CN110499389B - Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof - Google Patents
Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof Download PDFInfo
- Publication number
- CN110499389B CN110499389B CN201910934802.2A CN201910934802A CN110499389B CN 110499389 B CN110499389 B CN 110499389B CN 201910934802 A CN201910934802 A CN 201910934802A CN 110499389 B CN110499389 B CN 110499389B
- Authority
- CN
- China
- Prior art keywords
- tobacco
- rtsw
- primer
- spotted wilt
- identified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The molecular marker primer consists of two single-stranded DNAs of a primer 1 and a primer 2. The co-dominant marker primer can specifically mark and identify the tobacco genome DNA, detect the allele type of the RTSW in the tobacco material genome DNA, not only can identify whether the RTSW contains the anti-spotted wilt locus, but also can identify the allele type of the RTSW of the anti-spotted wilt locus of the tobacco, is reliable and convenient to use, has the advantages of close linkage with a target gene RTSW, high accuracy, low cost, high detection efficiency and the like compared with the conventional anti-spotted wilt markers, can greatly improve the screening efficiency of the anti-spotted wilt gene RTSW variety of the tobacco, greatly shortens the breeding period of the anti-spotted wilt tobacco variety and improves the breeding efficiency.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker capable of identifying a tobacco anti-spotted wilt gene locus RTSW and application thereof in positioning, cloning or breeding tobacco anti-spotted wilt varieties of tobacco RTSW disease-resistant genes.
Background
Tobacco spotted wilt is a disease of tobacco caused by the infection of tomato spotted wilt virus (Orthospovirus) virus. The Virus belongs to a plant Virus with the widest host range and the most serious occurrence, and the American type representative species Tomato Spotted Wilt Virus (TSWV) of the Virus poses a great threat to tobacco leaf production in Yunnan tobacco regions of China. In recent years, from the results of sample collection and detection in counties (states and cities) in Yunnan, TSWV on tobacco in Yunnan province has a distribution trend and a trend of expansion and aggravation. What is more worried about is that the main cultivated flue-cured tobacco varieties in Yunnan province do not resist TSWV at present, and field investigation finds that the existing main cultivated flue-cured tobacco varieties K326, honghua Dajinyuan, yunyan 87 and the like can be infected by TSWV, and become potential factors of TSWV epidemic and outbreak. The commonly used prevention and treatment means for the tobacco verticillium wilt mainly depends on the prevention and treatment of the virus-transmitting mediator thrips, but the thrips have the characteristics of short development period, small individual, easy concealment, easy generation of drug resistance to pesticides and the like, so the ideal control effect is difficult to obtain by the existing prevention and treatment measures, and therefore, the method for breeding the tobacco variety for resisting the verticillium wilt is the most economic and effective means.
The wild tobacco resource contains rich resistance genes. Studies have shown that floral tobacco (Nicotiana alata) has excellent resistance to TSWV. Inoculated TSWV showed symptoms of allergic necrosis only in inoculated leaves, and no virus was detected in systemic leaves. Through a series of conventional hybridization and backcross transformation, researchers have transformed the resistance gene from floral tobacco resistance to flue-cured tobacco varieties into a disease-resistant breeding intermediate material Polalta. Resistance to TSWV by Nicotiana alata and Polalta is controlled by a dominant single gene (designated RTSW) site.
Unfortunately, the disease resistance gene RTSW has not been cloned. Under the condition that the disease-resistant gene can not be cloned in a short time, developing a molecular marker tightly linked with the disease-resistant gene becomes an important means for the disease-resistant breeding of the tobacco spotted wilt. Until now, only H.Moon and J.S.Nicholson (2007) develop corresponding molecular markers internationally, but the AFLP markers exist and are far away from the resistance gene inheritance, the linkage is not tight, and the developed SCAR markers have the problem of generating false positive easily in practical application. Moreover, neither of these markers can distinguish between homozygous/heterozygous genotypes at the resistance locus, limiting the large-scale application of these markers. In the breeding process of the tobacco anti-spotted wilt by using the RTSW, different genotype individuals of the gene can be separated from the filial generation of the RTSW or the backcross, so that the genotype of the individual plant is required to be detected from the filial generation plant of the RTSW or the backcross, and the homozygous or heterozygous individual plant of the RTSW is selected for the subsequent backcross or selfing. Codominant markers (codominance markers) are genetic markers that can detect both dominant and recessive alleles and can distinguish between homozygous and heterozygous genotypes. Therefore, a co-dominant marker for identifying the type of the RTSW allele of the tobacco anti-spotted wilt locus is developed, a simple, convenient, quick, accurate and sensitive method for identifying the tobacco anti-spotted wilt gene can be established, and the defects of the prior art are overcome.
Disclosure of Invention
The invention aims to solve the defects of the prior art, and provides a co-dominant marker primer closely linked with a tobacco anti-spotted wilt locus RTSW, a method for identifying the type of alleles of the tobacco anti-spotted wilt locus RTSW by adopting the primer and specific application of the primer in positioning, cloning or breeding tobacco anti-spotted wilt disease-resistant genes.
In the context of the present invention, the term "anti-verticillium wilt gene site RTSW" refers to a site comprising a fragment of the wild tobacco chromosome of the tobacco verticillium wilt resistance gene (RTSW gene).
In order to achieve the purpose, the invention adopts the following technical scheme:
a codominant marker primer closely linked with a tobacco anti-spotted wilt locus RTSW, wherein the primer consists of two single-stranded DNAs of a primer 1 and a primer 2;
the sequence of the primer 1 is Seq ID No.1:
RTSW_Marker3_F 5’-CCTATGAAGCAACGAAGCGATA-3’；
the sequence of the primer 2 is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’；
the method for identifying the RTSW allele type of the tobacco anti-spotted wilt locus by adopting the primer comprises the following steps:
(1) Respectively taking the genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, carrying out PCR amplification on the genomic DNA by using a PCR primer consisting of two single-stranded DNAs of a primer 1 and a primer 2, and obtaining a specific fragment with the size of 490bp and the sequence of SEQ ID No.3 by amplifying a plant containing an RTSW gene; the specific fragment obtained by the amplification of the plant without the RTSW gene has the size of 570bp and the sequence of SEQ ID No.4;
(2) Carrying out electrophoresis detection or sequencing on the amplified PCR product, and identifying and determining the RTSW allele type of the tobacco anti-spotted wilt locus to be identified according to the following method:
1) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis or sequencing is only the same as the band type of Polalta and contains the band with the size of 490bp, the tobacco to be identified is the anti-spotted wilt tobacco or the candidate anti-spotted wilt tobacco, and the genotype is homozygous for the resistant RTSW gene locus;
2) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis or sequencing is only the same as the band type of K326 and contains the band with the size of 570bp, the tobacco to be identified is the tobacco suffering from the spotted wilt or the candidate tobacco suffering from the spotted wilt, and the genotype is homozygous at the infected rtsw gene locus;
3) If the bands of the PCR amplification products of the tobacco to be identified after electrophoresis or sequencing contain bands with the same types as Polalta and K326 bands, and the sizes of the bands are 490bp and 570bp respectively, the tobacco to be identified is the anti-spotted wilt tobacco or candidate anti-spotted wilt tobacco, the genotype is anti-disease RTSW/RTSW, and the gene loci are heterozygous.
The invention provides application of the codominant marker primer closely linked with the tobacco anti-spotted wilt locus RTSW in positioning of the tobacco anti-spotted wilt disease gene, cloning or breeding of tobacco anti-spotted wilt varieties.
Further, the invention adopts the tissue of any one part or a plurality of parts of the seeds, leaves, roots and flower organs of the tobacco when extracting the DNA of the tobacco to be identified.
Further, the PCR primer composed of two single-stranded DNAs of primer 1 and primer 2 is used for PCR amplification, and the reaction system of PCR is as follows: respectively taking the genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, and performing PCR amplification system: 2 XPremix Ex Taqmix PCR Buffer 12.5. Mu.L, 10. Mu. Mol/L primer 1 and primer 2 each 0.5. Mu.L, 50 ng/. Mu.L template DNA 1. Mu.L, adding sterilized double distilled water to make the total volume 25. Mu.L; the PCR reaction program is: pre-denaturation at 94 ℃ for 5min; then 35 cycles were entered: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s; after circulation is finished, extension is carried out for 10min at 72 ℃; storing at 4 deg.C.
The PCR primer consisting of two single-stranded DNAs of primer 1 and primer 2 of the present invention comprises a primer obtained by amplifying a substantially identical DNA fragment obtained by adding 1 to 30 bases to the 5 'end or the 3' end of Seq ID No.1 or Seq ID No.2, respectively.
Compared with the prior art, the invention has the beneficial effects that:
the primers are markers closely linked with RTSW gene loci, the molecular marker method established by the invention is a co-dominant marker generated based on a PCR technology, can be used for map-based cloning and molecular marker-assisted selection of disease-resistant genes, predicts the resistance of tobacco to the spotted wilt by detecting the spotted wilt resistant gene loci, identifies the type of RTSW alleles of the tobacco spotted wilt resistant loci, can perform elimination selection at the seedling stage of the tobacco, not only saves the production cost, but also greatly improves the selection efficiency, and further accelerates the tobacco spotted wilt resistant breeding process.
The concrete points are as follows:
1. closely interlocked: experiments prove that the result of the auxiliary identification of the tobacco breeding material by using the method is completely consistent with the result of resistance identification, and the partial result and resistance identification are inconsistent by using the conventional anti-spotted wilt AFLP and SCAR markers, which shows that the method can be used for molecular marker auxiliary selection of the anti-spotted wilt tobacco breeding.
2. The method has high accuracy, and the result of the auxiliary identification of the tobacco breeding material by using the method has clear bands and obvious band type difference, while the prior anti-spotted wilt SCAR marker amplified fragment is between 100 and 200bp and is easily confused with the band position where a primer dimer is positioned. Compared with the prior anti-spotted wilt marker, the detection method overcomes the problems of high false positive, poor stability and the like, and the accuracy rate reaches 100%.
3. The cost is low: the research utilizes a common PCR system, and the PCR product can be detected through electrophoresis, so that the high-flux detection cost is effectively reduced.
4. The detection efficiency is high: compared with the prior anti-spotted wilt AFLP markers, the research only uses one-time electrophoretic analysis, overcomes the defect that the prior detection needs polypropylene gel electrophoresis, and greatly improves the detection efficiency.
5. The operation is simple: the marking and detecting of the tobacco spotted wilt resistance gene RTSW of the breeding material by the invention has simple operation, not only saves the production cost, but also greatly improves the screening efficiency of the tobacco spotted wilt resistance gene RTSW variety, greatly shortens the breeding period of the disease resistance tobacco variety and improves the breeding efficiency.
Drawings
FIG. 1 is a product electrophoresis detection result of the invention which takes a molecular marker primer 1 and a primer 2 as primers to amplify genome DNA, wherein a Lane 1 is a disease-resistant parent Polalta, and a Lane 2 is a tobacco verticillium wilt resistant parent Polalta and a main planting disease resistant variety K326 (male) hybrid F1 single plant; lane 3 is the susceptible parent K326;
FIG. 2 shows the electrophoresis detection result of 210 individual amplification products of a hybrid BC6F3 segregation population of a tobacco spotted wilt resistant Polalta (male) and a main planting susceptible variety K326 (female) by using a primer 1 and a primer 2 as primers.
Detailed Description
The present invention will be described in further detail with reference to examples.
A codominant marker primer closely linked with a tobacco anti-spotted wilt locus RTSW, wherein the primer consists of two single-stranded DNAs of a primer 1 and a primer 2;
the sequence of the primer 1 is Seq ID No.1:
RTSW_Marker3_F 5’-CCTATGAAGCAACGAAGCGATA-3’；
the sequence of the primer 2 is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’。
the method for identifying the RTSW allelic gene type of the tobacco anti-spotted wilt locus by adopting the primer comprises the following specific steps:
(1) Respectively taking the genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, carrying out PCR amplification on the genomic DNA by using a PCR primer consisting of two single-stranded DNAs of a primer 1 and a primer 2 of a molecular marker RTSWmarker3, and carrying out amplification on a plant containing an RTSW gene to obtain a specific fragment with the size of 490bp and the sequence of SEQ ID No.3; the specific fragment obtained by amplification in a plant without the RTSW gene has the size of 570bp and the sequence of SEQ ID No.4. When the DNA of the tobacco to be identified is extracted, the tissue of any one part or several parts of the seed, leaf, root and floral organ of the tobacco can be adopted. The extraction method of the tobacco DNA is a conventional extraction method in the field, and can be a CTAB method, an SDS extraction method, a ROSE one-tube method, a TPS extraction method and the like, or a commercial kit can be directly adopted for extracting the DNA. It will be appreciated by those skilled in the art that the molecular marker of the present invention can also be obtained by chemical DNA synthesis.
When the genomic DNA is subjected to PCR amplification using a PCR primer consisting of two single-stranded DNAs of primer 1 and primer 2, the reaction system of PCR is as follows: respectively taking genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, and performing PCR amplification system: 2 XPremix Ex Taqmix PCR Buffer 12.5. Mu.L, 10. Mu. Mol/L primer 1 and primer 2 each 0.5. Mu.L, 50 ng/. Mu.L template DNA 1. Mu.L, adding sterilized double distilled water to make the total volume 25. Mu.L; the PCR reaction program is: pre-denaturation at 94 ℃ for 5min; then 35 cycles were entered: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s; extending for 10min at 72 ℃ after circulation is finished; storing at 4 ℃.
The sequence Seq ID No.3 is as follows:
GTTGACTGTTGACTGTTGATTAGAGATAAAACAGATCACAAGATTCTTGATTAATAGTTACTTCTTGATCAACTTGAACCTGCTTGCATTATAATATGAGAAATTACCTTGACTTTCCTTTTTAACAAATGGAAGCAAAAATATTATAAATGACTAAGACGGAAAAAAGATGTTAACAATCGACCAGATCGATTATTTCCAAATTTAATGAAAGTAGACTTTGCTATAACAATGAGCATGAGCTGGTTAATAACAAATTTAGTAGCCATTGTTGCTTTTTTTTTCCTTCCCAATTAGCTTATGCCTATGATCTCAATCCTCTACAAGACATATATGTTGGAGTTAAAGACACTAACGCTTCTGGTAAATCATATCCTTCTATAGTCAGGAAAGCTTTTTTATCGAATTTCTTCTTCTTCCTATTTTAAATAATATTGTATGTTATATTATAGTGTTGATAAAAGCATGTATCGCTTCGTTGCTTCATAGG；
the sequence Seq ID No.4 is as follows:
GTTGACTGTTGACTGTTGATTAGAGATAAAACAGATCACAAGGTTCTGGATTAACAGTTACTTCTTGATCAACTTGAACCTGCTTGTATTTTAATATGAGAAATTACCTTGACTTTCCTTTTTAACAAATGGAAGCAAAAATATTATAAATGACTAAGACGGAAACAAGATGTTAACAATTGACCAGATCGAACTATAAGTTATAGACTCCTCAGCTGGTTGTTTCGTAAAAGAAAAAAAAGTATAACACGCTAACTCCTTACCAAACAAACAATTGTTTCCAAATTTAATGAAAGTAGACTTTGCTATAACAATGAGCATGAGCTGGTTAATAACAACTTTAGTAGCCATTGCTGCTTTTTTTTCTTCCCAATTAGCTTATGCCTATGATCTCAATCCTCTACAAGACATATGTGTTGGAGTTAAAGACACTAACGCTTCTGGTAAATCATATCCTTCTATAGTCAGGAAAGCTTTTTTACCGAATTTCTTCTTTTTCCTATTTTATACAATATTGTATGTTATATTATAGTGTTGATAAAAGCATGTATCGCTTCGTTGCTTCATAGG。
(2) And (3) carrying out electrophoresis detection or sequencing on the amplified PCR product, and identifying and determining the type of the RTSW allele of the tobacco anti-spotted wilt locus to be identified according to the following method:
1) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis is the same as the band type of Polalta and contains the band with the size of 490bp, the tobacco to be identified is the anti-spotted wilt tobacco or the candidate anti-spotted wilt tobacco, and the genotype is homozygous for the resistant RTSW gene locus (RTSW/RTSW);
2) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis is the same as the band of K326 and contains a band with the size of 570bp, the tobacco to be identified is the tobacco with the susceptibility to the spotted wilt or the candidate tobacco with the susceptibility to the spotted wilt, and the genotype is homozygous (rtsw/rtsw) of the susceptibility to the wilt gene locus;
3) If the bands of the PCR amplification product of the tobacco to be identified after electrophoresis contain bands which are the same as the Polalta and K326 bands, and the sizes of the bands are 490bp and 570bp respectively, the tobacco to be identified is the anti-spotted wilt tobacco or candidate anti-spotted wilt tobacco, and the genotype is the heterozygous (RTSW/RTSW) of the anti-disease RTSW gene locus.
The codominant marker primer for identifying the type of the RTSW allele of the tobacco anti-spotted wilt locus can be applied to positioning of the tobacco anti-spotted wilt disease resistance gene, cloning or breeding of tobacco anti-spotted wilt varieties. By using the primer of the invention and taking the genomic DNA of the tobacco to be detected as a template to carry out PCR, whether the tobacco contains the tobacco anti-spotted wilt genetic locus RTSW can be detected, and the allele type of the tobacco anti-spotted wilt genetic locus RTSW can be identified. The detection may be a method of PCR detection, and specifically, genomic DNA may be subjected to PCR amplification using a PCR primer consisting of two single-stranded DNAs of primer 1 and primer 2. The detection can also detect whether the primer sequence and the amplification product of the invention are contained by a high-throughput sequencing method.
As is well known to those skilled in the art, in the sequence of Seq ID No.1 or Seq ID No.2, 1 to 30 bases may be added at the 5 'end or 3' end thereof, respectively, and the type of the added bases may be determined based on the type of bases in the region of the tobacco genomic DNA that matches Seq ID No.1 or Seq ID No.2 and on the base pairing principle, whereby the resulting primer is substantially identical to the amplification product of Seq ID No.1 or Seq ID No.2 (the DNA sequence between the upstream and downstream primers is identical). Therefore, the above-mentioned primers, which are capable of amplifying substantially the same DNA fragments by adding 1 to 30 bases to the 5 'end or 3' end of Seq ID No.1 or Seq ID No.2, respectively, are included in the primers of the present invention.
The invention utilizes the TSWV-resistant tobacco material containing the RTSW spotted wilt-resistant gene locus: polalta, a TSWV material K326 not containing RTSW anti-spotted wilt gene loci, and BC6F3 offspring obtained by hybridization, backcross and selfing of tobacco spotted wilt resistant Polalta (male) and a main planting infected variety K326 (female). The tobacco materials are common tobacco germplasm resources, and can be obtained by the public from tobacco germplasm resource storage units or tobacco agriculture science research institutes in Yunnan province. Restriction enzymes, kanamycin, spectinomycin, taq DNA polymerase 2 × Premix Ex Taqmix were purchased from Dalibao Bio. Other chemical agents are all commercially available products. A reference genomic sequence for N.tobacterium (K326) has been disclosed in (Edwards et al, 2017, A reference genome for Nitotiana tabacum enzymes map-based cloning of hoseologus localization in simulation efficacy. Bmc Genomics 18, 448.), publicly available from https:// solgenomics.
One specific example of the operation of the present invention is as follows:
1. and (3) constructing an anti-influenza pool by utilizing the tobacco resistance identification of the segregation population and sequencing the transcriptome.
And (3) taking 210 BC6F3 progeny obtained by hybridizing, backcrossing and selfing tobacco verticillium wilt resistance Polalta and a main planting disease variety K326 (male parent), and performing TSWV disease resistance identification by using a non-toxic gene infiltration method. When 4 to 5 leaves are selected, the top leaf which is completely unfolded is selected, and three positions on the same leaf are selected to be respectively inoculated with pK2-35S-NSm, pK2-35S-NSs and pK2-35S-NSm + p2300-35S-Sw-5b. The control system is characterized in that pK2-35S-NSs is used as a negative control, pK2-35S-NSm + p2300-35S-Sw-5b is used as a positive control, and the positive control generates allergic necrosis on all tobaccos. Culturing the tobacco seedlings in a light culture room at 20-28 ℃ for 72h after inoculation, and investigating and observing the anaphylactic necrosis (HR reaction) caused by pK2-35S-NSm on the tobacco leaves to be detected. Among 210 strains, 161 strains developed an HR reaction and were resistant individuals, while 49 strains developed no HR reaction and were susceptible individuals. The results are shown in Table 1
Respectively randomly selecting 40 plants from 161 resistant single plants and 49 susceptible single plants to construct a resistant pool (R-pool) and a sensitive pool (S-pool), wherein the construction method comprises the steps of respectively taking 0.1g of leaves from each plant of the selected 40 resistant single plants, mixing 4g of leaves to construct the resistant pool (R-pool), grinding the leaves into powder, and then sampling to perform transcriptome sequencing. A sensitive pool (S-pool) was constructed and sent for sequencing using the same method.
