CN109321670A - The molecular labeling of rice number of grain per ear gene NOG1 and its application - Google Patents
The molecular labeling of rice number of grain per ear gene NOG1 and its application Download PDFInfo
- Publication number
- CN109321670A CN109321670A CN201811169400.XA CN201811169400A CN109321670A CN 109321670 A CN109321670 A CN 109321670A CN 201811169400 A CN201811169400 A CN 201811169400A CN 109321670 A CN109321670 A CN 109321670A
- Authority
- CN
- China
- Prior art keywords
- rice
- nog1
- per ear
- gene
- grain per
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to Rice molecular breeding fields, molecular labeling and its application more particularly to a kind of rice number of grain per ear gene NOG1, are obtained or the nucleotide sequence as shown in SEQ ID NO:3 by nucleotide sequence primer amplification rice number of grain per ear gene NOG1 as shown in SEQ ID NO:1-2；Above-mentioned label is designed for the function series of variation of NOG1 gene, for gene function label, therefore there is no heredity exchanges, it does not need to make phenotypic evaluation, utilize above-mentioned molecular labeling, the favorable allels that can accurately, efficiently identify the site NOG1 in rice can be widely applied to the allele Molecular Identification of rice assisted selection and the site rice NOG1.
Description
Technical field
The invention belongs to Rice molecular breeding fields, and in particular to a kind of molecule mark of rice number of grain per ear gene NOG1
Note, primer combination, kit and detection method.
Background technique
Rice is important cereal crops, and the population for global half provides grain ration.With the growth of world population, rice
As staple food crop be faced with improve yield there is an urgent need to.Expect the year two thousand thirty, rice yield need to improve 40% with
The upper needs for being just able to satisfy the mankind.The yield of rice depends primarily on spike number, number of grain per ear and grain weight.Therefore, number of grain per ear is
One of most important economical character of rice, directly decision rice yield, therefore increase the important channel that number of grain per ear is increasing production of rice.
Number of grain per ear is quantitative character, is controlled by multiple quantitative trait locus (Quantitative Trait Loci, QTL).Tradition
Breeding method range estimation selection mainly carried out by fringe type, the grain number to rice, there is excellent number of grain per ear to obtain
The rice single plant of shape carries out selection cross breeding, and tool bears the character of much blindness, and low efficiency is at high cost.
Molecular marker assisted selection (Marker-Assisted Selection, MAS), is with modern molecular biology
The rapid development of technology and the new technology generated, it can rapidly and accurately analyze the genetic constitution of individual from molecular level,
Genotype is directly selected to realize, carries out molecular breeding.Relative to the blindness of traditional breeding method, low efficiency and
The disadvantages such as accuracy is low are then had efficient, quickly and the high advantage of accuracy using the molecular breeding of MAS technology.It is educated in rice
Kind field, has had pertinent literature to disclose and has carried out auxiliary choosing using with target gene close linkage or the molecular labeling isolated
It selects, the synergy gene of high efficiency selected rice number of grain per ear, the synergy gene of rice number of grain per ear can be greatly facilitated in high yield
Application in rice breeding.A kind of rice number of grain per ear synergy gene Gn1a as disclosed in Chinese patent literature CN103468674A
Molecular labeling, which can accurately and rapidly select number of grain per ear character preferably individual, by mutually tying with conventional breeding
It closes, breeding efficiency can be greatly improved in the case where reducing cost, meanwhile, it is high for the accuracy of breeding assisted Selection.
Chinese agricultural university grandson passes cleer and peaceful Tan Lu guest team and disclosed rice grain number per spike related gene NUMBER OF in 2017
The clone of GRAINS 1 (NOG1), rice grain number per spike can be increased by being overexpressed NOG1, gene pairs spike number, florescence, setting percentage, the grain
Other Correlated Yield Characters do not influence again etc., have much application prospect.Studies have shown that NOG1 coding enoyl-CoA hydratase/different
Structure zymoprotein (enoyl-CoAhydratase/isomerase) participates in the beta oxidation for adjusting jasmonic level and fatty acid,
The insertion of the 12bp of promoter region can increase the expression quantity of NGO1 gene and then increase grain number per spike.It is such as more in grain number per spike
Osmanthus is waited in rice cultivars towards No. 2, the 12bp segments comprising two copies in NOG1 gene promoter region, and in grain number per spike
In less wild rice, NOG1 promoter region contains only the 12bp segment of a copy.However, up to the present, not yet
Other people provide the Functional marker of NOG1, with it is accurate, efficiently identify advantageous NOG1 allele and the gene
Marker assisted selection breeding.
Summary of the invention
Therefore, the technical problem to be solved in the present invention is that proposing the molecule mark of rice number of grain per ear gene NOG1 a kind of
Note, primer combination, kit and detection method.
For this purpose, the present invention provides the following technical scheme that
The present invention provides the molecular labelings of rice number of grain per ear gene NOG1 a kind of, pass through nucleotide sequence such as SEQ ID
Primer amplification rice number of grain per ear gene NOG1 shown in NO:1-2 is obtained or the nucleotide sequence as shown in SEQ ID NO:3.
Equipotential base of the molecular labeling of the rice number of grain per ear gene NOG1 in rice assisted selection and the site rice NOG1
Because of the purposes of Molecular Identification.
The primer combination that the present invention provides a kind of for detecting rice number of grain per ear gene NOG1, including nucleotide sequence
The primer as shown in SEQ ID NO:1-2.
The primer for detecting rice number of grain per ear gene NOG1 is combined in rice assisted selection and rice
The purposes of the allele Molecular Identification in the site NOG1.
The present invention provides a kind of for detecting the kit of rice number of grain per ear gene NOG1, including nucleotide sequence is such as
Primer shown in SEQ ID NO:1-2.
The kit, including following PCR reaction system, by 10 μ L in terms of:
Template DNA, 1.0 μ L；
10 × PCR Buffer, 1.0 μ L；
MgCl2, concentration 25mM, 1.0 μ L；
DNTP, concentration 2mM, 1.0 μ L；
Primer combination, concentration are 0.3 μM, 1.0 μ L；
Taq enzyme, concentration 0.2U；
Add ddH2O is mended to 10 μ L.
The kit for detecting rice number of grain per ear gene NOG1 is in rice assisted selection and rice
The purposes of the allele Molecular Identification in the site NOG1.
The present invention provides a kind of methods for detecting rice number of grain per ear gene NOG1, include the following steps:
S1, rice total dna to be measured is extracted；
S2, using the rice total dna of extraction as template, using described in molecular labeling described in claim 1, claim 3
Primer combination or the described in any item kits of claim 5-6 carry out PCR amplifications；
S3, electrophoresis detection amplified production indicate advantageous equipotential base of the rice to be measured containing NOG1 if there is the band of 112bp
Cause；If there is the band of 100bp, indicate that rice to be measured is free of the favorable allels of NOG1.
The favorable allels containing NOG1 be contain there are two copy 12bp NOG1 gene.
The method, PCR amplification condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 20s, 55 DEG C of annealing 20s, 72 DEG C
Extend 20s, expands 32 circulations；72 DEG C of extension 5min, 16 DEG C of preservations.
Technical solution of the present invention has the advantages that
1, the molecular labeling of a kind of rice number of grain per ear gene NOG1 provided by the invention, passes through nucleotide sequence such as SEQ
Primer amplification rice number of grain per ear gene NOG1 shown in ID NO:1-2 is obtained or the nucleotides sequence as shown in SEQ ID NO:3
Column；Above-mentioned molecular labeling design for the function series of variation of NOG1 gene, is marked for gene function, therefore there is no something lost
Exchange is passed, does not need to make phenotypic evaluation, using above-mentioned molecular labeling, can accurately, efficiently identify the site NOG1 in rice
Favorable allels can be widely applied to the allele Molecular Identification of rice assisted selection and the site rice NOG1；
The molecular labeling is codominant marker, can identify the heterozygote and homozygote of NOG1 gene locus, and experiment repeats
Property is good, as a result reliably；
Assisted selection is carried out using molecular labeling of the invention, not only save the cost, but also can be accurately and efficiently
By the favorable allels transformation of NOG1 into target variety, rice yield level is effectively improved.
2, it is combined provided by the present invention for detecting the primer of rice number of grain per ear gene NOG1, primer combination can be with
Segment of the site NOG1 containing functional series of variation in amplifying rice can identify that the site NOG1 is in rice by electrophoresis detection
No carrying favorable allels, quickly, efficient, accuracy is high.
3, provided by the present invention for the kit of detection rice number of grain per ear gene NOG1, the kit can be expanded
Segment of the site NOG1 containing functional series of variation in rice can identify whether the site NOG1 is taken in rice by electrophoresis detection
Band favorable allels, quickly, efficient, accuracy is high.
4, the method for detection rice number of grain per ear gene NOG1 provided by the invention, utilizes above-mentioned primer combination or reagent
The segment containing functional series of variation in the site NOG1 in the amplifiable rice of box, can identify rice NOG1 by electrophoresis detection
Whether site carries favorable allels, and quickly, efficient, accuracy is high.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 is in the embodiment of the present invention 3 to the genotype call results of 32 rice materials.
Specific embodiment
Reagent involved in following embodiments, material or instrument are commercial product.
Primer involved in following embodiments is Nanjing Genscript Biotechnology Co., Ltd.'s synthesis.
Gel-electrophoretic apparatus, Gelose horizontal electrophoretic apparatus (DYCP-32C), 61 Biotechnology Co., Ltd of Beijing.
Rice varieties in table 1 are collected from Inst. of Rice, Jiangx Prov. Academy of Agricultural Sciences's germplasm resource bank.
Embodiment 1
Number of grain per ear gene NOG1 gene according to osmanthus towards No. 2 and two rice of OryzasativaLcv.Nipponbare is poor in the sequence of promoter 12bp
It is different, the primer combination NOG1-M1 of following molecular labeling is devised, positive and negative primer sequence is respectively such as SEQ ID NO:1 and SEQ ID
Shown in NO:2, specific sequence is as follows:
Forward primer (5 ' -3 ') F:AGAGAGCACCCAAGAGTT；
Reverse primer (5 ' -3 ') R:TGAGTAGTTAGGATGGCAAC.
The molecular labeling of the rice number of grain per ear gene NOG1, passes through above-mentioned nucleotide sequence such as SEQ ID NO:
Primer amplification rice number of grain per ear gene NOG1 shown in 1-2 is obtained.The rice number of grain per ear gene that amplification osmanthus is obtained towards No. 2
For the sequence of the molecular labeling of NOG1 as shown in SEQ ID NO:3, specific sequence is as follows:
AGAGAGCACCCAAGAGTTAATCAGATATTGGCAACAGGGAAAAAAAGGGAACCAAATTAACTGTTGGT
AACCTCGGCAAAGTTGCCATCAAAGTTGCCATCCTAACTACTCA.It is opened for osmanthus towards No. 2 NOG1 genes at above-mentioned stroke of horizontal line
First 12bp segment for including in sub-area, second copy followed by.
Whether the rice that above-mentioned molecular labeling and primer combination can widely identify different cultivars contains NOG1
Favorable allels.
Embodiment 2
The kit provided in this embodiment for being used to detect rice number of grain per ear gene NOG1, including nucleotide sequence is such as
Primer shown in SEQ ID NO:1-2.
It further, further include following PCR reaction system, by 10 μ L in terms of:
Template DNA, 1.0 μ L；
10 × PCR Buffer, 1.0 μ L；
MgCl2, concentration 25mM, 1.0 μ L；
DNTP, concentration 2mM, 1.0 μ L；
Primer combination, concentration are 0.3 μM, 1.0 μ L；
Taq enzyme, concentration 0.2U；
Add ddH2O is mended to 10 μ L.
Embodiment 3
A kind of method for detecting rice number of grain per ear gene NOG1 is present embodiments provided, is included the following steps:
S1, rice total dna to be measured is extracted, included the following steps:
1) material to be tested see the table below 1:
32 part rice materials of the table 1 for detection NOG1
2) DNA is extracted
Rice leaf is taken in seedling stage, and the extraction of genomic DNA is improved referring to the CTAB method of (1988) such as Scott, specifically such as
Under:
1, about 0.1g blade is taken, is placed in 2.0mL centrifuge tube, 1 steel ball and 500 μ L 2 × CTABDNA extracting solutions are added
(20g CTAB, the NaCl of the EDTA-Na of the Tris-Base of 12.1g, 7.44g, 81.9g is taken to be dissolved in 1L distilled water, i.e.,
), blade is smashed using tissue grinder instrument, 65 DEG C of warm bath 30min, during which vibration mixes for several times；
2, centrifuge tube is taken out from water-bath, and about 500 μ L chloroform (CHCl are added3), mixing fullys shake, at 10000rpm
It is centrifuged 5min；
3, transfer supernatant is added 2 times of supernatant volume of dehydrated alcohol, will be centrifuged into the centrifuge tube of a new 1.5mL
After placing half an hour in -20 DEG C of refrigerators after the slight mixing of pipe, 10000rpm is centrifuged 5min；
4, supernatant is abandoned, naturally dry on clean blotting paper is inverted in；
5, the DNA after drying adds distilled water to dissolve, and adjusting ultimate density is 100~1000ng/ μ L, is placed in -20 DEG C of refrigerators
Inside save backup.
S2, using the rice total dna of extraction as template, utilize embodiment 2 kit carry out PCR amplification；
PCR reaction system is as follows:
Template DNA, 1.0 μ L；
10 × PCR Buffer, 1.0 μ L；
MgCl2, concentration 25mM, 1.0 μ L；
DNTP, concentration 2mM, 1.0 μ L；
Primer combination, concentration are 0.3 μM, 1.0 μ L；
Taq enzyme, concentration 0.2U；
Add ddH2O is mended to 10 μ L.
PCR amplification condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 20s, 55 DEG C of annealing 20s, 72 DEG C of extension 20s, amplification
32 circulations；72 DEG C of extension 5min, 16 DEG C of preservations.
S3, electrophoresis detection amplified production, PCR reaction product electrophoresis in 3.5% Ago-Gel, are dyed through Gel-Red
It takes pictures in gel imager afterwards.For the result of detection as shown in Figure 1, M is DNAmarker, 1~32 rice material information is shown in Table 1,
By can be seen that in figure, osmanthus amplifies the segment of expected 112bp, 15 kinds such as OryzasativaLcv.Nipponbare towards No. 2 equal 15 kinds (1-15)
(16-30) amplifies the segment of 100bp, hands over F in 2 portions of Xian round-grained rice1The heterozygosis banding pattern containing parents' band is amplified in (31-32),
Electrophoretic band is clear, special, and whether show that the site NOG1 in rice can be identified using molecular labeling of the invention to contain is had
Sharp allele, and two kinds of allelotypes on NOG1 locus can be distinguished well, it can be used for rice grain number per spike base
Because of the marker assisted selection breeding of NOG1.
Obviously, the above embodiments are merely examples for clarifying the description, and does not limit the embodiments.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or
It changes.There is no necessity and possibility to exhaust all the enbodiments.And it is extended from this it is obvious variation or
It changes still within the protection scope of the invention.
SEQUENCE LISTING
<110>Jiangxi Province's super rice research and development center
<120>molecular labeling of rice number of grain per ear gene NOG1 and its application
<130> NHA201800302
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>artificial synthesized (NOG1-M1-F)
<400> 1
agagagcacc caagagtt 18
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized (NOG1-M1-R)
<400> 2
tgagtagtta ggatggcaac 20
<210> 3
<211> 112
<212> DNA
<213>artificial synthesized (artificial synthesis)
<400> 3
agagagcacc caagagttaa tcagatattg gcaacaggga aaaaaaggga accaaattaa 60
ctgttggtaa cctcggcaaa gttgccatca aagttgccat cctaactact ca 112
Claims (9)
1. a kind of molecular labeling of rice number of grain per ear gene NOG1, which is characterized in that pass through nucleotide sequence such as SEQ ID
Primer amplification rice number of grain per ear gene NOG1 shown in NO:1-2 is obtained or the nucleotide sequence as shown in SEQ ID NO:3.
2. the molecular labeling of rice number of grain per ear gene NOG1 described in claim 1 is in rice assisted selection and rice
The purposes of the allele Molecular Identification in the site NOG1.
3. the primer combination for detecting rice number of grain per ear gene NOG1, which is characterized in that including nucleotide sequence such as SEQ
Primer shown in ID NO:1-2.
4. the primer as claimed in claim 3 for detecting rice number of grain per ear gene NOG1 is combined in rice assisted selection
With the purposes of the allele Molecular Identification in the site rice NOG1.
5. the kit for detecting rice number of grain per ear gene NOG1, which is characterized in that including nucleotide sequence such as SEQ ID
Primer shown in NO:1-2.
6. kit according to claim 5, which is characterized in that including following PCR reaction system, by 10 μ L in terms of:
Template DNA, 1.0 μ L；
10 × PCR Buffer, 1.0 μ L；
MgCl2, concentration 25mM, 1.0 μ L；
DNTP, concentration 2mM, 1.0 μ L；
Primer combination, concentration are 0.3 μM, 1.0 μ L；
Taq enzyme, concentration 0.2U；
Add ddH2O is mended to 10 μ L.
7. the described in any item kits for detecting rice number of grain per ear gene NOG1 of claim 5-6 assist selecting in rice
Select the purposes of the allele Molecular Identification in breeding and the site rice NOG1.
8. a kind of method for detecting rice number of grain per ear gene NOG1, which comprises the steps of:
S1, rice total dna to be measured is extracted；
S2, using the rice total dna of extraction as template, using molecular labeling described in claim 1, as claimed in claim 3 draw
Object combination or the described in any item kits of claim 5-6 carry out PCR amplification；
S3, electrophoresis detection amplified production indicate favorable allels of the rice to be measured containing NOG1 if there is the band of 112bp；If
There is the band of 100bp, indicates that rice to be measured is free of the favorable allels of NOG1.
9. according to the method described in claim 8, it is characterized in that, PCR amplification condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of changes
20s, 55 DEG C of annealing 20s, 72 DEG C of extension 20s of property, expand 32 circulations；72 DEG C of extension 5min, 16 DEG C of preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811169400.XA CN109321670A (en) | 2018-10-08 | 2018-10-08 | The molecular labeling of rice number of grain per ear gene NOG1 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811169400.XA CN109321670A (en) | 2018-10-08 | 2018-10-08 | The molecular labeling of rice number of grain per ear gene NOG1 and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109321670A true CN109321670A (en) | 2019-02-12 |
Family
ID=65261728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811169400.XA Pending CN109321670A (en) | 2018-10-08 | 2018-10-08 | The molecular labeling of rice number of grain per ear gene NOG1 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109321670A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011258A (en) * | 2016-06-22 | 2016-10-12 | 海南波莲水稻基因科技有限公司 | Molecular marker for rice seed peel color gene Pb and application of molecular marker |
| CN107058516A (en) * | 2017-03-09 | 2017-08-18 | 海南波莲水稻基因科技有限公司 | The molecular labeling of wide gene GW2 of rice grain a kind of and its application |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
-
2018
- 2018-10-08 CN CN201811169400.XA patent/CN109321670A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011258A (en) * | 2016-06-22 | 2016-10-12 | 海南波莲水稻基因科技有限公司 | Molecular marker for rice seed peel color gene Pb and application of molecular marker |
| CN107058516A (en) * | 2017-03-09 | 2017-08-18 | 海南波莲水稻基因科技有限公司 | The molecular labeling of wide gene GW2 of rice grain a kind of and its application |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
Non-Patent Citations (2)
| Title |
|---|
| XING HUO等: "NOG1 increases grain production in rice", 《NATURE COMMUNICATIONS |》 * |
| 霍兴: "水稻产量基因的克隆与功能分析", 《中国博士学位论文全文数据库》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281A (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN110295251A (en) | Chain SNP marker and its application with wheat available tillering QTL | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN106521021B (en) | Gene marker for identifying haplotype of rice grain width and grain weight GS5 gene and application | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN109735648B (en) | Method for screening wheat with different thousand grain weights and special kit thereof | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN105821153B (en) | The relevant molecular labeling of rape cracking resistance angle character main effect QTL and application | |
| CN105861498B (en) | One kind SNP marker relevant to rubber tree dry incineration method and its application | |
| CN105838809B (en) | One kind SNP marker relevant to rubber tree latex dust quantity and its application | |
| CN109321670A (en) | The molecular labeling of rice number of grain per ear gene NOG1 and its application | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage | |
| CN113278723A (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN109797234A (en) | With the molecular labeling R060939-2 of resistance gene of rice blast Pi2 close linkage | |
| CN109652579A (en) | The codominant marker and its detection method of rice blast resistant gene Pi2 and application | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350580A (en) | Molecular marker OSb1b-SV2 closely linked with genes of resistant bacterial blight of rice | |
| CN109971877A (en) | A kind of molecular labeling R061007 and application with rice blast resistant gene Pi2 close linkage | |
| CN109797237A (en) | A kind of molecular labeling R112865-1 and application with rice blast resistant gene Pi1 close linkage | |
| CN102807981B (en) | With the closely linked molecular labeling SIsv0503 of millet fertile gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |