CN114292937B

CN114292937B - One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families

Info

Publication number: CN114292937B
Application number: CN202111187797.7A
Authority: CN
Inventors: 潘庆华; 汪金燕; 王兴; 汪文娟; 李落叶; 莫文珠; 王玲
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-10-12
Filing date: 2021-10-12
Publication date: 2022-12-16
Anticipated expiration: 2041-10-12
Also published as: CN114292937A

Abstract

The invention discloses a set of two sets of technical systems with inclusion and accurate identification, excavation and cloning of disease-resistant gene family alleles of rice blast Pit and Pi 54. The technical system consists of two-stage detection markers of functional haplotype-disease-resistant allele and the like of 2 sets of self-forming systems, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The technical system can be used for identifying, excavating, cloning and utilizing rice blast Pit and Pi54 disease-resistant allele family alleles, and has systematic and strict inclusion property and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, and improving the diversity and the reasonable layout of disease resistant varieties so as to prolong the service life of the gramineous crops.

Description

One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a set of two inclusive and accurate identification, excavation and cloning technical systems for disease-resistant gene family alleles of rice blast Pit and Pi 54.

Background

Rice is one of the most important food crops in the world, and rice blast caused by rice blast fungus (Pyricularia oryzae) is one of the most serious limiting factors of rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance depends on direct identification and selection of resistance phenotypes of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environmental and human factors, and identification and selection results are easy to cause errors. In particular, the direct selection of phenotypes by gene interaction between disease-resistant genes is very inefficient or impossible due to overlapping of resistance spectra and coverage. With the development of molecular marker identification technology, the technology has the advantages of accuracy, reliability, no environmental influence and the like, so that the technology becomes the mainstream technology of plant breeding, and the purpose and the efficiency of breeding work are greatly accelerated.

On the other hand, in the process of the long military competition of the disease-resistant gene of the host plant and the avirulence gene of pathogenic bacteria, the disease-resistant gene generates new disease-resistant specificity in the form of multiple-allele family (multiple-allele family) or gene cluster (gene cluster) with the lowest evolution cost, so that the disease-resistant specificity can keep pace with the rapid variation of the avirulence gene. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a broad spectrum persistent resistance "gene family" used for a long time in breeding programs, it will further differentiate into alleles (allels) with different disease resistance specificities in functional haplotypes (Zhai et al 2011, new Phytologist, 189.

In the above two-stage evolution process such as "functional haplotype-disease resistance allele", there are obvious and clear nucleotide polymorphisms, including Single Nucleotide Polymorphism (SNP) and polynucleotide polymorphism [ i.e., differentiated genomic region (differentiated genomic region), and Insertion/Deletion (Insertion/Deletion). Herein, nucleotide polymorphisms within functional genes are collectively referred to as function-specific nucleotide polymorphisms (simply, function-specificity). Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene family, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene families simultaneously. Taking the rice blast resistance gene as an example, among the 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1 (Pit and Pi37 family), 2 (Pib family), 6 (Pi 2/Pi9 family), 8 (Pi 36 family), 9 (Pii family), 11 (Pi 54 and Pik family) and 12 (Pita family) (Sharma et al 2012, agricultural Research, 1-37 and rateour 2019,3biotech, 209.

As described above, the Pit gene family located in the telomeric region of chromosome 1 is one of the most widely used sources of resistance in the global rice, particularly indica breeding programs (Hayashi and Yoshida,2009, the Plant journal,57 413-425). To make full use of the antigen gene, researchers have developed only one set of molecular markers [ seet256,t311, t8042(Hayashiet al 2006, the Theoretical and Applied Genetics, 113.

On the other hand, the Pi54 gene family located in the telomere region of chromosome 11 is one of the most widely used resistance sources in the global rice breeding program, particularly japonica rice breeding program (Raiet al.2011, journal of Plant Biochemistry and Biotechnology, 20. To fully utilize the antigen gene, researchers developed 2 sets of molecular markers [ seeRM27150,RM27181,RM27189(Jiang et al., 2019,Rice,12:29)；Pi54 MAS(Tererasanet al.2019, plant Genetic Resources: characterisation and Ulilization, 17.

As described above, since the Pit and Pi54 gene families are both resistance sources that have been widely used for a long time in rice breeding programs for disease resistance, under the continuous and strong selective pressure of Pyricularia oryzae, complex and diverse variations are generated in two-stage evolutionary levels such as "functional haplotype-disease-resistant alleles". However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the above reported molecular markers are developed sporadically for specific sites of specific genes, and have no clear comparability and logicality to each other, and are far from inclusive. For complex genomic regions, complex gene families, 2 outstanding and realistic problems arise from this: (1) Any single molecular marker which is not designed based on the evolutionary hierarchy is difficult to avoid the problem of false positive or false negative due to the technical limitation of the molecular marker; (2) Any single molecular marker that is not designed based on its evolutionary hierarchy cannot constitute an inclusive and comparable technical system to continuously mine, identify and name new genes in a complex gene family.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a group of two technical systems which are inclusive and can accurately identify, mine and clone the functional alleles of the rice blast Pit and Pi54 disease-resistant gene families. The technical system consists of 2 sets of functional haplotype-disease-resistant allele two-stage detection markers of a self-formed system, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The method specifically comprises the following steps:

(1) The second purpose of the invention is to provide a set of technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pit disease-resistant gene family alleles. Which comprises the following steps:

(a) Provides a specific molecular marker of functional haplotype/non-functional haplotype of Pit gene family and an identification method thereof;

(b) Provides a specific molecular marker of disease-resistant allele Pit-K59 of functional haplotype of Pit gene family and an identification method thereof;

(c) Provides a specific molecular marker of disease-resistant allele Pit-MH of functional haplotype of Pit gene family and an identification method thereof;

(d) Provides a specific molecular marker of disease-resistant allele Pit-IR64 of functional haplotype of Pit gene family and an identification method thereof;

(e) Providing an application and an example for identifying, excavating and cloning a novel disease-resistant allele Pit-SH from a sequencing reference variety by utilizing the technical system which has the advantages of inclusiveness, accurate identification, excavation and cloning of the disease-resistant gene family allele of the rice blast Pit;

(f) The application and the example of identifying, excavating and cloning new and old disease-resistant alleles from Guangdong rice variety resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusiveness, accurate identification, excavation and cloning of rice blast Pit disease-resistant gene family alleles are disclosed;

(g) The application and the example of identifying, excavating and cloning new and old disease-resistant alleles from Guangxi rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pit disease-resistant gene family alleles are disclosed;

(h) Provides an application and an example of the technical system which has the advantages of compatibility, accurate identification, excavation and clone of rice blast Pit disease-resistant gene family allele and the identification capability comparison of other marking technologies.

(2) The third purpose of the invention is to provide a set of technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pi54 disease-resistant gene family alleles. Which comprises the following steps:

(i) Provides a specific molecular marker of functional haplotype/non-functional haplotype of Pi54 gene family and an identification method thereof;

(j) Provides a specific molecular marker of a novel disease-resistant allele Pi54-SJ of a functional haplotype of a Pi54 gene family and an identification method thereof;

(k) Providing an application and an example for identifying, excavating and cloning disease-resistant allele Pi54-TTP from sequencing reference varieties by utilizing the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of the disease-resistant allele Pi54 family allele;

(l) The application and the example of identifying, excavating and cloning new and old disease-resistant alleles from Guangdong rice variety resource groups with unknown target genes by utilizing the technical system which has inclusiveness and accurately identifies, excavates and clones the rice blast Pi54 disease-resistant gene family alleles are disclosed;

(m) identifying and mining the applications and examples of new and old disease-resistant alleles from the Heilongjiang rice seed resource population with unknown target genes by utilizing the technical system which has inclusiveness and accurately identifies, mines and clones the rice blast Pi54 disease-resistant gene family alleles;

(n) provides the application and the example of comparing the identification capability of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pi54 disease-resistant gene family allele with other marking techniques.

(3) The fourth purpose of the invention is to provide the application and the example of the homologous gene cloning means based on the PCR technology for separating and cloning the allele.

The technical solution of the present invention to achieve the above object is as described in the claims and the specific examples.

The invention provides a set of two technical systems which can be used for identifying, excavating and cloning rice blast Pit and Pi54 disease-resistant allele family functional genes and have systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, and improving the diversity and the reasonable layout of disease resistant varieties so as to prolong the service life of the gramineous crops.

Drawings

FIG. 1 is a set of two schemes for the development and application of a comprehensive and precise identification, mining and cloning of alleles of the rice blast Pit and Pi54 disease-resistant gene families.

FIG. 2 sequence comparison of the pit disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,

the gene accession numbers for cloned Pit-K59 [ donor variety K59, hayashi and Yoshida2000 ] are: AB379815.1; to facilitate sequence alignment analysis, 7 sequencing reference varieties 93-11, minghui 63, IR8, shuhui 498, tetep, ZHENHAN 97, IR64, which are presumed to be carriers of the target gene, were added; and 4 genomic sequences corresponding to the reference species Nipponbare, hitomebore, suijing18, shennong 265 for sequencing which are presumed to be carriers of the non-target genes;

all validated haplotypes and allele-specific SNPs have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-6 for details).

In particular, since the above-mentioned 12 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pit disease-resistant gene family and the marker information thereof in conjunction with FIGS. 3 to 6.

FIG. 3 development and application of functional/non-functional haplotype specific molecular markers for pit disease-resistant gene family

3a, 2 optimal SNPs specific to the Pit haplotype;

3b 2 optimal haplotype specific markers [ t-1, pit-F/N ] ^C427G (upper band, non-functional haplotype; lower band, functional haplotype); # t-2, pit-F/N ^G528C (upper band, non-functional haplotype; lower band, functional haplotype) to identify 14 first set of Pit reference varieties; wherein, the first and the second end of the pipe are connected with each other,

functional haplotype variety: CK1, K59 (Pit-K59); CK2, minghui 63 (Pit-MH); CK3, IR8 (Pit-MH); CK4,93-11 (Pit-MH); CK5, IR64 (Pit-IR 64); CK6, kasalath (Pit-IR 64); CK7, SH498 (Pit-SH); CK8, TDK (Pit-SH);

non-functional haplotype variety: CK9, nipponbare (Pit-Null); CK10, shennong 265 (Pit-Null); CK11, suijing18 (Pit-Null); CK12, aichi Asahi (Pit-Null); CK13, BL1 (Pit-Null); CK14, sasanishiki (Pit-Null); m, DL-500;

specification of test varieties: the information of the 14 Pit first set of reference varieties is as described above, and if unnecessary, it is not repeated herein.

Description of the labeling: # t-1 and # t-2 for the number of the label, #1 and #2 for Pit; the gene symbol is italicized and represents a functional gene; the gene symbol is positive body, and represents a marker; F/N, functional/non-functional; the superscript C427G, means the specific SNP at the position of the target gene #427, and so on.

FIG. 4 development and application of disease-resistant allele Pit-K59 functional specific molecular marker of functional haplotype of Pit disease-resistant gene family

4a, 1 optimal SNP with Pit-K59 function specificity;

4b, 1 Pit-K59 functional specificity marker [ t-3, pit-K59 ] ^A2338G (upper band, non-target Gene; lower band, target Gene)

An example of the identification of the 14 Pit first set of reference varieties, wherein,

the target gene variety: CK1, K59 (Pit-K59);

non-target gene variety: the remaining 13 Pit first set of reference varieties.

FIG. 5 development and application of disease-resistant allele Pit-MH functional specific molecular marker of functional haplotype of Pit disease-resistant gene family

5a, 1 optimal SNP of Pit-MH functional specificity;

5b 1 Pit-MH function-specific marker combinations [ # t-4 ^T1924G (upper band, target gene; lower band, non-target gene) examples of the identification of 14 first set of Pit reference varieties, wherein,

the target gene variety: CK2, minghui 63 (Pit-MH); CK3, IR8 (Pit-MH); CK4,93-11 (Pit-MH);

non-target gene variety: the remaining 11 Pit first set of reference varieties.

FIG. 6 development and application of disease-resistant allele Pit-IR64 functional specific molecular markers of functional haplotypes of Pit disease-resistant gene family

6a, 1 optimal SNP specific for the Pit-IR64 function;

6b ^T792C (upper band, non-target gene; lower band, target gene) examples of the identification of 14 first set of reference varieties of Pit, wherein,

the target gene variety: CK5, IR64 (Pit-IR 64); CK6, kasalath (Pit-IR 64);

non-target gene variety: the remaining 12 Pit first set of reference varieties.

FIG. 7 shows the application and examples of identifying, mining and cloning novel disease-resistant alleles Pit-SH from sequencing reference varieties by using two-stage markers of a technical system of the invention with the advantages of compatibility and accurate identification, mining and cloning of rice blast Pit disease-resistant gene family alleles

7a, identifying haplotypes of 14 Pit first set reference varieties based on 2 optimal primary markers, wherein the result shows that CK 1-8 are functional haplotype varieties (red); CK 9-14 are non-functional haplotype varieties (black);

7b allele identification of the first set of 14 Pit reference varieties based on secondary markers, wherein,

7b1, allele identification based on 1 optimal Pit-K59 specific marker indicates that CK1 is a Pit-K59 carrier (red);

7b2 allele identification based on 1 optimal Pit-MH specific marker, the result shows that CK 2-4 is Pit-MH carrier (blue);

7b3, based on 1 optimal allele identification of the Pit-IR64 specific marker, the result shows that CK 5-6 is a Pit-IR64 carrier (green);

from the above results, CK 7-8 were functional haplotype varieties, but the genotypes were different from the 3 alleles of the Pit-disease resistance gene family, and therefore, they were estimated to be Pit-SH carriers (light red).

In particular, the primary and secondary labels are labeled in separate colors.

FIG. 8 is an example of identifying, mining and cloning new and old disease-resistant alleles from Guangdong rice seed resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pit disease-resistant gene family alleles with compatibility and accuracy. Wherein the content of the first and second substances,

8a, based on the identification of 44 test varieties by 2 optimal primary markers, the result shows that only 1 variety such as CV10 is a non-functional haplotype variety, and the rest 43 varieties are functional haplotype varieties;

8b, identification of 44 test varieties based on secondary markers, wherein,

8b1, 1 Pit-K59 function specificity optimal marker for identifying 44 test varieties, wherein the result shows that 9 varieties such as CV3, CV 22-23, CV27, CV32-33, CV39-40, CV43 and the like are Pit-K59 carriers;

8b2, 1 Pit-MH function specificity optimal marker for the identification of 44 test varieties, wherein the results show that 15 varieties, such as CV 1-2, CV11-12, CV17-19, CV24, CV26, CV29, CV34, CV37-38, CV42, CV44 and the like, are Pit-MH carriers;

8b3, 1 Pit-IR64 function specificity optimal marker for identifying 44 test varieties, wherein the result shows that 9 varieties such as CV8, CV 13-14, CV16, CV25, CV28, CV31, CV35-36 and the like are Pit-IR64 carriers;

8 a-b-overall the results, 9 varieties CK 4-7, CV9, CV15, CV20-21, CV41, etc. are functional haplotype varieties, but their genotypes were different from the 3 alleles of the Pit disease-resistant gene family, and were identical to CK4, and therefore, they were estimated as Pit-SH carriers (light red); furthermore, CV30 and other 1 variety were functional haplotype varieties, but the genotypes were different from the 4 Pit disease resistance gene family alleles, and thus, they were estimated to be novel Pit carriers (purple)

Wherein, the second set of 5 Pit reference varieties is CK1, K59 (Pit-K59); CK2, minghui 63 (Pit-MH); CK3, IR64 (Pit-IR 64); CK4, shuhui 498 (Pit-SH); CK5, nipponbare (Pit-Null).

FIG. 9 is an example of identifying, mining and cloning new and old disease-resistant alleles from Guangxi rice species resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pit disease-resistant gene family alleles with compatibility and accuracy. Wherein the content of the first and second substances,

9a, based on the identification of 52 test varieties by 2 optimal primary markers, the result shows that only 1 variety such as CV95 is a non-functional haplotype variety, and the rest 51 varieties are functional haplotype varieties;

9b identification of 52 test varieties based on secondary markers, wherein,

9 varieties such as CV 50-51, CV64, CV73, CV77-78, CV80, CV83, CV85 and the like are carriers of the Pit-K59;

9b2, identifying 52 test varieties by 1 optimal marker of the Pit-MH function specificity, wherein the results show that 18 varieties such as CV48, CV52, CV 65-70, CV74-76, CV79, CV81-82, CV84, CV86, CV88, CV96 and the like are Pit-MH carriers;

the 9b3, 1 optimal functional specificity marker of the Pit-IR64 identifies 52 test varieties, and the result shows that CV 45-47, CV49, CV54-55, CV58, CV62, CV72, CV87, CV89-93 and 15 varieties are carriers of Pit-IR64;

9 a-b, in which 8 varieties, such as CK53, CV9, CV 56-57, CV59-61, CV63, CV94, and the like, are functional haplotype varieties, but the genotypes of the varieties are different from the 3 alleles of the Pit disease-resistant gene family and are the same as CK4, and therefore, the varieties are estimated as Pit-SH carriers (light red); furthermore, CV71 and other 1 varieties were functional haplotype varieties, but the genotypes were different from each of the 4 Pit disease-resistant gene family alleles, and thus, they were estimated to be novel Pit carriers (purple color).

Information for the 5 Pit second set of reference cultivars is described above.

FIG. 10 is a comparative example of the identification ability of the technical system for identifying, mining and cloning the alleles of the disease-resistant gene family of rice blast Pit and other marker techniques with compatibility and precision

10 a-b, the result of the identification of the first set of 14 Pit reference varieties by the technical system of the invention shows that CK 1-8 is a functional haplotype variety, wherein CK1 is a Pit-K59 carrier; CK 2-4 are Pit-MH carriers; CK 5-6 is the carrier of Pit-IR64; CK 7-8 is Pit-SH;

10c identification of the first set of 14 Pit reference varieties by other marker technology (Hayashi et al 2006, theoretical and Applied Genetics,113:251-260, song et al 2014, korean Journal of Plant research, 27; the marker combination t311a/b is used only for the identification of Pit-K59; marker combination t8042a/b is similar to the primary marker of the present invention, but is not as accurate and reliable as the primary marker of the present invention (CK 6 is misinterpreted as a non-functional haplotype, etc.); even if the combination of 3 markers is considered comprehensively, the 4 Pit-resistant alleles cannot be identified because they have no strict logicality, comparability and inclusiveness as those of the technical system of the present invention.

FIG. 11. Sequence comparison of Pi54 disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,

the gene accession numbers of the cloned Pi54-TTP [ Donor variety Tetep, rai et al.2011 ] are: AY914077.1; to facilitate sequence alignment analysis, 5 sequencing reference varieties IR8, tadukan, suijing18, shennon 265, sasanishiki, which are presumed to be carriers of the target gene, were added; and 9 corresponding genomic sequences of the reference species CO39, hitomebore, nipponbare, koshihikari, IR64, shuhui 498,93-11, ZHENHAN 97, minghui 63, which were sequenced and which were presumed to be carriers of non-target genes;

In particular, genBank AY914077.1 of Pi54-TTP is incomplete, as shown in its full version by the applicants' GenBank OK247426 re-cloned, sequence accession.

In addition, since the above-mentioned 12 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pi54 disease-resistant gene family and the marker information thereof in conjunction with FIGS. 12 to 14.

FIG. 12. Development and application of functional/non-functional haplotype-specific molecular markers for Pi54 disease-resistant gene family

12 a-b 2 Pi54 haplotype-specific optimal SNPs;

12c 2 Pi 54-optimal haplotype-specific markers [ 54-1, pi54-F/N ] ^G340A (upper band, non-functional haplotype; lower band, functional haplotype); #54-2, pi54-F/N ^C956T (upper band, non-functional haplotype; lower band, functional haplotype) identification examples of the first set of 14 Pi54 reference varieties; wherein the content of the first and second substances,

functional haplotype variety: CK1, tetep (Pi 54-TTP); CK2, tadukan (Pi 54-TTP); CK3, IR8 (Pi 54-TTP); CK4, SJ18 (Pi 54-SJ); CK5, shennong 265 (Pi 54-SJ); CK6, sasanishiki (Pi 54-SJ); CK7, Q2, aichi Asahi (Pi 54-SJ);

non-functional haplotype variety: CK8, ZHENHAN 97 (Pi 54-Null); CK9, minghui 63 (Pi 54-Null); CK10, IR64 (Pi 54-Null); CK11,93-11 (Pi 54-Null); CK12, CO39 (Pi 54-Null); CK13, shuhui 498 (Pi 54-Null); CK14, nipponbare (Pi 54-Null); m, DL-500;

specification of test varieties: the information of the first set of 14 Pi54 reference varieties is as described above, and if not necessary, it will not be described in detail below.

Description of the labeling: #54-1 and #54-2 are the numbers of the markers, #1 and #2 of Pi54, and so on.

FIG. 13 development and application of disease-resistant allele Pi54-SJ function-specific molecular marker of functional haplotype of Pi54 disease-resistant gene family

13a, 1 optimal SNP of Pi54-SJ function specificity;

13b 1 Pi54-SJ function-specific marker [ 54-3 ^C245G (upper band, target gene;

bottom band, non-target gene) of 14 Pi54 first set of reference varieties, wherein,

the target gene variety: CK4, SJ18 (Pi 54-SJ); CK5, shennong 265 (Pi 54-SJ); CK6, sasanishiki (Pi 54-SJ); CK7, Q2, aichi Asahi (Pi 54-SJ);

non-target gene variety: the remaining 10 Pi54 first reference varieties.

FIG. 14 shows the application and example of identifying and mining disease-resistant allele Pi54-TTP from reference variety by using two-stage marker of the technical system of the present invention with compatibility and accurate identification, mining and cloning of disease-resistant allele Pi54 of rice blast

14a, identifying the haplotype of the first set of reference varieties of 14 Pi54 based on 2 optimal primary markers, wherein the result shows that CK 1-7 is a functional haplotype variety (red); CK 8-14 are non-functional haplotype varieties (black);

14b, identifying alleles of a first set of 14 Pi54 reference varieties based on 1 optimal Pi54-SJ specific secondary marker, wherein the result shows that CK 4-7 is a Pi54-SJ carrier (green);

14 a-b-analysis of the results in general, CK 1-3 are functional haplotype varieties, but for markers Pi54-SJ ^C245G The genotype was the same as that of the nonfunctional haplotype variety but different from that of Pi54-SJ, and therefore, it was inferred to be a Pi54-TTP carrier (blue).

FIG. 15 is a diagram showing an example of identifying and mining new and old disease-resistant alleles from a rice plant resource population of Guangdong, in which target genes are unknown, by using the above-mentioned technical system for identifying, mining and cloning rice blast Pi54 disease-resistant gene family alleles with compatibility and precision

15a, identifying the haplotypes of 44 test varieties based on 2 optimal primary markers, wherein the result shows that only 7 varieties such as CV 1-2, CV6-7, CV15, CV26, CV41 and the like are functional haplotype varieties (red), 37 varieties such as CV 3-5, CV8-10, CV13-14, CV16-25, CV27-40, CV42-44 and the like are non-functional haplotype varieties (black);

15b, identifying 44 test varieties based on 1 optimal Pi54-SJ specific secondary marker, wherein the result shows that no Pi54-SJ carriers exist;

15a to b-in summary of the above results, 7 varieties such as CV1 to 2, CV6 to 7, CV15, CV26, CV41 were functional haplotype varieties, but with respect to the markers Pi54 to SJ ^C245G The genotype is the same as that of the nonfunctional haplotype variety and is different from that of Pi54-SJ, and therefore, the carrier is inferred to be Pi 54-TTP;

wherein, the second set of 3 Pi54 reference varieties is CK1, tetep (Pi 54-TTP); CK2, suijing18 (Pi 54-SJ); CK3, nipponbare (Pi 54-Null).

FIG. 16 is a diagram showing an example of identifying and mining new and old disease-resistant alleles from a Heilongjiang rice seed resource population for which target genes are unknown by using the above-mentioned technical system for identifying, mining and cloning rice blast Pi54 disease-resistant gene family alleles with compatibility and accuracy

16a, identifying the haplotypes of 58 test varieties based on 2 optimal primary markers, wherein the results show that 36 varieties such as CV157, CV 160-163, CV166, CV168, CV172, CV174-180, CV184-190, CV192, CV 194-195, CV198-199, CV201-202, CV204-207, CV211-213 and the like are functional haplotype varieties (red); 22 varieties such as CV 158-159, CV164-165, CV167, CV169-171, CV173, CV 181-183, CV191, CV193, CV196-197, CV200, CV203, CV208-210, CV214 and the like are nonfunctional haplotype varieties (black);

16b, identifying 59 test varieties based on 1 optimal Pi54-SJ specific secondary marker, wherein the results show that the 36 functional haplotype varieties are Pi54-TTP carriers (blue) except CV157, and the other 35 varieties are Pi54-SJ carriers (green);

the second set of 3 Pi54 reference varieties was as described above.

FIG. 17 is a comparative example of the ability to identify the allele of the Pi54 disease-resistant gene family by using a technical system of the present invention with the ability to identify the allele by using other marker techniques

17 a-b, the result of the identification of the first set of reference varieties of 14 Pi54 by the technical system of the invention shows that CK 1-7 are functional haplotype varieties, wherein CK 1-3 are Pi54-TTP carriers; CK 4-7 is Pi54-SJ carrier;

17c1, identification of a first set of 14 Pi54 reference varieties by an other-party marking technology I (Jiang et al.2019, rice, 12);

17c 2. Identification of the first set of 14 Pi54 reference varieties by other marking technology II (Terasan et al 2019, plant Genetic Resources: characterization and inactivation, 17;

and (4) conclusion: the technical system of the present invention has incomparable advantages.

FIG. 18 is a schematic diagram and an example of cloning and verifying alleles of rice blast Pit and Pi54 disease-resistant gene families by using a homologous gene cloning means based on PCR technology

18a structural diagram and cloning schematic diagram of the major disease resistance allele of pit;

18b structural diagram and cloning schematic diagram of the major disease resistance allele of Pi54;

18c ₁ Analyzing disease-resistant phenotype and specific genotype of inoculated identification of strains and receptor varieties thereof;

wherein, a commonly used vector pGEM-T Easy (Promage Corporation, WI, USA) in a laboratory is used for cloning and sequencing a target gene, and a binary transformation vector pYLTAC380 and an upgraded version thereof pCPAN-MF (Lin et al.2003, PNAS,100, 5962-5967; wangli 2012, master academic thesis of south China university of agriculture) are used for genetic transformation of the target gene; the specific genotype consists of PCR fragments derived from antibiotic selection markers (Hpt) of the vector backbone; MR, middle resistance, intermediate disease resistance; MS, midle susceptable, intermediate susceptibility; s, susceptable, susceptibility.

FIG. 19 is a set of experimental graphs (attached to abstract) of two technical systems (two-stage marker system) for identifying, digging and cloning alleles of disease-resistant gene families of rice blast Pit and Pi54 with inclusion and precision

19a, detecting a first set of 14 reference varieties of Pit by using a primary marker of Pit;

19b, detecting a first set of 14 reference varieties of Pit by using a secondary marker of Pit;

1, detecting a first set of 14 Pi54 reference varieties by using a primary marker of 19c;

19d, detecting a first set of 14 Pi54 reference varieties by using a secondary marker of Pi54;

in particular, 2 sets of technical systems are indicated in separate colours.

14 Pit first set of reference breed information: CK1, K59 (Pit-K59); CK2, minghui 63 (Pit-MH); CK3, IR8 (Pit-MH); CK4,93-11 (Pit-MH); CK5, IR64 (Pit-IR 64); CK6, kasalath (Pit-IR 64); CK7, SH498 (Pit-SH); CK8, TDK (Pit-SH); CK9, NPB (Pit-Null); CK10, shennong 265 (Pit-Null); CK11, suijing18 (Pit-Null); CK12, aichi Asahi (Pit-Null); CK13, BL1 (Pit-Null); CK14, sasanishiki (Pit-Null);

information of 14 Pi54 first set of reference varieties: CK1, Q1350, TTP (Pi 54-TTP); CK2, Q160, TDK (Pi 54-TTP); CK3, Q1162, IR8 (Pi 54-TTP); CK4, Q2612, SJ18 (Pi 54-SJ); CK5, Q2412, SN265 (Pi 54-SJ); CK6, Q85, sasanishiki (Pi 54-SJ); CK7, Q2, aichi Asahi (Pi 54-SJ); CK8, Q2470, ZS97 (Pi 54-Null); CK9, Q2424, MH63 (Pi 54-Null); CK10, Q2352, IR64 (Pi 54-Null); CK11, Q1366,93-11 (Pi 54-Null); CK12, Q1047, CO39 (Pi 54-Null); CK13, Q2707, SH498 (Pi 54-Null); CK14, Q2443, NPB (Pi 54-Null).

Detailed Description

The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

All rice varieties used in the examples: 14 Pit first set reference varieties (containing 5 Pit second set reference varieties) and 14 Pi54 first set reference varieties (containing 3 Pi54 second set reference varieties); guangdong germplasm resource populations (CV 1-44), guangxi germplasm resource populations (CV 45-96), and Heilongjiang germplasm resource populations (CV 157-214) of the test varieties were collected and stored in the applicant's laboratory, and were commonly used in the research field and have been disclosed in, including but not limited to, the above references [ ZHai et al.2011, new Phytolst 189, https:// nph.onlinezoliry.wireless.com; hua et al.2012, the Theoretical and Applied Genetics 125,https://www.springer.com/journal/122(ii) a Snow plum, 2021, master paper of south china university of agriculture (no relevant core information for labeling is disclosed); linlisan, 2021, university of south china master paper (no relevant core information for labeling is disclosed); annex charts are available at the respective magazine web sites ].

