CN105420354B - Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label - Google Patents
Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label Download PDFInfo
- Publication number
- CN105420354B CN105420354B CN201510804539.7A CN201510804539A CN105420354B CN 105420354 B CN105420354 B CN 105420354B CN 201510804539 A CN201510804539 A CN 201510804539A CN 105420354 B CN105420354 B CN 105420354B
- Authority
- CN
- China
- Prior art keywords
- rice
- huaihe river
- river rice
- indel
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to bioassay technical fields, the identification method of specially a kind of conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 based on InDel label, 24 pairs of specific DNA primers designed by insertion/deletion differential fragment are obtained using the comparison of japonica rice variety OryzasativaLcv.Nipponbare and the complete genome DNA sequence of rice variety 93-11, DNA extraction, DNA fragmentation amplification and the analysis of electrophoretic separation and electrophorogram are carried out to Huaihe River rice No. 5 and Huaihe River rice No. 18 to identify No. 18 kinds of Huaihe River rice No. 5 and Huaihe River rice.Specifically, being combined using 24 pairs of InDel primers, the finger-print based on polymerase chain reaction and the acquisition of gel vertical slab electrophoresis is analyzed, according to the electrophoresis banding pattern in 24 sites InDel, and then determines whether it is conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18.The present invention need to be few with test sample amount, and the method is simple and quick, and qualification result is accurate, is applied to and carries out authenticity to Huaihe River rice No. 5 and Huaihe River rice No. 18 kinds in the market.
Description
Technical field
The invention belongs to bioassay technical field, be related to a kind of conventional rice variety Huaihe River rice No. 5 based on InDel label and
The identification method that Huaihe River rice is No. 18, i.e., it is a kind of using paddy DNA insertion or deleting molecular marker identification conventional rice variety Huaihe River rice No. 5 and
The method that Huaihe River rice is No. 18.
Background technique
Cultivated rice (Oryza sativa L.) is one of most important cereal crops in the world, has heredity abundant more
Sample.Rice varieties identification is of great significance for rice genetic research and breed of variety.It has been reported that identification rice product
Kind method be mostly japonica rice and long-grained nonglutinous rice subspecies identification, " Cheng's index Method " (including six individual characteies such as based on Morphological Identification
Shape: bran hair, phenol reaction, fringe section length, rice husk color, Ye Mao and grain length-width ratio) and japonica rice-long-grained nonglutinous rice identification side based on molecular labeling
Method etc..It whether is that the method that specific rice varieties are identified then is limited to a kind of method of SNP chip to a certain specific kind,
But SNP chip is expensive, and analytical cycle is longer, and subsequent data processing is cumbersome, cannot obtain testing result on the same day.
Huaihe River rice No. 5 are that the breeding of Region of Xuhuai, Jiangsu Province Huaiyin institute of agricultural sciences forms, and are one and collect high yield, stable yields, high-quality in one
The Japonica rice rice new varieties of body.It is authorized by Jiangsu Province within 2000, authorization number is careful word the 358th of Soviet Union kind.The kind strain
Type is compacter, and stalk is sturdy anti-fall.Blade is stood upright.Stooling is better-than-average, highest stem tiller 280,000/mu of number.The growth of stem tiller is neat, at
Fringe rate is up to 80% or more.Fringe grain is coordinated, and generally mature spike number 220,000, every total grain panicle number are 110-130 per acre, setting percentage
90% or more, 28 grams of mass of 1000 kernel or so.Good resistance is showed to bacterial leaf-blight, rice blast, banded sclerotial blight, false smut is light.Entirely
It is breeding time 150 days or so, similar with Wu-Yu-Geng 3.Later period annesl is good, and ripe color is ripe mutually all good, it is more difficult to threshing.Good grain quality, rice
Meal is pure white glossy, in good taste.It is suitble to plant under the better-than-average soil fertility condition in our province Huainan Area.
