR64 which are presumed to be carriers of the non-target genes;

the range of each gene ATG-TGA is annotated with reference to NCBI;

Second, experimental results

The sequence comparison results are shown in FIGS. 10-13, which show that:

(1) the Pii disease-resistant gene family has obvious functional haplotypes (8 reference sequences of the 4 target gene carriers) and non-functional haplotypes (10 reference sequences of the 5 non-target gene carriers) in the sequences of the paired genes (typical positions are shown as the marks # i-1 and # i-2 in FIG. 11);

(2) there are SNPs specific to each other among alleles of the Pii disease resistance gene family (typical positions are shown by the markers # i-3 and # i-4 in FIG. 12, and the markers # i-5 and # i-6 in FIG. 13);

in addition, since the 18 reference sequences are already disclosed, the paired genes in the following "figure of the specification" show only the first half of the first gene, respectively, so as to fully understand the specific sequences of the Pii disease-resistant gene family and the marker information thereof in combination with FIGS. 11 to 13.

Example 10: development and application of functional/non-functional haplotype specific molecular markers of Pii disease-resistant gene family (FIG. 11)

First, experiment method

(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pii disease-resistant gene family sequences, 2 indels are selected as the optimal 2 indels to be designed as haplotype specific molecular markers Pii-F/N^{Indel(1-1333)}(# i-1 marker) and Pii-F/N^{Indel(2-1323)}(# i-2 marker), the primer sequences were as follows:

for # i-1 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.11(Pii-F/N^{Indel(1-1333)}-F；5’-3’)：

ATTTTTGTTCTTCCAGCAACA；

SEQ ID NO.12(Pii-F/N^{Indel(1-1333)}-R；5’-3’)：

ACCTTTCAGAAGCATTGGATT。

for # i-2 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.13(Pii-F/N^{Indel(2-1323)}-F1；5’-3’)：

GGAGAAGGGTGGAATTTTGATCAGCGCATA；

SEQ ID NO.14(Pii-F/N^{Indel(2-1323)}-F2；5’-3’)：

GGAGAAGAGTGGAACTTTGATCAACGTATA；

SEQ ID NO.15(Pii-F/N^{Indel(2-1323)}-R1；5’-3’)：

ACTATCAAACTGCTTTGGTCACAAAGAAC；

SEQ ID NO.16(Pii-F/N^{Indel(2-1323)}-R2；5’-3’)：

GACTATCAAACTGCTTTTGTCAGAAAGAAC；

in particular, since the # i-2 marker is located in a region where the genome is significantly differentiated, the marker is optimized as a marker for 4 primer combinations (2F vs 2R) in order to ensure the reliability and accuracy of the detection result.

(2) Detection of haplotype-specific molecular markers: performing PCR amplification on a first set of 14 Pii reference varieties according to the PCR amplification system (annealing temperature: # i-1/52-54 ℃ and # i-2/58 ℃) by using the 2 marked 2 groups of primers; and taking out the PCR product, and detecting and recording the molecular marker according to the detection system.

Second, experimental results

The size of each molecular marker is shown in fig. 11, and the results show that the 14 Pii first set of reference varieties present clear genotypes (haplotypes):

non-functional haplotype variety: CK8, Shin 2 (Pii-Null); CK9, Aichi Asahi (Pii-Null); CK10, IR64 (Pii-Null); CK11, Tetep (Pii-Null); CK12, Shennong265 (Pii-Null); CK13, Suijing 18 (Pii-Null); CK14, Nipponbare (Pii-Null).

Example 11: development and application of functional haplotype disease-resistant allele Pii-F function-specific molecular marker of Pii disease-resistant gene family (FIG. 12)

First, experiment method

(1) Designing a Pii-F function specific molecular marker: according to the comparison result of the Pii disease-resistant gene family sequences, selecting the optimal 2 SNPs to respectively design as the Pii-F functional specific molecular marker Pii-F^G1-4603A(# i-3 marker) and Pii-F^C1-5687T(# i-4 marker); the primer sequences are as follows:

for the # i-3 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.17(Pii-F^G1-4603A-F；5’-3’)：