The transcriptome sequencing is carried out by selecting a BGI500 sequencing platform of Huada gene, and each sample of the resistance/pool is sequenced to obtain 12Gb sequencing data.
2. And (4) screening resistance linked molecular markers.
The anti-susceptible pool data obtained by the transcriptome are respectively compared with a K326 reference genome, and 6047 SNP loci with the Dealta value larger than 0.4 among the anti-susceptible pools are discovered through SNP typing, and the SNP is mainly concentrated on the No. 7 chromosome of the K326, so that the anti-spotted wilt gene is positioned on the No. 7 chromosome. Reads were retrieved for the presence of SNPs and sequence alignment was performed based on the genome of K326 as a reference genome. And (3) carrying out high-frequency SNP (single nucleotide polymorphism) search by using the genome sequence of the SNPs, and obtaining 31 sequences containing SNP enrichment for developing molecular markers related to the anti-spotted wilt disease. Extracting genomic DNA of tobacco anti-spotted wilt parent material Polalta, infected spotted wilt parent material K326 and tobacco spotted wilt resistant Polalta and main planting susceptible variety K326 (female parent) hybrid F1, designing primers according to the obtained 31 sequences, and carrying out electrophoresis screening on polymorphic markers between parents after PCR amplification. Finally, the PCR primer consisting of the two single-stranded DNAs of the primer 1 and the primer 2 is obtained, and the primer is used for carrying out PCR amplification on the genome DNA, so that obvious polymorphism exists between parents.
PCR amplification System: 2 XPremix Ex Taqmix PCR Buffer 12.5. Mu.L, 10. Mu. Mol/L upstream primer 1 and downstream primer 2 each 0.5. Mu.L, 25 ng/. Mu.L template DNA 2. Mu.L, adding sterile double distilled water to make the total volume 25. Mu.L; PCR reaction procedure: pre-denaturation at 94 ℃ for 5min; then 35 cycles were entered: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s; after circulation is finished, extension is carried out for 10min at 72 ℃; storing at 4 ℃.
The electrophoresis result shows that: the results shown in fig. 1 show that when the PCR labeled primer consisting of two single-stranded DNAs, namely primer 1 and primer 2, is used to perform PCR amplification on the above Polalta, K326 and F1 materials, all the materials are amplified, and no false negative result appears, indicating that the PCR reaction system verified by this research is completely normal and meets the detection requirements. Performing electrophoretic comparison analysis on the PCR product, wherein a lane 1 is a disease-resistant parent Polalta, and the PCR amplification product contains two bands after electrophoresis, wherein a band with the size of 490bp is an obvious specific band, and a band with the size of 550bp is a non-specific band; lane 2 is a tobacco spotted wilt resistant Polalta (male parent) and main cultivation susceptible variety K326 (female parent) hybrid F1 single plant, three bands are formed after electrophoresis of a PCR amplification product, wherein 490bp and 570bp are obvious specific bands respectively, and a band with the size of 550bp is a non-specific band; lane 3 is the diseased parent K326, and the PCR amplification product contains two bands after electrophoresis, wherein the band of 570bp is an obvious specific band, and the band of 550bp is a non-specific band. Indicating the presence of a polymorphism between the parents using this marker. The 490bp specificity band from the disease-resistant parent and the 570bp band from the disease-susceptible parent are reclaimed and subjected to gel cutting, and the molecular marker sequences SEQ ID No.3 and SEQ ID No.4 are obtained.
3. And verifying the polymorphic markers by using 210 single plants of BC6F3 progeny segregation populations obtained by hybridizing, backcrossing and selfing tobacco verticillium wilt resistant Polalta (male parent) and main susceptible variety K326 (female parent).
The individual plants are numbered, DNA samples of 210 different individual plants are respectively extracted, and the PCR amplification of the genomic DNA is carried out by using the primers according to the conventional nucleic acid extraction method CTAB method and with the purified genomic DNA as a template. PCR amplification System: 2 XPremix Ex Taqmix PCR Buffer 12.5. Mu.L, 10. Mu. Mol/L primer 1 and primer 2 each 0.5. Mu.L, 25 ng/. Mu.L template DNA 2. Mu.L, adding sterilized double distilled water to make the total volume 25. Mu.L; PCR reaction procedure: pre-denaturation at 94 ℃ for 5min; then 35 cycles were entered: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s; after circulation is finished, extension is carried out for 10min at 72 ℃; storing at 4 deg.C. And taking the PCR reaction product for electrophoresis detection and verification.
The sequence of the primer 1 is Seq ID No.1:
RTSW_Marker3_F 5’-CCTATGAAGCAACGAAGCGATA-3’；
the sequence of the primer 2 is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’；
the electrophoresis result shows that: FIG. 2 is an electrophoretic analysis of the codominant marker established by the applicant to identify the type of RTSW allele at the tobacco anti-spotted wilt locus. From the analysis result, the strip brightness is high, the strip is clear and easy to identify, and the strip size difference is obvious. If the band of the PCR amplification product of the tobacco to be identified after electrophoresis is the same as the band type of Polalta and contains a band with the size of 490bp, the tobacco to be identified is the anti-spotted wilt tobacco or the candidate is the anti-spotted wilt tobacco, and the genotype is the homozygous resistance RTSW gene locus (RTSW/RTSW); if the band of the PCR amplification product of the tobacco to be identified after electrophoresis is the same as the band type of K326 and contains a band with the size of 570bp, the tobacco to be identified is the tobacco suffering from the fusarium wilt or the candidate tobacco suffering from the fusarium wilt, and the genotype is the homozygous (rtsw/rtsw) of a disease-sensitive rtsw gene locus; if the bands of the PCR amplification products of the tobacco to be identified after electrophoresis contain bands with the same types as Polalta and K326 bands, and the sizes of the bands are 490bp and 570bp respectively, the tobacco to be identified is the anti-spotted wilt tobacco or the candidate is the anti-spotted wilt tobacco, and the genotype is the heterozygosity of the anti-disease RTSW gene locus (RTSW/RTSW).
As a result of marker detection, it was found that 39 individuals (resistant homozygous, RTSW/RTSW) were found to be single plants having only the 490bp band pattern, 50 individuals (susceptible homozygous, RTSW/RTSW) were found to be single plants having only the 570bp band pattern, and 121 individuals (resistant locus heterozygous) were found to be heterozygous. The resistance detection purity identification result shows that 160 of 210 single plants are disease-resistant plants, 50 of the single plants are disease-susceptible plants, the resistance detection purity identification result is consistent with the marking detection result, and the accuracy rate reaches 100%. The molecular marker result and the resistance identification result of the rapid identification tobacco anti-spotted wilt genetic locus RTSW established by the invention are compared, and then the resistance identification results of 210 samples are completely consistent, which shows that the method has stable, reliable and extremely high accuracy, and no false positive result (see table 1).
TABLE 1 statistics of resistance identification and marker detection results of BC6F3 populations
4. Verification of anti-spotted wilt locus RTSW allele type
Selecting resistance RTSW gene locus homozygosis (RTSW/RTSW) from 210 single plants of the BC6F3 group in the 3 rd point randomly, wherein the genotype is the infection RTSW gene locus homozygosis (RTSW/RTSW), and the genotype is the disease resistance RTSW gene locus heterozygosis (RTSW/RTSW), each 5 plants are selfed and reserved, BC6F4 seeds are obtained, about 30 plants are sown in each plant, disease resistance detection is carried out on each single plant of BC6F4, and the allele type of the BC6F4 single plant is determined. As can be seen from Table 2, the anti-infection/infection segregation ratio of randomly selected BC6F3 single plant offspring completely accords with the mark detection result of BC6F3 single plant, and the method is stable, reliable and extremely high in accuracy, and has no false positive result.
Table 2 part of disease resistance detection of BC6F4 individuals after BC6F3 individuals are selfed and reserved
Therefore, the method for detecting the resistance of the tobacco to the spotted wilt is reliable, simple, convenient and practical, has important application prospect in the evaluation of tobacco germplasm resources and the auxiliary selection of breeding markers, and provides reference basis for the cultivation of tobacco varieties with high resistance to the spotted wilt.
The specific techniques or conditions not indicated in the examples are performed according to the techniques or conditions described in the literature in the field or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available by purchase.
The above examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention, and all equivalent variations and modifications made in the claims of the present invention should be covered by the present invention.
Sequence listing
<110> research institute of tobacco agricultural science in Yunnan province
<120> codominant marker primer closely linked with tobacco anti-spotted wilt locus RTSW, identification method and application thereof
<141> 2019-09-29
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> RTSW_Marker3_F
<400> 1
cctatgaagc aacgaagcga ta 22
<210> 2
<211> 25
<212> DNA
<213> RTSW_Marker3_R
<400> 2
gttgactgtt gactgttgat tagag 25
<210> 3
<211> 490
<212> DNA
<213> Artificial sequence ()
<400> 3
gttgactgtt gactgttgat tagagataaa acagatcaca agattcttga ttaatagtta 60
cttcttgatc aacttgaacc tgcttgcatt ataatatgag aaattacctt gactttcctt 120
tttaacaaat ggaagcaaaa atattataaa tgactaagac ggaaaaaaga tgttaacaat 180
cgaccagatc gattatttcc aaatttaatg aaagtagact ttgctataac aatgagcatg 240
agctggttaa taacaaattt agtagccatt gttgcttttt ttttccttcc caattagctt 300
atgcctatga tctcaatcct ctacaagaca tatatgttgg agttaaagac actaacgctt 360
ctggtaaatc atatccttct atagtcagga aagctttttt atcgaatttc ttcttcttcc 420
tattttaaat aatattgtat gttatattat agtgttgata aaagcatgta tcgcttcgtt 480
<210> 4
<211> 570
<212> DNA
<213> Artificial sequence ()
<400> 4
gttgactgtt gactgttgat tagagataaa acagatcaca aggttctgga ttaacagtta 60
cttcttgatc aacttgaacc tgcttgtatt ttaatatgag aaattacctt gactttcctt 120
tttaacaaat ggaagcaaaa atattataaa tgactaagac ggaaacaaga tgttaacaat 180
tgaccagatc gaactataag ttatagactc ctcagctggt tgtttcgtaa aagaaaaaaa 240
agtataacac gctaactcct taccaaacaa acaattgttt ccaaatttaa tgaaagtaga 300
ctttgctata acaatgagca tgagctggtt aataacaact ttagtagcca ttgctgcttt 360
tttttcttcc caattagctt atgcctatga tctcaatcct ctacaagaca tatgtgttgg 420
agttaaagac actaacgctt ctggtaaatc atatccttct atagtcagga aagctttttt 480
accgaatttc ttctttttcc tattttatac aatattgtat gttatattat agtgttgata 540
aaagcatgta tcgcttcgtt gcttcatagg 570
Claims (5)
1. The codominant marker primer closely linked with the tobacco anti-spotted wilt locus RTSW is characterized in that the primer consists of two single-stranded DNAs of a primer 1 and a primer 2;
the sequence of the primer 1 is Seq ID No.1:
RTSW_Marker3_F 5’-CCTATGAAGCAACGAAGCGATA-3’；
the sequence of the primer 2 is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’。
2. the method for identifying the type of RTSW allele of the tobacco anti-spotted wilt locus by using the primer as claimed in claim 1, which comprises the following steps:
(1) Respectively taking the genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, carrying out PCR amplification on the genomic DNA by using a PCR primer consisting of two single-stranded DNAs of a primer 1 and a primer 2, and obtaining a specific fragment with the size of 490bp and the sequence of SEQ ID No.3 by amplifying a plant containing an RTSW gene; the specific fragment obtained by the amplification of the plant without the RTSW gene has the size of 570bp and the sequence of SEQ ID No.4;
(2) Carrying out electrophoresis detection or sequencing on the amplified PCR product, and identifying and determining the RTSW allele type of the tobacco anti-spotted wilt locus to be identified according to the following method:
1) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis or sequencing is only the same as the band type of Polalta and contains the band with the size of 490bp, the tobacco to be identified is the anti-spotted wilt tobacco or the candidate anti-spotted wilt tobacco, and the genotype is homozygous for the resistant RTSW gene locus;
2) If the band of the PCR amplification product of the tobacco to be identified after electrophoresis or sequencing is only the same as the band type of K326 and contains the band with the size of 570bp, the tobacco to be identified is the tobacco suffering from the spotted wilt or the candidate tobacco suffering from the spotted wilt, and the genotype is homozygous at the infected rtsw gene locus;
3) If the bands of the PCR amplification products of the tobacco to be identified after electrophoresis or sequencing contain bands with the same types as Polalta and K326 bands, and the sizes of the bands are 490bp and 570bp respectively, the tobacco to be identified is the anti-spotted wilt tobacco or candidate anti-spotted wilt tobacco, the genotype is anti-spotted wilt RTSW/RTSW, and the gene sites are heterozygous.
3. The use of the co-dominant marker primer tightly linked to the tobacco anti-spotted wilt locus RTSW of claim 1 for the localization, cloning or breeding of tobacco anti-spotted wilt disease resistant gene.
4. The method for identifying the type of the RTSW allele of the tobacco anti-spotted wilt locus using the primer as claimed in claim 2, wherein the DNA of the tobacco to be identified is extracted using the tissue of any one or more parts of the seed, leaf, root and floral organ of the tobacco.
5. The method for identifying the type of RTSW allele of tobacco anti-spotted wilt locus using the primer as claimed in claim 2, wherein PCR amplification is carried out by using a PCR primer consisting of two single-stranded DNAs of primer 1 and primer 2, and the reaction system of PCR is as follows: respectively taking genomic DNA of tobacco to be identified, tobacco spotted wilt resistance Polalta and spotted wilt susceptible variety K326 as templates, and performing PCR amplification system: 2 XPremix Ex Taqmix PCR Buffer 12.5. Mu.L, 10. Mu. Mol/L primer 1 and primer 2 each 0.5. Mu.L, 50 ng/. Mu.L template DNA 1. Mu.L, adding sterilized double distilled water to make the total volume 25. Mu.L; the PCR reaction program is: pre-denaturation at 94 deg.C for 5min; then 35 cycles were entered: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s; extending for 10min at 72 ℃ after circulation is finished; storing at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910934802.2A CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910934802.2A CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499389A CN110499389A (en) | 2019-11-26 |
| CN110499389B true CN110499389B (en) | 2023-03-10 |
Family
ID=68593065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910934802.2A Active CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499389B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452905B (en) * | 2019-08-22 | 2023-06-02 | 云南省烟草农业科学研究院 | Extraction method for improving tobacco DNA precipitation efficiency and application thereof |
| CN113881799B (en) * | 2021-10-25 | 2023-07-14 | 云南省烟草农业科学研究院 | Functional molecular marker for screening/detecting tobacco root black rot main effect resistance locus and application thereof |
| US20240049674A1 (en) * | 2021-11-08 | 2024-02-15 | Yunnan Academy Of Tobacco Agricultural Sciences | Tobacco Plant Resistant To Spotted Wilt Disease Without Linkage Drag And Method For Breeding The Same |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140040374A (en) * | 2012-09-26 | 2014-04-03 | 서울대학교산학협력단 | Primer set, method and kit for selecting tswv-resistant pepper cultivar |
| CN106119397A (en) * | 2016-08-26 | 2016-11-16 | 北京通州国际种业科技有限公司 | Fructus Lycopersici esculenti spotted wilt resistant gene Sw 5b close linkage SNP site obtains and marker development |
| CN106613136A (en) * | 2016-11-16 | 2017-05-10 | 云南省烟草农业科学研究院 | Method for screening tobacco plants resistant to tomato spotted wilt virus |
| CN107254477A (en) * | 2017-06-05 | 2017-10-17 | 云南省烟草农业科学研究院 | A kind of method that disease-resistant gene screening is carried out using tomato spotted wilf virus NSm genes |
| CN107400674A (en) * | 2017-06-05 | 2017-11-28 | 云南省烟草农业科学研究院 | A kind of method using tomato spotted wilf virus NSm identified for genes tobacco resistances |
| CN109055511A (en) * | 2018-09-19 | 2018-12-21 | 天津市农业生物技术研究中心 | A kind of detection method of anti-tomato spotted wilf virus gene SW-5b |
| KR102000469B1 (en) * | 2018-06-19 | 2019-07-16 | 대한민국 | Tomato spotted wilt virus disease resistance gene Tsw specific primer set for pepper cultivar and uses thereof |
-
2019
- 2019-09-29 CN CN201910934802.2A patent/CN110499389B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140040374A (en) * | 2012-09-26 | 2014-04-03 | 서울대학교산학협력단 | Primer set, method and kit for selecting tswv-resistant pepper cultivar |
| CN106119397A (en) * | 2016-08-26 | 2016-11-16 | 北京通州国际种业科技有限公司 | Fructus Lycopersici esculenti spotted wilt resistant gene Sw 5b close linkage SNP site obtains and marker development |
| CN106613136A (en) * | 2016-11-16 | 2017-05-10 | 云南省烟草农业科学研究院 | Method for screening tobacco plants resistant to tomato spotted wilt virus |
| CN107254477A (en) * | 2017-06-05 | 2017-10-17 | 云南省烟草农业科学研究院 | A kind of method that disease-resistant gene screening is carried out using tomato spotted wilf virus NSm genes |
| CN107400674A (en) * | 2017-06-05 | 2017-11-28 | 云南省烟草农业科学研究院 | A kind of method using tomato spotted wilf virus NSm identified for genes tobacco resistances |
| KR102000469B1 (en) * | 2018-06-19 | 2019-07-16 | 대한민국 | Tomato spotted wilt virus disease resistance gene Tsw specific primer set for pepper cultivar and uses thereof |
| CN109055511A (en) * | 2018-09-19 | 2018-12-21 | 天津市农业生物技术研究中心 | A kind of detection method of anti-tomato spotted wilf virus gene SW-5b |
Non-Patent Citations (4)
| Title |
|---|
| "From Player to Pawn: Viral Avirulence Factors Involved in Plant Immunity";Changjun Huang 等;《Viruses》;20210416;第13卷(第4期);doi.org/10.3390/v13040688 * |
| "Non-Structural Protein NSm of Tomato Spotted Wilt Virus Is an Avirulence Factor Recognized by Resistance Genes of Tobacco and Tomato via Different Elicitor Active Sites";Changjun Huang 等;《Viruses》;20181121;第10卷(第11期);doi.org/10.3390/v10110660 * |
| "Plasmodesmata targeting and intercellular trafficking of Tomato spotted wilt tospovirus movement protein NSm is independent of its function in HR induction";Wenyang Zhao 等;《J Gen Virol》;20160504;第97卷(第8期);第1990-1997页 * |
| "云南省主要烟区正番茄斑萎病毒属(Orthotospovirus)病毒的调查和检测";于海芹 等;《基因组学与应用生物学》;20191112;第39卷(第11期);第5194-5200页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499389A (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN112981001B (en) | Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| CN105695478B (en) | Gene for regulating plant type and yield of plant and application thereof | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN106498068B (en) | Co-dominant SSR marker closely linked with tobacco TMV resistance gene N and application thereof | |
| CN114134247B (en) | Molecular marker closely linked with millet plant height character, primer sequence and application thereof | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN112813192B (en) | Molecular marker HBAU-LrZH22 of wheat leaf rust resistance gene Lr13 and detection primer and application thereof | |
| CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
| CN107338293B (en) | KaSP molecular marker related to resistance of maize rough dwarf disease and application thereof | |
| CN103952403B (en) | The closely linked molecular marker of rice bacterial blight resistance new gene Xa39 | |
| CN106701895B (en) | Haplotype related to drought resistance of corn and molecular marker thereof | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN113913548B (en) | InDel molecular marker co-separated from disease-resistant and susceptible major genes of powdery mildew of cucumber and application thereof | |
| CN113564161B (en) | Molecular marker closely linked with bacterial wilt resistance of cultivated peanut and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN110373494B (en) | Molecular marker closely linked with Chinese cabbage turnip mosaic virus resistance gene retrcs03 and application thereof | |
| CN114908182A (en) | Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof | |
| CN108103236B (en) | SSR molecular marker tightly linked with maize leafless tongue gene lg1 and application thereof | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN111163630A (en) | Cucumber mosaic virus resistant pepper plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |