CN107916300B - Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof - Google Patents
Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof Download PDFInfo
- Publication number
- CN107916300B CN107916300B CN201810054310.XA CN201810054310A CN107916300B CN 107916300 B CN107916300 B CN 107916300B CN 201810054310 A CN201810054310 A CN 201810054310A CN 107916300 B CN107916300 B CN 107916300B
- Authority
- CN
- China
- Prior art keywords
- gene
- rice blast
- molecular marker
- locus
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rice blast resistance gene locusPi2/9The functional gene specific molecular marker and the application thereof are that the gene which is resistant to rice blast is amplified from the rice genome DNA by a primer pair SEQ ID NO.1-2Pi2、Piz‑t、Pi9AndPigmand (3) molecular markers in specific band patterns. The rice blast resistance gene locus provided by the inventionPi2/9The functional gene specific molecular marker has important application value, and the utilization efficiency of the gene in germplasm resource screening, molecular marker-assisted selective breeding, gene polymerization breeding and transgenic breeding can be improved by utilizing the marker.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a rice blast resistance gene locusPi2/9The functional gene specificity molecular marker and the application thereof.
Background
Is prepared from rice blast fungusMagnapothe oryzae) The caused rice blast is the most important disease of rice, and can cause serious loss to main production areas of the rice in the world. Due to frequent pathogenic variation of physiological races of rice blast, most resistant varieties gradually lose resistance within 3-5 years of planting; therefore, the identification and rational utilization of broad-spectrum resistance genes are important ways for disease-resistant varieties. In recent years, with the fine positioning or cloning of a plurality of rice blast resistance genes and the development and application of molecular markers, the identification of the resistance genes and the multi-disease resistance genes are promotedDevelopment of pyramiding breeding. However, among the cloned resistance genes, most of the high-resistance genes are clustered in the same region, e.g.Pi2/9、PikAndPi-taat isogenic loci, linked markers do not distinguish between genes at the same locus. Therefore, the sequence of the functional allele is directly analyzed and the functional specific molecular marker is developed to select the target gene, so that the selection reliability is high, and the breeding pace is greatly accelerated.
At present arePi2/9At least at the locus has been foundPi2, Piz-t，Pi9AndPigmisoresistance genes.Pi2Has been shown to show resistance to the vast majority of rice blast microspecies from China, and the donor parent C101A5l shows resistance to 36 of 43 rice blast strains from 13 countries.Pi9The resistance spectrum of the gene is also wide, and the gene shows high resistance to rice blast strains in a plurality of countries in the world. In the aspect of production application performance, the discovery of Wanqian and the likePi2/9The gene on the gene locus is the source of resistance with the best resistance and the widest resistance spectrum in various regions in the northeast. Zhang Church et al and Zengfansong et al were also confirmed in respective studiesPiz-tAlleles are currently excellent resistance genes.PigmIs one of the more important disease-resistant genes, and with the cloning of the gene and the publication of related research results, we can basically determine thatPigmIs one of the most broad-spectrum high-resistance genes at present. Currently, researchers have taken advantage of the development of several markers for functional genes at this locus. These markers are either based on polymorphism analysis between specific parents or flank the resistance gene at a physical distance from the target gene. Therefore, they are only suitable for partial parents and are not suitable for germplasm resource identification or resistance resource screening. Even if the functional marker is a functional marker, only one or two functional genes can be identified, and therefore, the rice blast resistance gene locus can be conveniently and efficiently identifiedPi2/9The functional gene of (2) is applied to rice resistance breeding work, and the development of a convenient and easy-to-use gene locus which truly reflects a target gene is necessaryPi2/9Functional gene specific molecular markers.
Disclosure of Invention
To overcome the disadvantagesDisadvantages and drawbacks of the prior art it is a primary object of the present invention to provide a pesti-resistance locusPi2/9Functional gene function specific molecular marker Pi 2/9-FM.
Another object of the present invention is to provide the rice blast resistance locusPi2/9A functional gene specific molecular marker Pi 2/9-FM.
It is still another object of the present invention to provide the rice blast resistance locusPi2/9Use of a functional gene specific molecular marker Pi 2/9-FM.
The purpose of the invention is realized by the following technical scheme:
rice blast resistance gene locusPi2/9The functional gene specific molecular marker Pi2/9-FM is obtained by amplifying and hybridizing a primer pair SEQ ID NO.1 and SEQ ID NO.2 from the genomic DNA of rice varieties Huazhan, Toride-1, 75-1-127 and flos Pruni mume No.4Pi2, Piz-t，Pi9AndPigmthe gene is a molecular marker of a specific band type;
SEQ ID NO.1（5’ -3’）: CTTATTTCGTTTGCTATGC ；
SEQ ID NO.2（5’ -3’）：GGACTATGTGATCGGTTAG ；
the rice variety Huazhan (Pi2）、Toride-1（Piz-t）、75-1-127（Pi9) And Gumei No. 4: (PigmThe donor parent);
the rice blast resistance genePigmComprises thatPi9Nbs5-Pi9, 3' UTR fragment I of Pigm-R2, Nbs2-Pi2,
Pi2、NBS-LRR fragment II of Pigm-R4 and Pigm-R6,
I: cttattt cgtttgctat gagcaccaat cgtttgctag aatgtctgaa agatcttgtg tacatatggt ggactgaaca attgaacatt acaagttatc atattttata ttgttgctaa ccgatcacat agtcc。
II: c ttatttcgtt tgctatgcgc agttgcgcac caaccgtttg ctagaatgtc tgaaagagcc tatgtacata tggtggcctg aacattacaa gttatcatat tttatattgt tgctagcttt cctttcaaaa aaaaaaaatt gttcctaacc gatcacatag tcc。
the rice blast resistance gene locusPi2/9Functional gene-specific molecular marker Pi2/9-FM, by aligning multiple rice blast resistance lociPi2/9Comprising the steps of:
(1) downloaded from a common database and homologous theretoPi2(DQ352453)、Pi9(DQ285630.1)、 Piz-t(DQ352040) and Pigm(KU904633.2) and sequencing the genomic sequence of the corresponding region of the variety Nipponbare (Nipponbare) against the locusPi2/9Functional gene locus is subjected to sequence comparison and locus screeningPi2/9The functional gene is specific and can be distinguished from the polymorphic sites of other rice blast allelic resistance genes at the site;
(2) designing gene specific primers at the upstream and downstream 100-200bp positions of the polymorphic sites by using the polymorphic information obtained in the step (1) according to a design principle of a marker, wherein the base sequences of the primers are as follows:
Fl:5- CTTATTTCGTTTGCTATGC -3；
Rl:5- GGACTATGTGATCGGTTAG -3；
(3) taking a rice variety carrying a rice blast resistance gene as Huazhan (Pi2）、Toride-1（Piz-t）、75-1-127（Pi9) And Gumei No. 4: (Pigm) The total DNA is used as a template to carry out PCR amplification, and the obtained PCR product is the rice blast resistance gene locusPi2/9A functional gene specific molecular marker Pi 2/9-FM;
the rice blast resistance gene locusPi2/9Application of functional gene specific molecular marker Pi2/9-FM in identifying rice blast resistance genes of rice varieties, and is particularly suitable for identifying rice blast resistance genes of rice varietiesPi2/9Application of rice blast resistance genes with different gene cluster regions; preferably comprising the steps of:
(I) amplification, namely performing PCR on the genome of the rice variety to be detected by using primers Fl and Rl;
(2) detection, namely detecting by utilizing polyacrylamide gel electrophoresis, and carrying the rice blast resistance gene if nucleotide fragments with the molecular weights of 132bp and 164bp are detectedPigm(ii) a If the nucleotide fragment with the molecular weight of 132bp is detected, the rice variety to be detected carriesPi9(ii) a When the molecular weight is detected to be 165/166bp, the detection result is to be examinedThe rice variety tested carriesPi2/z-tIf no nucleotide fragment is detected, the rice variety to be detected does not carry a locusPi2/9A functional gene.
