CN107245530A - A kind of molecular labeling, authentication method and application for identifying the long character of rice grain - Google Patents
A kind of molecular labeling, authentication method and application for identifying the long character of rice grain Download PDFInfo
- Publication number
- CN107245530A CN107245530A CN201710705246.2A CN201710705246A CN107245530A CN 107245530 A CN107245530 A CN 107245530A CN 201710705246 A CN201710705246 A CN 201710705246A CN 107245530 A CN107245530 A CN 107245530A
- Authority
- CN
- China
- Prior art keywords
- tpap
- grain
- long
- seq
- rice grain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, disclose a kind of molecular labeling, authentication method and application for identifying the long character of rice grain, the molecular labeling is GS3 TPAP, including the GS3 TPAP I R shown in the GS3 TPAP I F and SEQ ID NO.4 shown in GS3 TPAP O R, the SEQ ID NO.3 shown in GS3 TPAP O F, SEQ ID NO.2 of the nucleotide sequence as shown in SEQ ID NO.1.The molecular labeling can carry out Direct Identification, and rate of accuracy reached 100% to two kinds of allelotypes of the long character of rice grain of GS3 genes, can preferably distinguish two kinds of allelotypes, it is not influenced by environmental conditions, operating method is identified, expends relatively low, is suitable for promoting the use of on a large scale.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of molecule mark of the long character of identification rice grain
Note, authentication method and application.
Background technology
Paddy rice grain length is the important factor in order of Appearance Quality of Paddy Rice, and the general chalk of long-grained rice is relatively low in vain, exterior quality
Preferably, commercial value is higher, while being favorably improved grain weight further improves yield.Favored by breeder.Paddy
The identification of grain length character needs substantial amounts of sample size, is difficult to carry out selection work in the breeding work early generation, passes through molecule
A selection for type rice variety is grown in mark auxiliary progress can greatly improve efficiency of selection, not limited by generation and sample size
System, is the best means for improveing paddy rice grain length character.
GS3 genes are as the main effect QTL of regulation and control rice grain length in 2006 by successful clone.GS3 genes are located in water
No. 3 nearly centric regions of chromosome of rice, the feature base difference position of long grain gs3 allelotypes and short grain GS3 allelotypes
In its intron 2, A-C SNP differences form above two allelotype.With bright extensive 63 (big grains) be recurrent parent with
Nipponbare (granule) carries out continuous hybrid and backcrossing, constructs GS3 NIL.To BC3F2Random of 201 of offspring
Body is analyzed, it is found that GS3 explains the variation of colony 80-90% grain lengths.
GS3 genes are directed to, forefathers developed several to identification primer, and were divided into linked marker and the function based on enzyme incision technology
Property molecular labeling.But there is false positive phenomenon during Chromosome recombination in linked marker, the feature based on enzyme incision technology
Molecular labeling is in use due to being related to the application of restriction enzyme, and it operates expensive, takes longer.To sum up institute
State, the identification marking built is not suitable for the detection of lot of materials in molecular mark, PCR-based technology is available for mirror
Determine the functional molecular marker missing of above two allelotype.
The content of the invention
Molecular labeling, authentication method and the application for a kind of long character of identification rice grain that the present invention is provided, be at present only
The individual functional molecular marker for being directed to the gene constructed PCR types of GS3 one by one, the molecular labeling can preferably distinguish paddy rice paddy
Two kinds of allelotypes of grain length character, it is simple to operate, expend relatively low.
First purpose of the present invention is to provide a kind of molecular labeling for identifying the long character of rice grain, the molecular labeling
For GS3-TPAP, including shown in GS3-TPAP-O-F, SEQ ID NO.2 of the nucleotide sequence as shown in SEQ ID NO.1
The GS3-TPAP-I-R shown in GS3-TPAP-I-F and SEQ ID NO.4 shown in GS3-TPAP-O-R, SEQ ID NO.3.
Second object of the present invention is to provide a kind of method using the above-mentioned long character of molecular markers for identification rice grain,
Comprise the following steps：
S1, extracts the genomic DNA of rice material to be measured；
S2, the genomic DNA obtained using S1 is template, with GS3-TPAP-O-F, GS3-TPAP-O-R, GS3-TPAP-I-F
It is that primer enters performing PCR amplification with GS3-TPAP-I-R；
S3, result judgement
Combined using GS3-TPAP-O-F with GS3-TPAP-O-R and amplify 270bp fragments and be used as positive control；Work as GS3-
TPAP-I-F is combined with GS3-TPAP-O-R when amplifying 147bp fragments, and detection material is long grain allelotype A；Work as GS3-
TPAP-O-F is combined with GS3-TPAP-I-R when amplifying 177bp fragments, and detection material is short grain allelotype C.