GGTCACTAATTTTCAAGAATAGTGGTA；

SEQ ID NO.18(Pii-F^G1-4603A-R；5’-3’)：

CACTGAGATCCAAAACACGCA；

for the # i-4 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.19(Pii-F^C1-5687T-F；5’-3’)：

CCTCCATCTCACACCTAAATG；

SEQ ID NO.20(Pii-F^C1-5687T-R；5’-3’)：

CATAAGGAAATTTCAAAGGAAACAC。

(2) detection of Pii-F function specific molecular markers: and (3) carrying out PCR amplification on the first set of 14 Pii reference varieties by using the 2 pairs of primers according to the PCR amplification system (annealing temperature: # i-3/54 ℃; # i-4/54 ℃), taking out PCR products, and respectively carrying out detection and recording of molecular markers according to the enzyme digestion system (# i-3, NlaIII/37 ℃; # i-4, MseI/37 ℃) and the detection system.

Second, experimental results

The sizes of the molecular markers are shown in FIG. 12, and the results show that the Pii-F function specific molecular marker can distinguish the target gene from all known functional genes of the gene family, and non-functional genes:

non-target gene variety: the remaining 11 Pii first set of reference varieties.

Example 12: development and application of functional haplotype disease-resistant allele Pii-M function-specific molecular marker of Pii disease-resistant gene family (FIG. 13)

First, experiment method

(1) Designing a Pii-M function specific molecular marker: according to the comparison result of the Pii disease-resistant gene family sequences, selecting the optimal 2 SNPs to respectively design as a Pii-M functional specific molecular marker Pii-M^T1-^4591C(# i-5 marker) and Pii-M^A2-1832C(# i-6 marker); the primer sequences are as follows:

for the # i-5 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.21(Pii-M^T1-4591C-F；5’-3’)：

GGTCACTAATTTTCAAGAATAGTGGTA；

SEQ ID NO.22(Pii-M^T1-4591C-R；5’-3’)：

CACTGAGATCCAAAACACGCA；

for the # i-6 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.23(Pii-M^A2-1832C-F；5’-3’)：

GGTTTGAATTACTTGCATCGTTCAGTGAAATGTAC；

SEQ ID NO.24(Pii-M^A2-1832C-R；5’-3’)：

CCAACCATGTCAAGTGCTATCCACTGTT。

(2) detection of Pii-M function-specific molecular markers: the first set of 14 Pii reference varieties was subjected to PCR amplification using the above 2 pairs of primers according to the above PCR amplification system (annealing temperature: # I-5/54 ℃; # I-6/54 ℃), PCR products were taken out, and molecular markers were detected and recorded according to the above enzyme digestion system (# I-5, Rsa I/37 ℃; # I-6, Nde I/37 ℃) and detection system, respectively.

Second, experimental results

The sizes of the respective molecular markers are shown in FIG. 13, and the results show that the Pii-M function-specific molecular markers can distinguish target genes from all known functional genes of the gene family, as well as non-functional genes:

non-target gene variety: the remaining 7 Pii first set of reference varieties.

Example 13: the application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice variety resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusion and accurate identification, mining and cloning of the disease-resistant gene family alleles of the rice blast Pii (figure 14)

First, experiment method

(1) The Pii technology system of the invention is composed of 4 basic specific markers of two-stage detection markers of 'functional haplotype-disease-resistant allele'. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above, and are not repeated.

(2) Identifying and excavating Pii disease-resistant gene family alleles for 52 randomly selected Guangxi rice seed resource groups [ leaf Chimonanthus praecox, 2021, Master thesis of southern China agriculture university (related core information is not disclosed) by utilizing the technical system;

3 varieties CK1, Fijisaka 5 (Pii-F); CK2, IRBL5-M (Pii-M); CK3, Nipponbare (Pii-Null) was also included in the trial as a second set of reference varieties for Pii.

