CN105886613B - Method for constructing soybean variety SSR fingerprint identification card - Google Patents

Abstract

The invention relates to a method for constructing a soybean variety SSR fingerprint identity card, which is characterized by comprising the following steps: firstly, preliminarily screening SSR markers, then determining core markers required by the construction of the SSR fingerprint identity cards of soybean varieties by taking the diversity index as a selection basis, then recording the whole fingerprint banding patterns of the core SSR markers in the soybean varieties, carrying out digital coding on the banding patterns, and finally connecting the banding patterns of the core SSR markers in series according to a fixed sequence, namely, the SSR fingerprint identity card codes of the soybean varieties. The method effectively solves the technical problems that an allelic variation recording mode in the traditional method is easy to generate errors, a large number of SSR marker combinations are not beneficial to subsequent comparison identification, popularization and application and the like, has the advantages of simple and clear variety distinguishing, easy data archiving, recording, analysis and comparison and the like, and can provide scientific and effective reference basis for quickly and accurately identifying new varieties of soybeans, evaluating germplasm resources and solving variety property disputes.

Description

Method for constructing soybean variety SSR fingerprint identification card

Technical Field

The invention relates to a method for constructing a soybean variety SSR fingerprint identity card, belonging to the technical field of molecular identification of crop varieties.

Background

The variety identification is an important step in seed production, and is an important means for protecting new varieties, preventing counterfeit and shoddy varieties from entering the market and maintaining the benefits of farmers. In recent years, with the recycling of excellent parents and the lack of new germplasm, some soybean varieties have similar kindred relationships and similar phenotypic characteristics, but the traditional soybean variety identification method is based on the morphological characteristics of seeds, seedlings and plants, the difference of agronomic characters and the like, is simple and economic, but has a long required period, the phenotypic characteristics are easily influenced by the environment, and the identification error occurs sometimes, so that the requirement of the current variety identification cannot be met (Chinese oil crop academy, 2013/35(3)// 231-239). With the development of molecular biology technology, the method for directly detecting genotype difference among varieties by means of SSR molecular marker fingerprint identity card technology has become more accurate and efficient variety identification technology than the traditional morphological identification method.

At present, two technical problems exist in the traditional method for constructing the SSR fingerprint identity card of the soybean variety: firstly, when counting the SSR marker amplified fragments, the sizes of the amplified fragments are mostly recorded as 1, 2, 3, 9, n in sequence according to the sizes of the amplified fragments and the corresponding molecular weights from large to small, and the coding mode easily causes the problems of reading errors, difficult statistics and the like when the SSR amplified bands are more and the distribution is complex, so that the subsequent data statistical analysis results are directly influenced (academic reports on wheat crops, 2006/26(4)// 164-168); secondly, the number of SSR marker combinations used is large, so that the number of digits of the fingerprint identity card is increased, the workload is greatly increased in the actual application process, and the subsequent comparison identification and popularization and application are not facilitated (Chinese agricultural science, 2011/44(10)// 2081-2093). In order to provide more powerful technical support for the protection and management of soybean germplasm resources and variety rights, the improvement and the improvement of the existing soybean variety fingerprint spectrum identity card technical system are needed.

Disclosure of Invention

The invention aims to provide a method for constructing a soybean variety SSR fingerprint identity card, which can effectively solve the technical problems that an allelic variation recording mode in the traditional method is easy to generate errors, a large number of marker combinations are not beneficial to subsequent comparison identification, popularization and application and the like, has the advantages of simple and clear variety distinguishing, easy data archiving, recording, analysis and comparison and the like, and can provide scientific, accurate and effective technical support for quick identification and accurate evaluation of new soybean varieties.

In order to achieve the aim, the invention provides a method for constructing a soybean variety SSR fingerprint identity card, which is characterized by comprising the following specific steps of:

1) extracting soybean variety genome DNA: the concentration of a reducing agent beta-mercaptoethanol in the extracting solution is increased from 1 percent to 2.5 percent by utilizing an improved CTAB method, so that the browning degradation of tissues in the DNA extracting process is effectively reduced; the polyvinylpyrrolidone PVP40 with the concentration of 5% is added into the extracting solution, so that not only can substances such as pigments, fat and the like be effectively removed, but also the integrity of DNA can be improved; in the presence of phenol: during chloroform extraction, phenol with pH of 4.0 is used, and the phenol can promote protein in a water phase to be distributed to an organic phase under the condition of low pH, so that the protein is removed to the maximum extent, and the purity of DNA is improved, namely genomic DNA is extracted from 0.1g of soybean young leaves, diluted to 10-15 ng/microliter and stored in a refrigerator at the temperature of-20 ℃ for later use;

2) preliminary screening of SSR markers: selecting 320 SSR markers uniformly distributed on 20 linked groups of soybeans, carrying out PCR amplification and non-denaturing polyacrylamide gel electrophoresis detection, and carrying out primary screening on the SSR markers to obtain 12 SSR markers with stable amplification, clear bands and high polymorphism, wherein the 12 SSR markers are Satt397, Satt235, Satt422, Satt _128, Satt160, Satt367, Satt 155, Satt448, Sat _245, Satt494, Sat _288 and Sat _351 respectively;

3) recording and data statistical analysis of SSR band types: recording the overall banding pattern of each SSR marker amplified on the soybean variety as an allelic variation according to the detection result of non-denaturing polyacrylamide gel electrophoresis, then arranging all the banding patterns of each SSR marker amplified on the soybean variety from simple to complex, and sequentially recording the banding patterns as 1, 2, 3. Calculating the allelic variation number and the diversity index of each SSR marker by utilizing POPGENE 1.31 statistical software; the expression that all the banding patterns amplified by each SSR marker on the soybean variety are arranged in the order from simple to frequent means that the number of amplified bands is small and the banding patterns are simple; the number of amplified bands is large, and the band type is complicated;

4) determining core markers required by establishing the soybean variety SSR fingerprint identity card: and (3) taking the height of the diversity index as a selection basis, and adding the SSR marker obtained by primary screening in the step 2) until the marker combination can completely distinguish the soybean varieties. Since the 7 SSR markers can completely distinguish soybean varieties, the 7 SSR markers Satt422, Sat _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245 are determined as core markers required by the construction of the SSR fingerprint identity cards of the soybean varieties; selecting 12 initially-selected SSR markers, wherein the selection standard is that the SSR markers obtained by primary screening in the step 2) are added once according to the selection basis of the diversity index until the marker combination can distinguish all soybean varieties;

5) constructing an SSR fingerprint identity card of a soybean variety: recording the whole banding patterns of the core SSR markers obtained in the step 4) after PCR amplification in soybean varieties, arranging the banding patterns from simple to complex sequence, sequentially coding the banding patterns into 1, 2, 7 and n, finally, for each variety, connecting 7 banding patterns of the variety in series according to the fixed SSR marker sequence (Satt 422, Sat _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245 in sequence) to form a group of data arranged by 7 numbers, namely SSR fingerprint identification card codes of the soybean varieties.

The invention has the positive effects that:

1. the method is an applicable genetic germplasm analysis method, which digitizes the characteristics of varieties on the basis of fingerprint spectra, so that each variety has a code in a character string form, and compared with the traditional field planting identification method, the method has the advantages of short period, easiness in operation, good stability, high repeatability, reality, reliability, simplicity, clarity, easiness in archiving, recording, analyzing and comparing and the like, and can be effectively applied to the aspects of authenticity identification, genetic relationship analysis, resolution of variety property disputes and the like of soybean varieties;

2. according to the difference between each pair of SSR amplified banding patterns, the banding patterns are directly numbered integrally, so that each SSR marker has a corresponding digital identifier in different banding patterns amplified in different soybean varieties, the recording mode of the SSR banding patterns is simplified, the readability of the SSR marker amplified banding is improved, and errors caused by manual statistics are effectively avoided;

3. on the premise of ensuring the uniqueness of the digital code, the purpose of constructing the SSR fingerprint identity card of the soybean variety by using fewer marker combinations as much as possible is realized, the workload can be obviously reduced in the actual popularization and application process, the subsequent variety comparison and identification are facilitated, scientific, accurate and effective technical support can be provided for the rapid identification and accurate evaluation of the new soybean variety, and the method has important significance for protecting and utilizing germplasm resources, identifying the quality of seeds and protecting variety rights and interests.

Drawings

FIG. 1 shows allelic variation characteristics of SSR markers in soybean varieties screened for initially in one embodiment of the invention.

Detailed Description

The present invention is further described by the following examples, which do not limit the present invention in any way, and any modifications or changes that can be easily made by a person having ordinary skill in the art to the present invention will fall within the scope of the claims of the present invention without departing from the technical solution of the present invention.

Example (b): construction of SSR fingerprint identity card of newly bred soybean variety in Jilin province

(1) Extraction of genomic DNA of soybean variety

98 soybean varieties approved in 2005-2012 of Jilin province are selected, genome DNA is extracted from 0.1g of young soybean leaves by an improved CTAB method, and the extracted genome DNA is diluted to 10-15 ng/mu l and stored in a refrigerator at the temperature of-20 ℃ for later use.

(2) PCR amplification and polyacrylamide gel electrophoresis detection

The total volume of the PCR amplification reaction system was 20. mu.l, containing 10-15ng genomic DNA, 0.25. mu. mol/l upstream and downstream primers, 200. mu. mol/l dNTPs, 0.5U Taq enzyme (TaKaRa), 1 XPCR buffer (10 mmol/l Tris-HCl, pH 8.3; 50 mmol/l KCl; 1.5 mmol/l MgCl 2). The PCR amplification reaction program is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 30 times; extension at 72 ℃ for 10 min. After the PCR amplification reaction, 3. mu.l of a sample buffer (36% glycerol, 30 mmol/l EDTA, 0.05% bromophenol blue, 0.035% xylene cyan) was added to the amplified product, 2.5. mu.l was electrophoresed and separated in 12% native polyacrylamide gel at constant pressure, and developed by silver nitrate staining.

(3) Preliminary screening for SSR markers

According to an SSR marker primer sequence provided by an SoyBase website, 320 SSR markers uniformly distributed on 20 linked groups of soybeans are selected, firstly, 20 soybean varieties are utilized to carry out primary screening of the SSR markers, and 12 markers (shown in figure 1) with stable amplification, clear bands and high polymorphism are obtained, wherein the 12 SSR markers are Satt397, Satt235, Satt422, Sat _128, Satt160, Satt367, Sat155, Satt448, Sat _245, Satt494, Sat _288 and Sat _ 351. Allelic variation and diversity index for each SSR marker were calculated using the POPGENE 1.31 statistical software (table 1).

(4) Determination of core markers required for establishing soybean variety SSR fingerprint identity card

In order to achieve the purpose of distinguishing the most varieties by using the minimum SSR markers, the varieties are screened from the marker Satt422 with the highest diversity index by taking the diversity index of 12 SSR markers obtained by primary screening as a selection basis, but no variety can be distinguished; then adding a mark Sat _351 with the second highest diversity index, and finding that 10 varieties can be distinguished; then adding a marker Satt160 with the third highest diversity index, and as a result, 49 varieties can be distinguished; then adding a mark Sat _128 with the fourth highest diversity index, and finding that 72 varieties can be distinguished; then adding a mark Sat155 with the fifth highest diversity index, and finding that 84 varieties can be distinguished; then adding a marker Satt397 with the sixth highest diversity index, and finding that 94 varieties can be distinguished; finally, the marker Sat _245 with the seventh highest diversity index was added, and as a result, it was found that all 98 varieties could be distinguished (Table 2). Therefore, 7 SSR markers including Satt422, Sat _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245 are determined as core markers required for establishing the SSR fingerprint identity cards of the soybean varieties.

(5) Construction of soybean variety SSR fingerprint identification card

The overall banding patterns obtained after PCR amplification of 7 core SSR markers in 98 soybean varieties were recorded and digitally encoded. Taking Satt422 as an example, it has 3 allelic variations (Table 1), i.e., it has 3 banding patterns in soybean varieties after PCR amplification, the 3 banding patterns are arranged in a simple to complex order, and are coded as 1, 2, and 3 in sequence. In the same way, the amplified overall banding patterns of other core SSR markers are digitally encoded.

For each soybean variety, 7 core SSR markers are assigned to 7 band-type codes of the variety, and the 7 band-type codes are connected in series according to a fixed SSR marker sequence (Satt 422, Sat _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245 in sequence), so that a group of data formed by arranging 7 numbers, namely fingerprint identification card codes of various varieties can be formed (Table 3). Taking Jiyun 202 in Table 3 as an example, the fingerprint identification card code is 3213311, which indicates that the amplification band type of the 1 st SSR core marker (Satt 422) is the band type No. 3, the amplification band type of the 2 nd SSR core marker (Sat _ 351) is the band type No. 2, the amplification band type of the 3 rd SSR core marker (Satt 160) is the band type No. 1, the amplification band type of the 4 th SSR core marker (Sat _ 128) is the band type No. 3, the amplification band type of the 5 th SSR core marker (Sat 155) is the band type No. 3, the amplification band type of the 6 th SSR core marker (Satt 397) is the band type No. 1, and the amplification band type of the 7 th SSR core marker (Sat _ 245) is the band type No. 1.

The primer sequences of the 12 SSR markers (containing 7 core SSR markers) are as follows:

SSR fingerprint identification card codes of table 398 soybean varieties

。

Claims (3)

1. The method for constructing the soybean variety SSR fingerprint identity card is characterized by comprising the following specific steps of:

1) extracting soybean variety genome DNA: extracting gene DNA from 0.1g of soybean young leaves by using an improved CTAB method, diluting to 10-15 ng/mu L, and storing in a refrigerator at-20 ℃ for later use;

2) preliminary screening of SSR markers: selecting 320 SSR markers uniformly distributed on 20 linked groups of soybeans, carrying out PCR amplification and non-denaturing polyacrylamide gel electrophoresis detection, and carrying out primary screening on the SSR markers to obtain 12 SSR markers which are stable in amplification, clear in band and high in polymorphism, namely Satt397, Satt235, Satt422, Sat _128, Satt160, Satt367, Sat155, Satt448, Sat _245, Satt494, Sat _288 and Sat _ 351;

3) recording and data statistical analysis of SSR band types: recording the overall banding pattern of each SSR marker amplified on the soybean variety obtained in the step 2) according to the detection result of the non-denaturing polyacrylamide gel electrophoresis, and statistically analyzing the diversity index of each SSR marker;

4) determining core markers required by establishing the soybean variety SSR fingerprint identity card: using the height of the diversity index as a selection basis, and adding the primary screening SSR marker obtained in the step 2) until the marker combination can completely distinguish the soybean varieties; according to the SSR markers with the highest diversity index, firstly, screening soybean varieties from a marker with the highest diversity index, then adding markers with the second, third and fourth diversity indexes, namely the markers with the second, third and fourth diversity indexes, obtaining 7 SSR markers for completely distinguishing the soybean varieties, namely Satt422, Satt _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245, and determining the 7 SSR markers as core markers required by the construction of SSR fingerprint identity cards of the soybean varieties;

5) constructing an SSR fingerprint identity card of a soybean variety: recording the whole banding patterns obtained after the PCR amplification of the core SSR markers obtained in the step 4) in the soybean varieties, carrying out digital coding on the banding patterns, and then serially connecting the banding patterns according to the fixed SSR marker sequence to form fingerprint identification card codes of the soybean varieties;

in the improved CTAB method, the concentration of beta-mercaptoethanol is 2.5 percent, the concentration of polyvinylpyrrolidone PVP40 is 5 percent, and the pH value of phenol is 4.0 during chloroform extraction;

the corresponding primers used in the PCR amplification are shown in the following table:

SSR markers Location of soybean linkage group Upstream primer sequence Sequence of downstream primer Satt422 C2 ATTAGGGGAGGGGAGGTAAAAAGT TGAAGGCCCGATATCCAAATAAA Sat_351 D1b GCGCCACCCAAGGGCATCTTTCG GCGGGCCGCAACTATGAAAAGAC Satt160 F TCCCACACAGTTTTCATATAATATA CATCAAAAGTTTATAACGTGTAGAT Sat_128 B1 GGGGTTTTGTTAATCATTGTCCTTAGAT GGGAGAAAATTTTTAATGCCAGTAGTTA Sat155 A1 AGATCCAACACCTGGCCTAAT GCTGCACAATTCATTCCATTT Satt397 D2 TCTCGGGATCCTTGTTAGAT GCGAAGAAGAAGAGAACATGTGAA Sat_245 L GCGAGCCTACTTTTACTAGAACGTCAACAAG GCGAAAAATTCAACTCCCCTTTAATAGATTC Satt235 G GCGGGCTTTGCCAAGAAGTTT GCGGTGAGGCTGGCTATAAG Satt367 I GCGGATATGCCACTTCTCTCGTGAC GCGGAATAGTTGCCAAACAATAATC Satt448 L GCGCTAAGGGCAATTTTATTCAA GCGCAGCCTGTTCAGTTTTTCTTTTGTC Satt494 M GGCCGGTTCTCATTACAGGTCTCT GGATTTCCATCTTGAATTTTATTA Sat_288 M GCGACAGACTGCAAGAATTGATGTAAATCT GCGGGAAGGTAGGTTAAAGAAAATTCAAATGA

。

2. The method for constructing the soybean variety SSR fingerprint identity card according to claim 1, wherein when the SSR banding patterns are recorded and subjected to data statistical analysis, the overall banding pattern of each SSR marker amplified on the soybean variety is recorded and used as an allelic variation, then all the banding patterns of each SSR marker amplified on the soybean variety are arranged in the order from simple to frequent and are recorded as 1, 2, 1.

3. A method for constructing a soybean variety SSR fingerprint identity card is characterized in that a modified CTAB method is utilized to extract gene DNA from 0.1g of young soybean leaves, the gene DNA is diluted to 10-15 ng/mu L and the young soybean leaves are stored in a refrigerator at the temperature of-20 ℃ for later use; recording the whole banding patterns of 7 core SSR markers in the soybean varieties after PCR amplification, arranging the banding patterns from simple to complex sequence, and sequentially coding the banding patterns into 1, 2, 1, n, and finally, for each variety, giving the 7 banding patterns to the variety by 7 core SSR markers, sequentially connecting the 7 banding patterns according to the fixed SSR marker sequence, namely Satt422, Satt _351, Satt160, Sat _128, Sat155, Satt397 and Sat _245, and forming a group of data which are arranged by 7 numbers, namely SSR fingerprint identity card codes of the soybean varieties;

in the improved CTAB method, the concentration of beta-mercaptoethanol is 2.5 percent, the concentration of polyvinylpyrrolidone PVP40 is 5 percent, and the pH value of phenol is 4.0 during chloroform extraction;

the corresponding primers used in the PCR amplification are shown in the following table:

SSR markers Location of soybean linkage group Upstream primer sequence Sequence of downstream primer Satt422 C2 ATTAGGGGAGGGGAGGTAAAAAGT TGAAGGCCCGATATCCAAATAAA Sat_351 D1b GCGCCACCCAAGGGCATCTTTCG GCGGGCCGCAACTATGAAAAGAC Satt160 F TCCCACACAGTTTTCATATAATATA CATCAAAAGTTTATAACGTGTAGAT Sat_128 B1 GGGGTTTTGTTAATCATTGTCCTTAGAT GGGAGAAAATTTTTAATGCCAGTAGTTA Sat155 A1 AGATCCAACACCTGGCCTAAT GCTGCACAATTCATTCCATTT Satt397 D2 TCTCGGGATCCTTGTTAGAT GCGAAGAAGAAGAGAACATGTGAA Sat_245 L GCGAGCCTACTTTTACTAGAACGTCAACAAG GCGAAAAATTCAACTCCCCTTTAATAGATTC Satt235 G GCGGGCTTTGCCAAGAAGTTT GCGGTGAGGCTGGCTATAAG Satt367 I GCGGATATGCCACTTCTCTCGTGAC GCGGAATAGTTGCCAAACAATAATC Satt448 L GCGCTAAGGGCAATTTTATTCAA GCGCAGCCTGTTCAGTTTTTCTTTTGTC Satt494 M GGCCGGTTCTCATTACAGGTCTCT GGATTTCCATCTTGAATTTTATTA Sat_288 M GCGACAGACTGCAAGAATTGATGTAAATCT GCGGGAAGGTAGGTTAAAGAAAATTCAAATGA

。

Images