The principle of the invention is as follows: the invention searches gene loci by a method of multi-sequence alignmentPi2/9Two fragments appear in the functional gene sequence, and because the two fragments have different conditions in different functional genes, the site is not contained in Nipponbare, so that the locus is easy to be positionedPi2/9Functional genes are distinguished. The invention designs a primer pair F1/R1 according to the invention, and fragments with different sizes are displayed during polyacrylamide gel electrophoresis detection through conventional PCR amplification.
Compared with the prior art, the invention has the following advantages and effects:
(1) the molecular marker provided by the invention has high specificity:Pi2/9the existence of the gene cluster comprisesPi2、Piz-t、Pi9AndPigmcandidate genes such as those with high similarity between orthologues, paralogues and between each other; therefore, it is difficult to distinguish the genes at this site by common SSR markers (Zhou et al 2007; Dai et al 2010). The molecular marker provided by the invention is the inventionPi2/9The gene cluster is continuously subjected to sequence polymorphism comparison, and the obtained product is verified through experiments, so that the gene cluster can be obviously compared with the existing gene clusterPi2/z-t、Pi9AndPigmfromPi2/9The loci are separated.
(2) In practical application, the molecular marker provided by the invention has low cost and high flux: at present, most electrophoresis platforms are used for typing, the typing platforms are fast and economical, complex experimental equipment is not needed, and operability is high. The electrophoresis typing platform includes agarose gel electrophoresis, denaturing or non-denaturing polyacrylamide gel electrophoresis and capillary electrophoresis. The molecular marker provided by the invention only needs PCR combined with agarose gel electrophoresis or non-denaturing polyacrylamide gel electrophoresis, has low cost, high flux and high specificity (namely high accuracy), and is particularly suitable for production practice.
(3) The invention is directed toPi2/9Four functional genes of a locusAnd (4) marking. The invention can successfully detect by electrophoresisPi2/z-t、Pi9AndPigmfromPi2/9Other allelic regions of a locus are distinguished, and to date, there have been no reports of such markers. The invention providesPi2/9The gene locus functional gene specific molecular marker Pi2/9-FM is a compound marker, and the reliability and accuracy of the marker are superior to those of a dominant marker in the practical application process. The invention can be applied toPi2/z-t、Pi9AndPigmthe genetic resource screening, the transgene identification and the gene polymerization, and the rice resistance breeding work based on the MAS technology. The mark is present inPi2/9Loci function within the gene, thusPi2/z-t、 Pi9AndPigmthe theoretical value of the screening capacity of the composite material can reach 100 percent, and the comprehensive performance of the composite material is superior to that of the reported composite materialPi2/9Molecular and functional markers of a locus.
(4) The molecular marker provided by the invention can be simply applied to populations with different genetic backgrounds. ExistingPi2/ 9The molecular markers of the gene loci are mostly developed aiming at the sequence polymorphism of two different parents in the same population, and the applicability of the markers in other populations is limited. The developed functional markers are not suitable for large-scale germplasm resource identification and MAS breeding because the identified genes and processes are complicated. The invention is suitable for transgenic breeding, gene polymerization and MAS technology-based resistance breeding under any genetic background, does not need repeated parent polymorphism screening, and greatly improves the breeding efficiency.
Thus, the rice blast resistance gene provided by the present inventionSeat Pi2/9The functional gene specific molecular marker has important application value, and the utilization efficiency of the gene in germplasm resource screening, molecular marker-assisted selective breeding, gene polymerization breeding and transgenic breeding can be improved by utilizing the marker.