Second, experimental results

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 52 test varieties were classified (fig. 14 a):

functional haplotype variety (red marker): 23 varieties of Q2674-76, Q2678-79, Q2682-83, Q2687-2702 and the like;

non-functional haplotype variety (black marker): 29 varieties Q2631-73, Q2677, Q2680-81, Q2684-86, Q2703-06 and the like.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 14b), the 23 functional haplotype test varieties described above were further identified as:

the target gene Pii-F carries the variety (blue designation): none;

the target gene Pii-M carries the species (green designation): 18 varieties of Q2674-76, Q2678-79, Q2683, Q2687-98 and the like;

the novel target gene Pii-F036 carries a variety (purple designation): 5 varieties Q2682, Q2699-2702 and the like (the genotypes of the varieties are consistent and are different from those of Pii-F and Pii-M);

the example demonstrates that the technical system has strong compatibility and reliability, because 23 functional haplotype varieties are firstly identified in 52 Guangxi rice seed resource groups with unknown target genes; then identifying carriers of 18 target genes Pii-M; the detection results of the primary marker and the secondary marker are combined, and then carriers of 5 novel alleles Pii-F036 are further identified.

Example 14: the application and the example of identifying and mining the new and old disease-resistant alleles from the Liaoning rice variety resource population with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification, mining and cloning of the disease-resistant gene family alleles of the rice blast Pii (figure 15)

First, experiment method

(1) The detection procedure and scheme of the Pii technology system of the present invention are as described above, and are not repeated.

(2) 58 randomly selected Liaoning rice seed resource groups [ Q2709-41, Q2743-51, Q2753-60, Q2762 and Q2764-73 ] are subjected to the technical system; linlisan, 2021, university of south China Master thesis (unpublished mark related core information) ], identification and mining of Pii disease-resistant gene family alleles are performed;

the second set of reference 3 Pii varieties was also included as controls in the trial.

Second, experimental results

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 58 test varieties were classified (fig. 15 a):

functional haplotype varieties (red marker): 20 varieties of Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like;

non-functional haplotype varieties (black markers): 38 varieties such as Q2709 ~ 11, Q2713 ~ 16, Q2718 ~ 19, Q2721 ~ 26, Q2731 ~ 41, Q2743 ~ 45, Q2748, Q2755 ~ 56, Q2759, Q2764, Q2766 ~ 70, Q2772 ~ 73.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 15b), 58 functional haplotype test varieties were further identified as:

the target gene Pii-F carries the variety (blue indication): 18 varieties such as Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like;

the target gene Pii-M carries the species (green designation): only 1 variety such as Q2757;

novel target gene Pii-BJ carrying varieties (purple designation): only 1 variety Q2751 (genotype different from Pii-F and Pii-M and Pii-F036) was used.

This example demonstrates that the technical system has strong containment and reliability, since in 58 Liaoning rice species resource populations with unknown target genes, 20 functional haplotype varieties are first identified; then identifying carriers of 18 target genes Pii-F and 1 target gene Pii-M; combining the above detection results, the carriers of 1 novel allele Pii-BJ were further identified.

Implementation 15: an example of the present invention is a set of functional gene identification system with compatibility and accurate identification, excavation and cloning of rice blast Pii disease resistance gene and other marker technology identification ability comparison (figure 16)

(1) Although the rice blast Pii disease-resistant gene family is one of the most widely applied resistance sources in global rice, particularly japonica rice disease-resistant breeding programs, researchers have developed only a few scattered molecular markers so far, and only the functional specific markers developed in the genes are selected for comparative analysis of discriminative power. That is: pii other party labeling technology (Pii-ID07 (noted as # other party i-1), Pii-ID21(# other party i-2), Pii-ID24(# other party i-3); Kitazawaet al 2019, Breeding Science 69: 68-83; 40N23R (# other party i-3); Yadav et al 2019, Plos One,14: e 0211061);

particularly, primer sequences of Pii other party markers Pii-ID07, Pii-ID21, Pii-ID24 and 40N23R are respectively shown as SEQ ID NO. 51-52, 53-54, 55-56 and 57-58; since it is not a necessary reference for the present technology system, but is merely a reference;

(2) the first set of 14 Pii reference varieties are used as detection objects for identification and comparison, and the results show that compared with the Pii other-party marking technology, the technical system disclosed by the invention has the following outstanding and definite innovativeness and beneficial effects:

(a) first, functional/non-functional haplotype analysis was performed using 2 optimal primary markers of the present technology system, which marked clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 16 a). In this example, CK 1-7 were identified as functional haplotype varieties and CK 8-14 were non-functional haplotype varieties in the 14 Pii first set of reference varieties tested. This is one of the incomparable benefits of Pii other party labeling techniques;

(b) on the basis, 2 optimal secondary markers of the technical system are utilized to carry out disease-resistant allele analysis, and clear and comparable allele boundaries are marked for the identification of various disease-resistant alleles (figure 16 b). In this example, 7 functional haplotype varieties were further clearly identified as carriers of Pii-F and Pii-M. This is also one of the incomparable beneficial effects of Pii other party's marking technique;

(c) on the contrary, the identification results of the Pii other marker technology on the first set of 14 Pii reference varieties show that the detection results of all 4 markers and the combination thereof have no comparability and logicality, and can not distinguish functional/non-functional haplotypes, can not distinguish 2 known alleles, and can not distinguish and mine novel alleles (FIG. 16 c);

and (4) conclusion: the technical system of the invention has incomparable innovation, rigor and superiority compared with the Pii other marking technology.

Implementation 16 cloning and verification of applications and examples of alleles of the rice blast Pia and Pii disease-resistant Gene families by means of homologous Gene cloning based on PCR technology (FIG. 17)

The experimental procedures of this example are mainly referred to papers published in the art (Wang Li 2012, Master's paper of Huanan university of agriculture; Pan Jinmei 2013, Master's paper of Huanan university of agriculture; Lin et al 2003, PNAS,100: 5962-. Briefly described, the following steps:

(1) according to the results of the sequence comparison of the 2 disease-resistant gene families, fine allele secondary structure chart comparison diagrams are respectively constructed, and then gene cloning primers are respectively designed in the upper and lower conserved regions of the genes on the premise of ensuring the structural integrity of the respective genes (fig. 17 a-b); the primer sequences are shown below:

for the # Pia-1KL primer (annealing temperature: 60 ℃):

SEQ ID NO.25(Pia-1KLF；5’-3’)：

CCAGATAATATCGTGGGGTACATGTTG；

SEQ ID NO.26(Pia-1KLR；5’-3’)：

CTGTCCATCTTAAATGTGCACTTTATG。

for the # Pia-2KL primer (annealing temperature: 60 ℃):

SEQ ID NO.27(Pia-2KLF；5’-3’)：

CTTCCCCAATAGAGAGGACATCATTGC；

SEQ ID NO.28(Pia-2KLR；5’-3’)：

AAGGCATGCTAGTTGGCACGTTCGTTA。

for the # Pii-1KL primer (annealing temperature: 58 ℃):

SEQ ID NO.29(Pii-1KLF；5’-3’)：

CACAACTCCACTTCAGATCTAACTCCT；

SEQ ID NO.30(Pii-1KLR；5’-3’)：

AAGATCTCCTGGCGAGTAGGCTTCACAG。

for the # Pi2-2KL primer (annealing temperature: 58 ℃):

SEQ ID NO.31(Pii-2KLF；5’-3’)：

TGCTTATTGAGTGGGACGGAGGGAGTA；

SEQ ID NO.32(Pii-2KLR；5’-3’)：

ATGTCAATCAACGTGAAAGATGGCTAA。

(2) amplifying target genes respectively by using high-fidelity long-fragment DNA polymerase, Phata Max (Vazyme Biotech Co., Ltd, Nanjing, China) and high-quality DNA of each target gene as a template according to a PCR amplification program;

(3) the PCR product was ligated to pGEM-T Vector using pGEM-T Easy Vector (Promerge Corporation, Wis., USA) commonly used in the laboratory, sequenced according to the procedure, and stored for future use;

(4) taking the pGEM-T vector of each target gene as a template, adding a corresponding enzyme cutting site sequence (Asc I) on the basis of the gene cloning primer, and respectively connecting the paired genes of each target gene to a binary transformation vector pYLCC 380 DTH;

(5) connecting the molecular identification with a correct vector, respectively transforming target genes into corresponding susceptible varieties according to a conventional genetic transformation method, and identifying and analyzing transgenic offspring;

the results show that the invention is useful for cuttingThe dug and cloned disease resistant alleles were both intact and functional (FIG. 17C only shows the results for Pia-C), with most of the transgenic T₁The phenotype of the strain co-segregates well with the genotype (hygromycin selection marker based on its transformation vector backbone, Hpt) (individual individuals may not co-segregate due to vaccination evasion or post-transgene silencing);

(6) the complete sequence of the novel disease-resistant allele mined and cloned by the invention has been registered in a public database: Pia-C (GenBank OL773678, OL773679), Pii-BJ (GenBank OL689231, OL689232), Pii-F036(GenBank OL689233, OL 689234).

The above 16 embodiments prove that the technical system of the invention has the remarkable capabilities and effects of inclusively and accurately identifying, excavating and cloning the alleles of the Pia and Pii disease resistance gene families.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> a group of two technologies with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

System of

<130>

<160> 58

<170> PatentIn version 3.3

<210> 1

<211> 17

<212> DNA

<213> Pia-F/NG1-303T-F

<400> 1

acgacggcaa gcccaga 17

<210> 2

<211> 20

<212> DNA

<213> Pia-F/NG1-303T-R

<400> 2

agagccctga gctccgcgat 20

<210> 3

<211> 19

<212> DNA

<213> Pia-F/NIndel (2-1007)-F

<400> 3

aggtgctcgg cgaattgct 19

<210> 4

<211> 19

<212> DNA

<213> Pia-F/NIndel (2-1007)-R

<400> 4

agctgaccag catcggagt 19

<210> 5

<211> 33

<212> DNA

<213> Pia-CT1-2214C-F1

<400> 5

aataaagttt ttggctccga agatcaatgt cct 33

<210> 6

<211> 33

<212> DNA

<213> Pia-CT1-2214C-F2

<400> 6

aatagagttt ttggatcaga gcaacaatgt cct 33

<210> 7

<211> 27

<212> DNA

<213> Pia-CT1-2214C-R1

<400> 7

cggttggctt cctagaagac ctgctat 27

<210> 8

<211> 27

<212> DNA

<213> Pia-CT1-2214C-R2

<400> 8

cggcaggctt gctaaaagac cggctat 27

<210> 9

<211> 28

<212> DNA

<213> Pia-CIndel (2-3038)-F

<400> 9

gcctttcatc tactaaattt acaacagg 28

<210> 10

<211> 24

<212> DNA

<213> Pia-CIndel (2-3038)-R

<400> 10

caagtagctc aaattactca aggc 24

<210> 11

<211> 21

<212> DNA

<213> Pii-F/NIndel(1-1333)-F

<400> 11

atttttgttc ttccagcaac a 21

<210> 12

<211> 21

<212> DNA

<213> Pii-F/NIndel(1-1333)-R

<400> 12

acctttcaga agcattggat t 21

<210> 13

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-F1

<400> 13

ggagaagggt ggaattttga tcagcgcata 30

<210> 14

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-F2

<400> 14

ggagaagagt ggaactttga tcaacgtata 30

<210> 15

<211> 29

<212> DNA

<213> Pii-F/NIndel(2-1323)-R1

<400> 15

actatcaaac tgctttggtc acaaagaac 29

<210> 16

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-R2

<400> 16

gactatcaaa ctgcttttgt cagaaagaac 30

<210> 17

<211> 27

<212> DNA

<213> Pii-FG1-4603A-F

<400> 17

ggtcactaat tttcaagaat agtggta 27

<210> 18

<211> 21

<212> DNA

<213> Pii-FG1-4603A-R

<400> 18

cactgagatc caaaacacgc a 21

<210> 19

<211> 21

<212> DNA

<213> Pii-FC1-5687T-F

<400> 19

cctccatctc acacctaaat g 21

<210> 20

<211> 25

<212> DNA

<213> Pii-FC1-5687T-R

<400> 20

cataaggaaa tttcaaagga aacac 25

<210> 21

<211> 27

<212> DNA

<213> Pii-MT1-4591C-F

<400> 21

ggtcactaat tttcaagaat agtggta 27

<210> 22

<211> 21

<212> DNA

<213> Pii-MT1-4591C-R

<400> 22

cactgagatc caaaacacgc a 21

<210> 23

<211> 35

<212> DNA

<213> Pii-MA2-1832C-F

<400> 23

ggtttgaatt acttgcatcg ttcagtgaaa tgtac 35

<210> 24

<211> 28

<212> DNA

<213> Pii-MA2-1832C-R

<400> 24

ccaaccatgt caagtgctat ccactgtt 28

<210> 25

<211> 27

<212> DNA

<213> Pia-1KLF

<400> 25

ccagataata tcgtggggta catgttg 27

<210> 26

<211> 27

<212> DNA

<213> Pia-1KLR

<400> 26

ctgtccatct taaatgtgca ctttatg 27

<210> 27

<211> 27

<212> DNA

<213> Pia-2KLF

<400> 27

cttccccaat agagaggaca tcattgc 27

<210> 28

<211> 27

<212> DNA

<213> Pia-2KLR

<400> 28

aaggcatgct agttggcacg ttcgtta 27

<210> 29

<211> 27

<212> DNA

<213> Pii-1KLF

<400> 29

cacaactcca cttcagatct aactcct 27

<210> 30

<211> 28

<212> DNA

<213> Pii-1KLR

<400> 30

aagatctcct ggcgagtagg cttcacag 28

<210> 31

<211> 27

<212> DNA

<213> Pii-2KLF

<400> 31

