CN109825619A - With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage - Google Patents
With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage Download PDFInfo
- Publication number
- CN109825619A CN109825619A CN201811471643.9A CN201811471643A CN109825619A CN 109825619 A CN109825619 A CN 109825619A CN 201811471643 A CN201811471643 A CN 201811471643A CN 109825619 A CN109825619 A CN 109825619A
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- seq
- rice
- primer
- pigm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage.The present invention provides a kind of and resistance gene of rice blast Pigm close linkage molecular labeling, which contains sequence shown in SEQ ID NO:1.The invention further relates to expand the purposes and a kind of rice breeding method of primer, the molecular labeling and the primer of the molecular labeling in resistance gene of rice blast Pigm positioning or Genetic and breeding in rice.Molecular labeling of the invention connects genomic dna sequence and resistance gene of rice blast Pigm, is conducive to the foundation of rice molecular marker-assisted breeding system；The molecular labeling and resistance gene of rice blast Pigm close linkage.Molecular labeling and molecular labeling amplimer of the invention can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Description
Technical field
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, more particularly to a kind of and rice blast
The molecular labeling of resistant gene Pigm close linkage.The invention further relates to expand the primer of the molecular labeling, the molecular labeling and
Purposes of the primer in resistance gene of rice blast Pigm positioning or Genetic and breeding in rice.
Background technique
Rice blast (Rice Blast) is one of important disease of rice, which can cause rice yield significantly
The underproduction, the underproduction 40%~50% when serious, or even total crop failure.The prevention and treatment of rice blast plays to pass the guarantee of China's grain security
Important role.At present plantation disease-resistant variety be prevention and treatment the most economical effective measures of the disease, but produce on disease-resistant variety compared with
Less and many disease-resistant varieties just lose blast resisting resistance after popularizing planting 3~5 years.Therefore, cultivating has persistently extensively
The rice of spectrum blast resisting is to ensure that the important means of rice safety production.
Traditional breeding for disease resistance is selected according to the performance of segregating population and the experience of breeder, usually by environment item
The influence for the factors such as part, aobvious recessive relationship, gene be upper, it is time-consuming, laborious, inaccurate, specifically, for blast resisting breeding,
In conventional breeding practice, generally by field rice blast pathogen inoculation experiments or in the area rice blast Yi Fa come expert evidence
Rice blast resistance determines the rice blast resistance of young plant according to the information such as plant bacterial plaque area and incidence of leaf number by experiment
Rank is classified, so that selection has the material of rice blast resistance.In short, from one Genes For Plant Tolerance disease of identification to cultivating
Disease-resistant breeding need to spend time more than ten years, and pathogen once invades, and diffusion velocity is more faster than breeding speed.
The application of the development of biotechnology in recent years, especially molecular marking technique brings huge to Genetic and breeding in rice
Variation.Molecular marker assisted selection provides the effective means that selection is carried out to objective trait for breeder, it is greatly accelerated
Breeding process improves breeding selection efficiency, while reducing a large amount of wastes of blindly selection and human and material resources, shows pole
Its wide application prospect.
Although currently, located some rice blasts resistant gene and disease-resistant site, such as Pi-a, Pii, Pik,
Pigm etc., but since the genetic mechanism of rice anti-rice blast is more complex, still lack sufficient amount of related to blast resistance
QTLs and molecular labeling.With the development of genomics and biological information, by gene order-checking, exploitation and blast resisting base
It is because of the resistance especially with broad spectrum durable and close to the resistant Pigm gene of the most of rice blast biological strains of China
Chain molecular labeling will open up new idea and method for the genetic research of rice and breeding.
Summary of the invention
The object of the present invention is to provide a kind of and resistance gene of rice blast Pigm close linkage molecular labelings.
It can be used for PCR amplification it is a further object of the present invention to provide one kind closely to connect with resistance gene of rice blast Pigm
The primer pair of the molecular labeling of lock, and the molecular labeling obtained by the primer pair amplifies.
Another object of the present invention be to provide above-mentioned molecular labeling resistance gene of rice blast Pigm positioning, detect with
And the detection method of the purposes and above-mentioned molecular labeling in rice assistant breeding.
The purpose of the present invention further includes providing a kind of recombinant vector including above-mentioned molecular labeling, and carry containing the recombination
The recombinant cell of body；There is provided it is a kind of include using the localization method of the resistance gene of rice blast Pigm of above-mentioned molecular labeling,
With the rice auxiliary breeding means for using the molecular labeling.
To achieve the goals above, the invention adopts the following technical scheme:
The invention discloses a kind of and resistance gene of rice blast Pigm close linkage molecular labeling, the molecule marks
Note contains nucleotide sequence shown in SEQ ID NO:1；Preferably, the molecular labeling is nucleotides sequence shown in SEQ ID NO:1
Column.
Wherein, it should be noted that inventor has the characteristics that broad spectrum durable resistance for Pigm gene, utilizes molecule mark
Note technology has developed above-mentioned and Pigm gene linkage label.Inventors have found that the molecular labeling and Pi2, Pi9, Pigm,
The equal close linkage of the rice blast resistance genes such as Pi50, Piz, Piz-t will play weight in cultivating rice anti-rice blast new varieties
The effect wanted.The blast resistant gene with broad spectrum activity can be realized into polymerization rapidly using the label, when being used for breeding for disease resistance
Durable broad spectrum resistant variety can be cultivated.
The invention also discloses a kind of amplifications to draw with the molecular labeling of resistance gene of rice blast Pigm close linkage
Object pair, the target sequence of the primer pair amplifies include sequence shown in SEQ ID NO:1；
In one embodiment of the invention, the primer 1 of the primer pair contains nucleotides sequence shown in SEQ ID NO:2
Column, primer 2 contain nucleotide sequence shown in SEQ ID NO:3.
In another embodiment of the present invention, the primer 1 is nucleotide sequence shown in SEQ ID NO:2, described to draw
Object 2 is nucleotide sequence shown in SEQ ID NO:3.
The invention also discloses a kind of and resistance gene of rice blast Pigm close linkage molecular labeling, the molecules
Label is obtained using the oryza sativa genomic dna of blast resisting as template through PCR amplification by above-mentioned primer pair.
Nucleotide sequence shown in SEQ ID NO:1 is preferably contained as the molecular labeling that above-mentioned primer pair amplifies obtain.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in SEQ ID NO:1
DNA fragmentation) for the DNA fragmentation of nucleotide sequence shown in SEQ ID NO:1 in rice genome, that is, the SEQ ID NO for being included:
Nucleotide sequence other than 15 ' ends and/or 3 ' ends is also the sequence in rice genome, it is preferred that in rice genome
5 ' the ends of SEQ ID NO:1 and/or the upstream and downstream sequence at 3 ' ends.As long as it will be understood by those skilled in the art that amplification or inspection
The molecular labeling in the oryza sativa genomic dna of anti-hoja blanca is surveyed, is necessarily able to detect or expands and obtain containing SEQ ID NO:1
Shown in sequence.The length of the upstream and downstream sequence at the 5 ' ends and/or 3 ' ends of SEQ ID NO:1 is suitable length, is not limited especially
It is fixed, for example, meet the length of molecular labeling less than 10,000bp, less than 5,000bp, less than 2,000bp, less than 1,500bp, small
In 1,200bp, it is less than 1,000bp, is less than 800bp or is less than 500bp.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in SEQ ID NO:1
DNA fragmentation) included SEQ ID NO:1 5 ' end and/or 3 ' end be operably connected have artificial sequence and/or control sequence
Column, such as promoter, enhancer, terminator, restriction enzyme site, primer sequence etc..Wherein, term " operationally " is in the present invention
In be defined as a kind of following conformation, in the conformation, control sequence such as promoter is appropriately placed the one of SEQ ID NO:1
On a position, so that the generation for the polypeptide that the control sequence instructs SEQ ID NO:1 to encode.
The invention also discloses a kind of carriers, contain molecular labeling of the invention.The carrier can be inserted with this
The expression recombinant vector or clone's recombinant vector of the molecular labeling of invention.After obtaining above-mentioned recombinant vector, those skilled in the art
Member obtains the weight containing the recombinant vector it is appreciated that according to different needs, recombinant vector is transformed into suitable cell
Group cell.Therefore, the invention also discloses a kind of recombinant cells containing the recombinant vector.
