CN109694920A - It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene - Google Patents
It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene Download PDFInfo
- Publication number
- CN109694920A CN109694920A CN201910112433.9A CN201910112433A CN109694920A CN 109694920 A CN109694920 A CN 109694920A CN 201910112433 A CN201910112433 A CN 201910112433A CN 109694920 A CN109694920 A CN 109694920A
- Authority
- CN
- China
- Prior art keywords
- primer
- rice
- sbe3
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene, it includes primer 1, primer 2 and primer 3, it include sequential label A in the primer 1, it include sequential label B in primer 2, the specific nucleotide sequence of the primer 1 is as shown in SEQ ID NO.1, the specific nucleotide sequence of primer 2 is as shown in SEQ ID NO.2, the specific nucleotide sequence of primer 3 is as shown in SEQ ID NO.3, utilize the genotype of KASP labeled primer detection resistant starch, with high throughput, the characteristics of low cost and high accuracy, as a result accurate and reliable, it is convenient and efficient, it is at low cost, it will play a significant role in rice high-resistance starch breeding.
Description
Technical field
The invention belongs to agriculture field of molecular biotechnology, and in particular to a kind of for detecting rice sbe3-rs gene
KASP labeled primer.
Background technique
Diabetes have become the third-largest chronic disease for seriously threatening human health after tumour and cardiovascular pathological changes.
One article of September in 2013 " American Journal of Medicine " on the 4th publication was shown, according to Chinese epidemiological survey number in 2010
According to display, the illness rate of diabetes mellitus in China was turned over nearly twice at nearly 10 years, and diabetes mellitus in China incidence up to 11.6%, reaches alert
Rank is guarded against, world average level 6.4% is significantly higher than.Diabetes mellitus in China people at highest risk is also expanding, and about 1.5 hundred million, there is number every year
Patient in terms of ten thousand dies of diabetes and its complication.The diabetes status of China is very severe, and China has become entirely
The fastest-rising area of ball range diabetes, and age of onset more tends to rejuvenation.Future 50 years, diabetes will be China one
A public health problem the most serious.
For rice (Oryza sativa L.) as one of Three major grain crops, Starch content of rice highest is that the mankind are most heavy
One of the carbohydrate wanted and energy source improve the nutritional ingredient in rice, advantageously reduce human body to carbohydrate
Absorption, so as to reduce the disease incidence of " ciril disease ".
Improve resistant starch (Resistant Starch, RS) content in rice be a kind of largely effective feasible method it
One.Resistant starch refers to " unabsorbable starch or starch decomposition products in the small intestine of healthy individuals ", and (European resistance is formed sediment
Powder association EURESTA definition).RS occupies highly important status in adjusting diet structure, by screening and identifying that high RS contains
The rice genetic resource of amount, improves rice varieties, and the dietary structure of Lai Gaishan people is to treat and prevent the ciril diseases such as diabetes
One of the most economical effective means of disease hair.
Chinese patent CN102816778A located the major gene resistance sbe3-rs of control rice RS content, the mutated gene
With the base mutation of T → C at the 105th corresponding to the 16th exon of rice fecula branching enzyme SBE3 gene, and
A CAPS functional label molecular labeling is developed for the site.
When carrying out genotype detection using CAPS molecular labeling, restriction enzyme SpeI is used after being related to first PCR reaction
Digestion step, uses that there are complex steps, the series of malpractice such as somewhat expensive, and can only at most detect 96 samples every time
Product have limitation for great amount of samples detection.
Chinese invention patent CN104561315A discloses four primer ARMS-PCR molecule labelling methods, using four primers one
The method of step PCR amplification identifies sbe3-rs different genotype, can effectively distinguish the homozygosis and heterozygous genes of sbe3-rs
Type is not related to the use of restriction enzyme, and compared with CAPS molecular labeling, four primer ARMS-PCR molecule labelling methods are more
Efficiently, fast.But ARMS-PCR molecular labeling efficiency when amplification group is larger is relatively low, amplification less stable.
Summary of the invention
The purpose of the present invention is to provide a kind of for detecting the KASP labeled primer of rice sbe3-rs gene, and detection is anti-
Property starch sbe3-sr gene genotype, have the characteristics that high-throughput, low cost and high accuracy, it is as a result accurately and reliably, convenient
Fast, at low cost, it will play a significant role in rice high-resistance starch breeding.
In order to achieve the above object, the present invention provides the following technical solutions；
It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene comprising primer 1, primer 2 and primer 3, institute
The specific nucleotide sequence of primer 1 is stated as shown in SEQ ID NO.1, the specific nucleotide sequence of primer 2 such as SEQ ID NO.2 institute
Show, the specific nucleotide sequence of primer 3 is as shown in SEQ ID NO.3.
Further, there is the base mutation of T → C at the 105th of the 16th exon of sbe3-rs gene.
Also, 5 ' ends of the primer 1 are connect with fluorescence labels sequence A, 5 ' ends of primer 2 are connect with fluorescence labels sequence B.
Also, the extension increasing sequence of the primer 3 is 60-100bp.
KASP labeled primer of the present invention is for detecting rice resistant starch or the sbe3-rs gene of its filial generation
Type.
Further, in the KASP labeled primer, the fluorescence labels sequence A is FAM fluorescence labels sequence, fluorescence labels
Sequence B is HEX fluorescence labels sequence.
KASP is the abbreviation of competitive ApoE gene (Kompetitive Allele Specific PCR),
It can be in extensive genome DNA sample (DNA samples of even some complex genomes), on SNPs and specific site
InDels carries out accurately diallele and judges.Such label has the characteristics that high-throughput, low cost and high accuracy, is dividing
Play a significant role in sub- marker-assisted breeding application.
In the present invention, according to the SNP mutation informative site information of high-resistance starch genotype sbe3-rs gene, design is special
The complete KASP primer having is made of two upstream primers (primer 1, primer 2) and a downstream primer (primer 3), on two
Trip primer 5 ' end is connected with fluorescence labels sequence, 3 ' end allelic variation base T/C of two upstream primers, for distinguishing equipotential
Gene, 1 and 3 amplifications read wild type, and 2 and 3 amplifications read saltant type, have and can expand with 3 if it is heterozygous, 1,2,
The sequence of downstream primer guarantees amplification in 60-100bp.
Compared with prior art, the beneficial effects of the present invention are:
Using KASP labeled primer of the invention, the sbe3-rs genotype of rice high-resistance starch is detected, can be used
In 96 orifice plates, 384 orifice plates, 1536 orifice plates high-throughput PCR, substantially increase detection efficiency, reduce time and cost of labor, it is non-
The Genotyping selection for being often conducive to high-resistance starch field breeding material high throughput, improves breeding efficiency.
KASP labeled primer of the invention can quick, efficient, high throughput identification rice carrying resistant starch gene strain
It is genotype, simple and feasible screening process is not related to the use of restriction enzyme, and amplification efficiency is high, as a result accurately and reliably, side
Just quick, it is at low cost, it will play a significant role in rice high-resistance starch breeding.
Detailed description of the invention
Fig. 1 is the parting dendrogram that KASP of the invention is marked.
Fig. 2 is to mark parting sample results to verify KASP using mature CAPS molecular labeling in the embodiment of the present invention,
Wherein, 1-96: detection sample, M: molecular labeling DL2000.
Specific embodiment
Below in conjunction with specific embodiment, the invention will be further described.
The acquisition of the KASP labeled primer sequence of embodiment 1sbe3-rs gene
According to SNP mutation informative site information, Primer Analysis comparison is carried out using the Primer-BLAST in the website NCBI,
Distinctive complete KASP molecular labeling primer is obtained, by primer 1, primer 2 and primer 3 are formed, two upstream primer (primers 1
And primer 2) 3 ' end allelic variation base T/C, for the amplified production sequence of downstream primer 3 in 60-100bp, specificity is good.
The end of upstream primer 5 ' is connected with fluorescence labels sequence, wherein 5 ' end connection FAM fluorescence labels sequences of primer 1: 5 '-
GAAGGTGACCAAGTTCATGCT-3 ', the 5 ' of primer 2, which are held, is connected as HEX fluorescence labels sequence: 5 '-
GAAGGTCGGAGTCAACGG-3’。
The present invention is based on the dedicated sequences of the KASP of high-resistance starch genotype sbe3-RS Data mining label comprising
Primer 1, primer 2 and primer 3 include FAM fluorescence labels sequence in the primer 1, include HEX fluorescence labels sequence in primer 2,
The specific nucleotide sequence of the primer 1 is as shown in SEQ ID NO.1, the specific nucleotide sequence of primer 2 such as SEQ ID NO.2
Shown, the specific nucleotide sequence of primer 3 is as shown in SEQ ID NO.3.
Above-mentioned primer sequence is synthesized by upper sea cowry crystalline substance Bioisystech Co., Ltd.
Embodiment 2 detects sbe3-rs gene using KASP molecular labeling primer
With high-resistance starch material hypoglycemic rice No. 1 for donor parents, and different conventional rice mixing breed, after hybridization
96 samples of random selection are as sample populations in generation.
Using CTAB method extract leaf sample DNA, rice miniprep dna extraction method, Primary Reference McCouch's etc. (1988)
Report, method are summarized as follows:
1) one small pieces blade 4-5cm of clip, 700 1.5 × CTAB of μ L of addition (contain 1.5%CTAB, 75mM Tris-HCl,
15mM EDTA, 1.05M NaCl), it is fully ground；
2) homogenate is transferred to the centrifuge tube of 1.5ml, is cooled to room temperature after 56 DEG C of water-bath 20min；
3) isometric chloroform is added: isoamyl alcohol (24:1) shakes up；
4) maximum speed (13200rpm) is centrifuged 10min；
5) supernatant is transferred to new centrifuge tube, and is added 100% alcohol of the pre-cooling of two volumes, after static 20min
DNA is collected by centrifugation；
6) supernatant is removed, DNA is air-dried, adds 50-100 μ L distilled water to dissolve, is detected in ultraviolet specrophotometer.
Dilution DNA prepares a set of DNA working solution, and concentration is 50-100ng/ μ L or so, and 4 DEG C of refrigerators save backup,
Genotyping is carried out to above-mentioned sample DNA using the KASP labeled primer designed in embodiment 1, specific steps are as follows:
A) sample is transferred in 384 orifice plates from 96 orifice plates by Replikator, then is finally transferred to 1536 orifice plates
In, it is ensured that sample DNA final concentration is about 10ng/ μ l.
B) orifice plate equipped with DNA sample is placed in 65 DEG C of baking ovens dry 30min.
C) DNA after drying carries out PCR system building, 1 μ l system of each reaction: 2 × KASP master mix, 0.5 μ
L, 72 × Assay mix 0.014 μ l, H2O 0.486 μ l, PCR divide reaction solution to prepare packing to the DNA sample hole of drying
In plate.
D) orifice plate for having added reaction system is subjected to sealer, and vulgar rapid centrifugation.
E) PCR reaction: 94 DEG C of 15min of first step initial denaturation is carried out after being centrifuged；Second step denaturation, renaturation, extension, 94 DEG C
20s, from 61 DEG C -66 DEG C (each circulation decline 0.6 DEG C) 60s, totally 10 circulations；Third step denaturation, renaturation, extension, 94 DEG C
20s, 55 DEG C of 60s, totally 26 recycle；4th step carries out read plate after reaction on microplate reader Pherastar.
Scan data is analyzed using SNPviewer2 software, determines the sbe3- of rice sample based on the analysis results
Rs genotype, if the fluorescence asterisk data of the product to be measured that everybody expands are parsed into existing red, rice through SNPviewer2
Genotype is CC in sbe3-rs；If the fluorescent signal data of the product of rice amplification to be measured is parsed into existing indigo plant through SNPviewer2
Color, then rice sample sbe3-rs genotype to be measured is TT；If the fluorescent signal data warp of the product of rice amplification to be measured
SNPviewer2 is parsed into existing green, then rice sample sbe3-rs genotype to be measured is the CT of heterozygosis.If rice amplification to be measured
The fluorescent signal data of product is parsed into existing pink colour through SNPviewer2, is null result (Fig. 1), genotype summarized results are shown in Table
1。
Table 1:KASP molecular labeling genotyping result
Note: "/" expression does not amplify respective strap.
Seen from table 1, in addition to 2 samples, remaining sample obtains corresponding genotype results.
Embodiment 3 verifies KASP Markers for Detection result using CAPS molecular labeling.
PCR-SpeI can be marked with the resistant starch CPAS of precise Identification sbe3-rs genotype using developed, it is right
KASP label parting group is verified, the specific method of PCR-SpeI Markers for Detection resistant starch sbe3-rs genotype
It is specific as follows with reference to having authorized patent of invention ZL 201210266649.9:
PCR amplification primer:
PCR-SpeI F:ATGTGATGTGCTGGATTTGG
PCR-SpeI R:TGTGGTTTTCATACCGTTCTTA
Method:
With the primer pair amplifies F of above-mentioned PCR-SpeI2The DNA of population sample.
In reaction system include 2 μ 10 × PCR of l buffer (100mM Tris-HCl pH 8.0,15mM MgCl2,
500mM KCl, 1%TritonX-100), 0.2mM dNTPs, 0.2 μM of upstream and downstream primer, 50-100ng sample DNA and
0.625U Taq enzyme.
Response procedures are as follows: 94 DEG C of initial denaturation 5min, circulation (94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1min) 35 times, last 72 DEG C
Extend 10min.
PCR product is through SpeI (TaKaRa) digestion, 20 μ l of endonuclease reaction system, comprising: 17.5 μ l PCR products, 2 μ l 10
× M buffer, 0.5 μ l SpeI.37 DEG C digestion 2 hours, digestion products are polymorphic through 1.5% agarose gel electrophoresis analysis detection
Property.
Low resistant starch genotype is two bands of a spectrum of 375bp and 196bp, and high-resistance starch genotype cannot be digested, band
Type only has a 571bp.Heterozygous single plant has three strip-types, 571bp, 375bp and 196bp.
PCR-speI analysis result is marked to see Fig. 2 96 samples CAPS of KASP labeled analysis, it is seen then that of the invention
Judging result and KASP genotyping result are completely the same.
The KASP molecular labeling primer sequence for high-resistance starch gene sbe3-rs genotyping that the present invention designs
High-throughput genotype can be analyzed, and the result of the label is accurate and reliable, it is convenient and efficient, it is individual in the analysis process to expand
Increase the bad sample of result, can be detected again so that the CAPS molecular labeling developed before connected applications is a small amount of.
Sequence table
<110>Academy of Agricultural Sciences, Shanghai City
<120>a kind of for detecting the KASP labeled primer of rice sbe3-rs gene
<130> 1911037
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tatgctgaaa gtcatgatca agcact 26
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atgctgaaag tcatgatcaa gcacc 25
<210> 3
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
caaccagaat gcaatagttt tgtcaccaa 29
Claims (7)
1. a kind of for detecting the KASP labeled primer of rice sbe3-rs gene comprising primer 1, primer 2 and primer 3, it is described
The specific nucleotide sequence of primer 1 is as shown in SEQ ID NO.1, the specific nucleotide sequence of primer 2 such as SEQ ID NO.2 institute
Show, the specific nucleotide sequence of primer 3 is as shown in SEQ ID NO.3.
2. according to claim 1 for detecting the KASP labeled primer of rice sbe3-rs gene, which is characterized in that described
There is the base mutation of T → C at the 105th of the 16th exon of sbe3-rs gene.
3. according to claim 1 for detecting the KASP labeled primer of rice sbe3-rs gene, which is characterized in that described
5 ' ends of primer 1 are connect with fluorescence labels sequence A, and 5 ' ends of primer 2 are connect with fluorescence labels sequence B.
4. according to claim 1 for detecting the KASP labeled primer of rice sbe3-rs gene, which is characterized in that described
The extension increasing sequence of primer 3 is 60-100bp.
5. KASP labeled primer as described in claim 1 is in detection rice resistant starch or the sbe3-rs gene of its filial generation
Application in type.
6. applying according to claim 5, which is characterized in that 5 ' ends of the primer 1 are connect with fluorescence labels sequence A, are drawn
5 ' ends of object 2 are connect with fluorescence labels sequence B.
7. applying according to claim 6, which is characterized in that the fluorescence labels sequence A is FAM fluorescence labels sequence, glimmering
Optical label sequence B is HEX fluorescence labels sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910112433.9A CN109694920A (en) | 2019-02-13 | 2019-02-13 | It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910112433.9A CN109694920A (en) | 2019-02-13 | 2019-02-13 | It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109694920A true CN109694920A (en) | 2019-04-30 |
Family
ID=66233300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910112433.9A Pending CN109694920A (en) | 2019-02-13 | 2019-02-13 | It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109694920A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111084096A (en) * | 2019-12-31 | 2020-05-01 | 上海市农业科学院 | Breeding method of rice variety with high-resistance starch and low-gluten polymerization |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816778A (en) * | 2012-07-30 | 2012-12-12 | 上海市农业科学院 | Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene |
| CN107227373A (en) * | 2017-07-31 | 2017-10-03 | 长江师范学院 | A kind of SNP Functional markers of japonica rice gene resistant to lodging and application |
| US20170314035A1 (en) * | 2011-10-04 | 2017-11-02 | Arcadia Biosciences, Inc. | Wheat with increased resistant starch levels |
-
2019
- 2019-02-13 CN CN201910112433.9A patent/CN109694920A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170314035A1 (en) * | 2011-10-04 | 2017-11-02 | Arcadia Biosciences, Inc. | Wheat with increased resistant starch levels |
| CN102816778A (en) * | 2012-07-30 | 2012-12-12 | 上海市农业科学院 | Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene |
| CN107227373A (en) * | 2017-07-31 | 2017-10-03 | 长江师范学院 | A kind of SNP Functional markers of japonica rice gene resistant to lodging and application |
Non-Patent Citations (4)
| Title |
|---|
| RUIFANG YANG等: "A putative gene sbe3-rs for resistant starch mutated from SBE3 for starch branching enzyme in rice (Oryza sativa L.).", 《PLOS ONE》 * |
| RUIFANG YANG等: "B024-146", 《BREED SCI》 * |
| 杨瑞芳等: "分子标记辅助选择选育高抗性淀粉水稻新品种", 《核农学报》 * |
| 王昊龙: "小麦淀粉分支酶SBEIIa、SBEIIb基因序列多态性分析及功能标记的开发", 《中国优秀硕士学位论文全文数据库工程科技Ⅰ辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111084096A (en) * | 2019-12-31 | 2020-05-01 | 上海市农业科学院 | Breeding method of rice variety with high-resistance starch and low-gluten polymerization |
| CN111084096B (en) * | 2019-12-31 | 2021-11-02 | 上海市农业科学院 | Breeding method of rice variety with high-resistance starch and low-gluten polymerization |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kalpana et al. | Assessment of genetic diversity among varieties of mulberry using RAPD and ISSR fingerprinting | |
| CN107142315B (en) | SNP marker and its application with pumpkin lutein content main effect QTL compact linkage | |
| Onguso et al. | Genetic characterization of cultivated bananas and plantains in Kenya by RAPD markers | |
| Hwang et al. | Functional characterization of watermelon (Citrullus lanatus L.) EST–SSR by gel electrophoresis and high resolution melting analysis | |
| Li et al. | Developing EST-SSR markers to study molecular diversity in Liriope and Ophiopogon | |
| CN102816778B (en) | Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene | |
| CN107893126B (en) | For identifying the SSR molecular marker and application of Polygonatum germ plasm resource | |
| Sharma et al. | Genetic variability in Rubus ellipticus collections assessed by morphological traits and EST-SSR markers | |
| Juibary et al. | Genetic structure analysis and genetic finger printing of sweet orange cultivars (Citrus sinensis (L.) Osbeck) by using SCoT molecular markers | |
| CN104561315A (en) | SNP (Single Nucleotide Polymorphism) detection method of rice high-resistant starch content mutant gene sbe3-rs | |
| CN106011258A (en) | Molecular marker for rice seed peel color gene Pb and application of molecular marker | |
| AU2020103706A4 (en) | Ssr molecular marker primer related to walnut black spot disease and application thereof | |
| CN109694920A (en) | It is a kind of for detecting the KASP labeled primer of rice sbe3-rs gene | |
| CN107365835A (en) | SNP marker and its application with pumpkin sucrose/glucose ratio main effect QTL compact linkage | |
| CN114480721B (en) | Method for identifying whether melon variety to be detected is thin-skin melon or thick-skin melon and special SNP primer combination thereof | |
| CN114606339B (en) | KASP molecular marker linked with pumpkin inositol content major QTL and application thereof | |
| CN107475417B (en) | Molecular marker related to oat β glucan content and application thereof | |
| Singh et al. | Comparative transcriptome profiling of pomegranate genotypes having resistance and susceptible reaction to Xanthomonas axonopodis pv. punicae | |
| CN108277221A (en) | The functional label of wheat phytoene synthase gene psy-e2 a kind of and its application | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN105603072B (en) | Whether there is or not gene SbAn-1 and SNP mutation site and applications for a kind of control sorghum awns | |
| Guo et al. | Genetic diversity and population structure of Indigofera szechuensis complex (Fabaceae) based on EST-SSR markers | |
| Chikkaswamy et al. | Evaluation of genetic diversity in mulberry varieties using molecular markers | |
| CN105349650B (en) | A kind of method of qualitative detection rice digestion resistant content of starch | |
| Li et al. | Establishment of molecular identity cards for Cucumis melo cultivars using ssr markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190430 |
|
| WD01 | Invention patent application deemed withdrawn after publication |