tgcttattga gtgggacgga gggagta 27

<210> 32

<211> 27

<212> DNA

<213> Pii-2KLR

<400> 32

atgtcaatca acgtgaaaga tggctaa 27

<210> 33

<211> 22

<212> DNA

<213> Pia-F/NT1-68C-F

<400> 33

ctcaggaagc tcgattcgct ac 22

<210> 34

<211> 21

<212> DNA

<213> Pia-F/NT1-68C-R

<400> 34

ttccttgagc agctcgattc c 21

<210> 35

<211> 21

<212> DNA

<213> Pia-F/NT1-200A-F

<400> 35

ggaatcgagc tgctcaagga a 21

<210> 36

<211> 22

<212> DNA

<213> Pia-F/NT1-200A-R

<400> 36

ctcgatgtgg taggagaggt ca 22

<210> 37

<211> 20

<212> DNA

<213> Pia-F/NIndel(2-3489)-F

<400> 37

caccagaggg accagaacaa 20

<210> 38

<211> 22

<212> DNA

<213> Pia-F/NIndel(2-3489)-R

<400> 38

tcagcacaga agaggattcc aa 22

<210> 39

<211> 24

<212> DNA

<213> Pia-AT2-624C-F

<400> 39

agytgcagcg gcccaagagg atgg 24

<210> 40

<211> 22

<212> DNA

<213> Pia-AT2-624C-R

<400> 40

cgtggatgcg cggatctgag gc 22

<210> 41

<211> 24

<212> DNA

<213> Pia-AA2-627C-F

<400> 41

tgcagcggct gaagaggatg gtcg 24

<210> 42

<211> 22

<212> DNA

<213> Pia-AA2-627C-R

<400> 42

cgtggatgcg cggatctgag gc 22

<210> 43

<211> 21

<212> DNA

<213> Pia-C_1-F

<400> 43

tgcaagctaa tggctggtcg a 21

<210> 44

<211> 21

<212> DNA

<213> Pia-C_1-R

<400> 44

tagactggtg tagttgcgga c 21

<210> 45

<211> 21

<212> DNA

<213> Pia-C_2-F

<400> 45

gtgcagtcct gatcagtact c 21

<210> 46

<211> 19

<212> DNA

<213> Pia-C_2-R

<400> 46

agagccacca ggcgaacag 19

<210> 47

<211> 26

<212> DNA

<213> Pia-ID01_2-F

<400> 47

acggtagagc aatttagaag cagtga 26

<210> 48

<211> 25

<212> DNA

<213> Pia-ID01_2-R

<400> 48

agtgcgactg acactttcaa tagca 25

<210> 49

<211> 22

<212> DNA

<213> Pia-STS-F

<400> 49

cttttgagct tgattggtct gc 22

<210> 50

<211> 21

<212> DNA

<213> Pia-STS-R

<400> 50

ctattgcacc agagggacca g 21

<210> 51

<211> 20

<212> DNA

<213> Pii-ID07-F

<400> 51

ttcggtcatt agccggtgct 20

<210> 52

<211> 21

<212> DNA

<213> Pii-ID07-R

<400> 52

ggcggcaggt atggtacttc a 21

<210> 53

<211> 22

<212> DNA

<213> Pii-ID21-F

<400> 53

aagcgaacga ctctagctag aa 22

<210> 54

<211> 26

<212> DNA

<213> Pii-ID21-R

<400> 54

tctccatatg tatgtataac tggctt 26

<210> 55

<211> 22

<212> DNA

<213> Pii-ID24-F

<400> 55

atgaggagat gacaacgagg ag 22

<210> 56

<211> 18

<212> DNA

<213> Pii-ID24-R

<400> 56

gaagagggga acgccgag 18

<210> 57

<211> 24

<212> DNA

<213> 40N23R-F

<400> 57

tgtgaggcaa caatgcctat tgcg 24

<210> 58

<211> 24

<212> DNA

<213> 40N23R-R

<400> 58

ctatgagttc actatgtgga ggct 24

Claims

1. One group of two sets of compatible technical systems for accurately identifying and excavating rice blast Pia and Pii disease-resistant gene families are characterized in that the technical system consists of two-stage detection markers of disease-resistant functional haplotype-disease-resistant allele and the like of 2 sets of self-formed systems, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive result detected by each set of technical system;

specifically, the technical system comprises:

(1) a set of technical system with the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family alleles comprises:

(a) the functional haplotype/non-functional haplotype detection program for the gene family:

defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in a family; designing 2 optimal haplotype specific molecular markers, and carrying out haplotype analysis on functional gene/non-functional gene reference varieties based on a PCR technology to confirm the reliability of the markers; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety;

(b) the detection process of disease-resistant allele Pia-C of functional haplotype of the gene family:

defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 2 optimal functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the Pia-C gene carrier should belong to functional haplotype of Pia disease-resistant gene family, and 2 varieties (individuals) with the same genotype of the function-specific molecular marker as that of the Pia-C reference variety; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pia-C;

(2) a set of technical system with the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pii disease-resistant gene family alleles comprises:

(c) the functional haplotype/non-functional haplotype detection process of the gene family:

defining a genome region with clear haplotype differentiation by comparing the sequences of functional genes/non-functional genes in a gene family; designing 2 optimal haplotype specific molecular markers, and carrying out haplotype analysis on functional gene/non-functional gene reference varieties based on a PCR technology to confirm the reliability of the markers; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety;

(d) the detection procedure of disease-resistant allele Pii-F of functional haplotype of the gene family:

defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 2 optimal functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; Pii-F gene carriers should belong to functional haplotypes of Pii disease-resistant gene families, and 2 varieties (individuals) with the same genotype of the function-specific molecular markers as that of the Pii-F reference variety; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pii-F;

(e) the detection process of disease-resistant allele Pii-M of functional haplotype of the gene family:

defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 2 optimal functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pii-M gene carrier should belong to functional haplotype of Pii disease-resistant gene family, and 2 varieties (individuals) with the same genotype of the function-specific molecular marker as that of the Pii-M reference variety; on the contrary, the detection result of any detection mark which does not accord with the technical system is not the target gene Pii-M;

in the above technical system:

(a) the most optimal and simplified haplotype-specific molecular marker combination is Pia-F/N^G1-303TAnd Pia-F/N^Indel(2 ^-1007)(ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;

wherein, the mark indicates: F/N, functional (functional)/non-functional (non-functional); superscript G1-303T means a specific SNP located at position #303 of the #1 gene of the Pia couple gene (which requires 2 genes to express function); the superscript Indel (2-1007) means the specific insertion/deletion polymorphism (Indel) located at position #1007 in gene #2 of the Pia pair, and so on;

(b) the optimal target gene specific molecular marker combination is Pia-C^T1-2214CAnd Pia-C^Indel(2-³⁰³⁸⁾(ii) a The sequences are respectively shown in SEQ ID NO. 5-8 and SEQ ID NO. 9-10;

wherein, Pia-C^T1-2214CThe labeling needs 2 forward primers and 2 reverse primers to be paired to ensure the stability and reliability of the primer (a conventional pair of forward primers and reverse primers is used if no special description is made);

(c) the optimal target gene specific molecular marker combination is Pii-F/N^Indel(1-1333) and Pii-F/N^Indel(2-¹³²³⁾(ii) a The sequences are respectively shown in SEQ ID NO. 11-12 and SEQ ID NO. 13-16;

wherein, Pii-F/N^{Indel(2-1323)}The labeling requires 2 forward primers and 2 reverse primers to be paired to ensure the stability and the feasibilityReliability;

(d) the optimal target gene specific molecular marker combination is Pii-F^G1-4603AAnd Pii-F^C1-5687T(ii) a The sequences are respectively SEQ ID NO. 17-18 and SEQ ID NO. 19-20;

(e) the optimal target gene specific molecular marker combination is Pii-M^T1-4591CAnd Pii-M^A2-1832C(ii) a The sequences are SEQ ID NO. 21-22 and SEQ ID NO. 23-24 respectively.

2. The use of the technical system of claim 1 for the systematic and precise containment identification and mining of new and old alleles in the 2 complex families of rice blast resistance genes.

3. The use of claim 2, wherein the use is for systematic and precise containment identification and mining of new and old alleles in the 2 complex families of rice blast disease resistance genes, including but not limited to the following 6 target genes:

the functional haplotype new disease-resistant allele Pia-C of rice blast Pia disease-resistant gene family has the sequence of paired genes shown in GenBank OL773678 and OL 773679;

the functional haplotype disease-resistant allele Pia-A of the rice blast Pia disease-resistant gene family has the sequence of the paired genes shown in GenBank AB604626.1 and AB 604621.1;

the functional haplotype disease-resistant allele Pii-F of the rice blast Pii disease-resistant gene cluster has the sequence of paired genes shown in GenBank MH490982.1 and MH 490983.1;

disease-resistant allele Pii-M of functional haplotype of rice blast Pii disease-resistant gene cluster, the sequence of the paired genes is shown in GenBank EU869185.1 and EU 869186.1;

novel disease-resistant allele Pii-BJ of functional haplotype of rice blast Pii disease-resistant gene cluster, the sequence of the paired genes is shown in GenBank OL689231 and OL 689232;

a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene cluster has the sequence of the paired genes shown in GenBank OL689233 and OL 689234.

4. The use of the technical system as claimed in claim 1, wherein the use of the detection principle and procedure of functional/non-functional haplotypes of the Pia gene family to discriminate and infer the presence of global sequencing errors in the gene family.

5. Use of the technical system according to claim 1, characterized in that the use of the technical system of the Pia gene family for the screening of true and false resistance alleles of the gene family is used.

6. The use of the technical system according to claim 1, wherein the genetic resources of unknown target genes are used to identify the known target genes of the 2 gene families.

7. The use of claim 6, wherein and mining includes but is not limited to novel target genes: the functional haplotype new disease-resistant allele Pia-C of rice blast Pia disease-resistant gene family has the sequence shown in GenBank OL773678 and OL 773679.

8. The use of claim 6, wherein and mining includes but is not limited to novel target genes: a novel disease-resistant allele Pii-BJ of functional haplotype of the rice blast Pii disease-resistant gene cluster is shown in GenBank OL689231 and OL689232, and the sequences of the paired genes are shown in the sequence chart.

9. The use of claim 6, wherein and mining includes but is not limited to novel target genes: a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene cluster has the sequence of the paired genes shown in GenBank OL689233 and OL 689234.

10. The use of the technical system of claim 1 for mining and cloning of the use of alleles and their sequences against disease including but not limited to 3 novel types in plant breeding programs for combating disease:

the cloning primer sequences of the paired genes of the rice blast Pia-C disease-resistant gene family allele are shown in SEQ ID NO. 25-26 and SEQ ID NO. 27-28;

the sequences of novel disease-resistant allele Pia-C of functional haplotype of rice blast Pia disease-resistant gene family are shown in GenBank OL773678 and OL773679

The sequences of cloning primers of paired genes of rice blast Pii disease-resistant gene family alleles are shown in SEQ ID NO. 29-30 and SEQ ID NO. 31-32;

novel disease-resistant allele Pii-BJ of functional haplotype of rice blast Pii disease-resistant gene family, the sequence of the paired genes is shown in GenBank OL689231 and OL 689232;

a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene family has the sequence of a paired gene shown in GenBank OL689233 and OL 689234.