The technical route diagram developed and applied by the patent is shown in figure 1.

Example 1 sequence comparison of the Rice blast Pit disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 6)

1. Experimental method

Using the cloned genomic sequence (ATG-TAG) of Pit-K59 (donor variety K59; genBank AB 379815.1), another 7 sequencing reference varieties 93-11, minghui 63, IR8, shuhui 498, tetep, ZHENHAN 97, IR64, which are presumed to be carriers of the target gene, were retrieved and downloaded from public databases such as NCBI; to facilitate sequence alignment analysis, 4 genomic sequences corresponding to the putative non-target gene carriers of the sequencing reference variety Nipponbare, hitomebore, suijing18, shennong 265 were added.

The range of the individual genes ATG-TAG is referenced to the NCBI notes.

Sequence comparison analysis was performed by conventional bioinformatics methods.

2. Results of the experiment

The results of the sequence comparisons are shown in FIGS. 2 to 6, and show that:

(1) The sequence of the Pit disease-resistant gene family has obvious genome differentiation of functional haplotypes (the reference sequences of the 8 disease-resistant reference varieties) and non-functional haplotypes (the reference sequences of the 4 disease-sensitive reference varieties) (the typical positions are shown as the marks # t-1 and # t-2 in figure 3);

(2) There are individual function-specific SNPs between alleles of the Pit disease resistance gene family (typical positions are shown by the markers # t-3 to # t-5 in the marker diagrams 4 to 6);

in particular, since the above-mentioned 12 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pit disease resistance gene family and the marker information thereof in conjunction with FIGS. 3 to 6.

Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pit disease-resistant gene family (FIG. 3)

1. Experimental methods

The experimental procedure of this example is mainly described in the papers published by the applicant (Yuan et al 2011, the door Applied Genet 122, 1017-1028, ZHai et al 2011, new Phytologist 189, 321-334, hua et al 2012, the theoretical and Applied genetics,125, 1047-1055.

[ the following references are the same as those mentioned above, and need not be repeated ]

Briefly described, the following steps:

(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pit disease-resistant gene family sequence, aiming at 2 haplotype specificity optimal SNPs with clear differentiation of functional/non-functional haplotypes, according to the design principle of CAPS and dCAPS (derived significant polymorphism sequences; neff et al 2002, trends in Genetics 18; the design of the label was then confirmed using Primer design software Primer 5.0.

[ the following molecular markers and primer design procedures are the same as those described above, and are not repeated therein ]

For descriptive convenience, the labels are named as # t-1 and # t-2 respectively (and so on); the primer sequences are as follows:

for the # t-1 marker (upper band, non-functional haplotype; lower band, functional haplotype):

SEQ ID NO.1(Pit-F/N ^C427G -F；5’-3’)：

AAAGAGATGTTTGGCTTGGAGAGAA；

SEQ ID NO.2(Pit-F/N ^C427G -R；5’-3’)：

CAGTTGACCTGCTTTCATTGTAGTTAC。

for the # t-2 marker (upper band, non-functional haplotype; lower band, functional haplotype):

SEQ ID NO.3(Pit-F/N ^G528C -F；5’-3’)：

AAAGAGATGTTTGGCTTGGAGAGAA；

SEQ ID NO.4(Pit-F/N ^G528C -R；5’-3’)：

CAGTTGACCTGCTTTCATTGTAGTTAC。

the labeling instructions are as described above.

(2) Detection of haplotype-specific molecular markers: and carrying out PCR amplification on the 14 first set of Pit reference varieties by using the 2 groups of primers. The PCR amplification system (20.0. Mu.L) was as follows:

[ the following PCR amplification System is the same as that described above, and is not repeated therein ]

The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then PCR amplification for 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate according to the object to be detected) [ 94 ℃ denaturation for 30sec, annealing for 30sec (# t-1 and # t-2/62 ℃), extension at 72 ℃ for 25-30 sec (which can be adjusted as appropriate according to the object to be detected) ], finally extension at 72 ℃ for 5 min, and storing the PCR product in a refrigerator at 4 ℃ for later use.

[ except for annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated

(3) Enzyme digestion of haplotype specific molecular markers: for dCAPS tags such as #1 and #2 tags, the PCR product was first extracted and cleaved with the corresponding restriction enzymes (# t-1, hpaII; # t-2, nlaIII) in the following reaction scheme (10.0. Mu.L):

after digestion at 37 ℃ for 5 hours (in the present invention, 37 ℃ C., the same applies below), 10. Mu.L of 10 × loading was added to each tube of the digestion product and mixed for further use.

[ PCR amplification product enzyme digestion System is the same as that described above, and details are not repeated ] below

(4) Detection of haplotype-specific molecular markers:

respectively taking out the enzyme digestion products, and detecting according to the following procedures;

and (3) detection procedure: 1.5-2.5 mul of the product is electrophoresed on 10-12% denaturing polyacrylamide gel (250V, 20-120 min; adjusted according to the detected object) by a microsyringe, and then the molecular marker is photographed and recorded according to the conventional detection method.

[ the following molecular marker detection procedures are the same as those described above, and their descriptions are omitted ]

2. Results of the experiment

The size of each molecular marker is shown in fig. 3, and the results show that the 14 Pit first set of reference varieties present clear genotypes (haplotypes):

non-functional haplotype variety: CK9, nipponbare (Pit-Null); CK10, shennong 265 (Pit-Null); CK11, suijing18 (Pit-Null); CK12, aichi Asahi (Pit-Null); CK13, BL1 (Pit-Null); CK14, sasanishiki (Pit-Null).

Example 3: development and application of disease-resistant allele Pit-K59 functional specific molecular marker of functional haplotype of Pit disease-resistant gene family (figure 4)

1. Experimental methods

(1) Designing a Pit-K59 function specific molecular marker: according to the comparison result of the sequence of the Pit disease-resistant gene family, selecting the optimal 1 SNP to design as Pit-YM functional specific molecular marker Pit-K59 ^A2338G (# t-3 marker); the primer sequences are as follows:

for the # t-3 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.5(Pit-K59 ^A2338G -F；5’-3’)：

CAACGACTGCACTTCATGTTCC；

SEQ ID NO.6(Pit-K59 ^A2338G -R；5’-3’)：

CGCTATTGACGCCTTTCCCTA。

(2) Detection of Pit-K59 function specific molecular marker: the first set of 14 Pit reference varieties was subjected to PCR amplification using the above-mentioned 1 pair of primers according to the above-mentioned PCR amplification system (annealing temperature: # t-3/52-58 ℃), and then the molecular markers were detected and recorded according to the above-mentioned restriction enzyme (# t-3/NlaIII) and detection system.

2. Results of the experiment

The sizes of the molecular markers are shown in FIG. 4, and the results show that the Pit-K59 function specific molecular marker can distinguish the target gene from all known functional genes of the gene family and non-functional genes:

the target gene variety: CK1, K59 (Pit-K59);

non-target gene variety: the remaining 13 Pit first set of reference varieties;

example 4: development and application of disease-resistant allele Pit-MH function-specific molecular marker of functional haplotype of Pit disease-resistant gene family (FIG. 5)

1. Experimental methods

(1) Designing a Pit-MH function specific molecular marker combination: according to the comparison result of the above-mentioned Pit disease-resistant gene family sequences, selecting optimum 1 SNP to design into Pit-MH function specific molecular marker Pit-MH ^T1924G (# t-4 marker);

the primer sequences are as follows:

for the # t-4 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.7(Pit-MH ^T1924G -F；5’-3’)：

CCTAGAGCTAGAACAGACTGCAATCGAC；

SEQ ID NO.8(Pit-MH ^T1924G -R1；5’-3’)：

GGCCTGATAATAAGTTTTATCCTGACCT；

SEQ ID NO.9(Pit-MH ^T1924G -R2；5’-3’)：

GGCCCGATAATAAGTTCTATCCTGAGCT；

in particular, to ensure the success of PCR amplification in differentiated regions of the genome, the labeled PCR amplification system consists of 3 primers (1F vs 2R).

(2) Detection of Pit-MH function-specific molecular markers: the 3 primers are used for carrying out PCR amplification on the 14 first set of Pit reference varieties according to the PCR amplification system (annealing temperature: # t-4/59 ℃), and the molecular markers are detected and recorded according to the enzyme digestion (# t-4/Nla III) and the detection system.

2. Results of the experiment

The sizes of the individual molecular markers are shown in FIG. 5, and the results show that the combination of the Pit-MH function-specific molecular markers can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:

non-target gene variety: the remaining 11 Pit first set of reference varieties.

Example 5: development and application of disease-resistant allele Pit-IR64 function-specific molecular marker of functional haplotype of Pit disease-resistant gene family (figure 6)

1. Experimental method

(1) Design of Pit-IR64 function specific molecular marker: according to the comparison result of the sequence of the Pit disease-resistant gene family, selecting the optimal 1 SNP to design as Pit-IR64 functional specific molecular marker Pit-IR64 ^T792C (# t-5 marker), the primer sequences were as follows:

for the # t-5 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.10(Pit-IR64 ^T792C -F；5’-3’)：

GACCAGTTTGTTAAAACAGGCAATCAGAA；

SEQ ID NO.11(Pit-IR64 ^T792C -R；5’-3’)：

CAGATTTCCAAACATCATCCAGCACAAG。

(2) Detection of Pit-IR64 function-specific molecular markers: and (3) respectively carrying out PCR amplification on the 14 first sets of Pit reference varieties according to the PCR amplification system (annealing temperature: # t-5/58 ℃) by utilizing the 1 pair of primers, and then respectively carrying out detection and recording of the molecular markers according to the enzyme digestion (# t-5/BciVI) and the detection system.

2. Results of the experiment

The sizes of the individual molecular markers are shown in FIG. 6, and the results show that the combination of the Pit-IR64 function-specific molecular markers can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:

the target gene variety: CK5, IR64 (Pit-IR 64); CK6, kasalath (Pit-IR 64);

non-target gene variety: the remaining 12 Pit first set of reference varieties.

Example 6: application and example of identifying and mining novel disease-resistant allele Pit-SH from sequencing reference variety by using two-stage marker of technical system of the invention with inclusion and accurate identification, mining and cloning of rice blast Pit disease-resistant gene family allele (figure 7)

Unlike the general molecular marker patent technology, the technology of the present invention is only directed to the detection of specific genomic region DNA polymorphism of a specific target gene, and the technology system of the present invention is composed of two-stage detection markers, such as "functional haplotype-disease resistance allele". The method conforms to the evolution track and the mode of a target gene family, openly comprises the main function specificity SNP, and each marker is independent but has strict logicality and comparability, so that the accurate identification and mining with the inclusion property and the expansibility of the whole gene family are realized. The genotype identification of CK 7-8 of only 14 Pit first set reference varieties is exemplified:

(1) The identification result of the first set of 14 Pit reference varieties based on the primary markers (2 Pit functional haplotype specific optimal markers) indicates that CK 7-8 are also functional haplotype varieties (FIG. 7 a);

(2) However, the identification results of the first set of 14 Pit reference varieties based on the secondary markers [ 3 functional specificity optimal markers of Pit disease-resistant alleles (Pit-K59, pit-MH, pit-IR 64) ] show that CK 7-8 are not carriers of any of the above alleles; from this, it was concluded as a Pit-SH carrier (FIGS. 7b1 to 3);

(3) The result is integrated to conclude that CK 7-8 contains novel Pit disease-resistant allele, pit-SH;

specifically, CK 7-8 are judged as functional haplotype varieties in the primary marker system; in the secondary marker system (allele identification), the genotypes were all identical to those of the 6 non-functional haplotype varieties (CK 9-14). Therefore, the technical system of the invention not only can identify the disease-resistant allele with stronger function, but also can identify the disease-resistant allele (Pit-SH) with weaker function and similar to the non-functional haplotype variety;

the detection procedure of the technical system of the present invention is as described above.

Example 7: an example of identifying and mining new and old disease-resistant alleles from Guangdong rice variety resource populations with unknown target genes by using the technical system which has the advantages of inclusion and accurate identification, mining and cloning of rice blast Pit disease-resistant gene family alleles (figure 8)

1. Experimental methods

(1) The technical system of the invention comprises 5 basic specific markers of two-stage detection markers, such as 'functional haplotype-disease-resistant allele'. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele does not have the precedence. The detection procedures and schemes of the whole set of technical system are as described above (fig. 3-7; examples 2-6), which are not repeated.

In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the number of non-functional haplotype test varieties is too small, the disease resistance allele is detected by retaining the whole population of the test varieties in order to maintain the uniformity and comparability of the detection effect.

(2) Utilizing the technical system to perform resource population [ CV 1-44 ] on 44 randomly selected Guangdong rice seeds; zhai et al.2011, new Phytologist, 189; hua et al.2012, the Theoretical and Applied Genetics, 125; leaf snow plum, 2021, master paper of south China university of agriculture (no public mark related core information) ], identification and mining of Pit disease resistance gene family alleles are performed;

the 5 Pit second set of reference varieties described above were also used as controls in the trial.

(3) Using conventional PCR-based homologous gene cloning techniques (Zhai et al 2011, new Phytologist,189, 321-334, hua et al 2012, theor Appl Genet 125, 1047-1055), novel disease-resistant alleles were isolated, cloned, sequenced and deposited in GenBank;

in particular, according to the rules of GenBank, all the registered gene sequences are genetically annotated (annotated) to ensure their integrity and readability and are thus functional genes.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 44 test varieties were classified as (FIG. 8a; red marker, functional haplotype; black marker, non-functional haplotype):

non-functional haplotype variety: only 1 variety such as CV 10;

functional haplotype variety: 43 varieties except CV 10.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 8 b), 43 functional haplotype test varieties were further identified as:

the target gene Pit-K59 carries the variety (FIG. 8b1; red designation): 9 varieties of CV3, CV 22-23, CV27, CV 32-33, CV39-40, CV43 and the like;

the target gene Pit-MH carries the variety (FIG. 8b2; blue indication): 15 varieties of CV 1-2, CV11-12, CV 17-19, CV24, CV26, CV29, CV34, CV37-38, CV42, CV44 and the like;

the target gene Pit-IR64 carries the variety (FIG. 8b3; green designation): 9 varieties of CV8, CV 13-14, CV16, CV25, CV28, CV31, CV 35-36 and the like;

the target gene Pit-SH carrying species (FIGS. 8 a-b; light red symbols): 9 varieties CK 4-7, CV9, CV15, CV 20-21, CV41 and the like;

unknown novel disease-resistant allele Pit-HHS carrying variety (FIGS. 9 a-b; purple designation): CV30, etc. (genotype different from all 4 alleles).

In particular, the results of two-stage marker detection such as "functional haplotype-disease resistance allele" are marked with independent color systems.

(3) 1 novel disease-resistant alleles such as Pit-HHS (GenBank OK 169590) are isolated and cloned by using CV30 (Huahang silk seedling) as a template by using a conventional PCR-based homologous gene cloning method (see example 17 for details).

This example demonstrates that the present technology system has strong compatibility and comparability, since 43 functional haplotype varieties are first identified in the Guangdong rice resource population with unknown target genes; then, 4 determined target genes Pit-K59, pit-MH, pit-IR64 and Pit-SH are further identified, and 1 novel disease-resistant allele Pit-HHS is added.

Example 8: an example of identifying and mining new and old disease-resistant alleles from Guangxi rice variety resource populations with unknown target genes by using the technical system which has the advantages of inclusion and accurate identification, mining and cloning of rice blast Pit disease-resistant gene family alleles (figure 9)

1. Experimental method

(1) The technical system of the present invention is as described above.

(2) Utilizing the technical system to randomly select 52 Guangxi rice seed resource groups [ CV 45-96; zhai et al.2011, new Phytologist, 189; hua et al.2012, the scientific and Applied Genetics, 125; leaf snow plum, 2021, master paper of south China university of agriculture (unpublished mark relevant core information) ], identification and mining of Pit disease-resistant gene family alleles are carried out;

(3) The gene cloning was as described above.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 52 test varieties were classified as (FIG. 9a; red marker, functional haplotype; black marker, non-functional haplotype):

non-functional haplotype variety: only 1 variety such as CV 95;

functional haplotype variety: 51 varieties except CV 95.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 9 b), 51 functional haplotype test varieties were further identified as:

the target gene Pit-K59 carries the variety (FIG. 9b1; red symbol): 9 varieties of CV 50-51, CV64, CV73, CV 77-78, CV80, CV83, CV85 and the like;

the target gene Pit-MH carried the variety (FIG. 9b2; blue indication): 18 varieties of CV48, CV52, CV65 to 70, CV74 to 76, CV79, CV81 to 82, CV84, CV86, CV88, CV96 and the like;

the target gene Pit-IR64 carries the variety (FIG. 9b3; green designation): 15 varieties of CV 45-47, CV49, CV54-55, CV58, CV62, CV72, CV87, CV 89-93 and the like;

the target gene Pit-SH carrying species (FIGS. 8 a-b; light red symbols): 8 varieties of CV53, CV 56-57, CV 59-61, CV63, CV94, and the like;

unknown novel disease-resistant allele Pit-F04 carrying variety (FIGS. 9 a-b; purple designation): CV71 (F04), etc. [ the genotypes differed from all 5 alleles described above (Pit-K59, pit-MH, pit-IR64, pit-SH, and Pit-HHS) ].

(3) 1 novel disease-resistant alleles such as Pit-F04 (GenBank OK 169591) are isolated and cloned by using CV71 (F04) as a template by using a conventional PCR-based homologous gene cloning method (see example 17 for details).

The example demonstrates that the technical system has strong inclusion and comparability, because 51 functional haplotype varieties are firstly identified in 52 Guangxi rice seed resource populations with unknown target genes; then 4 determined target genes Pit-K59, pit-MH, pit-IR64 and Pit-SH are further identified, and 1 novel disease-resistant allele Pit-F04 is added.

Example 9: one set of the invention has the comparative example of the identification capability of the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of the rice blast Pit disease-resistant gene family functional gene and other marking techniques (figure 10)

(1) Although the rice blast Pit disease-resistant gene family is one of the most widely applied broad-spectrum persistent resistance sources in the global rice disease-resistant breeding program, only one set of three sets of resistance/susceptibility genes are mutually verified molecular markers developed and applied so far, and the resistance/susceptibility genes are all only targeted at the first separately cloned Pit-K59 (derived from Japanese rice variety K59) [ ]t256a/b,t311a/b, t8042a/b(Hayashi et al.2006,Theoretical and Applied Genetics,113:251-260；Song et al.2014,Korean Journal of Plant Research,27:687- 700 ); underlined is a mark); (other side marks t256a/b, t311a/b and t8042a/b are respectively shown as SEQ ID NO. 22-SEQ ID NO. 33);

(2) The above-mentioned three sets of markers were used as the other marker technique, and the first set of 14 Pit reference varieties was used as the test subjects for identification and comparison (FIG. 10). The results show that compared with other marking technologies, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects:

(a) Functional/non-functional haplotype analysis using the primary markers demarcated clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 10 a). In this example, CK 1-8 were identified as functional haplotype varieties and CK 9-14 were non-functional haplotype varieties in the 14 Pit first set of reference varieties tested. The method is one of incomparable beneficial effects compared with other marking technologies;

(b) On this basis, disease resistance allele analysis using secondary markers demarcated clear and comparable allele boundaries for the identification of individual disease resistance alleles (FIG. 10 b). In this example, 3 optimal disease-resistant allele function specific markers were selected, independent of each other and compared to each other to form a rigorous identification system. Thus, 4 disease-resistant alleles were clearly identified (Pit-K59, pit-MH, pit-IR64, pit-SH). This is one of the incomparable benefits of other marking technologies. Specifically, the method comprises the following steps:

the technical system of the present invention comprises a set of 5 optimal function specific markers of two-stage markers, such as functional haplotype-disease resistance allele, etc. as described above, thereby precisely identifying the 4 disease resistance alleles on the basis of clearly identifying functional/non-functional haplotypes.

The other party marking technology is that the identification result of the first set of 14 Pit reference varieties shows that the marking combination t256a/b is similar to the first-level marking of the invention, but is not as accurate and reliable as the first-level marking of the invention (CK 8 is misjudged as non-functional haplotype, etc.); the marker combination t311a/b is only suitable for the authentication of Pit-K59; marker combination t8042a/b is similar to the primary marker of the present invention, but is not as accurate and reliable as the primary marker of the present invention (CK 6 is misinterpreted as a non-functional haplotype, etc.); even if the combination of 3 markers is considered comprehensively, it is not as strict as the technical system of the present invention in terms of logic, comparability and compatibility (FIG. 10 c).

In particular, since other labels do not fall within the scope of the present invention, the primer sequences are shown in the "sequence listing" only for reference;

and (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with other marking technologies.

Example 10 sequence comparison of the rice blast Pi54 disease-resistant Gene family and identification of its specific sequence (FIGS. 11 to 13)

1. Experimental methods

By using the genome sequence (ATG-TAG) of the cloned Pi54-TTP (GenBank AY914077.1; the sequence is incomplete), in order to facilitate the sequence comparison analysis, other 5 sequencing reference varieties IR8, tadukan, suijing18, shennong 265, sasanishiki which are presumed to be the target gene carriers are searched and downloaded from public databases such as NCBI and added; and the corresponding genomic sequences of 9 sequencing reference varieties CO39, hitomebore, nipponbare, koshihikari, IR64, shuhui 498,93-11, ZHENHAN 97, minghui 63, which are presumed to be carriers of non-target genes.

The range of the individual genes ATG-TAG is annotated with reference to NCBI.

2. Results of the experiment

The results of the sequence comparisons are shown in FIGS. 11 to 13, which show that:

(1) Although the sequence of the Pi54 disease-resistant gene family has little differentiation variation, the obvious genome differentiation of functional haplotypes (the reference sequences of the 6 disease-resistant reference varieties) and non-functional haplotypes (the reference sequences of the 9 susceptible reference varieties) still exists (the typical positions are shown as the marks #54-1 and #54-2 in FIG. 12);

(2) Specific SNPs exist among alleles of the Pi54 disease-resistant gene family (typical positions are shown as a marker #54-3 in a marker map 13);

in addition, since the above 15 reference sequences have been disclosed, the figure shows only the first one in the following "drawings of the specification" in order to fully understand the specific sequence of the Pi54 disease-resistant gene family and its marker information in conjunction with FIGS. 12 to 13.

Example 11: development and application of functional/non-functional haplotype-specific molecular markers of Pi54 disease-resistant gene family (FIG. 12)

1. Experimental methods

(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pi54 disease-resistant gene family sequences, the optimal 2 SNPs are selected to be designed into a haplotype specific molecular marker Pi54-F/N ^G340A (# 54-1 marker) and Pi54-F/N ^C956T (# 54-2 marker), the primer sequences were as follows:

for the #54-1 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.12(Pi54-F/N ^G340A -F；5’-3’)：

ACACTGAAGATGCAAGAATGGC；

SEQ ID NO.13(Pi54-F/N ^G340A -R；5’-3’)：

CCTTCATACGCAACAATCTCCA。

for the #54-2 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.14(Pi54-F/N ^C956T -F；5’-3’)：

CTCGTCTTGCAGAACTTGTCATC；

SEQ ID NO.15(Pi54-F/N ^C956T -R；5’-3’)：

TTCCTTCGAGCTGTACAACATCAT。

(2) Detection of haplotype-specific molecular markers: performing PCR amplification on the following 14 Pi54 first set of reference varieties according to the PCR amplification system (annealing temperature: #54-1/55 ℃, #54-2/54 ℃) by utilizing the 2 groups of primers; the PCR product was taken out, cleaved with restriction enzymes Bfa I (# 54-1) and NlaIII (# 54-2), detected by electrophoresis, photographed, and recorded.

2. Results of the experiment

The size of each molecular marker is shown in fig. 12, and the results show that the 14 Pi54 first set of reference varieties present distinct genotypes (haplotypes):

non-functional haplotype variety: CK8, ZHenshan 97 (Pi 54-Null); CK9, minghui 63 (Pi 54-Null); CK10, IR64 (Pi 54-Null); CK11,93-11 (Pi 54-Null); CK12, CO39 (Pi 54-Null); CK13, shuhui 498 (Pi 54-Null); CK14, nipponbare (Pi 54-Null).

Example 12: development and application of disease-resistant allele Pi54-SJ function-specific molecular marker of functional haplotype of Pi54 disease-resistant gene family (FIG. 13)

1. Experimental method

(1) Design of Pi54-SJ function-specific molecular marker: according to the alignment result of the sequence of the Pit disease-resistant gene family, selecting the optimal 1 SNP to design the Pi54-SJ function-specific molecular marker Pi54-SJ ^C245G (# 54-3 marker); the primer sequences are as follows:

for the #54-3 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.16(Pi54-SJ ^C245G -F；5’-3’)：

GATGCAAGAATGGCAAAACTTCCTGA；

SEQ ID NO.17(Pi54-SJ ^C245G -R；5’-3’)：

ACAATCTCCAAAGTTTTCAGGCACTGG。

(2) Detection of Pi54-SJ function-specific molecular markers: the first set of 14 Pi54 reference varieties was PCR-amplified using the above 1 pair of primers according to the PCR amplification system described above (annealing temperature: #54-3/55 ℃), and then the molecular markers were detected and recorded according to the above digestion (# 54-3/Dde I) and detection system.

2. Results of the experiment

The sizes of the individual molecular markers are shown in FIG. 13, and the results indicate that Pi54-SJ function-specific molecular markers can distinguish the target genes from all known functional genes of the gene family, as well as non-functional genes:

the target gene variety: CK4, SJ18 (Pi 54-SJ); CK5, shennong 265 (Pi 54-SJ); CK6, sasanishiki (Pi 54-SJ); CK7, aichi Asahi (Pi 54-SJ);

non-target gene variety: the remaining 10 Pi54 first set of reference varieties.

Example 13: application and example of identifying and mining disease-resistant allele Pi54-TTP from reference variety by using two-stage marker of technical system of the invention with compatibility and accurate identification, mining and cloning of disease-resistant allele Pi54 (FIG. 14)

Unlike the general molecular marker patent technology, the technology of the present invention is only directed to the detection of specific genomic region DNA polymorphism of a specific target gene, and the technology system of the present invention is composed of two-stage detection markers, such as "functional haplotype-disease resistance allele". The method conforms to the evolution track and the mode of a target gene family, openly comprises the main function specificity SNP, and each marker is independent but has strict logic and comparability, so that the accurate identification and excavation of the whole gene family with inclusion and expansibility are realized. The genotyping of CK 1-3 of only the first set of 14 Pi54 reference varieties is illustrated as an example:

(1) Based on the haplotype identification of the first set of reference varieties of 14 Pi54 by 2 optimal primary markers, the result shows that CK 1-7 are functional haplotype varieties (red); CK 8-14 are non-functional haplotype varieties (black) (FIG. 14 a);

(2) Secondary markers Pi54-SJ based on 1 optimal Pi54-SJ specificity ^C245G Allele identification of the first set of 14 Pi54 reference varieties indicated that CK 4-7 are Pi54-SJ carriers (green) (FIG. 14 b);

(3) From the results analysis, CK 1-3 were functional haplotype varieties, but the genotypes of the secondary markers were the same as those of the non-functional haplotype varieties and were different from those of Pi54-SJ, and therefore, they were estimated to be Pi54-TTP carriers (blue) (FIGS. 14 a-b).

Example 14: an example of identifying and mining new and old disease-resistant alleles from a Guangdong rice variety resource population for which target genes are unknown by using the technical system for identifying, mining and cloning rice blast Pi54 disease-resistant gene family alleles with compatibility and accuracy (FIG. 15)

1. Experimental method

(1) The technical system of the invention comprises 5 basic specific markers of two-stage detection markers, such as 'functional haplotype-disease-resistant allele'. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above (fig. 13-14; examples 12-13), which are not repeated herein.

In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, in order to maintain uniformity of detection effect, the test variety group was entirely retained and the detection of the disease-resistant allele was carried out.

(2) Utilizing the technical system to randomly select 44 Guangdong rice seed resource groups [ CV 1-44; zhai et al.2011, new Phytologist, 189; hua et al.2012, the Theoretical and Applied Genetics, 125; leaf snow plum, 2021, master paper of south China university of agriculture (no public mark related core information) ], identification and mining of Pi54 disease-resistant gene family alleles are carried out;

a second set of 3 Pi54 reference varieties CK1, tetep (Pi 54-TTP); CK2, suijing18 (Pi 54-SJ); CK3, nipponbare (Pi 54-Null) was also included as a control.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 44 test varieties were classified into (FIG. 15a; red mark, functional haplotype; black mark, non-functional haplotype):

functional haplotype variety: only 9 varieties such as CV 1-2, CV6-7, CV11-12, CV15, CV26, CV41 and the like;

non-functional haplotype variety: 35 varieties of CV 3-5, CV8-10, CV3-14, CV6-25, CV7-40, CV 42-44, and the like.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 15 b), 9 functional haplotype test varieties were further identified as:

the gene of interest Pi54-TTP carries the variety (blue indication): 9 varieties of CV 1-2, CV6-7, CV11-12, CV15, CV26, CV41 and the like;

the target genes Pi54-SJ carry the species (green designation): none.

Example 15: an example of identifying and mining new and old disease-resistant alleles from a Heilongjiang rice seed resource population with unknown target genes by using the technical system which has the advantages of compatibility and accurate identification, mining and cloning of rice blast Pi54 disease-resistant gene family alleles (figure 16)

1. Experimental methods

(1) The detection procedure and scheme of the technical system of the present invention are as described above (FIGS. 13-14; examples 12-13), which are not repeated herein.

(2) Utilizing the technical system to randomly select 58 Heilongjiang rice seed resource groups (CV 157-214); zhai et al.2011, new Phytologist, 189; hua et al.2012, the Theoretical and Applied Genetics, 125; linlisanna, 2021, master thesis (unpublished mark relevant core information) of south China university ] identifies and mines the allele of Pi54 disease-resistant gene family;

3 Pi54 second set of reference varieties CK1, tetep (Pi 54-TTP); CK2, suijing18 (Pi 54-SJ); CK3, nipponbare (Pi 54-Null) was also included as a control.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 58 test varieties were classified (FIG. 16a; red mark, functional haplotype; black mark, non-functional haplotype):

functional haplotype variety: 36 varieties of CV157, CV 160-163, CV166, CV168, CV172, CV 174-180, CV184-190, CV192, CV194-195, CV198-199, CV201-202, CV 204-207, CV211-213 and the like;

non-functional haplotype variety: 22 varieties of CV 158-159, CV164-165, CV167, CV169-171, CV173, CV 181-183, CV191, CV193, CV196-197, CV200, CV203, CV208-210, CV214 and the like.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 15 b), 36 functional haplotype test varieties were further identified as:

the target gene Pit-TTP carries the variety (blue designation): only 1 variety, CV157, etc.;

the target gene Pit-SJ carries the variety (green designation): 35 varieties of CV 160-163, CV166, CV168, CV172, CV 174-180, CV184-190, CV192, CV194-195, CV198-199, CV201-202, CV 204-207, CV211-213 and the like.

From the results of the above examples 14 to 15, it can be seen that the Guangdong rice seed resource group has only 9 functional haplotype varieties and is a Pit-TTP carrier; the Heilongjiang rice resource group has 36 functional haplotype varieties, and the rest 35 functional haplotype varieties are all Pit-SJ carriers except CV157 which is a Pit-TTP carrier. Therefore, the technical system of the invention not only has strong and strict identification capability of target gene family alleles, but also is suitable for dynamic change analysis of rice seed resource population rice blast disease-resistant gene population structure;

Example 16: one set of the invention has the advantages of compatibility, accurate identification, excavation and cloning of the functional gene of the rice blast Pi54 disease-resistant gene family and the comparative example of the identification capability of other marking technologies (figure 17)

(1) Although the rice blast Pi54 disease-resistant gene family is one of the most widely applied broad-spectrum persistent resistance sources in the global rice disease-resistant breeding program, only one group of linked microsatellite markers, which are developed and applied so far, is marked as other-party marker technology I (RM27150,RM27181,RM27189；Jiang et al 2019, rice,12, 29), and 1 gene function-specific marker, notedFor others marking technique II (Pi54MAS；Tererasan et al 2019, plant Genetic Resources: characterization and Ulilization, 17; (other side marks RM27150, RM27181, RM27189 and Pi54 MAS primer sequences are respectively shown in SEQ ID NO. 34-SEQ ID NO. 41);

(2) The first set of 14 Pi54 reference varieties is used as detection objects for identification and comparison, and the result shows that the technical system has the following prominent and definite innovativeness and beneficial effects compared with the other-party marking technology I and the other-party marking technology II:

(a) Functional/non-functional haplotype analysis using the primary marker demarcated clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 17 a). In this example, CK 1-7 were identified as functional haplotype varieties and CK 8-14 were non-functional haplotype varieties in the first set of 14 Pi54 reference varieties tested. The method is one of incomparable beneficial effects compared with other marking technologies;

(b) On this basis, disease resistance allele analysis using secondary markers demarcated clear and comparable allele boundaries for the identification of individual disease resistance alleles (FIG. 17 b). In this example, 1 optimal disease resistance allele function specific marker was selected, combined with the primary marker results, thereby clearly identifying 2 disease resistance alleles (Pi 54-SJ, pi 54-TTP). This is one of the incomparable benefits of other marking technologies. Specifically, the method comprises the following steps:

as described above, the technical system of the present invention comprises a set of 3 optimal function-specific markers of two-stage markers, such as functional haplotype-disease-resistant allele, etc., thereby precisely identifying the 2 disease-resistant alleles on the basis of clearly identifying the functional/non-functional haplotypes.

The other-party marking technology I shows that the identification result of the first set of 14 Pi54 reference varieties shows that the linkage markers of 3 target genes have no logic and consistency at all and are not suitable for the identification of the target genes at all (FIG. 17c 1);

other marker technique II this marker is a functional specific marker for the target gene, but only barely identifies Pi54-TTP derived from Tetep, and cannot identify Pi54-TTP derived from other sources, and even cannot identify Pi54-SJ (FIG. 17c 2).

In particular, since other labels do not fall within the scope of the present invention, the primer sequences are shown in the "sequence listing" only for reference.

Example 17 cloning and verification of alleles of the disease-resistant Gene families of Rice blast Pit and Pi54 by means of homologous Gene cloning based on PCR technology (FIG. 18)

The experimental procedures of this example are mainly described in the art in published papers (Lin et al 2003, PNAS,100, 5962-5967; wang 2012, master university of south China university of agriculture treaty; yuan et al 2011, the or Appl Genet 122. Briefly described, the following steps:

(1) According to the results of the sequence comparison of the 2 disease-resistant gene families, fine allele secondary structure chart comparison diagrams are respectively constructed, and then on the premise of ensuring the integrity of the gene structure, gene cloning primers are respectively designed in upper and lower conserved regions of the gene cloning primers; the primer sequences are shown below:

for the # KL-1 primer (Pit allele):

SEQ ID NO.18(Pit-KLF；5’-3’)：

GCGTAGAGCTTAGGTTACGGGC；

SEQ ID NO.19(Pit-KLR；5’-3’)：

CTAGGCCTTAATTATATCTACTTC。

for the # KL-2 primer (Pi 54 allele):

SEQ ID NO.20(Pi54-KLF；5’-3’)：

TTCCTTCAAGTGAAGCATCTGCAACAGCTA；

SEQ ID NO.21(Pi54-KLR；5’-3’)：

TTACTAATTTTCTTATTGGTAGATGTGATATTCATTAC。

(2) Amplifying target genes respectively by using high-fidelity long-fragment DNA polymerase, phata Max (Vazyme Biotech Co., ltd, nanjing, china) and high-quality DNA of each target gene as a template according to a PCR amplification program;

(3) The PCR product was ligated to pGEM-T Vector using pGEM-T Easy Vector (Promerge Corporation, wis., USA) commonly used in the laboratory, sequenced according to the procedure, and stored for future use;

(4) Taking the pGEM-T vector of each target gene as a template, adding a corresponding enzyme cutting site sequence on the basis of the gene cloning primer, and respectively connecting each target gene to a binary transformation vector pYLTAC380 or pCPAN-MF;

(5) Connecting the molecular identification with a correct vector, respectively transforming target genes into corresponding susceptible varieties according to a conventional genetic transformation method, and identifying and analyzing transgenic offspring;

the results show that the disease resistant alleles mined and cloned according to the invention are both intact and functional (fig. 18c shows only the results for Pit-K59).

The 17 above embodiments prove that the technical system of the invention has the remarkable capabilities and effects of inclusively and accurately identifying, excavating and cloning alleles of the disease-resistant gene families of Pit and Pi54 from different angles.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> a group of two sets of technical systems with inclusion and accurate identification, excavation and cloning of disease-resistant gene families of rice blast Pit and Pi54

<130>

<160> 41

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

<213> marker Pit-F/NC427G-F

<400> 1

aaagagatgt ttggcttgga gagaa 25

<210> 2

<211> 27

<212> DNA

<213> marker Pit-F/NC427G-R

<400> 2

cagttgacct gctttcattg tagttac 27

<210> 3

<211> 25

<212> DNA

<213> marker Pit-F/NG528C-F

<400> 3

aaagagatgt ttggcttgga gagaa 25

<210> 4

<211> 27

<212> DNA

<213> marker Pit-F/NG528C-R

<400> 4

cagttgacct gctttcattg tagttac 27

<210> 5

<211> 22

<212> DNA

<213> marker Pit-K59A2338G-F

<400> 5

caacgactgc acttcatgtt cc 22

<210> 6

<211> 21

<212> DNA

<213> marker Pit-K59A2338G-R

<400> 6

cgctattgac gcctttccct a 21

<210> 7

<211> 28

<212> DNA

<213> tag Pit-MHT1924G-F

<400> 7

cctagagcta gaacagactg caatcgac 28

<210> 8

<211> 28

<212> DNA

<213> tag Pit-MHT1924G-R1

<400> 8

ggcctgataa taagttttat cctgacct 28

<210> 9

<211> 28

<212> DNA

<213> tag Pit-MHT1924G-R2

<400> 9

ggcccgataa taagttctat cctgagct 28

<210> 10

<211> 29

<212> DNA

<213> marker Pit-IR64T792C-F

<400> 10

gaccagtttg ttaaaacagg caatcagaa 29

<210> 11

<211> 28

<212> DNA

<213> Mark Pit-IR64T792C-R

<400> 11

cagatttcca aacatcatcc agcacaag 28

<210> 12

<211> 22

<212> DNA

<213> marker Pi54-F/NG340A-F

<400> 12

acactgaaga tgcaagaatg gc 22

<210> 13

<211> 22

<212> DNA

<213> marker Pi54-F/NG340A-R

<400> 13

ccttcatacg caacaatctc ca 22

<210> 14

<211> 23

<212> DNA

<213> Label Pi54-F/NC956T-F

<400> 14

ctcgtcttgc agaacttgtc atc 23

<210> 15

<211> 24

<212> DNA

<213> Label Pi54-F/NC956T-R

<400> 15

ttccttcgag ctgtacaaca tcat 24

<210> 16

<211> 26

<212> DNA

<213> Label Pi54-SJC245G-F

<400> 16

gatgcaagaa tggcaaaact tcctga 26

<210> 17

<211> 27

<212> DNA

<213> Label Pi54-SJC245G-R

<400> 17

acaatctcca aagttttcag gcactgg 27

<210> 18

<211> 22

<212> DNA

<213> marker Pit-KLF

<400> 18

gcgtagagct taggttacgg gc 22

<210> 19

<211> 24

<212> DNA

<213> marker Pit-KLR

<400> 19

ctaggcctta attatatcta cttc 24

<210> 20

<211> 30

<212> DNA

<213> marker Pi54-KLF

<400> 20

ttccttcaag tgaagcatct gcaacagcta 30

<210> 21

<211> 38

<212> DNA

<213> marker Pi54-KLR

<400> 21

ttactaattt tcttattggt agatgtgata ttcattac 38

<210> 22

<211> 24

<212> DNA

<213> other Party's tag t256a (K59) -F

<400> 22

ggatagcaga agaacttgag acta 24

<210> 23

<211> 26

<212> DNA

<213> other Party's tag t256a (K59) -R

<400> 23

catgtctttc aacataagaa gttctc 26

<210> 24

<211> 24

<212> DNA

<213> Tafang marker t256b (KSH) -F

<400> 24

ggatagcaga agaacttgag actg 24

<210> 25

<211> 26

<212> DNA

<213> Tafang marker t256b (KSH) -R

<400> 25

catgtctttc aacataagaa gttctc 26

<210> 26

<211> 24

<212> DNA

<213> other party's tag t311a (K59) -F

<400> 26

cgtgaaccca aggcaccagt atta 24

<210> 27

<211> 28

<212> DNA

<213> other party symbol t311a (K59) -R

<400> 27

catgtagttc tggatgttgt agctactc 28

<210> 28

<211> 24

<212> DNA

<213> other party marker t311b (KSH) -F

<400> 28

cgtgaaccca aggcaccagt attc 24

<210> 29

<211> 28

<212> DNA

<213> other Party's tag t311b (KSH) -R

<400> 29

catgtagttc tggatgttgt agctactc 28

<210> 30

<211> 25

<212> DNA

<213> other Party notation t8042a (K59) -F

<400> 30

ctcaagattg tatcgtcgac gactc 25

<210> 31

<211> 23

<212> DNA

<213> other Party notation t8042a (K59) -R

<400> 31

gagaggtttg cagccagacc agg 23

<210> 32

<211> 25

<212> DNA

<213> Tafang notation t8042b (KSH) -F

<400> 32

ctcaagattg tatcgtcgac gacta 25

<210> 33

<211> 23

<212> DNA

<213> other Square marker t8042b (KSH) -R

<400> 33

gagaggtttg cagccagacc agg 23

<210> 34

<211> 23

<212> DNA

<213> other party marker RM27150-F

<400> 34

attcaggctc gcttaccatc tcc 23

<210> 35

<211> 22

<212> DNA

<213> other party marker RM27150-R

<400> 35

cctctgcttg tcccaaatca cc 22

<210> 36

<211> 23

<212> DNA

<213> other party mark RM27181-F

<400> 36

caattcagag gagcaaggtg tcc 23

<210> 37

<211> 23

<212> DNA

<213> other party tag RM27181-R

<400> 37

ttcttaacct ggacttgcca tgc 23

<210> 38

<211> 24

<212> DNA

<213> other party mark RM27189-F

<400> 38

ccgagcttaa tttgcatcta ctgc 24

<210> 39

<211> 22

<212> DNA

<213> other party marker RM27189-R

<400> 39

tgcagattgt ggttggaaat gg 22

<210> 40

<211> 20

<212> DNA

<213> other party marker Pi54 MAS-F

<400> 40

caatatccaa agttttcagg 20

<210> 41

<211> 21

<212> DNA

<213> other party marker Pi54 MAS-R

<400> 41

gcttcaatca ctgctagaac c 21

Claims

1. A method for identifying, digging and cloning rice blast Pit and Pi54 disease-resistant gene family allele with inclusion and precision is characterized in that the method consists of 2 sets of two-stage detection markers of functional haplotype-disease-resistant allele of self-formed system, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive result of detection of each set of detection markers;

specifically, the method comprises the following steps:

(1) A set of method for identifying, excavating and cloning rice blast Pit disease-resistant gene family alleles with compatibility and precision comprises the following steps:

(a) The functional haplotype/non-functional haplotype detection program for the gene family:

defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in families; designing 2 optimal haplotype specific molecular markers, and carrying out haplotype analysis on functional gene/non-functional gene reference varieties based on a PCR technology to confirm the reliability of the markers; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety;

(b) The detection process of disease-resistant allele Pit-K59 of functional haplotype of the gene family:

defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 1 optimal functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the carrier of the Pit-K59 gene belongs to functional haplotype of Pit disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of the Pit-K59 reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pit-K59;

(c) The detection procedure of disease-resistant allele Pit-MH of functional haplotype of the gene family:

defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker combination; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the carrier of the Pit-MH gene belongs to the functional haplotype of a Pit disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of a Pit-MH reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pit-MH;

(d) The detection process of disease-resistant allele Pit-IR64 of functional haplotype of the gene family:

defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the carrier of the Pit-IR64 gene belongs to functional haplotype of Pit disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of the Pit-IR64 reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pit-IR64;

(2) A method for identifying, excavating and cloning rice blast Pi54 disease-resistant gene family alleles with inclusion and precision comprises the following steps:

(e) The functional haplotype/non-functional haplotype detection process of the gene family:

(f) The detection procedure of the disease-resistant allele Pi54-SJ of the functional haplotype of the gene family:

defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 1 optimal functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; pi54-SJ gene carrier belongs to functional haplotype of Pi54 disease-resistant gene family, and the genotype of the function specific molecular marker is the same as that of Pi54-SJ reference variety; on the contrary, the detection result that any detection mark does not meet the method is not the target gene Pi54-SJ;

specifically, in the above method:

(a) The specific molecular marker combination of the medium haplotype is Pit-F/N ^C427G And Pit-F/N ^G528C (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;

wherein, the mark indicates: F/N, functional/non-functional; the superscript C427G means a specific SNP at the position of the target gene #427, and so on;

(b) Specific molecular marker of middle target gene is Pit-K59 ^A2338G (ii) a The sequence is shown in SEQ ID NO. 5-6;

(c) The specific molecular marker combination of the medium target gene is the Pit-MH ^T1924G (ii) a The sequence is shown in SEQ ID NO. 7-9;

in particular, pit-MH ^T1924G The PCR amplification consists of 1 forward and 2 reverse primers;

(d) The specific molecular marker combination of the medium target gene is Pit-IR64 ^T792C (ii) a The sequence is shown in SEQ ID NO. 10-11;

(e) The specific molecular marker combination of the medium target gene is Pi54-F/N ^G340A And Pi54-F/N ^C956T (ii) a The sequence is shown in SEQ ID NO. 12-13, SEQ ID NO. 14-15;

(f) The specific molecular marker combination of the medium target genes is Pi54-SJ ^C245G (ii) a The sequence is shown in SEQ ID NO. 16-17.

2. The method of claim 1, wherein the method is used for systematic and precise inclusively identifying and mining new and old alleles in the 2 complex rice blast disease-resistant gene families as follows:

the sequence of the disease-resistant allele Pit-K59 of the functional haplotype of the rice blast Pit disease-resistant gene family is shown as GenBank AB379815.1;

the functional haplotype disease-resistant allele Pit-MH of the rice blast Pit disease-resistant gene family has the sequence shown in GenBank OK 169593;

the functional haplotype disease-resistant allele Pit-IR64 of the rice blast Pit disease-resistant gene family has the sequence shown in GenBank OK 169592;

the sequence of disease-resistant allele Pi54-SJ of functional haplotype of rice blast Pi54 disease-resistant gene family is shown in GenBank OK 247427.

3. The method of claim 1, wherein the method is applied to the functional haplotype varieties respectively, and the following 2 novel target genes are deduced and mined through the comprehensive results of two-stage marker genotypes:

a novel disease-resistant allele Pit-SH of a functional haplotype of a rice blast Pit disease-resistant gene family, and the sequence is shown in GenBank OK 169594;

the sequence of the disease-resistant allele Pi54-TTP of the functional haplotype of the rice blast Pi54 disease-resistant gene family is shown in GenBank OK 247426.

4. The method of claim 1, wherein the method is applied to identifying known target genes of the 2 gene families and mining 2 novel target genes in germplasm resources of unknown target genes:

a novel disease-resistant allele Pit-HHS of a functional haplotype of a rice blast Pit disease-resistant gene family, and the sequence is shown in GenBank OK 169590;

the functional haplotype of the rice blast Pit disease-resistant gene family is a novel disease-resistant allele Pit-F04, and the sequence is shown in GenBank OK 169591.

5. Use of the method according to claim 1 for mining and cloning 6 novel disease resistant alleles and their sequences for use in plant breeding programs for disease resistance:

the sequence of the primer cloned by the rice blast Pit disease-resistant gene family allele is shown in SEQ ID NO. 18-19;

a novel disease-resistant allele Pit-F04 of a functional haplotype of a rice blast Pit disease-resistant gene family, and the sequence is shown in GenBank OK 169591;

the sequence of the primer cloned by the allele of the rice blast Pi54 disease-resistant gene family is shown as SEQ ID NO. 20-21;

the functional haplotype disease-resistant allele Pi54-SJ of the rice blast Pi54 disease-resistant gene family has the sequence shown in GenBank OK 247427.