The invention also discloses the preparation methods of molecular labeling of the invention, include the following steps: using blast resisting
Oryza sativa genomic dna carries out PCR amplification as template, with above-mentioned primer pair, and obtained amplified production contains the molecule mark
Note；Preferably, further include the steps that purifying pcr amplification product.
To those skilled in the art, it will be understood that molecule of the invention can also be obtained in the chemically synthesized method of DNA
Label.
The invention also discloses the detection methods of molecular labeling of the invention, comprising steps of according to above-mentioned molecular labeling
Nucleotide sequence design primer is expanded as template using being detected oryza sativa genomic dna, and judges whether deposit in amplified production
In the molecular labeling.Preferably, the primer is the above-mentioned primer pair respectively containing SEQ ID NO:2 and SEQ ID NO:3.
For example, can be using the genomic DNA of detected rice as template, with above-mentioned primer (SEQ ID NO:2 and SEQ ID
NO:3 PCR amplification) is carried out, amplified production is obtained.Obtained amplified production can be carried out to sequencing or gel electrophoresis.
Invention additionally discloses the molecular labelings or the molecular labeling primer in resistance gene of rice blast
Purposes in Pigm positioning or detection.
The invention also discloses a kind of methods of resistance gene of rice blast Pigm positioning, and the method includes using this
The molecular labeling of invention or the step of molecular labeling primer pair.
The invention also discloses the molecular labelings or the molecular labeling primer in rice assistant breeding
Purposes.
The invention also discloses a kind of rice auxiliary breeding means, the method includes detect molecular labeling of the invention or
The step of with molecular labeling primer of the invention to detecting.
Molecular labeling of the invention can be used in molecular mark from now on, and those skilled in the art can manage
Solution, for example screen whether rice contains rice blast resistance gene Pigm by detecting whether that there are molecular labelings of the invention.
Specifically the primer pair of above-mentioned molecular labeling of the invention can be used in the method that the detection can be PCR detection.Institute
Stating detection can also be carried out by sequencing approach.The rice auxiliary breeding means have the advantages that easy, quick, high-throughput.
Due to using the technology described above, the beneficial effect for having the present invention is:
The present invention provides the molecular labeling with resistance gene of rice blast Pigm close linkage, the molecular labeling is by base
Because group DNA sequence dna and resistance gene of rice blast Pigm connect, be conducive to rice molecular marker-assisted breeding system
It establishes；The molecular labeling and resistance gene of rice blast Pigm close linkage.Molecular labeling and molecular labeling of the invention
Amplimer can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Detailed description of the invention
Fig. 1: the electricity of molecular labeling primer (SEQ ID NO:2 and SEQ ID NO:3) male parent, female parent and first familiar generation amplification
Swimming testing result, in which: male parent amplified fragments are about 800bp, and maternal amplified fragments are about 550bp, and first familiar generation contains simultaneously
The two amplified fragments；
Fig. 2 is the result that F2 individual in part utilizes molecular labeling primer (SEQ ID NO:2 and SEQ ID NO:3) amplification.
Specific embodiment
A kind of molecular labeling the invention discloses primer pair and with resistance gene of rice blast Pigm close linkage
R060939 (nucleic acid sequence shown in SEQ ID NO:1).Using primer pair of the invention, using oryza sativa genomic dna as template into
Row PCR, the available molecular labeling with resistance gene of rice blast Pigm close linkage, the molecular labeling is in the present invention
It is named as molecular labeling R060939.It should be pointed out that it will be understood by those skilled in the art that except through above-mentioned PCR amplification
It obtains outside molecular labeling of the invention, molecular labeling of the invention can also be obtained by chemical synthesis.
Primer pair of the invention contains nucleotide sequence shown in sequence table SEQ ID NO:2 and SEQ ID NO:3 respectively.
Those skilled in the art are known, can in the nucleotide sequence shown in above-mentioned SEQ ID NO:2 and SEQ ID NO:3
Increase separately 1~10 base at its 5 ' end or 3 ' ends, the increased base type of institute can according on oryza sativa genomic dna with SEQ
ID NO:2 and SEQ ID NO:3 match region base type and determined according to basepairing rule, it is thus obtained to draw
Essentially identical (the DNA sequence dna between upstream and downstream primer of amplified production of object pair and SEQ ID NO:2 and SEQ ID NO:3
It is identical).Therefore, above-mentioned to increase separately 1~10 base and energy at the 5 ' ends of SEQ ID NO:2 and SEQ ID NO:3 or 3 ' ends
Amplification obtains the primer pair of essentially identical DNA fragmentation, is included in primer pair of the invention.In the specific embodiment party of the present invention
In formula, primer pair of the invention is preferably nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:3.
Below by specific embodiment and in conjunction with attached drawing, invention is further described in detail.Following embodiment is only right
The present invention is further detailed, and should not be construed as limiting the invention.Particular technique or condition are not specified in embodiment
, according to the literature in the art described technology or conditions (such as write with reference to J. Pehanorm Brooker etc., what Huang Peitang etc. was translated
" Molecular Cloning:A Laboratory guide ", the third edition, Science Press) or carry out according to product description.Agents useful for same or instrument are not
Production firm person is indicated, being can be with conventional products that are commercially available, such as can purchase from Illumina company.
Embodiment 1
1, building of the rice F2 for segregating population
Male parent is paddy plum No. 4, is the local varieties come in Sichuan, the anti-rice blast with broad spectrum durable, i.e. resistance
Show as wide spectrum highly resistance.
Female parent is peaceful round-grained rice 43, is a high-grade rice kind, by research institute, Ningxia Academy of Agri-Forestry Sciences with peaceful round-grained rice 12, meaning
Big benefit 4,92 summer temperature, 37 breeding form.Plant height 95cm, plant type is compact, and stem is more sturdy, and dark green leaf color, growing way is in great numbers, tiller
Power is medium, and Leaves on main stem 15, half Erect Panicle, big panicle many grains per panicle, solid 92 of every fringe or more, 84% or more setting percentage, thousand
Weight 24.6g, the long grain shape of seed, the yellow slightly biased canescence of glume, no awns.It is surveyed through food quality supervision inspection center, the Ministry of Agriculture (Wuhan)
It is fixed: Coarse Rice Rate 81.2%, polished rice rate 80.6%, head rice rate 78.8%, chalky grain rate 10%, chalkiness degree 0.5%, grain length
5.6mm, length-width ratio 2.1,1 grade of transparency, 7.0 grades of caustic SCC, gel consistence 82mm, amylose 16.8%, rice matter reaches international
1 grade of superior rice.The time of infertility 150-155 days, late variety.Fertilizer resistance anti-lodging, low temperature resistant, blast resisting ability is poor.
Female parent obtains F1 after emasculation is handled, with paternal pollen and hybridization of female parent, and F1 generation selfing generates F2 for group, altogether
198 single plants.F2 group is planted in the Hua Da agricultural roc garden of Shenzhen, the rice blast resistance of filial generation is observed, measures phenotype
Data.
Phenotypic data is shown: in 198 F2 offsprings, wherein 147 individual plant are uninfected by rice blast, having rice blast
Resistance trait；Other 51 individual plant have infected rice blast, do not have rice blast resistance.Through Chi-square statistic it is found that F2 rice blast
Sick resistance trait segregation ratio is 3:1, meets the mendelian inheritance of single-gene-controlled traits, it is known that the rice blast in this group
Resistance is dominant Dominant gene qualitative character.
1 rice F2 group rice blast resistance segregation ratio of table
2, Parent and F1 generation, F2 for genes of individuals group DNA extraction
Extract the genomic DNA of Parent, F1 generation and F2 generation individual respectively with the CTAB method of improvement, specific method is such as
Under:
1) it samples: taking tender blade 1g or so, be placed in 2ml centrifuge tube.
2) sample freezing is drained: the sample man grinding bead taken, and opening pipe lid is put into vacuum refrigeration and drains machine, -50 DEG C of items
Persistently freezing is drained 12 hours or more (general freezing is drained overnight) under part.
3) sample is ground: the sample that freezing is drained being placed in high-throughput mechanical lapping instrument, startup program grinding, by sample
It crushes.The operation of mechanical lapping instrument program needs 5 minutes, and flux is 96 parts of sample/5 minute.
4) after sample grinding sufficiently, the CTAB extracting solution of 65 DEG C of preheating 1h is added in pipe, mixes, 65 DEG C of water-baths 40 divide
During which clock was mixed by inversion primary every 5 minutes.
5) sample after water-bath is taken out out of water-bath, after being cooled to room temperature, is added and CTAB isometric chloroform (three
Chloromethanes/isoamyl alcohol is mixed according to 24:1 ratio), it mixes gently 10 minutes, until lower liquid becomes bottle green.(this step needs
It is operated in ventilating kitchen)
6) centrifuge tube is transferred in supercentrifuge after mixing and is centrifuged, revolving speed 12000rpm is centrifuged 15 minutes.Sample after centrifugation
Product upper layer is the stillness of night.
7) suitable supernatant is extracted in 1.5ml centrifuge tube, and adds isometric isopropanol, is mixed gently and (at this time may be used
Have flocculent deposit precipitation to see), then sample is placed in refrigerator-freezer 30 minutes of -20 DEG C, to precipitate DNA.
8) sample is transferred to centrifugation in supercentrifuge after freezing 30 minutes, and revolving speed 12000rmp is centrifuged 10 minutes.
9) stillness of night is discarded, and DNA is precipitated with 75% ethanol washing 2 times, ethyl alcohol outwelled after washing, unlimited nozzle is placed in logical
Wind dries in kitchen.
10) after ethyl alcohol volatilizees completely, 50 microlitres of TE buffer (adding RNA enzyme) dissolving DNAs are added, and save in -20 DEG C.
3, genetic map construction and the assignment of genes gene mapping
(1) genetic map construction
For the genomic DNA of the F2 generation individual obtained in step 2, based on the genotyping technique of RAD-seq to F2 groups
The individual of body carries out Genotyping, obtains the genotype data of F2 group.
With 3.0 software of MapMaker (Constructing genetic maps with MAPMAKER/EXP3.0, S
Lincoln, M Daly, E Lander-Cambridge, MA:Whitehead Institute, 1992) carry out genetic linkage map
Spectrum is drawn, and genetic linkage map is obtained.
(2) assignment of genes gene mapping
Since Parent has apparent difference (male parent broad-spectrum disease resistance, maternal low anti-rice blast in rice blast resistance performance
Disease), character analysis is carried out to F2 individual, and the anti-rice of male parent will be derived from according to the linkage relationship between character and molecular labeling
The seasonal febrile diseases assignment of genes gene mapping is on genetic map.
Specifically, the phenotypic data of the F2 group obtained according to step 1, in conjunction with group's genotype and genetic linkage map,
QTL positioning is carried out by 2.5 software of WinQTLCart.The results show that one of rice blast resistant gene Pigm is located in
In No. 6 sections of chromosome 9395664 and 9396272, length about 608bp.
4, the exploitation of molecular labeling
According to the sequencing result of RAD-seq, sequencing reads is compared using the SOAP software of Hua Da independent development, is then used
SOAPsv finds the biggish molecular labeling of Fragment Differential, identifies convenient for being distinguished with gel electrophoresis.It selects close to blast resistant gene
The label R060939 of section is as candidate where Pigm.The molecular labeling shows as nucleotide sequence shown in SEQ ID NO:1
Insertion/deletion length polymorphism.According to an embodiment of the invention, nucleotide sequence shown in SEQ ID NO:1 is as follows
(336bp):
GAAAGACTGGCAGAGTAAGGCTGTCTTTAGTTCACACTAAAATTTTAGTTGAAATTGGTACGATGTGA
TAGGAAAGTTGTGTGTGTATGAAATGTTTGATGTGATAGAAAATTGGAAGTTTGGAAAAAAAACTTTGGAACTAGG
CTATGTTTAGTTCAGCGCAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACCGAAAAGTTGTGTGTGTATG
ATAGGTTGATATGATGGAAAAGGACTGAAGCTTGAATCCATCTAAACACAGCCTAAACAGGACCTAAACAAATTCC
TAACTACTCTAGCTAAAATATCGCAGAAACCCTCCCCACA (SEQ ID NO:1).
5, candidate molecular marker is verified
To the rice anti-rice blast candidate molecular marker R060939 (nucleic acid shown in SEQ ID NO:1 determined in step 4
Sequence) it is verified, specific as follows:
For above-mentioned candidate molecular marker design primer, primer sequence is as follows:
Forward primer: 5 '-CTCAGCAAACCATGTTCAGT-3 ' (SEQ ID NO:2)
Reverse primer: 5 '-AAACAGCTCGTGGTTTCGCT-3 ' (SEQ ID NO:3)
Using above-mentioned primer, the candidate molecular marker are verified by PCR amplification and agarose gel electrophoresis detection more
State property and amplification stability.
Specifically, using extracted in step 3 Parent, F1 generation, the genomic DNA in F2 generation as template, utilize above-mentioned amplification
Primer carries out PCR amplification, wherein
PCR reaction system is as follows:
| Sterile water | 20.2μl |
| 10*Buffer (contains Mg2+) | 2.5μl |
| dNTPs(25mM) | 0.15μl |
| Taq enzyme (5U/ μ l) | 0.15μl |
| Forward primer | 0.5μl |
| Reverse primer | 0.5μl |
| Template | 1.0μl |
| Total volume | 25μl |
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.It is saved at 4 DEG C after pcr amplification product is purified.
Molecular labeling is obtained through above-mentioned amplification procedure, takes part pcr amplification product, is detected with 1% agarose gel electrophoresis,
Obtain polymorphism electrophoretic band, the result is shown in Figure 1-2.
As shown in Figure 1, male parent amplified fragments are about 800bp, maternal amplified fragments are about 550bp, and first familiar generation contains simultaneously
There are the two amplified fragments.Fig. 2 is this labeled primer amplification of part F2 individual, all amplified bands for 800bp or
Simultaneously containing there are two the individual of amplified fragments, plant has rice blast resistance；All amplified bands are the individual of 550bp, are planted
Strain does not have rice blast resistance.Thus prove molecular labeling R060939 (nucleotide sequence shown in SEQ ID NO:1) in father
Between female parent have polymorphism, and with blast resisting character close linkage.
Then, each amplified production is sequenced using 3730 sequenators, as a result, the list of male parent and the F2 blast resisting in
Strain amplified band, with the single plant amplified band of blast resisting is not compared to some sequences are increased in maternal and F2 generation, as candidate
Molecular labeling R060939.Thus, it was demonstrated that candidate molecular marker R060939 has polymorphism, the candidate point between Parent
Son label is closely related with rice anti-rice blast character, and has the stability with rice blast resistance gene Pigm linkage inheritance.
Because candidate molecular marker has polymorphism, the stability with rice blast resistance gene Pigm linkage inheritance,
The molecular labeling that the candidate molecular marker can be used as rice blast resistance gene Pigm uses.Polymorphism refers to: molecular labeling exists
Blast resisting is different with the sequence in not anti-rice blast rice genome, can distinguish.
Although a specific embodiment of the invention has obtained detailed description, it will be understood to those of skill in the art that.Root
According to all introductions having disclosed, those details can be carry out various modifications and be replaced, these change in guarantor of the invention
Within the scope of shield.Full scope of the invention is given by the appended claims and any equivalents thereof.
Sequence table
<110>Chinese Academy of Agricultural Sciences Shenzhen Biology Breeding innovation research institute
Hua Da agricultural application study institute, Shenzhen
Shenzhen Hua Da life science institute
<120>with the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage
<130> P2018-1-0111.CN
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 336
<212> DNA
<213>rice (Oryza sativa)
<400> 1
gaaagactgg cagagtaagg ctgtctttag ttcacactaa aattttagtt gaaattggta 60
cgatgtgata ggaaagttgt gtgtgtatga aatgtttgat gtgatagaaa attggaagtt 120
tggaaaaaaa actttggaac taggctatgt ttagttcagc gcaaagtttg gattttggtt 180
gaaattggag atgatgtgac cgaaaagttg tgtgtgtatg ataggttgat atgatggaaa 240
aggactgaag cttgaatcca tctaaacaca gcctaaacag gacctaaaca aattcctaac 300
tactctagct aaaatatcgc agaaaccctc cccaca 336
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized (Artificial)
<400> 2
ctcagcaaac catgttcagt 20
<210> 3
<211> 20
<212> DNA
<213>artificial synthesized (Artificial)
<400> 3
aaacagctcg tggtttcgct 20
Claims (10)
1. a kind of and resistance gene of rice blast Pigm close linkage molecular labeling, it is characterised in that: the molecular labeling
Contain nucleotide sequence shown in SEQ ID NO:1；Preferably, the molecular labeling is nucleotide sequence shown in SEQ ID NO:1.
2. a kind of primer pair that can be used for expanding with the molecular labeling of resistance gene of rice blast Pigm close linkage, feature
It is that the target sequence expanded includes sequence shown in SEQ ID NO:1；Preferably, the primer 1 of the primer pair includes SEQ ID
Sequence shown in NO:2, primer 2 include sequence shown in SEQ ID NO:3；It is furthermore preferred that primer 1 is sequence shown in SEQ ID NO:2
Column, primer 2 are sequence shown in SEQ ID NO:3.
3. a kind of and resistance gene of rice blast Pigm close linkage molecular labeling, it is characterised in that: the molecular labeling
It is to be obtained using the oryza sativa genomic dna of blast resisting as template through PCR amplification by primer pair as claimed in claim 2.
4. molecular labeling according to claim 3, it is characterised in that: the molecular labeling contains shown in SEQ ID NO:1
Nucleotide sequence；Preferably, the molecular labeling is nucleotide sequence shown in SEQ ID NO:1.
5. a kind of carrier, it is characterised in that: contain molecular labeling described in any one of claim 1,3,4.
6. a kind of recombinant cell, it is characterised in that: contain the carrier described in claim 5.
7. the detection method of molecular labeling described in claim 1, comprising steps of the core of molecular labeling according to claim 1
Nucleotide sequence design primer is expanded as template using being detected oryza sativa genomic dna, and judges to whether there is in amplified production
The molecular labeling；Preferably, the primer is primer pair as claimed in claim 2.
8. the molecular labeling primer of molecular labeling described in any one of claim 1,3,4 or claim 2 is to auxiliary in rice
Help the purposes in breeding or resistance gene of rice blast Pigm positioning or detection.
9. a kind of method of resistance gene of rice blast Pigm positioning, it is characterised in that: the method includes using right to want
The step of the molecular labeling primer pair of molecular labeling described in asking any one of 1,3,4 or claim 2.
10. a kind of rice auxiliary breeding means, it is characterised in that: the method includes any one of detection claims 1,3,4
The molecular labeling or with the molecular labeling primer of claim 2 to detecting the step of.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811471643.9A CN109825619A (en) | 2018-12-03 | 2018-12-03 | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811471643.9A CN109825619A (en) | 2018-12-03 | 2018-12-03 | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109825619A true CN109825619A (en) | 2019-05-31 |
Family
ID=66859231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811471643.9A Pending CN109825619A (en) | 2018-12-03 | 2018-12-03 | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109825619A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980962A (en) * | 2019-12-12 | 2021-06-18 | 深圳华大生命科学研究院 | SNP marker related to birth weight trait of pig and application thereof |
-
2018
- 2018-12-03 CN CN201811471643.9A patent/CN109825619A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980962A (en) * | 2019-12-12 | 2021-06-18 | 深圳华大生命科学研究院 | SNP marker related to birth weight trait of pig and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN116200528A (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CN109797234A (en) | With the molecular labeling R060939-2 of resistance gene of rice blast Pi2 close linkage | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN109971877A (en) | A kind of molecular labeling R061007 and application with rice blast resistant gene Pi2 close linkage | |
| CN109797237A (en) | A kind of molecular labeling R112865-1 and application with rice blast resistant gene Pi1 close linkage | |
| CN106350514B (en) | With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN109321670A (en) | The molecular labeling of rice number of grain per ear gene NOG1 and its application | |
| CN106350580A (en) | Molecular marker OSb1b-SV2 closely linked with genes of resistant bacterial blight of rice | |
| CN109652579A (en) | The codominant marker and its detection method of rice blast resistant gene Pi2 and application | |
| CN102807981B (en) | With the closely linked molecular labeling SIsv0503 of millet fertile gene | |
| CN116814846B (en) | Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang ordinary wild rice and application thereof | |
| CN108660230A (en) | A kind of molecular labeling SIsv0163 with millet anti-imazethapyr herbicide resistance gene close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190531 |
|
| WD01 | Invention patent application deemed withdrawn after publication |