Huaihe River rice No. 18 by Jiangsu Xuhuai Zone Huaiyin Agricultural Sciences Institute and Huaiyin Normal College with 66/ Xu 23121 of Huaihe River
Hybridization was bred as in 2010, belonged to Japonica rice rice varieties.Knob plantation is raised in area and peaceful town in suitable Soviet Union of Jiangsu Province.It should
Kind plant type is compact, and growing way is more prosperous, and fringe type is medium, and tillering ability is stronger, green in leaf color, and later period grouting is fast, and ripe color is good, lodging resistance compared with
By force；Provinces and regions examination average result: effective fringe 22.4 ten thousand per acre, Defined daily doses 114.1, setting percentage 93.8%, mass of 1000 kernel 28.3
Gram, 96.0 centimetres of plant height, the time of infertility 154.6 days, than control Huaidao 9 ripe 2 days late.Disease identification: panicle blast loss late 3
Grade, panicle blast comprehensive resistance index 4.25, middle sense bacterial leaf-blight, anti-banded sclerotial blight, stripe virus disease, rice matter physical and chemical index is through agricultural
Food quality inspection center of portion is detected for 2014: head rice rate 73.7%, chalkness ratio 11%, chalkiness degree 3.2%, and 69 millimeters of gel consistence,
Amylose content 18.2% reaches national standard three-level high quality paddy standard.
Huaihe River rice No. 5 similar with 18 genetic background of Huaihe River rice, may generate in production kind and obscure, with traditional form identification side
Method long period, error probability are high, it is necessary to establish the rapid identification method based on genotype.
InDel marks (insertion-deletion length polymorphism), also makes insertion and deletion length more
State property, widely distributed in genome caused by being the opposite insertion or missing as base sequence, length is from a nucleosides
Acid is to several hundred or even tens of thousands of differ.The conservative pairs of primer of sequence design in side is faced to InDel label, by round pcr, through poly- third
Acrylamide gel electrophoresis can show the site InDel in interindividual polymorphism, to achieve the purpose that identification.With answer
It is compared with wider SSR marker, InDel label has the advantage that (1) quantity very abundant, is distributed widely in each item dyeing
On body；(2) it is codominant marker, meets mendelian inheritance；(3) design is simple, and easily operated, technology is reproducible, knot
Fruit is reliable.
Summary of the invention
The difficult technological deficiency for distinguishing breed difference is observed for traditional form, the object of the present invention is to provide one kind to be based on
The conventional rice variety Huaihe River rice No. 5 of InDel label and Huaihe River rice No. 18 identification methods, by 24 pairs of specific primers of exploitation to
Identify conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18, it is intended to which whether Rapid identification certain species are the high-quality routine newly cultivated
Rice varieties Huaihe River rice No. 5 and Huaihe River rice No. 18, the extraction that identification of species carries out genomic DNA is treated, is reported using this research specific
Primer pair combination carries out PCR to it, is then developed the color by polyacrylamide gel electrophoresis and silver staining, and kind can be obtained in the same day
Qualification result, efficiently, accurately, reliably.
The present invention is achieved by the following technical solutions: utilizing the complete of japonica rice variety OryzasativaLcv.Nipponbare and rice variety 93-11
The comparison of genomic dna sequence and obtain 24 pairs of specific DNA primers designed by insertion/deletion differential fragment, to Huaihe River rice No. 5 and
Huaihe River rice No. 18 carry out DNA extraction, DNA fragmentation amplification and the analysis of electrophoretic separation and electrophorogram to identify Huaihe River rice No. 5 and Huaihe River
No. 18 kinds of rice；Specifically, being combined using 24 pairs of InDel primers, to based on polymerase chain reaction and gel vertical panel electricity
The finger-print that swimming obtains is analyzed, and according to the electrophoresis banding pattern in 24 sites InDel, and then determines whether it is conventional rice variety
Huaihe River rice No. 5 and Huaihe River rice No. 18；It is characterized in that: conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identifications based on InDel label are used
InDel primer pair is corresponding as described in following table:
| Number | Primer pair title | Forward primer sequence (5'- > 3') | Reverse primer sequences (5'- > 3') |
| 1_1 | chr01-1 | gttgttcagtcaaaagtttcagc | tccttatgtgaagtggaagtataac |
| 1_2 | chr01-2 | atcggtagcactaaatctttcc | gatagggttttaggtttttcgag |
| 2_1 | chr02-1 | gtaagactagctgtttcaatcacag | gtatgaggtatagacatgggagaac |
| 2_2 | chr02-2 | agttgagatgaatagctagatggag | aacttgaggaggatcggtatc |
| 3_1 | chr03-1 | ggatcaagtagcacgataagc | acctattggttgtgtgtcttgtag |
| 3_2 | chr03-2 | tgtctcattcagagtatggagttc | ttagattggagctatagttgaggac |
| 4_1 | chr04-1 | cattgacttttcaacacattgg | cataaatttccaggccatatactac |
| 4_2 | chr04-2 | aacaaccgaaaggtatatgacac | gaatccttaaaattgtaccgtagtg |
| 5_1 | chr05-1 | gaactcttgctcttcatagaaaatg | taatactcatcctctccgatcc |
| 5_2 | chr05-2 | cctaaaacctttatcccaaagc | gatcatgtagaaatgaacggc |
| 6_1 | chr06-1 | cacttagacagcacaaaaatatacc | actaattaaagtcgacacatgacag |
| 6_2 | chr06-2 | ctaatttgctacacttctgtcgtc | tgtaaagcatatagcaccaagttac |
| 7_1 | chr07-1 | gtgtgccagttatatttcactttag | ctgagttgacattgagaaaacaatc |
| 7_2 | chr07-2 | gcgatcaaagtctataaaacatctg | atatctgcagtagctgtcaaaaag |
| 8_1 | chr08-1 | ttctattaaagtcacaaggctcac | aatacaggcatatctaaaggttgtc |
| 8_2 | chr08-2 | gtaaagtttgtgtgttcaaaggag | agtcgagtacgtctatcacacatc |
| 9_1 | chr09-1 | tagggtgttgtataaatggtattgc | ccattagtttacatgtggaatgtc |
| 9_2 | chr09-2 | cacatttcgttgtcttatctgag | atctttgacctggcactcttac |
| 10_1 | chr10-1 | ggtaaaactaatcatatcgaggaag | tactgttatatgttggatggtgaac |
| 10_2 | chr10-2 | gacgatcttaaactaaaacatgagc | atccaacaacaggatattactatgg |
| 11_1 | chr11-1 | agtgagaaccaatgttgagatg | cattataaaagaacccatagagagc |
| 11_2 | chr11-2 | aactaaacccataagtcagtgtagc | ctattcactactcacctaccatgtc |
| 12_1 | chr12-1 | atcctatatcatgtgtttcacacc | atatcactttgacctttttccctc |
| 12_2 | chr12-2 | cttagcctcttctgttgaaaattg | gcaactgaaactacatgactagaag |
The identification method of above-mentioned conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 based on InDel label comprises the following steps that
Step 1: any organ or tissue for choosing rice plant extracts total DNA；
Step 2: the DNA described in primer pair amplifies step 1；
Step 3: the product of the amplification described in step 2 carries out gel electrophoresis analysis, the result in 24 sites is completely the same,
It is then conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18.
Wherein, in step 1, the extraction total DNA specifically refers to extract nuclear DNA with CTAB method.
Wherein, in step 2, the amplification system: 20 μ L, the DNA of the template including 30-50ng, 0.25 unit
Archaeal dna polymerase (Shen energy lottery industry), 10 × Buffer(of 2.0 μ L contains Mg2+), 2 μ L of 2.0mM dNTPs；
The amplification program: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of renaturation 30s, 72 DEG C of extension 30s, 32
Circulation；Last 72 DEG C of extensions 7min.
Wherein, in step 3, gel electrophoresis analysis specifically: the amplification described in step 2 of appropriate sample-loading buffer is added
In product, under 22V/cM constant electric field strength, after 12% denaturing polyacrylamide gel electrophoresis 100 minutes, silver staining colour developing；
Sample containing paddy DNA can expand in different loci (primer pair) respectively and occur obviously when aforementioned 24 pairs of primers combine
Polymorphism banding pattern (following two master tapes and recombination band) above.
Compared with prior art, the present invention have it is following the utility model has the advantages that
1, the special primer of the InDel Fragment Differential design on rice full-length genome specific site, Xian-round-grained rice heterozygosis band are utilized
Type identifies conventional Rice Huaihe River rice No. 5 and Huaihe River rice No. 18, and method is easy, and amount of samples is few, and accuracy is high, speed is fast；
2, based on PCR amplified reaction, using on 24 sites of Xian-japonica rice InDel fragment sequence difference and PCR reaction
Rapidly and efficiently property, in a short time can be accurate identification conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18, and method is easy, quick, has very
Good application prospect；
3, the other adjacent conservative pairs of primer of sequence design is marked to InDel, by round pcr, through polyacrylamide gel
Electrophoresis can show the site InDel in interindividual polymorphism, to achieve the purpose that identification；
4, the polymerase chain amplification system used is Standard PCR system, does not need special PCR instrument and special reaction
Reagent, the PCR instrument of any company's production and the reagent of any biological reagent company production can be used and achieve the goal.
Detailed description of the invention
By reading referring to attached drawing detailed description of non-limiting embodiments, other feature of the invention, purpose
It will be become more apparent upon with advantage:
Fig. 1 is PCR electrophoretogram, swimming lane 1 to swimming lane 7 be respectively rice varieties 9311, II excellent 084, Huaihe River rice No. 18, Guangdong Thailand A,
Yueyou 938, Huaihe River rice No. 5, OryzasativaLcv.Nipponbare；It will be seen from figure 1 that No. 18 genotype of Huaihe River rice are mainly japonica rice background (OryzasativaLcv.Nipponbare), with
Huaihe River rice No. 5 have a closer affiliation, Huaihe River rice No. 18 and Huaihe River rice No. 5 it is only variant in primer 5-1, also illustrate that the present invention has
Good detection specificity.
Specific embodiment
The present invention is described in detail combined with specific embodiments below.Following embodiment will be helpful to the technology of this field
Personnel further understand the present invention, but the invention is not limited in any way.It should be pointed out that the ordinary skill of this field
For personnel, without departing from the inventive concept of the premise, various modifications and improvements can be made.These belong to the present invention
Protection scope.
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition, such as Smbrook equal part
Son clone: described in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989)
Condition, or according to the normal condition proposed by manufacturer.
24 InDel of the rice are labeled as nucleosides shown in rice varieties OryzasativaLcv.Nipponbare sequence and rice varieties 93-11 sequence
Acid sequence, the DNA sequence dna difference collectively formed.
Embodiment 1: the extracting of paddy DNA
Genome polymorphism analysis is carried out using primer pair used in the invention and based on PCR amplification；
Use amplification system are as follows: 20 μ L, the DNA of the template including 30-50ng, archaeal dna polymerase (the Shen energy of 0.25 unit
Lottery industry), 10 × Buffer(of 2.0 μ L contains Mg2+), 2 μ L of 2.0mM dNTPs；
Use amplification program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of renaturation 30s, 72 DEG C of extension 30s, 32
A circulation；Last 72 DEG C of extensions 7min；
Electrophoresis detection: being added appropriate sample-loading buffer in the product of the amplification, under 22V/cM constant electric field strength,
After 12% denaturing polyacrylamide gel electrophoresis 100 minutes, silver staining colour developing；Sample containing paddy DNA is in aforementioned 24 pairs of primers
When combination, it can be expanded in different loci (primer pair) respectively and apparent polymorphism banding pattern occur.
The electrophoresis product of rice sample amplification are as follows: 1) long-grained nonglutinous rice reference material 9311；2) excellent 084 II；3) Huaihe River rice No. 18；4) Guangdong
Safe A；5) Yueyou 938；6) Huaihe River rice No. 5；7) japonica rice reference material OryzasativaLcv.Nipponbare.
Embodiment 2: rice varieties Huaihe River rice No. 5 and No. 18 genotype identifications of Huaihe River rice
With following primer of the present invention to for rice varieties Huaihe River rice No. 5 and Huaihe River rice No. 18 identifications；
| Number | Primer pair title | Forward primer sequence (5'- > 3') | Reverse primer sequences (5'- > 3') |
| 1-1 | chr01-1 | gttgttcagtcaaaagtttcagc | tccttatgtgaagtggaagtataac |
| 1-2 | chr01-2 | atcggtagcactaaatctttcc | gatagggttttaggtttttcgag |
| 2-1 | chr02-1 | gtaagactagctgtttcaatcacag | gtatgaggtatagacatgggagaac |
| 2-2 | chr02-2 | agttgagatgaatagctagatggag | aacttgaggaggatcggtatc |
| 3-1 | chr03-1 | ggatcaagtagcacgataagc | acctattggttgtgtgtcttgtag |
| 3-2 | chr03-2 | tgtctcattcagagtatggagttc | ttagattggagctatagttgaggac |
| 4-1 | chr04-1 | cattgacttttcaacacattgg | cataaatttccaggccatatactac |
| 4-2 | chr04-2 | aacaaccgaaaggtatatgacac | gaatccttaaaattgtaccgtagtg |
| 5-1 | chr05-1 | gaactcttgctcttcatagaaaatg | taatactcatcctctccgatcc |
| 5-2 | chr05-2 | cctaaaacctttatcccaaagc | gatcatgtagaaatgaacggc |
| 6-1 | chr06-1 | cacttagacagcacaaaaatatacc | actaattaaagtcgacacatgacag |
| 6-2 | chr06-2 | ctaatttgctacacttctgtcgtc | tgtaaagcatatagcaccaagttac |
| 7-1 | chr07-1 | gtgtgccagttatatttcactttag | ctgagttgacattgagaaaacaatc |
| 7-2 | chr07-2 | gcgatcaaagtctataaaacatctg | atatctgcagtagctgtcaaaaag |
| 8-1 | chr08-1 | ttctattaaagtcacaaggctcac | aatacaggcatatctaaaggttgtc |
| 8-2 | chr08-2 | gtaaagtttgtgtgttcaaaggag | agtcgagtacgtctatcacacatc |
| 9-1 | chr09-1 | tagggtgttgtataaatggtattgc | ccattagtttacatgtggaatgtc |
| 9-2 | chr09-2 | cacatttcgttgtcttatctgag | atctttgacctggcactcttac |
| 10-1 | chr10-1 | ggtaaaactaatcatatcgaggaag | tactgttatatgttggatggtgaac |
| 10-2 | chr10-2 | gacgatcttaaactaaaacatgagc | atccaacaacaggatattactatgg |
| 11-1 | chr11-1 | agtgagaaccaatgttgagatg | cattataaaagaacccatagagagc |
| 11-2 | chr11-2 | aactaaacccataagtcagtgtagc | ctattcactactcacctaccatgtc |
| 12-1 | chr12-1 | atcctatatcatgtgtttcacacc | atatcactttgacctttttccctc |
| 12-2 | chr12-2 | cttagcctcttctgttgaaaattg | gcaactgaaactacatgactagaag |
Excellent 084, Huaihe River rice No. 18, Guangdong Thailand A, Yueyou 938, Huaihe River rice using InDel molecular markers for identification rice varieties 9311, II
No. 5, OryzasativaLcv.Nipponbare；
Use amplification system are as follows: 20 μ L, the DNA of the template including 30-50ng, archaeal dna polymerase (the Shen energy of 0.25 unit
Lottery industry), 10 × Buffer(of 2.0 μ L contains Mg2+), 2 μ L of 2.0mM dNTPs；
Use amplification program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of renaturation 30s, 72 DEG C of extension 30s, 32
A circulation；Last 72 DEG C of extensions 7min；
Electrophoresis detection: being added appropriate sample-loading buffer in the product of the amplification, under 22V/cM constant electric field strength,
After 12% denaturing polyacrylamide gel electrophoresis 100 minutes, silver staining colour developing；Sample containing paddy DNA is in aforementioned 24 pairs of primers
When combination, it can be expanded in different loci (primer pair) respectively and apparent polymorphism banding pattern occur.
The electrophoresis product of rice sample amplification are as follows: 1) long-grained nonglutinous rice reference material 9311；2) excellent 084 II；3) Huaihe River rice No. 5 and Huaihe River rice
No. 18；4) Guangdong Thailand A；5) Yueyou 938；6) Huaihe River rice No. 5；7) japonica rice reference material OryzasativaLcv.Nipponbare.
Fig. 1: using the combination (electrophoretic band includes two master tapes and recombination band) of 24 pairs of primer pairs of the invention to Huaihe River rice 5
Number and Huaihe River rice No. 18 accurately identified that some independent primer pair is simultaneously without convincingness.
As can be seen from the above results long-grained nonglutinous rice and japonica rice base that same rice varieties are shown on 24 InDel specific sites
Because type be it is different, the predominantly japonica rice gene banding pattern of Huaihe River rice No. 5 and Huaihe River rice No. 18 passes through the reading to all specific site banding patterns
Record and statistics are taken, determines whether sample is Huaihe River rice No. 5 and Huaihe River rice No. 18.
Specific embodiments of the present invention are described above.It is to be appreciated that the invention is not limited to above-mentioned
Particular implementation, those skilled in the art can make various deformations or amendments within the scope of the claims, this not shadow
Ring substantive content of the invention.
Claims (2)
1. conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label, utilize japonica rice variety OryzasativaLcv.Nipponbare
Comparison with the complete genome DNA sequence of rice variety 93-11 and obtain designed by insertion/deletion differential fragment 24 pairs
InDel primer combination, to No. 18 progress DNA extractions of Huaihe River rice No. 5 and Huaihe River rice, DNA fragmentation amplification and electrophoretic separation and electrophoretogram
Huaihe River rice No. 5 and No. 18 kinds of Huaihe River rice are identified in the analysis of spectrum；It is combined using 24 pairs of InDel primers, to based on polymerase chain reaction
The finger-print that should be obtained with gel vertical slab electrophoresis is analyzed, and according to the electrophoresis banding pattern in 24 sites InDel, and then is determined
It whether is conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18；It is characterized in that: conventional rice variety Huaihe River rice No. 5 based on InDel label and
The identification that Huaihe River rice is No. 18 is corresponding as shown in following table with 24 pairs of InDel primer combinations:
。
2. identification method according to claim 1 includes the following steps: Step 1: choosing any organ of rice plant
Or tissue extraction total DNA；Step 2: the DNA described in 24 pairs of InDel primers combination amplification step one；Step 3: to step
The product of rapid two amplification carries out gel electrophoresis analysis, and the result in 24 sites is completely the same, then is conventional rice variety Huaihe River rice 5
Number and Huaihe River rice No. 18；It is characterized in that: the extraction total DNA specifically refers to extract nuclear DNA with CTAB method in step 1；
In step 2, the amplification system: 20 μ L, the DNA of the template including 30-50ng, the archaeal dna polymerase of 0.25 unit, 2.0 μ L
10 × Buffer, 2 μ L of 2.0mM dNTPs；The amplification program: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 58 DEG C of renaturation
30s, 72 DEG C of extension 30s, 32 circulations；Last 72 DEG C of extensions 7min；In step 3, gel electrophoresis analysis specifically: be added suitable
In the product for measuring sample-loading buffer amplification described in step 2, under 22V/cM constant electric field strength, through 12% modacrylic acyl
After amine gel electrophoresis 100 minutes, silver staining colour developing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804539.7A CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804539.7A CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105420354A CN105420354A (en) | 2016-03-23 |
| CN105420354B true CN105420354B (en) | 2018-12-25 |
Family
ID=55498889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510804539.7A Active CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105420354B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666758B (en) * | 2019-02-14 | 2023-03-07 | 四川省农业科学院经济作物育种栽培研究所 | InDel-labeled primer for identifying ligusticum wallichii franchetii and identification method |
| CN113308563A (en) * | 2021-05-28 | 2021-08-27 | 扬州大学 | Method for rapidly developing Australian wild rice specific molecular marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031253A (en) * | 2010-12-16 | 2011-04-27 | 复旦大学 | Molecular marker method for identifying indica type rice and japonica rice by using rice grain |
| CN104789671A (en) * | 2015-04-10 | 2015-07-22 | 上海交通大学 | Identification method for hybrid rice variety hybrid source superior 69 based on InDel (insertion-deletion length polymorphism) marker |
-
2015
- 2015-11-20 CN CN201510804539.7A patent/CN105420354B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031253A (en) * | 2010-12-16 | 2011-04-27 | 复旦大学 | Molecular marker method for identifying indica type rice and japonica rice by using rice grain |
| CN104789671A (en) * | 2015-04-10 | 2015-07-22 | 上海交通大学 | Identification method for hybrid rice variety hybrid source superior 69 based on InDel (insertion-deletion length polymorphism) marker |
Non-Patent Citations (1)
| Title |
|---|
| 新一代遗传标记——InDel研究进展;孙宽 等;《法医学杂志》;20130430;第29卷(第2期);134-139、143页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105420354A (en) | 2016-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN103060318B (en) | SSR (Simple Sequence Repeat) core primer group developed based on whole genome sequence of foxtail millet and application of SSR core primer group | |
| CN102031253B (en) | Molecular marker method for identifying indica type rice and japonica rice by using rice grain | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN105063185B (en) | The close linkage mark of wheat spike length main effect QTL and its application | |
| CN112980999B (en) | SSR molecular marker of mulberry variety Yuehei 74 and core primer group, kit and application thereof | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN110195126B (en) | SSR core primer group developed based on tartary buckwheat whole genome data and application thereof | |
| CN105802962B (en) | Molecular labeling and its application | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN106591460B (en) | Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application | |
| CN111057784B (en) | SSR molecular marker primer related to walnut black spot and application thereof | |
| CN105462971B (en) | The specific molecular marker and its primer special of rice blast resistant gene Pi2 | |
| CN105385768A (en) | Method for identifying foxtail millet variety by adopting SSR molecular marker technique and application | |
| CN105385769A (en) | SSR molecular marker method for identifying foxtail millet variety and application | |
| CN105112523A (en) | SSR (Simple Sequence Repeats) core primer group developed on basis of whole-genome sequences of cabbages and application | |
| CN108977563A (en) | SSR core primers group and its application based on the exploitation of radish whole genome sequence | |
| CN110257551B (en) | SSR primers for constructing peach DNA fingerprint, application and construction method | |
| CN102296124B (en) | A kind of RAPD of utilization distinguishes the method for jujube kind fast | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| CN109554498B (en) | Molecular marker for identifying early-late maturing characteristics of single-cropping water bamboo and application and acquisition method thereof | |
| CN104789671B (en) | The authentication method in source excellent 69 is handed over based on the Hybrid Rice Varieties that InDel is marked | |
| CN116179748B (en) | Molecular marker primer group and kit for identifying fruit Sang Pinchong 'Yue mulberry 33' and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhu Mingchao Inventor after: Zhang Dabing Inventor after: Yuan Zheng Inventor after: Yuan Caiyong Inventor after: Wei Jiaojun Inventor after: Ni Xiangqun Inventor after: Wen Zhenghuai Inventor after: Yan Weigu Inventor after: Zhang Jinping Inventor before: Yuan Zheng Inventor before: Zhang Dabing Inventor before: Zhu Mingchao Inventor before: Yuan Caiyong Inventor before: Wei Jiaojun Inventor before: Ni Xiangqun Inventor before: Wen Zhenghuai Inventor before: Yan Weigu Inventor before: Zhang Jinping |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |