CN107988410A - Identify molecular labeling, identification method and the application of rice blast resistant gene Pita - Google Patents
Identify molecular labeling, identification method and the application of rice blast resistant gene Pita Download PDFInfo
- Publication number
- CN107988410A CN107988410A CN201711397066.9A CN201711397066A CN107988410A CN 107988410 A CN107988410 A CN 107988410A CN 201711397066 A CN201711397066 A CN 201711397066A CN 107988410 A CN107988410 A CN 107988410A
- Authority
- CN
- China
- Prior art keywords
- pita
- tpap
- rice
- rice blast
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, disclose a kind of molecular labeling, identification method and application for identifying Rice Resistance To Rice Blast, the molecular labeling is Pita TPAP, including the Pita TPAP I R shown in the Pita TPAP I F and SEQ ID NO.4 shown in Pita TPAP O R, the SEQ ID NO.3 shown in Pita TPAP O F, SEQ ID NO.2 of the nucleotide sequence as shown in SEQ ID NO.1.The molecular labeling can carry out Direct Identification to two kinds of allelotypes of the rice blast fungus resistance of Pita genes, the molecular labeling based on PCR technology, without sequencing or digestion, only once PCR can precise Identification it is anti-sense two kinds of allelotypes, substantially increase the detection efficiency of the gene loci, and rate of accuracy reached 100%.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of point for identifying rice blast resistant gene Pita
Son mark, identification method and application.
Background technology
The rice blast as caused by Pyricularia oryzae (Magnaporthe oryzae) is one of important disease of rice, can cause water
The rice significantly underproduction, causes that No kernels or seeds are gathered, as in a year of scarcity when serious, drastically influence the grain security production in China.Historical practice proves, selects
It is to mitigate the most effective solution of rice blast harm to educate anti-rice blast rice kind.And due to rice blast Resistance Identification more
It is cumbersome, have a great influence between by the age, the selection for aiding in carrying out Varieties Resistant To Rice Blast by molecular labeling can greatly improve selection
Efficiency, is the best means for improveing Rice Resistance To Rice Blast from the influence of external elements.
At present, existing 24 blast resistant genes are by successful clone, and in 2000 by successful clone, it is encoded Pita genes
The cytoplasma membrane receptor protein rich in leucine repetitive sequence being made of 928 amino acid residues, is decided to be positioned at rice
Region of 12 chromosomes near kinetochore, there are two kinds of allelotypes of anti-sense, its feature are more by single base nucleotide
State property determines.It is a blast resistant gene with resistance of wide spectrum.Since the anti-sense allelotype of Pita genes is by single alkali
Yl nucleosides acid polymorphism determines that PCR is detected dependent on sequencing or repeatedly for detection.
At present, the Resistance Identification of rice blast can be identified by two kinds of forms of phenotype and genotype, phenotypic evaluation by
Have a great influence between age, it is cumbersome.Although genotype identification is accurate, efficiency is higher, have no that based on PCR technology is examined at present
Survey the feature detection mark of the anti-sense allelotype of Pita genes.
The content of the invention
In order to solve the above technical problem, the present invention provides a kind of identification rice blast resistant gene Pita molecule mark
Note, identification method and application, overcome phenotypic evaluation and have a great influence between by the age, it is cumbersome the defects of, be a kind of based on PCR
The feature detection mark of the anti-sense allelotype of technology for detection Pita genes.
The present invention provides a kind of molecular labeling for identifying rice blast resistant gene Pita, the molecular labeling is
Pita-TPAP, including shown in Pita-TPAP-O-F, SEQ ID NO.2 of the nucleotide sequence as shown in SEQ ID NO.1
The Pita-TPAP-I-R shown in Pita-TPAP-I-F and SEQ ID NO.4 shown in Pita-TPAP-O-R, SEQ ID NO.3.
Present invention also offers a kind of method using above-mentioned molecular markers for identification rice blast resistant gene Pita, including
Following steps：
S1, extracts the genomic DNA of rice material to be measured；
S2, the genomic DNA obtained using S1 is template, with Pita-TPAP-O-F, Pita-TPAP-O-R, Pita-TPAP-
I-F and Pita-TPAP-I-R carries out PCR amplification for primer；
S3, result judgement
Combined using Pita-TPAP-O-F with Pita-TPAP-O-R and amplify 381bp fragments and be used as positive control；Work as Pita-
TPAP-I-F is combined with Pita-TPAP-O-R when amplifying 201bp fragments, and detection material carries susceptible allelotype T；When
Pita-TPAP-O-F is combined with Pita-TPAP-I-R when amplifying 233bp fragments, and detection material carries disease-resistant allelotype
G。
Preferably, in the method for above-mentioned identification rice blast resistant gene Pita, the response procedures of PCR amplification are：95℃
Pre-degeneration 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 30s-50s, 35 circulations；72 DEG C of extension 10min；4℃
Cool down 10min.
Present invention also offers a kind of above-mentioned molecular labeling in Rice Resistance To Rice Blast molecular marking supplementary breeding
Using.
Present invention also offers a kind of application of above-mentioned method in Rice Resistance To Rice Blast molecular marking supplementary breeding.
Compared with prior art, the present invention provide it is a kind of identify the molecular labeling of Rice Resistance To Rice Blast, identification method and
Using having the advantages that：
The present invention is obstructed for the polymorphism of the feature single base nucleotide T-G of Pita genes based on four primer amplifications
Principle is mutated, develops the feature detection mark Pita-TPAP of the anti-sense allelotype of detection Pita genes.
Molecular labeling Pita-TPAP is identified from the functional polymorphism of DNA base, and inventor passes through a large number of experiments
Material confirms that the molecular labeling can directly reflect two kinds of allelotypes of the rice blast fungus resistance of Pita genes
Fixed, the molecular labeling based on PCR technology, without sequencing or digestion, only once PCR can precise Identification two kinds of allele of anti-sense
Type, substantially increases the detection efficiency of the gene loci, and rate of accuracy reached 100%, can preferably distinguish two kinds of allelotypes,
Not influenced by environmental conditions, identification operating method is simple, and consuming is relatively low, and primer molecule disclosed in other existing literatures marks
It can only achieve the identification accuracy rate of 50-70%；The molecular labeling Pita-TPAP of the present invention is the mirror of Pita alleles types
Fixed and corresponding molecular marker assisted selection work lays a solid foundation, and is suitable for promoting the use of on a large scale.
Brief description of the drawings
Fig. 1 is the Pita genes of Nipponbare material；
Fig. 2 is the Pita genes of military fortune round-grained rice 27；
Fig. 3 carries out PCR amplification result for different annealing temperature group；
Wherein, M swimming lanes are DNA standard molecular weights；1st, 3,5,7,9,11,13,15,17 swimming lanes are respectively military fortune No. 27 materials of round-grained rice
Expect the amplification under 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C of annealing temperatures；2、3、4、5、
10th, 12,14,16,18 swimming lanes be respectively Nipponbare material 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C,
Amplification under 63 DEG C of annealing temperatures.
Embodiment
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings, but should not be construed as the limit of the present invention
System.Experimental method in following embodiments, is conventional method unless otherwise specified, material used, examination in following embodiments
Agent etc., is commercially available unless otherwise specified.
A kind of molecular labeling for identifying Rice Resistance To Rice Blast provided by the invention, the molecular labeling is Pita-TPAP,
Including Pita-TPAP-O-F of the nucleotide sequence as shown in SEQ ID NO.1, the Pita-TPAP-O- shown in SEQ ID NO.2
R, the Pita-TPAP-I-R shown in Pita-TPAP-I-F the and SEQ ID NO.4 shown in SEQ ID NO.3.
Specifically obtain in accordance with the following methods：
With reference to the research such as Gregory T (Gregory T.Bryan；Kun-Sheng Wu；Leonard Farrall；
Yulin Jia；Howard P.Hershey；Sean A.McAdams；Kristina N.Faulk；Gail K.Donaldson；
Renato Tarchini；Barbara Valent.A Single Amino Acid Difference Distinguishes
Resistant and Susceptible Alleles of the Rice Blast Resistance Gene Pi-ta.The
Plant Cell,2000,12(11):2033-2046, cloned sequence [Os12g0281300], choosing are searched by RAP-DB websites
The SNP that T-G at the 4364 of sequence is provided with RAP-DB is designed.Check variety is disease-resistant variety " force fortune round-grained rice 27 ", susceptible
Kind " Nipponbare ".Design is marked using online primer-design software Primer1, is named as Pita-TPAP, Pita-
TPAP includes Pita-TPAP-O-F of the nucleotide sequence as shown in SEQ ID NO.1, the Pita- shown in SEQ ID NO.2
The Pita-TPAP-I-R shown in Pita-TPAP-I-F and SEQ ID NO.4 shown in TPAP-O-R, SEQ ID NO.3, its sequence
Column information refers to table 1.
SEQ ID NO.5 and Fig. 1 are for the nucleotide sequence of susceptible genotype Nipponbare.As shown in Figure 1, SNP in Fig. 1
Difference site represents that the letter with underscore represents primer binding site with tilted letter T is blackened, and solid arrow represents that primer expands
Increase direction, dotted arrow represents effectively to expand.
SEQ ID NO.6 and Fig. 2 are the nucleotide sequence of the military fortune round-grained rice 27 of disease-resistant allelotype.As shown in Fig. 2, figure
SNP differences site is represented with tilted letter G is blackened in 2, and the letter with underscore represents primer binding site, and solid arrow represents
Primer amplification direction, dotted arrow represent effectively to expand.
Each molecule labelled series in 1 Pita-TPAP of table
| Gene | Mark | Sequence (5 ' -3 ') |
| Pita | Pita-TPAP-I-F | ctctgccgtggcttctatctttacttg |
| Pita | Pita-TPAP-I-R | atcaagtcaggttgaagatgcatgga |
| Pita | Pita-TPAP-O-F | tatggttgatatacaatgggtggattgg |
| Pita | Pita-TPAP-O-R | cccgagaaaatataggacctcccattaa |
Embodiment 1
The Pyricularia oryzae resistance trait for examination rice material is identified using above-mentioned molecular labeling Pita-TPAP, is specifically included
Following steps：
Material to be tested is the control material rice varieties Nipponbare in the experiment of Pita gene clonings and the military fortune round-grained rice of rice varieties
No. 27, wherein Nipponbare carries the susceptible allelotype Pita of rice blast, No. 27 carrying disease-resistant allele of rice blast of force fortune round-grained rice
Type Pita.
S1, extracts the genomic DNA of two materials of Nipponbare and Wu Yun round-grained rice No. 27, extracting genome DNA is using complete respectively
Formula gold plant DNA extraction kit carries out (operate and illustrate according to kit).
S2, the genomic DNA obtained using S1 is template, with Pita-TPAP-O-F, Pita-TPAP-O-R, Pita-TPAP-
I-F and Pita-TPAP-I-R carries out PCR amplification for primer.
Pcr amplification reaction system is 20 μ L：Including 1 μ L of DNA (1ng/ μ L)；Pita-TPAP-O-F0.5μL、Pita-
TPAP-O-R 0.5μL、Pita-TPAP-I-F 0.5μL、Pita-TPAP-I-R 0.5μL；2×Tap PCR Master Mix
(band dyestuff, health are bought for ShiJi Co., Ltd) 10.0 μ L；ddH2O 7.0μL。
Wherein Pita-TPAP-O-F, Pita-TPAP-O-R are outer primer, Pita-TPAP-I-F and Pita-TPAP-I-R
For inner primer, the concentration of above-mentioned primer is 4pmol/ μ L.
The anti-program of answering of PCR amplification is：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extensions
30s, 35 circulations；72 DEG C of extension 10min；4 DEG C of cooling 10min.Reaction product 100V electrophoresis 1h on 4% Ago-Gel,
Observed after being dyed through ethidium bromide (Ethidium Bromide, EB) and under gel imaging system, record result.
S3, result judgement
Combined using Pita-TPAP-O-F with Pita-TPAP-O-R and amplify 381bp fragments and be used as positive control；Work as Pita-
TPAP-I-F is combined with Pita-TPAP-O-R when amplifying 201bp fragments, and detection material carries susceptible allelotype T；When
Pita-TPAP-O-F is combined with Pita-TPAP-I-R when amplifying 233bp fragments, and detection material carries disease-resistant allelotype
G。
PCR amplification is carried out to 9 annealing temperature groups of 2 control materials by Pita-TPAP, wherein, the 9 of PCR amplification
A annealing temperature is respectively 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, remaining program is with reference to real
Apply the pcr amplification reaction program described in the S2 of example 1.Different annealing temperature group carries out PCR amplification, and the results are shown in Figure 3, by Fig. 3
Understand, when annealing temperature is 55 DEG C, band brightness region is shown clearly in electrophoretogram, and without blooming, there is no false positive to show
As.Pita-TPAP-O-F is combined with Pita-TPAP-O-R amplifies 381bp fragments as positive control；When detection material is to take
During Nipponbare with the susceptible allelotype of rice blast, Pita-TPAP-I-F is combined with Pita-TPAP-O-R amplifies 201bp
Fragment；When detecting material to carry the military fortune round-grained rice of the disease-resistant allelotype of rice blast 27, Pita-TPAP-O-F and Pita-
TPAP-I-R is combined and is amplified 233bp fragments.Since material has been sequenced for the gene loci in forefathers' research in the control material of selection
Material, it was confirmed that the validity and accuracy of Pita-TPAP.
Embodiment 2
(Wang Zhonghua is studied according to Wang Zhonghua et al..The foundation and its application of Rice Blast Resistance Gene Pi ta molecular labeling
[D].Zhejiang University, 2003.), Pita resistance alleles have rice blast fungus biological strain ZN52 and ZN57 significantly anti-
Property.Embodiment 2 is test material by the DH colonies that anti-sense allelotype mixing breed produces, by being inoculated with ZN52 and ZN57
Rice blast fungus biological strain, contrasts genotype and phenotype, verifies the accuracy and practicality of the invention.
DH colonies hybridize the disease-resistant equipotential base of rice blast for the susceptible allelotype rice varieties Nipponbare (male parent) of rice blast
Because of the military fortune round-grained rice No. 27 (female parents) of type rice varieties, the stable strain of 120 obtained by Anther Culture, by marking Pita-
TPAP carries out the Pita allelotypes identification of 120 stables strains, and is inoculated with 2 years phenotype with 2013-2014 and carries out pair
Than the results are shown in Table 2, and 2013 is identical with 2014 annual bearings, and disease-resistant allelotype rice product material amounts to 52 parts, inoculation knot
Fruit is R grades (blast resistings)；Susceptible allelotype rice varieties amount to 68, and inoculation result is S grades (blast resistings).
Genotype identification result is consistent with inoculation phenotypic evaluation, it was confirmed that marks the accuracy of Pita-TPAP.
Table 2 utilizes molecular labeling Pita-TPAP detection DH colony's rice blast genotype and phenotype comparing result
Note：Mark letter r represents disease-resistant, and S represents susceptible.
Embodiment 3 carries out the genotype detection of RIL colony offsprings using molecular labeling Pita-TPAP
(Wang Zhonghua is studied according to Wang Zhonghua et al..The foundation and its application of Rice Blast Resistance Gene Pi ta molecular labeling
[D].Zhejiang University, 2003.), Pita resistance alleles have rice blast fungus biological strain ZN52 and ZN57 significantly anti-
Property.Embodiment 3 be test material by the RIL colonies that anti-sense allelotype mixing breed produces, by be inoculated with ZN52 with
ZN57 rice blast fungus biological strains, contrast genotype and phenotype, verify the accuracy and practicality of the invention.
RIL colonies hybridize disease-resistant allelotype kind Yanjing 188 (mother for susceptible allelotype kind more light (male parent)
This), the 160 stable strains obtained by simple grain transmission method, by marking Pita-TPAP 160 stable strains of progress
Pita allelotypes are identified, and are contrasted with 2 years phenotypes of 2013-2014, and the results are shown in Table 3, as a result such as the institute of table 2
Show, 2013 is identical with 2014 annual bearings, and disease-resistant allelotype rice product material amounts to 82 parts, and inoculation result is R grades of (anti-rice
Seasonal febrile diseases)；Susceptible allelotype rice varieties amount to 78, and inoculation result is S grades (blast resistings).Genotype identification result
It is consistent with inoculation phenotypic evaluation, it was confirmed that to mark the accuracy of Pita-TPAP.
Table 3 utilizes molecular labeling Pita-TPAP detection RIL colony's rice blast genotype and phenotype comparing result
Note：Mark letter r represents disease-resistant, and S represents susceptible.
It should be noted that involved in claims of the present invention during number range, it is thus understood that each number range
Any one numerical value can be selected between two endpoints and two endpoints, due to step method and above-described embodiment phase of use
Together, repeat in order to prevent, description of the invention preferred embodiment, but those skilled in the art once know substantially
Creative concept, then can make these embodiments other change and modification.So appended claims are intended to be construed to wrap
Include preferred embodiment and fall into all change and modification of the scope of the invention.
Obviously, various changes and modifications can be made to the invention without departing from essence of the invention by those skilled in the art
God and scope.In this way, if these modifications and changes of the present invention belongs to the scope of the claims in the present invention and its equivalent technologies
Within, then the present invention is also intended to comprising including these modification and variations.
Sequence table
<120>Identify molecular labeling, identification method and the application of rice blast resistant gene Pita
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 28
<212> DNA
<213>Artificial sequence
<400> 1
tatggttgat atacaatggg tggattgg 28
<210> 2
<211> 28
<212> DNA
<213>Artificial sequence
<400> 2
cccgagaaaa tataggacct cccattaa 28
<210> 3
<211> 27
<212> DNA
<213>Artificial sequence
<400> 3
ctctgccgtg gcttctatct ttacttg 27
<210> 4
<211> 26
<212> DNA
<213>Artificial sequence
<400> 4
atcaagtcag gttgaagatg catgga 26
<210> 5
<211> 480
<212> DNA
<213>Artificial sequence
<400> 5
ttcgcaagca tccgacgccg agcactctta tggttgatat acaatgggtg gattggatct 60
ttggtgctga agggagagac ttggatgaag atttggcaca acaagatgat cacgggtatg 120
gatttttcat tctattccca ggttacaact tacaaggatt attgagcttc tttctttctc 180
tgccgtggct tctatcttta ccttctatgc atcttcaacc tgacttgatg attgtttgaa 240
accaatttta atggaagtta aatgttattg ttgtgaccct gaatcaggtt ttgtatgcta 300
ccggaatcct cttcacgtct tcagagtaga ggtaattttg tttcttgtca ttttacagtt 360
acagttcatc tacttaagga attaatggga ggtcctatat tttctcgggt acctagaagg 420
tgtggttcct agtcttacct ccttaagaac cgtagaatgt tggccctaac acttggatca 480
<210> 6
<211> 480
<212> DNA
<213>Artificial sequence
<400> 6
ttcgcaagca tccgacgccg agcactctta tggttgatat acaatgggtg gattggatct 60
ttggtgctga agggagagac ttggatgaag atttggcaca acaagatgat cacgggtatg 120
gatttttcat tctattccca ggttacaact tacaaggatt attgagcttc tttctttctc 180
tgccgtggct tctatcttta cctgctatgc atcttcaacc tgacttgatg attgtttgaa 240
accaatttta atggaagtta aatgttattg ttgtgaccct gaatcaggtt ttgtatgcta 300
ccggaatcct cttcacgtct tcagagtaga ggtaattttg tttcttgtca ttttacagtt 360
acagttcatc tacttaagga attaatggga ggtcctatat tttctcgggt acctagaagg 420
tgtggttcct agtcttacct ccttaagaac cgtagaatgt tggccctaac acttggatca 480
Claims (5)
1. a kind of molecular labeling for identifying rice blast resistant gene Pita, it is characterised in that the molecular labeling is Pita-
TPAP, including Pita-TPAP-O-F of the nucleotide sequence as shown in SEQ ID NO.1, the Pita- shown in SEQ ID NO.2
The Pita-TPAP-I-R shown in Pita-TPAP-I-F and SEQ ID NO.4 shown in TPAP-O-R, SEQ ID NO.3.
2. the method for molecular markers for identification rice blast resistant gene Pita using described in claim 1 a kind of, its feature exist
In comprising the following steps：
S1, extracts the genomic DNA of rice material to be measured；
S2, the genomic DNA obtained using S1 is template, with Pita-TPAP-O-F, Pita-TPAP-O-R, Pita-TPAP-I-F
With Pita-TPAP-I-R PCR amplification is carried out for primer；
S3, result judgement
Combined using Pita-TPAP-O-F with Pita-TPAP-O-R and amplify 381bp fragments and be used as positive control；Work as Pita-
TPAP-I-F is combined with Pita-TPAP-O-R when amplifying 201bp fragments, and detection material carries susceptible allelotype T；When
Pita-TPAP-O-F is combined with Pita-TPAP-I-R when amplifying 233bp fragments, and detection material carries disease-resistant allelotype
G。
3. the method for molecular markers for identification rice blast resistant gene Pita according to claim 2, it is characterised in that
The response procedures of PCR amplification are：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s-50s, 35
Secondary circulation；72 DEG C of extension 10min；4 DEG C of cooling 10min.
4. application of the molecular labeling according to claim 1 in Rice Resistance To Rice Blast molecular marking supplementary breeding.
5. application of the method according to claim 11 in Rice Resistance To Rice Blast molecular marking supplementary breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711397066.9A CN107988410A (en) | 2017-12-21 | 2017-12-21 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711397066.9A CN107988410A (en) | 2017-12-21 | 2017-12-21 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988410A true CN107988410A (en) | 2018-05-04 |
Family
ID=62037965
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711397066.9A Pending CN107988410A (en) | 2017-12-21 | 2017-12-21 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988410A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321670A (en) * | 2018-10-08 | 2019-02-12 | 江西省超级水稻研究发展中心 | The molecular labeling of rice number of grain per ear gene NOG1 and its application |
| CN112442547A (en) * | 2020-12-11 | 2021-03-05 | 华智生物技术有限公司 | Development and application of SNP molecular marker of rice blast resistance gene Pita |
| CN113981122A (en) * | 2021-09-18 | 2022-01-28 | 华南农业大学 | A set of compatible and accurate identification, excavation and cloning technology system for rice blast Pita disease-resistant gene family alleles |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789654A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice blast resistance gene Pita and application thereof |
| CN106167827A (en) * | 2016-08-11 | 2016-11-30 | 江苏焦点农业科技有限公司 | Resistance gene of rice blast Pita, Pib molecule labelling method |
| CN107245530A (en) * | 2017-08-17 | 2017-10-13 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain |
| CN105907884B (en) * | 2016-07-04 | 2019-06-21 | 湖北省农业科学院粮食作物研究所 | Rice blast resistant gene Pita specific molecular marker primer and application |
-
2017
- 2017-12-21 CN CN201711397066.9A patent/CN107988410A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789654A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice blast resistance gene Pita and application thereof |
| CN105907884B (en) * | 2016-07-04 | 2019-06-21 | 湖北省农业科学院粮食作物研究所 | Rice blast resistant gene Pita specific molecular marker primer and application |
| CN106167827A (en) * | 2016-08-11 | 2016-11-30 | 江苏焦点农业科技有限公司 | Resistance gene of rice blast Pita, Pib molecule labelling method |
| CN107245530A (en) * | 2017-08-17 | 2017-10-13 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321670A (en) * | 2018-10-08 | 2019-02-12 | 江西省超级水稻研究发展中心 | The molecular labeling of rice number of grain per ear gene NOG1 and its application |
| CN112442547A (en) * | 2020-12-11 | 2021-03-05 | 华智生物技术有限公司 | Development and application of SNP molecular marker of rice blast resistance gene Pita |
| CN113981122A (en) * | 2021-09-18 | 2022-01-28 | 华南农业大学 | A set of compatible and accurate identification, excavation and cloning technology system for rice blast Pita disease-resistant gene family alleles |
| CN113981122B (en) * | 2021-09-18 | 2023-02-03 | 华南农业大学 | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104073487B (en) | The molecule marker of rice blast resistant gene Pi2 and application thereof | |
| CN103146695B (en) | Functional molecular marker for rice anti-blast gene Pi9 and application thereof | |
| CN106480228B (en) | The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3 | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN107227373B (en) | SNP functional molecular marker of japonica rice lodging-resistant gene and application | |
| CN112430606A (en) | Wheat stripe rust resistant gene yrZ15-1949 and molecular marker and application thereof | |
| CN107988410A (en) | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita | |
| CN108018371A (en) | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character | |
| CN104611332A (en) | Molecular marker primers for rice blast-resistant gene Piz-t specific SNP and application | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN104419708B (en) | Nucleic acid and detection transgenic paddy rice EB7001S and its method for Derivative line and kit and application thereof | |
| CN102732514B (en) | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same | |
| CN117265168A (en) | Molecular marker related to protein content in soybean and application thereof | |
| CN107245530A (en) | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain | |
| CN116875736A (en) | SNP molecular marker of rice blast resistance gene pizz, primer set and application | |
| CN101880725B (en) | Polymerase chain reaction (PCR) detection method for trans-cry2A-genic rice line T2A-1 and application thereof | |
| CN109554494A (en) | The general codominant marker and its detection method of rice brown planthopper resistant BPH9 multiple allele and application | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN110592260B (en) | Competitive allele specific polymerase chain reaction marker of hard wheat adult plant leaf rust resistant locus and application thereof | |
| CN107858446A (en) | A kind of molecular labeling, authentication method and application for identifying Rice Resistance To Rice Blast | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN107254548A (en) | A kind of molecular labeling, authentication method and application for identifying paddy rice Chalkiness trait |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |
|
| RJ01 | Rejection of invention patent application after publication |