It is preferred that, the method for the above-mentioned long character of molecular markers for identification rice grain, PCR amplification response procedures be：95℃
Pre-degeneration 5min；95 DEG C of denaturation 30s, 55.1 DEG C of annealing 30s, 72 DEG C of extension 30s-50s, 35 circulations；72 DEG C of extension 10min；4
DEG C cooling 10min.
Third object of the present invention is to provide a kind of above-mentioned molecular labeling in the long trait molecular marker auxiliary of rice grain
Application in seed selection.
It is long in rice grain that fourth object of the present invention is to provide a kind of method of the above-mentioned long character of identification rice grain
Application in trait molecular marker assist-breeding.
Compared with prior art, the present invention provide it is a kind of identify the molecular labeling of the long character of rice grain, authentication method and
Using having the advantages that：
Feature SNP differences of the invention based on its intron 2 of GS3 genes A-C, are obstructed using four primers and expand mutation
Principle (Tetra-primer ARMS-PCR), designs the functional molecular marker GS3-TPAP of PCR-based, and constructs the mark
The PCR amplification system of note.Molecular labeling GS3-TPAP is currently the only one work(for being directed to the gene constructed PCR types of GS3
Can property molecular labeling.
At present, the identification of GS3 alleles type mainly utilizes several marks such as GS09, MRG5881 and GS3-PstI.
GS09 and MRG5881 are linked markers, there is false positive phenomenon during Chromosome recombination, accuracy rate is between 50-70%；
GS3-PstI is functional molecular marker, and accuracy rate is higher, but due to being related to the application of restriction enzyme, it operates high
It is expensive, take longer.The identification marking built is not suitable for the detection of lot of materials in molecular mark.The present invention is carried
The molecular labeling GS3-TPAP of confession is identified from the functional polymorphism of DNA base, is functional molecular marker, inventor
The rate of accuracy reached 100% of the molecular labeling is confirmed by many experiments material, it is not influenced by environmental conditions；Compared to digestion mark
Note GS3-PstI can significantly improve detection efficiency, can preferably distinguish two kinds of allelotypes, reduce testing cost, PCR
Amplification is simple to operate, with high pass flow characteristic, expends relatively low, is the identification of GS3 alleles types and corresponding molecule mark
Note assisted Selection work lays a solid foundation, and is suitable for promoting the use of on a large scale.
Brief description of the drawings
Fig. 1 is the GS3 genes of bright extensive 63 material；
Fig. 2 is the GS3 genes of Nipponbare material；
Fig. 3 is that different annealing temperature group enters performing PCR amplification；
Wherein, M swimming lanes are DNA standard molecular weights；1st, 3,5,7,9,11,13,15 swimming lanes are respectively that bright extensive 63 material exists
55.1 DEG C, 55.4 DEG C, 55.8 DEG C, 56.3 DEG C, 57.1 DEG C, 57.7 DEG C, 58.4 DEG C, the amplification under 59.1 DEG C of annealing temperatures；
2nd, 3,4,5,10,12,14,16 swimming lanes be respectively Nipponbare material 55.1 DEG C, 55.4 DEG C, 55.8 DEG C, 56.3 DEG C, 57.1 DEG C,
57.7 DEG C, 58.4 DEG C, the amplification under 59.1 DEG C of annealing temperatures.
Embodiment
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings, but should not be construed as the limit of the present invention
System.Experimental method in following embodiments, is conventional method unless otherwise specified, material used, examination in following embodiments
Agent etc., unless otherwise specified, is commercially obtained.
A kind of molecular labeling for long character of identification rice grain that the present invention is provided, the molecular labeling is GS3-TPAP,
The GS3-TPAP-O-R shown in GS3-TPAP-O-F, SEQ ID NO.2 including nucleotide sequence as shown in SEQ ID NO.1,
The GS3-TPAP-I-R shown in GS3-TPAP-I-F and SEQ ID NO.4 shown in SEQ ID NO.3.
Specifically obtain in accordance with the following methods：
Cloned sequence (Os03g0407400) is searched by RAP-DB：SNP differences from its intron 2 A-C are carried out
Design, material to be tested is allelotype material known to GS3 genes, and bright extensive 63 carry long grain allelotype gs3, and Nipponbare is taken
With short grain allelotype GS3.Molecular labeling design is carried out using online primer-design software Primer1, GS3- is named as
TPAP, GS3-TPAP include SEQ ID NO.1 shown in GS3-TPAP-O-F, SEQ ID NO.2 shown in GS3-TPAP-O-R,
The GS3-TPAP-I-R shown in GS3-TPAP-I-F and SEQ ID NO.4 shown in SEQ ID NO.3, its sequence information refers to table
1。
SEQ ID NO.5 is carry long bright extensive 63 nucleotide sequence of grain allelotype, wherein 1-30 are GS3-
TPAP-O-F binding site, the 242-270 binding sites for GS3-TPAP-O-R, 124-149 are GS3-TPAP-
I-F binding site, the 149-177 invalid amplification sites for GS3-TPAP-I-R.As shown in figure 1, SNP differences in Fig. 1
Site represents that the letter with underscore represents primer binding site, and solid arrow represents primer amplification side with tilted letter A is blackened
To dotted arrow represents effectively to expand.
SEQ ID NO.6 is carry the nucleotide sequence of short grain allelotype Nipponbare, wherein 1-30 are GS3-
TPAP-O-F binding site, the 242-270 binding sites for GS3-TPAP-O-R, 124-149 are GS3-TPAP-
I-F invalid amplification site, the 149-177 binding sites for GS3-TPAP-I-R.As shown in Fig. 2 SNP differences in Fig. 2
Site represents that the letter with underscore represents primer binding site, and solid arrow represents primer amplification side with tilted letter C is blackened
To dotted arrow represents effectively to expand.
Each molecule labelled series in table 1GS3-TPAP
| Gene | Mark | Sequence (5 ' -3 ') |
| GS3 | GS3-TPAP-I-F | GGATCCACGCTGCCTCCAGATGCTTA |
| GS3 | GS3-TPAP-I-R | AAAGAAACAGCAGGCTGGCTTACTCTCGG |
| GS3 | GS3-TPAP-O-F | CCTCAGACATCACCTGAAAAGTTGACAGGC |
| GS3 | GS3-TPAP-O-R | CGGTCAAAGTTCATGATCAAAAACTGGGG |
Embodiment 1
The long character of grain for examination rice material is identified using above-mentioned molecular labeling GS3-TPAP, following step is specifically included
Suddenly：
Material to be tested is control material bright extensive 63 and Nipponbare during GS3 gene clonings are tested, wherein bright extensive 63 carry length
Grain allelotype GS3, Nipponbare carries short grain allelotype GS3.
S1, extracts the genomic DNA of bright extensive 63 and two rice materials to be measured of Nipponbare respectively, and extracting genome DNA is adopted
Carried out (operation illustrates according to kit) with the golden plant DNA extraction kit of full formula.
S2, the genomic DNA obtained using S1 is template, with GS3-TPAP-O-F, GS3-TPAP-O-R, GS3-TPAP-I-F
It is that primer enters performing PCR amplification with GS3-TPAP-I-R.
Pcr amplification reaction system is 10 μ L：Including the μ L of DNA 0.2 (1ng/ μ L)；GS3-TPAP-O-F、GS3-TPAP-O-R
Each each 0.2 μ L of 0.3 μ L, GS3-TPAP-I-F, GS3-TPAP-I-R；2 × Tap PCR Master Mix (band dyestuff, Kang Weishi
Ji companies buy) 5.0 μ L；ddH2O 3.8μL。
Wherein GS3-TPAP-O-F, GS3-TPAP-O-R are outer primer, and GS3-TPAP-I-F and GS3-TPAP-I-R are interior
Primer, each primer concentration is 4pmol/ μ L.
PCR expands anti-program of answering：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 55.1 DEG C of annealing 30s, 72 DEG C of extensions
30s, 35 circulations；72 DEG C of extension 10min；4 DEG C of cooling 10min.Reaction product 100V electrophoresis 1h on 5% Ago-Gel,
After being dyed through ethidium bromide (Ethidium Bromide, EB) and in being observed under gel imaging system, result is recorded.
S3, result judgement
Combined using GS3-TPAP-O-F with GS3-TPAP-O-R and amplify 270bp fragments and be used as positive control；Work as GS3-
TPAP-I-F is combined with GS3-TPAP-O-R when amplifying 147bp fragments, and detection material is long grain allelotype A；Work as GS3-
TPAP-O-F is combined with GS3-TPAP-I-R when amplifying 177bp fragments, and detection material is short grain allelotype C.
8 annealing temperature groups of 2 control materials are entered with performing PCR by GS3-TPAP to expand, wherein, 8 of PCR amplifications
Annealing temperature is respectively 55.1 DEG C, 55.4 DEG C, 55.8 DEG C, 56.3 DEG C, 57.1 DEG C, 57.7 DEG C, 58.4 DEG C, 59.1 DEG C, its tail
Sequence is with reference to the record of the preceding paragraph pcr amplification reaction program.Different annealing temperature group enter performing PCR amplification as shown in figure 3, by
Fig. 3 is understood, when annealing temperature is 55.1 DEG C, and ribbon area shows clearly in electrophoretogram, in the absence of false positive phenomenon.GS3-TPAP-
O-F is combined with GS3-TPAP-O-R amplifies 270bp fragments as positive control；When detection material is that long grain allelotype is bright
When extensive 63, GS3-TPAP-I-F is combined with GS3-TPAP-O-R amplifies 147bp fragments；When detection material is short grain allele
During type Nipponbare, GS3-TPAP-O-F is combined with GS3-TPAP-I-R amplifies 177bp fragments.Because the control material of selection is
Material has been sequenced in the gene loci in forefathers' research, it was confirmed that GS3-TPAP validity and accuracy.
Embodiment 2
The genotype detection of DH colony offsprings is carried out using molecular labeling GS3-TPAP
DH colonies are that bright extensive 63 (male parents) of long grain allelotype rice varieties hybridize short grain allelotype rice varieties
Qiu Guang (female parent), the 140 stable strains obtained by Anther Culture, by marking GS3-TPAP to carry out 140 stable strains
The identification of GS3 allelotypes, and contrasted with 2 years long phenotypes of grain of 2012-2013, as a result as shown in table 2,2012
Year, long grain allelotype paddy rice product amount to 59, and phenotype is long grain, and such as averagely grain length is up to 8.25mm；Short grain etc.
Position genotypic rice kind amounts to 81, and phenotype is short grain, and such as averagely grain length is only 5.56mm；, long grain etc. in 2013
Position genotypic rice product amount to 59, and phenotype is long grain, and such as averagely grain length is up to 8.44mm；Short grain allelotype water
Rice varieties amount to 81, and phenotype is short grain, and such as averagely grain length is only 5.19mm.Statistical analysis shows different allele
The long Traits change of type offspring's grain reaches the pole level of signifiance, and genotype is coincide with phenotype, it was confirmed that mark GS3-TPAP's is accurate
Property.
Table 2 utilizes molecular labeling GS3-TPAP detection DH colony's grain length and the long phenotype comparing result of grain
Annotation：Mark letter A and B represents the conspicuousness in 0.01 level
Example 2 carries out the genotype detection of RIL colony offsprings using molecular labeling GS3-TPAP
RIL colonies are that bright extensive 63 (male parents) of long grain allelotype rice varieties hybridize short grain allelotype rice varieties
Bridge section 951 (female parent), the 110 stable strains obtained by simple grain transmission method, by marking GS3-TPAP to carry out 110 stabilizations
The GS3 allelotypes identification of strain, and contrasted with 2 years long phenotypes of grain of 2013-2014, as a result as shown in table 3,
2013, long grain allelotype paddy rice product amounted to 38, and phenotype is long grain, and such as averagely grain length is up to 8.38mm；It is short
Grain allelotype rice varieties amount to 72, and phenotype is short grain, and such as averagely grain length is only 5.32mm；It is 2014, long
Grain allelotype paddy rice product amount to 38, and phenotype is long grain, and such as averagely grain length is up to 8.39mm；Short grain allele
Type rice varieties amount to 72, and phenotype is short grain, and such as averagely grain length is only 5.31mm.Statistical analysis shows different equipotentials
The long Traits change of genotype offspring's grain reaches the pole level of signifiance, and genotype is coincide with phenotype, it was confirmed that mark GS3-TPAP's
Accuracy.
Table 3 utilizes molecular labeling GS3-TPAP detection RIL colony's grain length and the long phenotype comparing result of grain
Annotation：Mark letter A and B represents the conspicuousness in 0.01 level
It should be noted that when being related to number range in claims of the present invention, it is thus understood that each number range
Any one numerical value can select between two end points and two end points, due to step method and above-described embodiment phase of use
Together, in order to prevent from repeating, description of the invention preferred embodiment, but those skilled in the art once know substantially
Creative concept, then can make other change and modification to these embodiments.So, appended claims are intended to be construed to bag
Include preferred embodiment and fall into having altered and changing for the scope of the invention.
Obviously, those skilled in the art can carry out the essence of various changes and modification without departing from the present invention to the present invention
God and scope.So, if these modifications and variations of the present invention belong to the scope of the claims in the present invention and its equivalent technologies
Within, then the present invention is also intended to comprising including these changes and modification.
Sequence table
<120>A kind of molecular labeling, authentication method and application for identifying the long character of rice grain
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213>Artificial sequence
<400> 1
cctcagacat cacctgaaaa gttgacaggc 30
<210> 2
<211> 29
<212> DNA
<213>Artificial sequence
<400> 2
cggtcaaagt tcatgatcaa aaactgggg 29
<210> 3
<211> 26
<212> DNA
<213>Artificial sequence
<400> 3
ggatccacgc tgcctccaga tgctta 26
<210> 4
<211> 29
<212> DNA
<213>Artificial sequence
<400> 4
aaagaaacag caggctggct tactctcgg 29
<210> 5
<211> 270
<212> DNA
<213>Bright extensive 63
<400> 5
cctcagacat cacctgaaaa gttgacaggc taaacacatg cccatctccc tcgtttactt 60
aaattaattc gaacaaacaa ctgtatatat atttcttgca gggtgaaata aattcaatcg 120
aagggatcca cgctgcctcc agatgctgaa gagagtaagc cagcctgctg tttctttttg 180
tactacttcc atttcttctc gtctttactc ttaccatgca ttcacaaaat atacttactt 240
accccagttt ttgatcatga actttgaccg 270
<210> 6
<211> 270
<212> DNA
<213>Nipponbare
<400> 6
cctcagacat cacctgaaaa gttgacaggc taaacacatg cccatctccc tcgtttactt 60
aaattaattc gaacaaacaa ctgtatatat atttcttgca gggtgaaata aattcaatcg 120
aagggatcca cgctgcctcc agatgctgca gagagtaagc cagcctgctg tttctttttg 180
tactacttcc atttcttctc gtctttactc ttaccatgca ttcacaaaat atacttactt 240
accccagttt ttgatcatga actttgaccg 270
Claims (5)
1. a kind of molecular labeling for identifying the long character of rice grain, it is characterised in that the molecular labeling is GS3-TPAP, including
GS3-TPAP-O-R, SEQ shown in GS3-TPAP-O-F, SEQ ID NO.2 of the nucleotide sequence as shown in SEQ ID NO.1
The GS3-TPAP-I-R shown in GS3-TPAP-I-F and SEQ ID NO.4 shown in ID NO.3.
2. a kind of method of the long character of molecular markers for identification rice grain described in utilization claim 1, it is characterised in that including
Following steps：
S1, extracts the genomic DNA of rice material to be measured；
S2, the genomic DNA obtained using S1 as template, with GS3-TPAP-O-F, GS3-TPAP-O-R, GS3-TPAP-I-F and
GS3-TPAP-I-R is that primer enters performing PCR amplification；
S3, result judgement
Combined using GS3-TPAP-O-F with GS3-TPAP-O-R and amplify 270bp fragments and be used as positive control；Work as GS3-TPAP-I-
F is combined with GS3-TPAP-O-R when amplifying 147bp fragments, and detection material is long grain allelotype A；Work as GS3-TPAP-O-F
Combined with GS3-TPAP-I-R when amplifying 177bp fragments, detection material is short grain allelotype C.
3. the method for the long character of molecular markers for identification rice grain according to claim 1, it is characterised in that PCR is expanded
Response procedures be：95 DEG C of pre-degeneration 5min；95 DEG C denaturation 30s, 55.1 DEG C annealing 30s, 72 DEG C extension 30s-50s, follow for 35 times
Ring；72 DEG C of extension 10min；4 DEG C of cooling 10min.
4. application of the molecular labeling according to claim 1 in the long trait molecular marker assist-breeding of rice grain.
5. the method for the identification long character of rice grain is in the long trait molecular marker auxiliary choosing of rice grain according to claim 2
Application in educating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710705246.2A CN107245530A (en) | 2017-08-17 | 2017-08-17 | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710705246.2A CN107245530A (en) | 2017-08-17 | 2017-08-17 | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107245530A true CN107245530A (en) | 2017-10-13 |
Family
ID=60012872
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710705246.2A Pending CN107245530A (en) | 2017-08-17 | 2017-08-17 | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107245530A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858446A (en) * | 2017-12-21 | 2018-03-30 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying Rice Resistance To Rice Blast |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
| CN109811076A (en) * | 2019-03-08 | 2019-05-28 | 浙江大学 | For identifying molecular labeling and its application of the elongated particle shape of rice |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882146A (en) * | 2014-04-15 | 2014-06-25 | 江苏省农业科学院 | Four-primer molecular marking method for identifying different genotypes of rice grain length gene GS3 |
-
2017
- 2017-08-17 CN CN201710705246.2A patent/CN107245530A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882146A (en) * | 2014-04-15 | 2014-06-25 | 江苏省农业科学院 | Four-primer molecular marking method for identifying different genotypes of rice grain length gene GS3 |
Non-Patent Citations (2)
| Title |
|---|
| TAKANO-KAI, N；DOI, K；YOSHIMURA, A: "GS3 participates in stigma exsertion as well as seed length in rice", 《BREEDING SCIENCE》 * |
| 邓华凤: "《杂交水稻知识大全》", 30 September 2014 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858446A (en) * | 2017-12-21 | 2018-03-30 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying Rice Resistance To Rice Blast |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
| CN109811076A (en) * | 2019-03-08 | 2019-05-28 | 浙江大学 | For identifying molecular labeling and its application of the elongated particle shape of rice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967803B (en) | High-throughput molecular marker for detecting fertility restorer gene of radish Ogura-CMS (fertility restorer gene) and application of high-throughput molecular marker | |
| CN102154471B (en) | Molecular marking method for major quantitative trait loci(QTL) for rice grain length | |
| CN103882145A (en) | PCR (Polymerase Chain Reaction) molecular marking method for identifying allele mutation of rice long-grain gene qGL3 | |
| CN107245530A (en) | A kind of molecular labeling, authentication method and application for identifying the long character of rice grain | |
| CN108018371A (en) | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character | |
| CN113637789A (en) | Wheat stripe rust resistant gene YRTD121 linked KASP molecular marker, primer, kit and application | |
| CN106591489B (en) | Molecular marker of rice grain length gene GW7 and special primer sequence thereof | |
| CN106521021B (en) | Gene marker for identifying haplotype of rice grain width and grain weight GS5 gene and application | |
| CN104672315A (en) | Gene for controlling cucumber non-tendril character and cucumber tendril character-related SNP marker | |
| CN102181559B (en) | Specific primer system of EST (expressed sequence tag)-SSR (simple sequence repeat) molecular markers for Pleurotus ostreatus and application of specific primer system | |
| CN103866006A (en) | Molecular markers M3B-1a and M3B-2a with resistance to wheat preharvest sprouting quantitative trait loci (QTL) QPhs.sicau-3B.1 and applications thereof | |
| CN107988410A (en) | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita | |
| CN103589805B (en) | Give the main QTLS of corn Fijivirus resistance | |
| CN105821153B (en) | The relevant molecular labeling of rape cracking resistance angle character main effect QTL and application | |
| CN108690883B (en) | Molecular marker RMD7 for assisting in identifying soybean powdery mildew resistance of soybean to be detected | |
| CN108148920B (en) | Functional molecular marker of hot pepper nuclear male sterility related gene and application thereof | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN107254548A (en) | A kind of molecular labeling, authentication method and application for identifying paddy rice Chalkiness trait | |
| CN111518940B (en) | Method for detecting Wx1 molecular marker and applying Wx1 molecular marker to sweet waxy corn breeding | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN112501338A (en) | Development and application of SNP molecular marker of rice grain width and grain weight gene GS5 | |
| CN106011301B (en) | A kind of primer, kit and its method of throughput assays wheat seed main effect dormant gene | |
| CN107858446A (en) | A kind of molecular labeling, authentication method and application for identifying Rice Resistance To Rice Blast | |
| CN116287373B (en) | KASP molecular marker closely linked with wheat spike number major QTL as well as method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171013 |
|
| RJ01 | Rejection of invention patent application after publication |