Drawings
FIG. 1 isPi2/9Functional gene specific molecular marker Pi2/9-FMPi2/9The verification result chart of different rice blast resistance genes in the gene cluster region and Nipponbare 9311, wherein: lane 1 is DNA ladder, and the DNA templates in lanes 2-7 are resistant variety grains in turnMei 4 No. (B)Pigm) Resistant cultivar Huazhan (Pi2) Resistant variety Toride-1 (C)Piz-t) Resistant variety 75-1-127 (Pi9) The susceptible variety Nipponbare (NPB) and the susceptible variety Co 39.
FIG. 2 isPi2/9The functional gene specific molecular marker Pi2/9-FM is shown in the figure of the verification results of other rice varieties, wherein a Lane 1 is DNA ladder, and DNA templates in lanes 2-13 are flos Pruni mume No.4, Huazhan, Toride-1, 75-1-127, Gufeng A, Ezao 11, Minhui 3119, New 1223, Y58s, Zhongfeng B, Xiangzaixian No. 45, Zhongzaixao 23, 618B, Yixiang 1B, potpourri B, II-32B, 629B, 2155, Wufeng B, Huifeng B, Anfeng B, Longtepu B, Jinkang 1B, Taifeng B, Tianfeng 7388988, Guangzang 13B, Guangshan 97B, Jinfeng 23B, Gexiang B, D B, Bobai B, Shenyun 95B, Yifu B, Yifeng S, SE B5821, S, Meizhang B2, Zhengzhang B97B, Zhengyang B, D B, Yuanfeng 1124, Yuanyu B, Yuanfeng 3646R 46, Yuanfeng 368, Yuanfeng R3, Yuanfeng 46, 131, xiang morning long-shaped rice, No. 7, zhong hui 8015, yin zhan, guan surpass 128, xiao zhan, huang hua zhan, zhong xiang 1, zhong jian 100, guan lu kuan 4, nan te, gui faced 2, tai zhong lai 1, wan li long-shaped rice, zhen xian 232, xianzai zhan, di-jiunan 1, hui 29, nanjian nante, ming hui 63, IR661-1, nanjing 11, caraway 630, tuo gu 151, xiang late long-shaped rice 1, dongting late long-shaped rice, yanggong No.2, zhongnong 4, guan hui 128, te qing chong, test 64, late 3, R527, guan hui 998, yuhui 188, shuhui 881, multisystem 1, shui hui 498, minghui 72, lui 17, yanghui 559, radiata 838, jiangqing dui zhan, jian zhan, 151, guan yun yu.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
Example 1 Rice blast resistance Gene locusPi2/9Functional gene specific molecular marker and primer design and detection thereof
(1) Pi2/9Analysis of functional gene polymorphism of gene cluster:
downloaded from a public databasePi2、Piz-t、Pi9AndPigmthe genomic sequence and the sequenced variety Nipponbare (Nipponbare) phaseGenomic sequence of the corresponding region, againstPi2/9Functional genes are subjected to sequence comparison and screeningPi2/z-t、 Pi9AndPigma site of difference which is specific and distinguishable from the allele at that site. With gene specificityPi2、Piz-t、 Pi9AndPigmthe following table shows the results of the multiple sequence alignment:
Pi2/z-t：
II:CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACATATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTCAA/AAAAAAAAAAAAATTGTTCCTAACCGATCACATAGTCC；
Pi9:
I:CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAATGTCTGAAAGATCTTGTGTACATATGGTGGACTGAACAATTGAACATTACAAGTTATCATATTTTATATTGTTGCTAACCGATCACATAGTCC；
Pigm:
I:CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAATGTCTGAAAGATCTTGTGTACATATGGTGGACTGAACAATTGAACATTACAAGTTATCATATTTTATATTGTTGCTAACCGATCACATAGTCC；
II:CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACATATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTCAAAAAAAAAAAATTGTTCCTAACCGATCACATAGTCC；
wherein the bold nucleotides arePi2/z-tGene relative toPigm- II 1 and 2 bases in excess.
(2) Designing a primer:
according to the design principle of molecular markers, primers are designed at the upstream and downstream positions of 100-200bp of the locus, and the base sequences of the primer pairs are shown as follows:
Fl:5’ - CTTATTTCGTTTGCTATGC -3’；
Rl:5’ - GGACTATGTGATCGGTTAG -3’。
(3) selecting a representative variety of rice carryingPi2/9Representative varieties of loci functional genes and non-functional alleles are as follows:
huazhan (Chinese Huazhan)Pi2）、Toride-1（Piz-t）、75-1-127（Pi9) And Gumei No. 4: (Pigm) The disease control variety is Nipponbare.
(4) PCR amplification to obtain a DNA fragment containingPi2/z-t, Pi9AndPigmgene-specific fragments
The results of conventional PCR amplification using the primer pair Fl and R1 and the total DNA of the rice variety as a template and polyacrylamide gel electrophoresis detection are shown in FIG. 1.
The amplification reaction system is as follows:
2 × Mix buffer(Mg2+Plus):12.5μ L
primer Fl (10. mu.M) 1. mu.L
Primer Rl (10 μm) 1 μ L
Taqase(5U/ml):0.2 μL
DNA template (20-50 ng/. mu.L) 1. mu.L
ddH2O make up to 25. mu.L.
The PCR temperature cycling conditions were 94 ℃ for 3 minutes; 30 seconds at 94 ℃, 30 seconds at 58 ℃, 30 seconds at 72 ℃ and 35 cycles; 7 minutes at 72 ℃; storing at 10 deg.C.
After the PCR reaction is finished, taking a proper amount of sample to carry out electrophoresis detection on 8% polyacrylamide gel under the electrophoresis condition of 90V for 1 hour.
Wherein, lane I in FIG. 1 is DNA Ladder; lane II isPigmPCR-obtained fragment using genome of Donor variety rice variety flos Pruni mume No.4 as template, and rice blast resistance genePigmIn a specific band pattern, lane IIIPi2PCR fragment obtained by using genome of Donor variety rice variety Huazhan as template, and rice blast resistance genePi2Is in a specific band pattern, lane IV isPiz-tFragments obtained by PCR using donor variety rice variety Toride-1 genome as template and rice blast resistance genePiz-tPresenting a specific band pattern; lane V isPi9PCR fragment obtained by using donor variety rice variety 75-1-127 genome as template and rice blast resistance genePi9The gene is in a specific band type, and the gene does not contain a functional gene and is presented in Nippon clear.
Example 2 resistance lociPi2/9Functional gene specific molecular marker in identificationPi2/9Application of rice blast resistance genes with different gene cluster regions。
Based on the PCR product band of the polymorphism, the PCR product can contain the target genePi2，Piz-t, Pi9AndPigmare respectively provided withPi2/9And (4) distinguishing gene clusters. As shown in FIG. 1, depending on the presence of the band, the band may be selected fromPi2，Piz-t, Pi9AndPigm132bp and 164bp are indicated to containPigmGenes, 165bp and 166bp indicate the genes containPi2/z-tThe resistance gene is 132bp which indicates that the gene containsPi9Resistance gene, no band means a functional gene not containing this site. The result of the test is matched with the design analysis, which indicates the resistance gene locusPi2/9The functional gene specific molecular marker can be identifiedPi2，Piz-t, Pi9AndPigmand the like.
Example 3 resistance lociPi2/9Application of functional gene specific molecular marker in detection of other rice varieties
Selecting 92 representative rice varieties, sequentially including GUFENG A, EZAO 11, MINHUI 3119, XIN1223, Y58s, ZHONGFENG B, XIANGYINXUANG No. 45, ZHONGZAO 23, 618B, YIXIANG 1B, HUAXIANG B, II-32B, 629B, 2155, WUFENG B, HUIFENG B, ANFENG B, LONTENG B, JINKANG 1B, TITAIFENG B, TIANFENG B, IR88988B, GUANGKANG 13B, ZHENSHAN 97B, JIN23B, DIXIANG B, D702B, BOBANG B, DENG95B, YUFENG B, FU B, 710S, SE S, Min 2B, ZHONGYANG No. B, LIMING B, JINNANTE 43B, you 1B, Yue B, D B, gang 46B, YYUANYUANYU 586, 48325, MINGHUI 86, MIN 86, ZHONGYIYUANQINGYUANYUANYUANYUANYU NO 8018, ZHONGYUANYINZHONG NO No.1, ZHONGYINZHEN, ZHEN NO. 131, ZHONGZI NO.1, ZHONGYINZHONGZI NO. 128, ZHEN, ZHONGZIYINZHONG YINZHEN, ZHEN NO. 100 ZHONGZI YINZHEN, ZH, Nandan, shinounan No.1, hui 29, nantai, minghui 63, IR661-1, nanjing No. 11, caray 630, dwarf tuo valley 151, xiang late long-shaped No.1, dongting late long-shaped, yanggao No.2, zhongnong No.4, guanghui 128, super qingchong, test 64, late 3, R527, guanghui 998, yuanhui 188, shuhui 881, multisystem No.1, shuhui 498, minghui 72, luhui 17, jihui 559, radiaghui 838, jiangyou 151, anti-mosquito woad, yunhui 99, chenghui 448 and radiaghui 718.
Respectively extracting the genomic DNA of the plants, using the genomic DNA as a template,PCR amplification and electrophoresis detection were carried out in the same manner as in example 1. Depending on the size and presence of the band, the resistance gene can be selectedPi2、Piz-t、Pi9AndPigmand (4) distinguishing. As shown in FIG. 2, the detection is made at 5 th, 21 th, 27 th and 35 thPigmA type gene specific band; at 8 th, 11 th, 16 th, 19 th, 20 th, 31 th, 34 th, 36 th, 37 th, 42 th, 43 th, 44 th, 47 th, 48 th, 54 th, 58 th, 65 th and 72 thPi2/z-tType Gene-specific band, not detectedPi9A type gene specific band. As can be seen, the results of the experiments are consistent with the design analysis, which indicates that the resistance gene Pi2/9-FM can be identifiedPi2、Piz- t、Pi9AndPigmthe method is applied.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of biotechnology of academy of agricultural sciences of Fujian province
<120> rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence
<400> 1
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 132
<212> DNA
<213> Artificial sequence
<400> 3
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 4
<211> 164
<212> DNA
<213> Artificial sequence
<400> 4
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaat tgttcctaac cgatcacata gtcc 164
<210> 5
<211> 167
<212> DNA
<213> Artificial sequence
<400> 5
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaaa aattgttcct aaccgatcac atagtcc 167
<210> 6
<211> 132
<212> DNA
<213> Artificial sequence
<400> 6
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 7
<211> 132
<212> DNA
<213> Artificial sequence
<400> 7
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 8
<211> 164
<212> DNA
<213> Artificial sequence
<400> 8
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaat tgttcctaac cgatcacata gtcc 164
Claims (6)
1. Rice blast resistance gene locusPi2/9The primer pair of the functional gene specific molecular marker is characterized in that: the sequence of the primer pair is shown as SEQ ID NO. 1-2.
2. Rice blast resistance gene locusPi2/9A specific molecular marker characterized by: the rice blast resistance gene locus is amplified from the rice genome DNA by the primer pair SEQ ID NO.1-2 of claim 1Pi2/9The functional gene is a molecular marker of a specific band type.
3. The pesti-resistance locus of rice as claimed in claim 2Pi2/9A functional gene specific molecular marker characterized by: the rice blast resistance gene locusPi2/9Comprises gene segments I and II, wherein the sequences of the gene segments I and II are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.
4. The rice blast resistance locus of claim 2Pi2/9The method for preparing a functional gene specific molecular marker of (1), which is characterized in that: tong (Chinese character of 'tong')Over-comparison of multiple rice blast resistance lociPi2/9The functional gene sequence of (1), comprising the steps of:
(1) downloaded from a public databasePi2、Piz-t、Pi9AndPigmcomparing the gene sequence and the genome sequence of the corresponding area of the sequencing variety Nipponbare aiming at the mutual difference, and screening the polymorphism sites which are specific to each functional gene and can be distinguished from other rice blast allelic resistance genes at the sites;
(2) designing gene specific primers at the upstream and downstream 100-200bp positions of the polymorphic sites by using the polymorphic information obtained in the step (1) according to a marker design principle, wherein the sequences of the primer pairs are shown in SEQ ID NO.1-2 of claim 1;
(3) to carry a rice blast resistance genePi2、Piz-t、Pi9AndPigmtaking the total DNA of the rice blast resistant varieties Huazhan, Toride-1, 75-1-127 and flos Pruni mume No.4 as a template, carrying out PCR amplification, and obtaining a PCR product, namely the rice blast resistant gene locusPi2/9Functional gene specific molecular marker Pi 2/9-FM.
5. The rice blast resistance locus of claim 2Pi2/9The functional gene specific molecular marker is applied to identifying rice blast resistance genes of rice varieties.
6. The rice blast resistance locus of claim 2Pi2/9The functional gene specific molecular marker is used for identificationPi2/9Application of rice blast resistance genes with different gene cluster regions.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810054310.XA CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810054310.XA CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107916300A CN107916300A (en) | 2018-04-17 |
| CN107916300B true CN107916300B (en) | 2021-03-26 |
Family
ID=61891413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810054310.XA Active CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107916300B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300802A (en) * | 2018-04-27 | 2018-07-20 | 江西省农业科学院水稻研究所 | The general molecular label of detection blast resisting multiple allele Pi-2/gm/zt a kind of and application |
| CN109182342B (en) * | 2018-08-20 | 2021-08-20 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | Rice blast resistance gene Pisj of rice and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
-
2018
- 2018-01-19 CN CN201810054310.XA patent/CN107916300B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GenBank: KU904633.2;Deng,Y等;《NCBI-GenBank》;20170215;1-39 * |
| Identification of resistant germplasm containing novel resistance genes at or tightly linked to the Pi2/9 locus conferring broad-spectrum resistance against rice blast;Gui Xiao等;《Rice》;20171231;1-11 * |
| 抗稻瘟病Pi2/9/z-t基因特异性分子标记的开发;华丽霞等;《中国水稻科学》;20150510;第29卷(第3期);305-310 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107916300A (en) | 2018-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN108715902B (en) | Plum blossom pendulous branch character SNP molecular marker and application thereof | |
| CN103146695B (en) | Functional molecular marker for rice anti-blast gene Pi9 and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN111118194B (en) | Lycoris fluorescent EST-SSR molecular marker and application thereof | |
| CN104073487A (en) | Molecular marker of rice-blast-resistant gene Pi2 and application of molecular marker | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN107916300B (en) | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof | |
| CN107988419A (en) | A kind of rice blast resistance gene Pigm specific Functions molecular labeling and its application | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN108977568B (en) | Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof | |
| CN105296472A (en) | Molecular marker of peel full-brown trait gene locus of Chinese 'Qingxiang'-variety pears and screening method of molecular marker | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN114525356B (en) | Haplotype identification marker of rice grain length control gene GS3 and screening method thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| Wang et al. | An extended random primer amplified region (ERPAR) marker linked to a dominant male sterility gene in cabbage (Brassica oleracea var. capitata) | |
| CN115786564A (en) | Rice Pi-ta and Ptr dominant functional molecular marker and application thereof | |
| CN116219048A (en) | Pea core SNP molecular marker set developed based on KASP technology and application thereof | |
| Wang et al. | Development of EST-SSR markers related to disease resistance and their application in genetic diversity and evolution analysis in Gossypium | |
| CN107653341B (en) | KASP marker for detecting powdery mildew resistance gene of aegilops tauschii and application thereof | |
| CN111705157A (en) | PCR marker and primer for screening I-type S haplotypes of cabbage self-incompatible line | |
| CN114703311B (en) | Haplotype identification marking method of rice grain size control gene SMG11 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |