CN105420354A - Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks - Google Patents
Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks Download PDFInfo
- Publication number
- CN105420354A CN105420354A CN201510804539.7A CN201510804539A CN105420354A CN 105420354 A CN105420354 A CN 105420354A CN 201510804539 A CN201510804539 A CN 201510804539A CN 105420354 A CN105420354 A CN 105420354A
- Authority
- CN
- China
- Prior art keywords
- rice
- huaihe river
- indel
- dna
- river rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the technical field of creature recognition and particularly provides an identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks. 24 pairs of peculiar DNA primers designed according to inserted/missing difference segments obtained through comparison of whole-genome DNA sequences of a japonica rice variety Nipponbare and an indica type rice variety 93-11 are used for performing DNA extraction, DNA segment amplification, electrophoretic separation and electrophoretogram analysis on Huai rice No.5 and No.18 to identify the Huai rice No.5 and No.18 varieties. Specifically, 24 pairs of InDel primers are used for analyzing a fingerprint spectrum obtained on the basis of a polymerase chain reaction and vertical gel plate electrophoresis, and then whether the varieties are conventional rice varieties Huai rice No.5 and No.18 or not is determined according to the electrophoretic band type of 24 InDel loci. The number of required detected samples is small, the method is convenient and rapid to use, the identification result is accurate, and the method is applied to the market for identification of authenticity of the Huai rice No.5 and No.18 varieties.
Description
Technical field
The invention belongs to bioassay technical field, relate to a kind of based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, i.e. a kind of method utilizing paddy DNA insertion or deleting molecular marker qualification conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18.
Background technology
Cultivated rice (OryzasativaL.) is one of most important food crop in the world, has abundant genetic diversity.Rice varieties qualification for rice genetic research and breed of variety significant.The method of the qualification rice varieties reported mostly is the qualification of japonica rice and long-grained nonglutinous rice subspecies, as " Cheng's index Method " (the comprising six proterties: the reaction of bran hair, phenol, fringe joint length, rice husk look, Ye Mao and grain long-width ratio) based on identification of morphology and the japonica rice-long-grained nonglutinous rice authentication method etc. based on molecule marker.Whether be a kind of method that method that specific rice varieties is identified then is limited to SNP chip to a certain concrete kind, but SNP chip is expensive, analytical cycle is longer, and follow-up data processing is loaded down with trivial details, can not obtain detected result the same day.
Huaihe River rice No. 5 is that the seed selection of Huaiyin, Region of Xuhuai, Jiangsu Province institute of agricultural sciences forms, and is the Japonica rice rice new variety integrating high yield, stable yields, high-quality.Within 2000, authorized by Jiangsu Province, authorization is numbered Soviet Union's kind of No. 358th, careful word.This kind plant type is compacter, and stem stalk is sturdy anti-fall.Blade is stood upright.Stooling is better-than-average, the highest stem tiller number 280,000/mu.The growth of stem tiller is neat, and the percentage of earbearing tiller is up to more than 80%.Fringe grain is coordinated, and generally every mu of mature spike number 220,000, every total grain panicle number is 110-130 grain, setting percentage more than 90%, thousand seed weight about 28 grams.All show good resistance to bacterial leaf-blight, rice blast, banded sclerotial blight, false smut is light.About the 150 days time of infertility, similar with Wu-Yu-Geng 3.Later stage annesl is good, and ripe look ripe is all good mutually, more difficult threshing.Good grain quality, rice is pure white glossy, and mouthfeel is good.Plant under being applicable to the better-than-average soil fertility condition in our province Huainan Area.
Huaihe River rice No. 18 is hybridized with Huaihe River 66/ Xu 23121 by Jiangsu Xuhuai Zone Huaiyin Agricultural Sciences Institute and Huaiyin Normal College, is bred as, belongs to Japonica rice rice varieties in 2010.In Soviet Union of suitable Jiangsu Province, knob plantation is raised in area and peaceful town.This kind plant type is compact, and growing way is more prosperous, and fringe type is medium, and ability for tillering is comparatively strong, leaf look medium green, and later stage grouting is fast, and ripe look good, and lodging resistance is stronger; Provinces and regions examination average result: every mu of effective fringe 22.4 ten thousand, Defined daily doses 114.1, setting percentage 93.8%, thousand seed weight 28.3 grams, plant height 96.0 centimetres, the 154.6 days time of infertility, than contrasting Huaidao 9 ripe 2 days late.Disease identification: panicle blast rate of loss 3 grades, panicle blast comprehensive resistance index 4.25, middle sense bacterial leaf-blight, anti-banded sclerotial blight, stripe virus disease, rice matter physical and chemical index detects through food quality inspection center of the Ministry of Agriculture for 2014: head rice rate 73.7%, chalkness ratio 11%, chalkiness degree 3.2%, gel consistence 69 millimeters, amylose content 18.2%, reaches GB three grades of high quality paddy standards.
Huaihe River rice No. 5 is similar with Huaihe River rice 18 genetic background, may produce kind aborning and obscure, and long with the traditional form authentication method time cycle, probability of makeing mistakes is high, is necessary to set up based on genotypic rapid identification method.
InDel marks (insertion-deletionlengthpolymorphism), also insertion-deletion length polymorphism is, be because the relative insertion of base sequence or disappearance cause, widely distributed in genome, length is not from a Nucleotide to hundreds of even several ten thousand etc.The conservative paired primer of sequences Design in side is faced to InDel mark, by round pcr, through polyacrylamide gel electrophoresis, InDel site can be shown in interindividual polymorphism, thus reach the object of qualification.Compared with the SSR marker that application is wider, InDel mark has the following advantages: (1) quantity is very abundant, is distributed widely on each bar karyomit(e); (2) be codominant marker, meet mendelian inheritance; (3) simplicity of design, easy handling, technology is reproducible, reliable results.
Summary of the invention
The difficult technological deficiency distinguishing breed difference is observed for traditional form, the object of this invention is to provide a kind of based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, by exploitation 24 pairs of Auele Specific Primers in order to identify conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18, whether be intended to Rapid identification certain species is the new high-quality conventional rice variety Huaihe River rice No. 5 cultivated and Huaihe River rice No. 18, treat the extraction that identification of species carries out genomic dna, the specific primer using this research to report carries out PCR to combination to it, then by polyacrylamide gel electrophoresis and the colour developing of silver dye, the qualification result of kind can be obtained the same day, efficiently, accurately, reliably.
The present invention is achieved by the following technical solutions: utilize the fine 24 pairs of specific DNA primers obtained designed by insertion/deletion differential fragment with the comparison of the complete genome DNA sequence of rice variety 93-11 of japonica rice variety Japan, to Huaihe River rice No. 5 and Huaihe River rice No. 18 carry out DNA extraction, DNA fragmentation amplification and electrophoretic separation and electrophoretogram analysis to identify Huaihe River rice No. 5 and Huaihe River rice No. 18 kinds; Specifically, utilize 24 pairs of InDel combination of primers, the finger printing obtained based on polymerase chain reaction and gel vertical slab electrophoresis is analyzed, according to the electrophoresis banding pattern in 24 InDel sites, and then determines whether it is conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18; It is characterized in that: the conventional rice variety Huaihe River rice No. 5 marked based on InDel and the qualification InDel special primer of Huaihe River rice No. 18 are to described in the following list of correspondence:
| Numbering | Primer pair title | Forward primer sequence (5'-> 3') | Reverse primer sequences (5'-> 3') |
| 1_1 | chr01-1 | gttgttcagtcaaaagtttcagc | tccttatgtgaagtggaagtataac |
| 1_2 | chr01-2 | atcggtagcactaaatctttcc | gatagggttttaggtttttcgag |
| 2_1 | chr02-1 | gtaagactagctgtttcaatcacag | gtatgaggtatagacatgggagaac |
| 2_2 | chr02-2 | agttgagatgaatagctagatggag | aacttgaggaggatcggtatc |
| 3_1 | chr03-1 | ggatcaagtagcacgataagc | acctattggttgtgtgtcttgtag |
| 3_2 | chr03-2 | tgtctcattcagagtatggagttc | ttagattggagctatagttgaggac |
| 4_1 | chr04-1 | cattgacttttcaacacattgg | cataaatttccaggccatatactac |
| 4_2 | chr04-2 | aacaaccgaaaggtatatgacac | gaatccttaaaattgtaccgtagtg |
| 5_1 | chr05-1 | gaactcttgctcttcatagaaaatg | taatactcatcctctccgatcc |
| 5_2 | chr05-2 | cctaaaacctttatcccaaagc | gatcatgtagaaatgaacggc |
| 6_1 | chr06-1 | cacttagacagcacaaaaatatacc | actaattaaagtcgacacatgacag |
| 6_2 | chr06-2 | ctaatttgctacacttctgtcgtc | tgtaaagcatatagcaccaagttac |
| 7_1 | chr07-1 | gtgtgccagttatatttcactttag | ctgagttgacattgagaaaacaatc |
| 7_2 | chr07-2 | gcgatcaaagtctataaaacatctg | atatctgcagtagctgtcaaaaag |
| 8_1 | chr08-1 | ttctattaaagtcacaaggctcac | aatacaggcatatctaaaggttgtc |
| 8_2 | chr08-2 | gtaaagtttgtgtgttcaaaggag | agtcgagtacgtctatcacacatc |
| 9_1 | chr09-1 | tagggtgttgtataaatggtattgc | ccattagtttacatgtggaatgtc |
| 9_2 | chr09-2 | cacatttcgttgtcttatctgag | atctttgacctggcactcttac |
| 10_1 | chr10-1 | ggtaaaactaatcatatcgaggaag | tactgttatatgttggatggtgaac |
| 10_2 | chr10-2 | gacgatcttaaactaaaacatgagc | atccaacaacaggatattactatgg |
| 11_1 | chr11-1 | agtgagaaccaatgttgagatg | cattataaaagaacccatagagagc |
| 11_2 | chr11-2 | aactaaacccataagtcagtgtagc | ctattcactactcacctaccatgtc |
| 12_1 | chr12-1 | atcctatatcatgtgtttcacacc | atatcactttgacctttttccctc |
| 12_2 | chr12-2 | cttagcctcttctgttgaaaattg | gcaactgaaactacatgactagaag |
It is as follows that the above-mentioned conventional rice variety Huaihe River rice No. 5 based on InDel mark and the authentication method of Huaihe River rice No. 18 comprise step:
Step one, any organ or tissue choosing rice plant extract STb gene;
DNA described in step 2, use primer pair amplifies step one;
Step 3, carry out gel electrophoresis analysis to the product increased described in step 2, the result in 24 sites is completely the same, be then conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18.
Wherein, in step one, described extraction STb gene specifically refers to CTAB method extraction nuclear DNA.
Wherein, in step 2, described amplification system: 20 μ L, comprise the DNA of the template of 30-50ng, the archaeal dna polymerase (Shen energy lottery industry) of 0.25 unit, the 10 × Buffer(of 2.0 μ L is containing Mg
2+), 2.0mMdNTPs2 μ L;
Described amplification program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, 32 circulations; Last 72 DEG C extend 7min.
Wherein, in step 3, gel electrophoresis analysis is specially: add appropriate sample-loading buffer in the product increased described in step 2, under 22V/cM constant electric field strength, through 12% denaturing polyacrylamide gel electrophoresis after 100 minutes, and the colour developing of silver dye; Sample containing paddy DNA when aforementioned 24 pairs of combination of primers, can respectively the upper amplification of different loci (primer pair) occur obvious polymorphism banding pattern (below two master tapes and above restructuring band).
Compared with prior art, the present invention has following beneficial effect:
1, utilize the special primer that the InDel Fragment Differential on paddy rice full-length genome specific site designs, Xian-round-grained rice heterozygosis banding pattern identifies conventional Rice Huaihe River rice No. 5 and Huaihe River rice No. 18, and method is easy, and amount of samples is few, and accuracy is high, and speed is fast;
2, PCR-based amplified reaction, utilize the rapidly and efficiently property that the InDel fragment sequence difference on Xian-japonica rice 24 sites and PCR react, at short notice can accurate identification conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18, method is easy, quick, has good application prospect;
3, to the other adjacent conservative paired primer of sequences Design of InDel mark, by round pcr, through polyacrylamide gel electrophoresis, InDel site can be shown in interindividual polymorphism, thus reach the object of qualification;
4, the polymerase chain amplification system used is Standard PCR system, does not need special PCR instrument and special reaction reagent, and the PCR instrument that any company produces and the reagent that any biological reagent company produces all can use and achieve the goal.
Accompanying drawing explanation
By reading the detailed description done non-limiting example with reference to accompanying drawing, other features, objects and advantages of the present invention will become more obvious:
Fig. 1 is PCR electrophorogram, and swimming lane 1 to swimming lane 7 is respectively that rice varieties 9311, II are excellent 084, Huaihe River rice No. 18, the safe A in Guangdong, Yueyou 938, Huaihe River rice No. 5, Japan are fine; As can be seen from Figure 1, Huaihe River rice No. 18 genotype are mainly japonica rice background (Japan is fine), and have nearer sibship with Huaihe River rice No. 5, Huaihe River rice No. 18 is only variant at primer 5-1 with Huaihe River rice No. 5, and the detection specificity that the present invention has had also is described.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.Following examples will contribute to those skilled in the art and understand the present invention further, but not limit the present invention in any form.It should be pointed out that to those skilled in the art, without departing from the inventive concept of the premise, some distortion and improvement can also be made.These all belong to protection scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, such as Smbrook equimolecular clone: the condition described in laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989), or according to the condition that manufacturer advises.
Described paddy rice 24 InDel are labeled as nucleotide sequence shown in the rice varieties fine sequence of Japan and rice varieties 93-11 sequence, the common DNA sequence dna difference formed.
embodiment 1: the extracting of paddy DNA
Genome polymorphism analysis is carried out in the primer pair utilizing this invention used and PCR-based amplification;
Use amplification system is: 20 μ L, comprise the DNA of the template of 30-50ng, the archaeal dna polymerase (Shen energy lottery industry) of 0.25 unit, and the 10 × Buffer(of 2.0 μ L is containing Mg2+), 2.0mMdNTPs2 μ L;
Use amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, 32 circulations; Last 72 DEG C extend 7min;
Electrophoresis detection: add appropriate sample-loading buffer in the product of described amplification, under 22V/cM constant electric field strength, through 12% denaturing polyacrylamide gel electrophoresis after 100 minutes, the colour developing of silver dye; When aforementioned 24 pairs of combination of primers, obvious polymorphism banding pattern can be there is in the upper amplification of different loci (primer pair) respectively in the sample containing paddy DNA.
The electrophoresis product of paddy rice sample amplification is: 1) long-grained nonglutinous rice reference material 9311; 2) II excellent 084; 3) Huaihe River rice No. 18; 4) the safe A in Guangdong; 5) Yueyou 938; 6) Huaihe River rice No. 5; 7) japonica rice reference material Japan is fine.
embodiment 2: rice varieties Huaihe River rice No. 5 and Huaihe River rice No. 18 genotype identification
With following primer of the present invention to the qualification for rice varieties Huaihe River rice No. 5 and Huaihe River rice No. 18;
| Numbering | Primer pair title | Forward primer sequence (5'-> 3') | Reverse primer sequences (5'-> 3') |
| 1-1 | chr01-1 | gttgttcagtcaaaagtttcagc | tccttatgtgaagtggaagtataac |
| 1-2 | chr01-2 | atcggtagcactaaatctttcc | gatagggttttaggtttttcgag |
| 2-1 | chr02-1 | gtaagactagctgtttcaatcacag | gtatgaggtatagacatgggagaac |
| 2-2 | chr02-2 | agttgagatgaatagctagatggag | aacttgaggaggatcggtatc |
| 3-1 | chr03-1 | ggatcaagtagcacgataagc | acctattggttgtgtgtcttgtag |
| 3-2 | chr03-2 | tgtctcattcagagtatggagttc | ttagattggagctatagttgaggac |
| 4-1 | chr04-1 | cattgacttttcaacacattgg | cataaatttccaggccatatactac |
| 4-2 | chr04-2 | aacaaccgaaaggtatatgacac | gaatccttaaaattgtaccgtagtg |
| 5-1 | chr05-1 | gaactcttgctcttcatagaaaatg | taatactcatcctctccgatcc |
| 5-2 | chr05-2 | cctaaaacctttatcccaaagc | gatcatgtagaaatgaacggc |
| 6-1 | chr06-1 | cacttagacagcacaaaaatatacc | actaattaaagtcgacacatgacag |
| 6-2 | chr06-2 | ctaatttgctacacttctgtcgtc | tgtaaagcatatagcaccaagttac |
| 7-1 | chr07-1 | gtgtgccagttatatttcactttag | ctgagttgacattgagaaaacaatc |
| 7-2 | chr07-2 | gcgatcaaagtctataaaacatctg | atatctgcagtagctgtcaaaaag |
| 8-1 | chr08-1 | ttctattaaagtcacaaggctcac | aatacaggcatatctaaaggttgtc |
| 8-2 | chr08-2 | gtaaagtttgtgtgttcaaaggag | agtcgagtacgtctatcacacatc |
| 9-1 | chr09-1 | tagggtgttgtataaatggtattgc | ccattagtttacatgtggaatgtc |
| 9-2 | chr09-2 | cacatttcgttgtcttatctgag | atctttgacctggcactcttac |
| 10-1 | chr10-1 | ggtaaaactaatcatatcgaggaag | tactgttatatgttggatggtgaac |
| 10-2 | chr10-2 | gacgatcttaaactaaaacatgagc | atccaacaacaggatattactatgg |
| 11-1 | chr11-1 | agtgagaaccaatgttgagatg | cattataaaagaacccatagagagc |
| 11-2 | chr11-2 | aactaaacccataagtcagtgtagc | ctattcactactcacctaccatgtc |
| 12-1 | chr12-1 | atcctatatcatgtgtttcacacc | atatcactttgacctttttccctc |
| 12-2 | chr12-2 | cttagcctcttctgttgaaaattg | gcaactgaaactacatgactagaag |
Utilize that InDel molecular markers for identification rice varieties 9311, II are excellent 084, Huaihe River rice No. 18, the safe A in Guangdong, Yueyou 938, Huaihe River rice No. 5, Japan is fine;
Use amplification system is: 20 μ L, comprise the DNA of the template of 30-50ng, and the archaeal dna polymerase (Shen energy lottery industry) of 0.25 unit, the 10 × Buffer(of 2.0 μ L is containing Mg
2+), 2.0mMdNTPs2 μ L;
Use amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, 32 circulations; Last 72 DEG C extend 7min;
Electrophoresis detection: add appropriate sample-loading buffer in the product of described amplification, under 22V/cM constant electric field strength, through 12% denaturing polyacrylamide gel electrophoresis after 100 minutes, the colour developing of silver dye; When aforementioned 24 pairs of combination of primers, obvious polymorphism banding pattern can be there is in the upper amplification of different loci (primer pair) respectively in the sample containing paddy DNA.
The electrophoresis product of paddy rice sample amplification is: 1) long-grained nonglutinous rice reference material 9311; 2) II excellent 084; 3) Huaihe River rice No. 5 and Huaihe River rice No. 18; 4) the safe A in Guangdong; 5) Yueyou 938; 6) Huaihe River rice No. 5; 7) japonica rice reference material Japan is fine.
Fig. 1: utilize the combination of 24 pairs of primer pairs of the present invention (electrophoretic band comprises two master tapes and restructuring band) to identify accurately Huaihe River rice No. 5 and Huaihe River rice No. 18, certain primer pair does not have cogency separately.
From the above results, the long-grained nonglutinous rice that same rice varieties shows on 24 InDel specific sites and japonica rice genotype are different, Huaihe River rice No. 5 and Huaihe River rice No. 18 are mainly japonica rice gene banding pattern, by to the reading record of all specific site banding patterns and statistics, determine whether sample is Huaihe River rice No. 5 and Huaihe River rice No. 18.
Above specific embodiments of the invention are described.It is to be appreciated that the present invention is not limited to above-mentioned particular implementation, those skilled in the art can make various distortion or amendment within the scope of the claims, and this does not affect flesh and blood of the present invention.
Claims (5)
1. based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, utilize the fine 24 pairs of specific DNA primers obtained designed by insertion/deletion differential fragment with the comparison of the complete genome DNA sequence of rice variety 93-11 of japonica rice variety Japan, to Huaihe River rice No. 5 and Huaihe River rice No. 18 carry out DNA extraction, DNA fragmentation amplification and electrophoretic separation and electrophoretogram analysis to identify Huaihe River rice No. 5 and Huaihe River rice No. 18 kinds; Specifically, utilize 24 pairs of InDel combination of primers, the finger printing obtained based on polymerase chain reaction and gel vertical slab electrophoresis is analyzed, according to the electrophoresis banding pattern in 24 InDel sites, and then determines whether it is conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18; It is characterized in that: the conventional rice variety Huaihe River rice No. 5 marked based on InDel and the qualification InDel special primer of Huaihe River rice No. 18 are to described in the following list of correspondence:
。
2., based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, it is characterized in that described authentication method comprises step as follows:
Step one, any organ or tissue choosing rice plant extract STb gene;
DNA described in primer pair amplifies step one described in step 2, use claim 1;
Step 3, carry out gel electrophoresis analysis to the product increased described in step 2, the result in 24 sites is completely the same, be then conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18.
3. the conventional rice variety Huaihe River rice No. 5 based on InDel mark according to claim 2 and the authentication method of Huaihe River rice No. 18, is characterized in that: in step one, and described extraction STb gene specifically refers to CTAB method extraction nuclear DNA.
4. according to claim 2 based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, it is characterized in that: in step 2, described amplification system: 20 μ L, comprise the DNA of the template of 30-50ng, the archaeal dna polymerase of 0.25 unit, 10 × the Buffer of 2.0 μ L, 2.0mMdNTPs2 μ L; Described amplification program: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of renaturation 30s, 72 DEG C extend 30s, 32 circulations; Last 72 DEG C extend 7min.
5. according to claim 2 based on the conventional rice variety Huaihe River rice No. 5 of InDel mark and the authentication method of Huaihe River rice No. 18, it is characterized in that: in step 3, gel electrophoresis analysis is specially: add appropriate sample-loading buffer in the product increased described in step 2, under 22V/cM constant electric field strength, through 12% denaturing polyacrylamide gel electrophoresis after 100 minutes, the colour developing of silver dye.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804539.7A CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804539.7A CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105420354A true CN105420354A (en) | 2016-03-23 |
| CN105420354B CN105420354B (en) | 2018-12-25 |
Family
ID=55498889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510804539.7A Active CN105420354B (en) | 2015-11-20 | 2015-11-20 | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105420354B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666758A (en) * | 2019-02-14 | 2019-04-23 | 四川省农业科学院经济作物育种栽培研究所 | Genuine rhizome of chuanxiong identification primer and identification method based on InDel label |
| CN113308563A (en) * | 2021-05-28 | 2021-08-27 | 扬州大学 | Method for rapidly developing Australian wild rice specific molecular marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031253A (en) * | 2010-12-16 | 2011-04-27 | 复旦大学 | Molecular marker method for identifying indica type rice and japonica rice by using rice grain |
| CN104789671A (en) * | 2015-04-10 | 2015-07-22 | 上海交通大学 | Identification method for hybrid rice variety hybrid source superior 69 based on InDel (insertion-deletion length polymorphism) marker |
-
2015
- 2015-11-20 CN CN201510804539.7A patent/CN105420354B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031253A (en) * | 2010-12-16 | 2011-04-27 | 复旦大学 | Molecular marker method for identifying indica type rice and japonica rice by using rice grain |
| CN104789671A (en) * | 2015-04-10 | 2015-07-22 | 上海交通大学 | Identification method for hybrid rice variety hybrid source superior 69 based on InDel (insertion-deletion length polymorphism) marker |
Non-Patent Citations (1)
| Title |
|---|
| 孙宽 等: "新一代遗传标记——InDel研究进展", 《法医学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109666758A (en) * | 2019-02-14 | 2019-04-23 | 四川省农业科学院经济作物育种栽培研究所 | Genuine rhizome of chuanxiong identification primer and identification method based on InDel label |
| CN109666758B (en) * | 2019-02-14 | 2023-03-07 | 四川省农业科学院经济作物育种栽培研究所 | InDel-labeled primer for identifying ligusticum wallichii franchetii and identification method |
| CN113308563A (en) * | 2021-05-28 | 2021-08-27 | 扬州大学 | Method for rapidly developing Australian wild rice specific molecular marker |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105420354B (en) | 2018-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN102031253B (en) | Molecular marker method for identifying indica type rice and japonica rice by using rice grain | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN105886613B (en) | Method for constructing soybean variety SSR fingerprint identification card | |
| CN101921866A (en) | Method for identifying cotton variety by utilizing SSR core primers | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN105132570B (en) | A kind of primer sets of assistantly screening anti-stripe rust wheat and its application | |
| CN107012217A (en) | One group is used to distinguish the SNP marker that China is bred as sesame variety | |
| CN104774922B (en) | The molecular labeling WGRB125 of wheat flag leaf gene TaFLW1 wide and its application | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN105176978A (en) | Molecular marker primer of disease-resistant gene ty-5 of tomato yellow leaf curl disease and application of molecular marker primer | |
| CN105462971B (en) | The specific molecular marker and its primer special of rice blast resistant gene Pi2 | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN106480224A (en) | The molecular marker combination of Rapid identification difference albino tea tree breed, method and application | |
| CN105385769A (en) | SSR molecular marker method for identifying foxtail millet variety and application | |
| CN105112523A (en) | SSR (Simple Sequence Repeats) core primer group developed on basis of whole-genome sequences of cabbages and application | |
| CN105713983B (en) | A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage | |
| CN110257551B (en) | SSR primers for constructing peach DNA fingerprint, application and construction method | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| CN106434869A (en) | Brown-planthopper-resistant gene Bph14 molecular marker for rice and application | |
| CN102296124B (en) | A kind of RAPD of utilization distinguishes the method for jujube kind fast | |
| CN112481410A (en) | SNP loci significantly associated with wheat stripe rust resistance and application thereof in genetic breeding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhu Mingchao Inventor after: Zhang Dabing Inventor after: Yuan Zheng Inventor after: Yuan Caiyong Inventor after: Wei Jiaojun Inventor after: Ni Xiangqun Inventor after: Wen Zhenghuai Inventor after: Yan Weigu Inventor after: Zhang Jinping Inventor before: Yuan Zheng Inventor before: Zhang Dabing Inventor before: Zhu Mingchao Inventor before: Yuan Caiyong Inventor before: Wei Jiaojun Inventor before: Ni Xiangqun Inventor before: Wen Zhenghuai Inventor before: Yan Weigu Inventor before: Zhang Jinping |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |