CN107227373B - SNP functional molecular marker of japonica rice lodging-resistant gene and application - Google Patents
SNP functional molecular marker of japonica rice lodging-resistant gene and application Download PDFInfo
- Publication number
- CN107227373B CN107227373B CN201710640684.5A CN201710640684A CN107227373B CN 107227373 B CN107227373 B CN 107227373B CN 201710640684 A CN201710640684 A CN 201710640684A CN 107227373 B CN107227373 B CN 107227373B
- Authority
- CN
- China
- Prior art keywords
- primer
- rice
- lodging
- snp
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP functional molecular marker of a lodging-resistant gene of japonica rice and application thereof, wherein the lodging-resistant gene is SCM2, the SNP functional molecular marker is K _06G _ SCM2-1 and is positioned at the 27481645 th base of the No. 6 chromosome of rice, the SNP molecular marker polymorphism is T/G, the sequence of the SNP molecular marker is shown as SEQ ID No.1, the base at the 55bp position is T or G, and the SNP functional molecular marker is positioned in the SCM2 promoter region of the gene. The SNP functional molecular marker can be used for predicting the lodging resistance capability of the japonica rice subspecies material in early stage (seedling stage or embryo stage), can be accurately screened, and promotes the genetic improvement and breeding of the lodging resistance character of japonica rice. The invention adopts the KASP method to detect the SNP locus, the detection method is accurate and reliable, the operation is simple and convenient, and the invention is suitable for the application of high-flux commercial molecular breeding.
Description
Technical Field
The invention relates to the technical field of plant molecular biology, in particular to a SNP functional molecular marker of japonica rice lodging-resistant genes and application thereof.
Background
The traditional pedigree method is a method generally adopted by rice breeders, and a large number of new rice varieties with high yield, high resistance and high quality are cultivated and created through years of efforts of the breeders. However, the traditional breeding mode combined with phenotype identification has the defects of inaccurate phenotype control, large demand of genetic population, high labor cost, long breeding period and the like, and is difficult to realize large-scale commercial integrated breeding or material genetic improvement. With the development of Molecular biology and bioinformatics, Molecular Assisted selective breeding (MAS) shows huge technical advantages, realizes the combination of genetic basis and target traits, selects materials (single plants) containing target genes for combination, realizes the precise improvement of the target traits, and can effectively avoid the technical barriers of the traditional breeding method.
Single Nucleotide variations (SNPs) are widely present in the genome of species, including: the forms of single base conversion or transversion, single base (fragment) insertion or deletion and the like gradually arouse a new generation of SNP molecular marker technology aiming at the polymorphic sites. Functional SNP markers are developed aiming at genes controlling target traits, and the traits are associated with genotypes, so that efficient and accurate breeding is realized. At present, the means suitable for SNP detection mainly comprise gel electrophoresis and fluorescent quantitative PCR, but the detection process needs enzyme digestion, electrophoresis, sequencing and the like, the operation is complex, and aerosol and EB of PCR products are harmful to human bodies and pollute the environment. Competitive allele PCR (KASP) has been applied to molecular assisted breeding, target trait gene localization, seed purity and authenticity identification and the like, and has the advantages of low cost, high flux, safe experimental operation, accurate fluorescence signal acquisition data and the like.
When planting rice, the rice lodging is a very common problem, and the rice lodging seriously affects the rice production quality and restricts the improvement of yield: firstly, the plants are senescent and the yield is reduced. After the rice is laid down, the plants are mutually overlapped, and the light receiving area is reduced; meanwhile, due to poor ventilation and light transmission, the added field humidity is high, the lower leaves are withered and yellow and rot, and the area of the functional leaves is reduced. In addition, due to mechanical damage and hindered nutrient exchange of plants, premature senility of root systems and leaves is further enhanced, photosynthesis is affected, photosynthetic substances are reduced, and therefore insufficient grouting, thousand-grain weight reduction, blighted grain increase and seed setting rate reduction are caused. Second, the rice quality is reduced. Due to insufficient grouting, the proportion of heart-abdomen white of rice is large, and the broken rice rate is increased. When the rice ears are in a high-humidity environment for a long time, partial rice grains are mildewed and germinate, the glossiness of rice is poor, and the quality and the yield are reduced. However, in rice lodging-resistant breeding work, the traditional phenotype identification needs to be carried out after crop jointing or in the middle and later periods of crop growth; these factors greatly limit the breeding and genetic improvement progress of rice lodging resistance traits, and are time-consuming and labor-consuming. Therefore, the functional SNP molecular marker suitable for high-throughput identification of plant genotypes in the seedling stage is developed, and the molecular marker has wide application prospect and economic value in assisting large-scale commercial molecular breeding.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide the SNP functional molecular marker of the japonica rice lodging-resistant gene, and solve the problems of long time consumption and high labor input in the existing japonica rice lodging-resistant phenotype identification.
The invention also provides a primer group for detecting the SNP functional molecular marker and a KASP method, which solve the problems of unsafe experimental operation, complex operation, inaccurate artificial identification result and the like.
In order to achieve the purpose, the invention adopts the following technical scheme: the SNP functional molecular marker of the japonica rice lodging-resistant gene is SCM2, is K _06G _ SCM2-1, is positioned at the 27481645 th base of the 6 th chromosome of rice, belongs to the SCM2 promoter region of the gene, has the polymorphism of T/G, has the sequence shown as SEQ ID No.1, and has the base at the 57bp position of T or G.
A primer set for detecting the SNP functional molecular marker of claim 1, comprising specific primer sequences:
Specific-allele X：TAGCCATGCCAAAGCTAAA
Specific-allele Y：TAGCCATGCCAAAGCTAAC
the sequence of the universal primer is as follows:
Primer Common：GCTTTGCTTAGATTGCGATT。
further, the reagent or the kit containing the primer combination is used for detecting the lodging resistance of rice, the identification of japonica rice germplasm resources or the genetic improvement of japonica rice.
Further, the application of the primer group of the SNP functional molecular marker of the japonica rice lodging-resistant gene comprises the following steps:
1) genome extraction: extracting genome DNA from rice leaves by a simplified CTAB method, freeze-drying or drying the rice leaves, putting a proper amount of the rice leaves into a 2.0mL centrifuge tube, adding two steel balls, and grinding on a tissue grinder; then adding 750 mu L CTAB solution, shaking and homogenizing, and shaking and bathing for 0.5-1h at 65 ℃; cooling to room temperature, adding 750 μ L of mixed solution of chloroform and isoamyl alcohol in a fume hood, reversing for 3-4 times, and mixing uniformly, wherein the volume ratio of chloroform to isoamyl alcohol is 24: 1; centrifuging at 12000rmp for 10min, and transferring 500 μ L of the supernatant to a new 1.5mL centrifuge tube; adding isovolumetric isopropanol solution, shaking, precipitating at-20 deg.C for more than 1 hr, centrifuging at 12000rmp for 10min, and removing supernatant; adding 1mL of 70% ethanol, flicking for precipitation, centrifuging at 1000rmp for 3min, and removing the supernatant; adding 300 μ LH2O, dissolving for use;
2) KASP reaction: taking the rice genome DNA obtained in the step 1) as a template, and carrying out PCR reaction by using a fluorescence specific primer, wherein the forward primer of the fluorescence specific primer is that the 5' end of the specific primer is respectively connected with different fluorescence label sequences, and the reverse primer is the universal primer;
wherein the sequence of the fluorescent label is as follows:
FAM-tail：GAAGGTGACCAAGTTCATGCT
VIC-tail：GAAGGTCGGAGTCAACGGATT
the forward primer sequence is:
Primer X：GAAGGTGACCAAGTTCATGCTTAGCCATGCCAAAGCTAAA
Primer Y：GAAGGTCGGAGTCAACGGATTTAGCCATGCCAAAGCTAAC
3) fluorescence detection: if only the fluorescence signal corresponding to the fluorescence sequence connected with the primer Specific-allel X is detected, the rice to be detected does not contain the lodging-resistant gene SCM2, if only the fluorescence signal corresponding to the fluorescence sequence connected with the primer Specific-allel Y is detected, the rice to be detected is judged to contain the lodging-resistant gene SCM2, if two kinds of fluorescence are detected simultaneously, the rice sample is judged to be a heterozygous type carrying the SCM2 gene, and the rice sample which detects the fluorescence signal corresponding to the fluorescence sequence connected with the primer Specific-allel X is selected for breeding.
The SCM 2-carrying isogenic line had a stalk strength-enhanced, spike-number-increased phenotype with no abnormal phenotype compared to the overexpressed mutant APO1 of the gene. Experiments prove that the relative expression level of SCM2 genotype rice material genes is 2-3 times of that of SCM2 genotype; the relative expression quantity of the SCM2 overexpression mutant APO1 gene is tens of times that of SCM2, and the overexpression can cause the rice spike development deformity. When the SCM2 gene is at a medium expression level, the plant stem is thicker, the mechanical strength of the stem is higher, and the plant shows lodging resistance. Therefore, PCR parallel sequencing is carried out on the promoter region about 1.5Kb and the 3' -UTR region about 1.5Kb of the gene expression regulatory sequence, and the sequence analysis result shows that: the plurality of linked genetic loci can distinguish the tested resistant materials from the sensitive materials, show the characteristic of indica-japonica differentiation, and can also be used for the identification of indica-japonica rice germplasm resources.
The invention selects one SNP variation site from the plurality of SNP sites of linkage inheritance to develop a molecular marker, namely a molecular marker K _06G _ SCM2-1, which belongs to a gene SCM2 promoter region and is positioned at the 27481645 th base of the No. 6 chromosome of rice, the polymorphism of the SNP molecular marker is T/G, the sequence of the SNP molecular marker is shown as SEQ ID No.1, the base at the 57bp site is T or G, the 57bp sequences on the left side and the right side of the site are extracted, and the Primer design is carried out by using Batch Primer 3. The obtained Primer group for detecting the SNP functional molecular marker comprises Specific primers of Specific-allel X and Specific-allel Y and a universal Primer Common, wherein the Specific-allel X is a non-lodging-resistant genotype Specific Primer, and the Specific-allel Y is a lodging-resistant genotype Specific Primer.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention provides an SNP functional molecular marker for detecting a lodging-resistant gene SCM2 of japonica rice, wherein the SNP functional molecular marker is positioned in a gene (gene promoter region), the detection genotype is closely related to the phenotype, a complex and long-period phenotype identification process is not needed, and a large amount of manpower and material resources are saved; the method is suitable for high-throughput SCM2 gene identification and molecular-assisted selective breeding in early stages such as rice seedling stage and embryo stage, greatly reduces labor cost, shortens breeding cycle, and the like, and has wide application prospect in assisting large-scale commercial molecular breeding.
2. The marker developed by the invention is suitable for detecting SNP sites by a KASP method, compared with the conventional gel electrophoresis marker detection result, the marker and the method have the advantages of accurate and reliable detection result, safe experimental operation process, great reduction of labor input, capability of carrying out high-throughput operation, and accordance with the market demands of large-scale high-efficiency commercial molecular breeding, such as: foreground selection, germplasm resource identification and the like.
3. The invention proves that the SCM2 gene is generally deleted in indica rice, and the SCM2 is mainly suitable for lodging-resistant genetic improvement of japonica rice. Meanwhile, the marker can be used as a rice indica-japonica differentiation functional marker, is used in the directions of rice subspecies germplasm resource identification, genetic breeding and the like, further improves the production quality and yield of japonica rice in northern China, and has great economic value. The SNP functional molecular marker has wide application range and has important significance for promoting the application of SCM2 gene commercial molecular breeding.
Drawings
FIG. 1 is a diagram of genotyping of natural populations using the molecular marker K-06 g-SCM 2-1;
FIG. 2 is a graph of genotyping F2 isolate population using molecular marker K-06 g-SCM 2-1.
Detailed Description
The present invention will be described in further detail with reference to the following specific embodiments and the accompanying drawings. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. The materials, reagents and the like used are commercially available unless otherwise specified.
Example 1: natural genetic material phenotype verification of SNP marker K _06g _ SCM2-1
And selecting 23 parts of natural genetic material for verification, wherein the natural genetic material comprises 11 parts of relatively lodging-resistant material and 12 parts of lodging-sensitive material.
1. And extracting genome DNA from japonica rice leaves by a simplified CTAB method.
(1) Freeze-drying or oven-drying Japonica rice leaf, placing appropriate amount of leaf into 2.0mL centrifuge tube, adding two steel balls, and grinding on tissue grinder;
(2) adding 750 mu L CTAB solution, shaking and homogenizing, and shaking and bathing at 65 ℃ for 0.5-1 h;
(3) cooling to room temperature, adding 750 μ L chloroform-isoamyl alcohol (24: 1) in fume hood, reversing for 3-4 times, and mixing;
(4) centrifuging at 12000rmp for 10min, and transferring 500 μ L of the supernatant to a new 1.5mL centrifuge tube;
(5) adding isovolumetric isopropanol solution, shaking, precipitating at-20 deg.C for more than 1 hr, centrifuging at 12000rmp for 10min, and removing supernatant;
(6) adding 1mL of 70% ethanol, flicking for precipitation, centrifuging at 1000rmp for 3min, and removing the supernatant;
(7) adding 300 mu LH2And O, dissolving for later use.
2. KASP reaction test
The KASP reaction assay was performed on the LGC SNPline genotyping platform. Adding 1.0-1.5 μ L of the japonica rice genomic DNA sample (20ng/μ L) obtained in step 1 into a micropore reaction plate, drying, and adding KASP reaction mixed solution, wherein the reaction system is shown in Table 1; PCR amplification is completed in a water bath thermal cycler under the following conditions: 15min at 94 ℃; 94 ℃ for 20sec, 65-57 ℃ for 1min, and each cycle is reduced by 1 ℃ for 10 cycles; 26 cycles of 94 ℃ for 20sec and 57 ℃ for 1 min.
TABLE 1
After the reaction is finished, a scanner Pherastar is used for reading fluorescence data of the KASP reaction product, the Specific-allel X is connected with a fluorescence sequence FAM, and the Specific-allel Y is connected with a fluorescence sequence VIC. If only a fluorescence signal corresponding to the fluorescence sequence VIC is detected, determining that the test material is a lodging-resistant material when the base type of the test site marked with K _06G _ SCM2-1 is G; if only the fluorescence signal corresponding to the fluorescence sequence FAM is detected, the SCM2 gene of the test material is T in the test site base type of the marker K _06g _ SCM2-1, and the test material is judged to be a non-lodging resistant material; if two kinds of fluorescence are detected simultaneously, the test material is judged to be a heterozygous type carrying the genotype. The results of the fluorescence scan are automatically converted into a graph (fig. 1). The results of the 23 part test material marker typing are shown in Table 2.
The LGC SNpline genotyping platform used in the invention and the consumable materials of the reagents matched with the platform are purchased from LGC company in the United kingdom.
Table 2: test results of 23 natural genetic material markers K _06g _ SCM2-1
Note: "R" indicates that the plant phenotype is lodging resistance; "S" indicates that the plant phenotype is susceptible to lodging.
As can be seen from Table 2, the 23 parts tested contained 11 parts of the lodging-resistant and 12 parts of the lodging-sensitive material. Wherein the SCM2 gene of the lodging sensitive material has a base type of T at a test site marked by K _06g _ SCM2-1, and both belong to japonica subspecies of rice; the SCM2 gene of the resistant material has a G base type at a test site marked by K _06G _ SCM2-1, and belongs to indica subspecies of rice. Further, we amplified the natural genetic population for testing and also reached the same conclusion (data not shown). The SCM2 gene is proved to be widely existed in indica rice and is not discovered in japonica rice, which indicates that the SCM2 gene can only be used for the lodging-resistant character genetic improvement of japonica rice. Preliminarily determining that the SNP marker of the gene SCM2 has high correlation with phenotype, and judging that the gene is suitable for japonica rice lodging-resistant trait genetic improvement; meanwhile, the marker can be used as an important molecular marker for rice indica-japonica subspecies differentiation.
Example 2 phenotypic validation of F2 isolate population of SNP marker K-06 g-SCM 2-1
Detecting the genotype of F2 segregation population individuals hybridized by the donor parent Habataki and the acceptor parent Sasanishiki;
1. the method of genotyping was the same as in example 1. The results of genotyping 80F 2 isolates of the population individuals are shown in FIG. 2.
2. Selecting two homozygous genotype single plants for phenotype identification, removing leaves at the top ends of the plants from the booting stage of the rice to the period of heading, measuring the mechanical strength and the diameter of plant stalks, and comprehensively evaluating the lodging resistance of the plants.
Genotype and phenotype data for homozygous individuals are presented in table 3.
TABLE 3 phenotypic identification of F2 isolate population labeled K _06g _ SCM2-1
Note: "R" indicates that the plant phenotype is lodging resistance; "S" indicates that the plant phenotype is susceptible to lodging.
As can be seen from Table 3, the phenotype identification result of the F2 segregation population genotype homozygous single plant highly corresponds to the genotype typing result, the G base type single plant has strong lodging resistance, the T base type single plant is susceptible to lodging, and the feasibility and the accuracy of the invention are verified again.
Finally, the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered in the claims of the present invention.
SEQUENCE LISTING
<110> Changjiang university academy;
<120> SNP functional molecular marker of japonica rice lodging-resistant gene and application
<160>12
<170>PatentIn version 3.5
<210>1
<211>112
<212>DNA
<213> Artificial sequence
<220>
<223>K_06g_SCM2-1
<400>1
gctttgctta gattgcgatt ctcaaattta atcatgaatt ctcatatatg cataccttta 60
gctttggcat ggctagcctc acatgaatta atcccttggc atctcgagta ca 112
<210>2
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>Specific-allele X
<400>2
tagccatgcc aaagctaaa 19
<210>3
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>Specific-allele Y
<400>3
tagccatgcc aaagctaac 19
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223>Primer Common
<400>4
gctttgctta gattgcgatt 20
<210>5
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223>FAM-tail
<400>5
gaaggtgacc aagttcatgc t 21
<210>6
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223>VIC-tail
<400>6
gaaggtcgga gtcaacggat t 21
<210>7
<211>40
<212>DNA
<213> Artificial sequence
<220>
<223>Primer X
<400>7
gaaggtgacc aagttcatgc ttagccatgc caaagctaaa 40
<210>8
<211>40
<212>DNA
<213> Artificial sequence
<220>
<223>Primer Y
<400>8
gaaggtcgga gtcaacggat ttagccatgc caaagctaac 40
<210>9
<211>1564
<212>DNA
<213>Oryza.sativa L.
<220>
<223> SCM2 promoter
<400>9
tgtactggat atactaggga tttagtgttc ttttgaaaca caaatgttga aaaaacttag 60
ggatatgcat tgagcttctg aaaggaaatc aaaaccatga ggtttgagct tatgtttgaa 120
atccttcaaa aagtggagga aagaaaggat tcctatgaaa attttcttga aaggaatcct 180
atgaaaattt tctaaccaaa tcattcaaac catatgtctc cctagctagg aaaattttca 240
atagtatttc aatcctacaa ctttccttta aaaacccttt gtttcaaaag agcctttaat 300
ggaggggagg ggggggcaga gagaagatgc gttggcctca ccaaacacag gatcataaaa 360
acgcatgaat gatcataaaa acacagaaat aaaaaaaaaa tacaggtttg gagtacccct 420
accacttcaa atcctatgca ggaaaactgc atgaatccgt ttagatggag cgcaggaaac 480
acacaggaat cagttcataa gagtgaaaga cacaaatgat atttttccaa taggttgtac 540
ctcatgtcaa aattcctata ctttgaacca atccaaggaa tttggtagga ttttcggatg 600
gaaatttcct ttgattcata ggaccatgta taaaaatttt ccttaggatt gagttccttc 660
aaatttctta caaacctgtc ccaaaggagc actaaaataa gatttgagct catatatagt 720
aaaaaaaatt tccaatggaa gtgatgcata ggataacagt ccatagaaaa ttgtcatgtt 780
catatccttt gttccaaaac acactagata tatataggaa aaaatccttc aaaattcctt 840
tgtgggctcc tttggaacat tgtccaacac tttcaaagga attttaaaga aaaatccgaa 900
gatatttttt gaggaaatga tgaacactgt ccaacaaatt gtttaaaatc aaccactgcc 960
gtgtgcaaaa aataaaaata aaaataaaaa taaaaatgca tagaataaca gatcagagct 1020
gagacaaacc aaaaccggcg ttgcgctacc cagacaacaa caacaacatg tcaacaactg 1080
ctactctact ccatatccaa tcctttcccc tctcaaattt aattacgcaa gaacacacag 1140
tccatcgata tccatcatcc atttatataa ctgttgcttt gcttagattg cgattctcaa 1200
atttaatcat gaattctcat atatgcataccgttagcttt ggcatggcta gcctcacatg 1260
aattaatccc ttggcatctc gagtacaagc tagtaccaca gtttcactat catttgctcg 1320
cagctgccac ttcacagctg cctcactcca ctccacttca cccttgaaaa ttttcagctc 1380
acgcagctgc agctgacgac gccgcgcgcc gacgacgacg accatgatga accctcgccg 1440
gctgccgcct ctgccgtcgt cgacgtcgtc cgcctcggca gcggacgaca tggacccgcg 1500
cgtgtggcgc cggctgccgc agccgctggt ggaccgcgtc ctggcgtgcc tcccgacgcc 1560
gtcg 1564
<210>10
<211>1557
<212>DNA
<213>Oryza.sativa L.
<220>
<223> scm2 promoter
<400>10
tgtactggat atactaggga tttagtgttc ttttgaaaca caaatgttga aaaaacttag 60
ggatatgcat tgagcttctg aaaggaaatc aaaaccatga ggtttgagct tatgtttgaa 120
atccttcaaa aagtggagga aagaaaggat tcctatgaaa attttcttga aaggaatcct 180
atgaaaattt tctaaccaaa tcattcaaac catatgtctc cctagctagg aaaattttca 240
atagtatttc aatcctacaa ctttccttta aaaacccttt gtttcaaaag agcctttaat 300
ggaggggagg gggggggggg cagagagaag atgcgttggc ctcaccaaac acaggatcat 360
aaaaacgcat gaatgatcat aaaaacacag aaatagaaaa aaaaatacag gtttggagta 420
cccctaccac ttcaaatcct atgcaggaaa actgcatgaa tccgtttaga tggagcgcag 480
gaaacacaca ggaatcagtt cataagagtgaaagacacaa atgatatttt tccaataggt 540
tgtacctcat gtcaaaattc ctatactttg aaccaatcca aggaatttgg taggattttc 600
ggatggaaat ttcctttgat tcataggacc atgtataaaa attttcctta ggattgagtt 660
ccttcaaatt tcttacaaac ctgtcccaaa ggagcactaa aataagattt gagctcatat 720
atagtaaaaa aaatttccaa tggaagtgat gcatatgata acagtccata gaaaattgtc 780
atgttcatat cctttgttcc aaaacacact agatatatat aggaaaaaat ccttcaaaat 840
tcctttgtgg gctcctttgg aacaatgtcc aacactttca aaggaatttt aaagaaaaat 900
ccgaagatat tttttgagga aatgatgaac actgtccaac aaattgttta aaatcaacca 960
ctgccgtgtg caaaaaataa aaataaaaat gcatagaata acagatcaga gctgagacaa 1020
accaaaaccg gcgttgcgct acccagacaa caacaacaac atgtcaacaa ctgctactct 1080
actccatatc caatcctttc ccctctcaaa tttaattacg caagaacaca cagtccatcg 1140
atatccatca tccatttata taactgttgc tttgcttaga ttgcgattct caaatttaat 1200
catgaattct catatatgca tacctttagc tttggcatgg ctagcctcac atgaattaat 1260
cccttggcat ctcgagtaca agctagtacc acagtttcac tatcatttga tcgcagctgc 1320
cgcttcacag ctgcctcact ccactccact tcacccttga aaattttcag ctcacgcagc 1380
tgcagctgac gacgccgcgc gccgacgacg acgaccatga tgaaccctcg ccggctgccg 1440
cctctgccgt cgtcgacgtc gtccgcctcg gcagcggacg acatggaccc gcgcgtgtgg 1500
cgccggctgc cgcagccgct ggtggaccgc atcctggcgt gcctcccgac gccgtcg 1557
<210>11
<211>1406
<212>DNA
<213>Oryza.sativa L.
<220>
<223> 3' -UTR of SCM2
<400>11
tgtgcttttt tgtgcatgct gcctgcatca actaatcaat ttgttatggc ctagggcatg 60
catacacatg ttcatgagca agctaggttt gtggtgtatt aaagttgttt cagcaatggg 120
gatcatatgt taatttctta tgagcaatta agtgtgttat atgataggtt aggtatgaga 180
attagcatga ttctagctag tagtatgtgc aagttagtag tatgtactag gtagcttaat 240
taattaatta ggttgtattt gtcatctgag ttggtagtgt gctagattga cagtggtctg 300
aactctgaag tggtttcatc tctgttaatt cagaaaacac taataattca gaaaacctac 360
tgaagggttt ctactcaaca actactacta ctttgatctt gccatgagat ctgttgaaga 420
atattcatgc atgtgatttt ctgaagagtg ttgatttaga tggtttatca tgatcacatg 480
aagcctacaa cagtatgtga tcatttgagt atgatcttct ggccagcatg actttgtctg 540
ttgaatccac ctcagatcgg tatatagttt ctcagtttgg atatgcattt ctttcatata 600
tttgcttaat attcacacat acttatgtgt gtggttgcat ctttcttgtg agtgaaatta 660
gtacgacctc tattaaataa agctagatac tctgaaaaag taagatgccc aaacttagtt 720
tatgtagcgc ccttggtcga tcaaatttta tggccaatct tttttttttc ttttgcaagc 780
ttactctagc tagaattgta ctcctaacat agacattgta tatatgtaaa catagttttc 840
ccgatcgatc gagttgttga ttcagtatat catgcatctc tggggaagca gtaacaagca 900
ccagagatat ggtggttcag atctttagcc acccccaacc aggttctaat cacatccatt 960
taattttaaa aatcatgtgt aagtaatata ctgctagtat atatagtatg ttctaaagat 1020
ctcaatagga ttgtagaaat cccaaaggaa ctaaactgca aaacatgcta cgaactgatt 1080
attacagtca tttggaacac actacgaagt gatcatgcat gcatgcatga aactgatgaa 1140
agtaacttgt gtatatttca gcagactctg aataaaagag catatgtgtt tcagaaccat 1200
gaaattgtac gtcttctgtt tttctgttgc aaagtatgac ttcactagct tgtagagtat 1260
actccatcgc actaactatc aaattgcatt ttgacatata accatccagt agcaaatatc 1320
tactgtacta tatatcttca gatactggac gcactagtga ataaattttc ggagaatata 1380
tctaacatac gtaccatctg gtccta 1406
<210>12
<211>1406
<212>DNA
<213>Oryza.sativa L.
<220>
<223> 3' -UTR of scm2
<400>12
tgtgcttttt tgtgcatgct gcctgcatca actaatcaat ttgttatggc ctagggcatg 60
catacacatg ttcatgagca agctaggttt gtggtgtatt aaagttgttt cagcaatggg 120
gatcatatgt taatttctta tgagcaatta agtgtgttat atgataggtt aggtatgaga 180
attagcatga ttctagctag tagtatgtgc aagttagtag tatgtactag gtagcttaat 240
taattaatta ggttgtattt gtcatctgag ttggtagtgt gctagattga cagtggtctg 300
aactctgaag tggtttcatc tctgttaatt cagaaaacac taataattca gaaaacctac 360
tgaagggttt ctactcaaca actactacta ctttgatctt gccatgagat ctgttgaaga 420
atattcatgc atgtgatttt ctgaagagtg ttgatttaga tggtttatca tgatcacatg 480
aagcctacaa cagtatgtga tcatttgagt atgatcttct ggccagcatg actttgtctg 540
ttgaatccac ctcagatcgg tatatagttt ctcagtttgg atatgcattt cttccatata 600
tttgcttaat attcacacat acttatgtgt gtagttgcat ctttcttgtg agtgaaatta 660
gtacgacctc tattaaataa agctagatac tctgaaaaag taagatgccc aaacttagtt 720
tatgtagcgc ccttggtcga tcaaatttta tggccaatct tttttttttc ttttgcaagc 780
ttactctagc tagaattgta ctcctaacat agacattgta tatatgtaaa catagttttc 840
ccgatcgatc gagttgttga ttcagtatat catgcatctc tggggaagca gtaacaagca 900
ccagagatat ggtggttcag atctttagcc acccccaacc aggttctaat cacatccatt 960
taattttaaa aatcatgtgt aagtaatata ctgctagtat atatagtatg ttctaaagat 1020
ctcaatagga ttgtagaaat cccaaaggaa ctaaactgca aaacatgcta cgcactgatt 1080
attacagtca tttggaacac actacgaagt gatcatgcat gcatgcatga aactgatgaa 1140
agtaacttgt gtatatttca gcagactctg aataaaagag catatgtgtt tcagaaccat 1200
gaaattgtac gtcttctgtt tttctgttgc aaagtatgac ttcactagct tgtagagtat 1260
actccatcgc actaactatc aaattgcatt ttgacatata accatccagt agcaaatatc 1320
ttctgtacta tatatcttca gatactggac gcactagtga ataaattttc ggagaatata 1380
tctaacatac gtaccatctg gtccta 1406
Claims (4)
1. A primer group for detecting SNP functional molecular markers of japonica rice lodging-resistant genes is characterized by comprising
The sequence of the specific primer is as follows:
Specific-allele X：TAGCCATGCCAAAGCTAAA；
Specific-allele Y：TAGCCATGCCAAAGCTAAC；
the sequence of the universal primer is as follows:
Primer Common：GCTTTGCTTAGATTGCGATT；
the lodging-resistant gene is SCM2, the SNP functional molecular marker is K _06G _ SCM2-1, is positioned at the 27481645 th basic group of the No. 6 chromosome of rice and belongs to the SCM2 promoter region of a gene, the SNP molecular marker polymorphism is T/G, the sequence of the SNP molecular marker is shown as SEQ ID No.1, and the basic group at the 57bp site is T or G.
2. A reagent or kit comprising the primer set of claim 1.
3. The use of the primer set for SNP functional molecular markers of japonica rice lodging-resistant genes as set forth in claim 1,
the method comprises the following steps:
1) genome extraction: extracting genome DNA from rice leaves by a simplified CTAB method, freeze-drying or drying the rice leaves, putting a proper amount of the rice leaves into a 2.0mL centrifuge tube, adding two steel balls, and grinding on a tissue grinder; then adding 750 mu L CTAB solution, oscillating and homogenizing, and oscillating and bathing for 0.5-1h at 65 ℃; cooling to room temperature, adding a mixed solution of chloroform and isoamylol with the volume ratio of 750 mu L into a fume hood, reversing for 3-4 times, and uniformly mixing, wherein the volume ratio of the chloroform to the isoamylol is 24: 1; centrifuging for 10min at 12000rmp, and transferring 500 mu L of supernatant into a new 1.5mL centrifuge tube; adding isovolumetric isopropanol solution, shaking, precipitating at-20 deg.C for more than 1 hr, centrifuging at 12000rmp for 10min, and removing supernatant; adding 1mL of 70% ethanol, flicking for precipitation, centrifuging at 1000rmp for 3min, and removing the supernatant; add 300 mu L H2Dissolving O for later use;
2) KASP reaction: taking the rice genome DNA obtained in the step 1) as a template, and carrying out PCR reaction by using a fluorescent specific primer, wherein the forward primer of the fluorescent specific primer is obtained by connecting the specific primer in the claim 1 with different fluorescent label sequences at the 5' end of the specific primer, and the reverse primer is the universal primer in the claim 1;
3) fluorescence detection: if only the fluorescent signal corresponding to the fluorescent sequence connected with the primer Specific-allele X is detected, and the genotype is T, the rice to be detected does not contain the lodging-resistant gene SCM 2; if only the fluorescent signal corresponding to the fluorescent sequence connected with the primer Specific-allele Y is detected and the genotype is G, determining that the rice to be detected contains the lodging-resistant gene SCM 2; if two kinds of fluorescence are detected simultaneously, the rice sample is judged to be a heterozygous type carrying the SCM2 gene, and the rice sample which detects the fluorescence signal corresponding to the fluorescence sequence connected with the primer Specific-allele X is selected for breeding.
4. The application of the primer group of the SNP functional molecular marker of the japonica rice lodging-resistant gene according to claim 3,
the sequence of the fluorescent label is as follows:
FAM-tail: GAAGGTGACCAAGTTCATGCT；
VIC-tail: GAAGGTCGGAGTCAACGGATT；
the sequence of the forward primer is as follows:
Primer X： GAAGGTGACCAAGTTCATGCTTAGCCATGCCAAAGCTAAA；
Primer Y： GAAGGTCGGAGTCAACGGATTTAGCCATGCCAAAGCTAAC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710640684.5A CN107227373B (en) | 2017-07-31 | 2017-07-31 | SNP functional molecular marker of japonica rice lodging-resistant gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710640684.5A CN107227373B (en) | 2017-07-31 | 2017-07-31 | SNP functional molecular marker of japonica rice lodging-resistant gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107227373A CN107227373A (en) | 2017-10-03 |
| CN107227373B true CN107227373B (en) | 2020-07-07 |
Family
ID=59957800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710640684.5A Expired - Fee Related CN107227373B (en) | 2017-07-31 | 2017-07-31 | SNP functional molecular marker of japonica rice lodging-resistant gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107227373B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101431478B (en) * | 2008-12-17 | 2011-05-11 | 清华大学 | P2P operator level router and home gateway combined IPv4/IPv6 grouping conversion method |
| CN108048458B (en) * | 2018-01-22 | 2020-11-13 | 华智生物技术有限公司 | SNP marker of rice lodging-resistant gene and application thereof |
| CN108060161A (en) * | 2018-01-26 | 2018-05-22 | 周口师范学院 | A kind of extracting method of simple and quick plant genome DNA |
| CN109694920A (en) * | 2019-02-13 | 2019-04-30 | 上海市农业科学院 | It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene |
| CN109777885B (en) * | 2019-03-31 | 2022-09-27 | 浙江师范大学 | Rice hard-stalk high-yield gene molecular marker and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098210A2 (en) * | 2001-06-05 | 2002-12-12 | The Curators Of The University Of Missouri | Chromosome doubling method |
| CN104087575A (en) * | 2014-04-18 | 2014-10-08 | 黑龙江省农业科学院耕作栽培研究所 | Molecular marker of paddy-rice stalk-strengthening lodging-resistant gene prl4 and application of molecular marker |
| CN106086180A (en) * | 2016-06-17 | 2016-11-09 | 湖南农业大学 | A kind of molecule labelling method of lodging resistance in rice main effect QTL qSR5.1 |
-
2017
- 2017-07-31 CN CN201710640684.5A patent/CN107227373B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098210A2 (en) * | 2001-06-05 | 2002-12-12 | The Curators Of The University Of Missouri | Chromosome doubling method |
| CN104087575A (en) * | 2014-04-18 | 2014-10-08 | 黑龙江省农业科学院耕作栽培研究所 | Molecular marker of paddy-rice stalk-strengthening lodging-resistant gene prl4 and application of molecular marker |
| CN106086180A (en) * | 2016-06-17 | 2016-11-09 | 湖南农业大学 | A kind of molecule labelling method of lodging resistance in rice main effect QTL qSR5.1 |
Non-Patent Citations (4)
| Title |
|---|
| Development and application of KASP marker for high throughput detection of AhFAD2 mutation in peanut;Shuzhen Zhao等;《Electronic Journal of Biotechnology》;20161116;第25卷;第10页左栏第2段、右栏表1，第11页图1，第2.2-2.3节 * |
| New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield;Taiichiro Ookawa等;《Nat Commun.》;20101030;第1卷(第132期);摘要，参考文献23，第2页左栏倒数第1-2段,第4页左栏最后1段至右栏倒数第2段,第10页左栏第3段 * |
| Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate;Kyoko Ikeda等;《The Plant Journal》;20070807;第51卷;1030–1040 * |
| Taiichiro Ookawa等.New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield.《Nat Commun.》.2010,第1卷(第132期),摘要，参考文献23，第2页左栏倒数第1-2段,第4页左栏最后1段至右栏倒数第2段,第10页左栏第3段. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107227373A (en) | 2017-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107227373B (en) | SNP functional molecular marker of japonica rice lodging-resistant gene and application | |
| CN108411028B (en) | Specific SNP codominant molecular marker primer in rice salt-tolerant gene SKC1 gene and application | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN109593881A (en) | Detect rice low amylose content gene WxmqKASP molecular labeling and method | |
| CN112195265B (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of pepper hybrid and application | |
| EP2786146A1 (en) | High throughput single nucleotide polymorphism assay | |
| CN114717355A (en) | Watermelon whole genome SNP-Panel | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
| CN114517241A (en) | Functional KASP molecular marker of wheat dwarf gene Rht8 and application thereof | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN110373491B (en) | KASP molecular marker for detecting rice blast-resistant broad-spectrum gene Pi1 and application | |
| CN111926102A (en) | Molecular marker of rice photo-thermo-sensitive male sterility gene pms3 and application thereof | |
| CN108707685B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN115011717A (en) | Development and detection method and breeding application of watermelon whole-genome SNP-Panel | |
| CN111500761B (en) | Molecular marker linked with pepper leaf color yellowing gene and application thereof | |
| CN106636386B (en) | Molecular marker DNdCAPS8.03-1 linked with maize head smut resistant minor major site and application thereof | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN116397040B (en) | Single copy papaya gene and method for detecting copy number of exogenous gene in transgenic papaya by using same | |
| CN116970734B (en) | SNP locus linked with cotton multi-ventricular control gene GaMV and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200707 Termination date: 20210731 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |