CN113981122B - Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy - Google Patents
Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy Download PDFInfo
- Publication number
- CN113981122B CN113981122B CN202111116143.5A CN202111116143A CN113981122B CN 113981122 B CN113981122 B CN 113981122B CN 202111116143 A CN202111116143 A CN 202111116143A CN 113981122 B CN113981122 B CN 113981122B
- Authority
- CN
- China
- Prior art keywords
- pita
- disease
- functional
- resistant
- haplotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 317
- 201000010099 disease Diseases 0.000 title claims abstract description 171
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title claims abstract description 171
- 108700028369 Alleles Proteins 0.000 title claims abstract description 132
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 79
- 235000009566 rice Nutrition 0.000 title claims abstract description 79
- 238000000034 method Methods 0.000 title claims description 57
- 238000010367 cloning Methods 0.000 title abstract description 27
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 78
- 238000001514 detection method Methods 0.000 claims abstract description 56
- 208000035240 Disease Resistance Diseases 0.000 claims abstract description 25
- 238000009412 basement excavation Methods 0.000 claims abstract description 10
- 230000009897 systematic effect Effects 0.000 claims abstract description 3
- 102000054766 genetic haplotypes Human genes 0.000 claims description 131
- 239000003550 marker Substances 0.000 claims description 63
- 239000003147 molecular marker Substances 0.000 claims description 60
- 238000005516 engineering process Methods 0.000 claims description 20
- 238000005065 mining Methods 0.000 claims description 19
- 238000012408 PCR amplification Methods 0.000 claims description 16
- 238000012360 testing method Methods 0.000 claims description 12
- 238000004458 analytical method Methods 0.000 claims description 11
- 102200115589 rs111033423 Human genes 0.000 claims description 6
- 230000008569 process Effects 0.000 claims description 4
- 238000003976 plant breeding Methods 0.000 claims description 3
- 230000001488 breeding effect Effects 0.000 abstract description 13
- 230000008901 benefit Effects 0.000 abstract description 11
- 238000009395 breeding Methods 0.000 abstract description 10
- 230000004069 differentiation Effects 0.000 abstract description 5
- 238000002474 experimental method Methods 0.000 description 17
- 238000011161 development Methods 0.000 description 15
- 239000000969 carrier Substances 0.000 description 13
- 238000013461 design Methods 0.000 description 8
- 238000002372 labelling Methods 0.000 description 8
- 238000000137 annealing Methods 0.000 description 7
- 238000012216 screening Methods 0.000 description 7
- 241000196324 Embryophyta Species 0.000 description 5
- 238000010586 diagram Methods 0.000 description 5
- 230000029087 digestion Effects 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 101001077376 Oryza sativa subsp. japonica UMP-CMP kinase 4 Proteins 0.000 description 4
- 210000000349 chromosome Anatomy 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 238000001976 enzyme digestion Methods 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 230000002085 persistent effect Effects 0.000 description 4
- 230000009261 transgenic effect Effects 0.000 description 4
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000012215 gene cloning Methods 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- 102000054765 polymorphisms of proteins Human genes 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 101100268551 Drosophila melanogaster Appl gene Proteins 0.000 description 2
- 101000975474 Homo sapiens Keratin, type I cytoskeletal 10 Proteins 0.000 description 2
- 101000614627 Homo sapiens Keratin, type I cytoskeletal 13 Proteins 0.000 description 2
- 102100023970 Keratin, type I cytoskeletal 10 Human genes 0.000 description 2
- 102100040487 Keratin, type I cytoskeletal 13 Human genes 0.000 description 2
- 241001330975 Magnaporthe oryzae Species 0.000 description 2
- 230000000680 avirulence Effects 0.000 description 2
- 244000052616 bacterial pathogen Species 0.000 description 2
- 210000002230 centromere Anatomy 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 230000007613 environmental effect Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 108091008053 gene clusters Proteins 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 102000005962 receptors Human genes 0.000 description 2
- 108091008146 restriction endonucleases Proteins 0.000 description 2
- 238000002864 sequence alignment Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 230000009466 transformation Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 241000589158 Agrobacterium Species 0.000 description 1
- 101150022237 Appl gene Proteins 0.000 description 1
- 102000004533 Endonucleases Human genes 0.000 description 1
- 108010042407 Endonucleases Proteins 0.000 description 1
- 241000162682 Heterogen Species 0.000 description 1
- 208000025814 Inflammatory myopathy with abundant macrophages Diseases 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000006757 chemical reactions by type Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000008659 phytopathology Effects 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 102000040430 polynucleotide Human genes 0.000 description 1
- 239000002157 polynucleotide Substances 0.000 description 1
- 108091033319 polynucleotide Proteins 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000000717 retained effect Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pita disease-resistant gene family alleles. The technical system sets two-stage detection markers according to two-stage differentiation of the gene family, such as clear functional haplotype-disease-resistant allele. The technical system can be used for identifying, excavating and cloning rice blast Pita disease-resistant allele family alleles, and has systematic and strict inclusion property and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pita disease-resistant gene family alleles.
Background
Rice is one of the most important food crops in the world, and rice blast caused by rice blast fungus (Pyricularia oryzae) is one of the most serious limiting factors of rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance depends on direct identification and selection of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and errors are easily caused by identification and selection results. In particular, the disease-resistant genes have the problems of overlapping resistance spectrums, coverage and the like due to gene interaction, and the direct selection efficiency of the phenotypes aggregated target genes of the same type is very low or even impossible. With the development of molecular marker identification technology, the technology has the advantages of accuracy, reliability, no environmental influence and the like, so that the technology becomes the mainstream technology of plant breeding, and the purpose and the efficiency of breeding work are greatly accelerated.
Generally, in the long military competition process of host plant disease-resistant genes and pathogenic bacteria avirulence genes, the disease-resistant genes generate new disease-resistant specificity in the form of multiple-allele family (multiple-allele family) or gene cluster (gene cluster) with the lowest evolution cost, so that the rapid variation of the avirulence genes can be followed. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a broad spectrum persistent resistance "gene family" used for a long time in breeding programs, it will further differentiate into alleles (functional alleles) with different disease resistance specificities in functional haplotypes (Zhai et al 2011, new Phytologist, 189.
In the above two-stage evolution process such as "functional haplotype-disease resistance allele", there are obvious and clear nucleotide polymorphisms, including Single Nucleotide Polymorphism (SNP) and polynucleotide polymorphism [ i.e., differentiated genomic region (differentiated genomic region), and Insertion/Deletion (Insertion/Deletion). Herein, nucleotide polymorphisms within functional genes are collectively referred to as function-specific nucleotide polymorphisms (simply, function-specificity). Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene family, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene families simultaneously. Taking the rice blast resistance gene as an example, among the 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1 (Pi 37 family), 2 (Pita family), 6 (Pi 2/Pi9 family), 8 (Pi 36 family), 9 (Pii family), 11 (Pik family) and 12 (Pita family) (Sharma et al.2012, agricultural Research, 1.
As described above, the Pita gene family located in The centromeric region of chromosome 12 is one of The most widely used broad-spectrum persistent resistance sources in The global rice breeding program (Bryan et al 2000, the Plant Cell,12: 2033-2045, jia et al 2002, crop Science, 42. In order to apply the broad-spectrum persistent antigen gene to rice disease-resistant breeding program, researchers developed 2 sets of main molecular markers [ seeYL155/YL87,YL183/YL87(Jia et al 2002, crop Science,42, 2145-2149, jia et al 2004, phytopathology,94, 296-301 Wang et al 2007, plant Breeding,126, 36-42; houke et al, 2009, prof. Plant genetic resources, 10;Pita-ID13,Pita-ID04(Kitazawa et al.2019,Breeding Science,69:68-83) To improve the utilization efficiency (underline is used).
Since the Pita gene family is an anti-source which is widely used in rice disease-resistant breeding plans for a long time in the rice regions of north and south China (Shikk et al, 2009, journal of plant genetic resources, 10-21; lie et al, 2012, china Rice science, 26 593-599) after the Pik disease-resistant allele family, under the continuous and strong selective pressure of rice blast, complex and diverse variations are generated in the two-stage evolutionary levels of functional haplotype-disease-resistant allele. However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the 2 sets of molecular markers reported above are all developed sporadically for specific sites of specific genes, and have no clear comparability and logicality to each other, and are even less inclusive. And only one set of marks: (YL155/YL87,YL183/YL87) Is widely used. For complex genomic regions, complex gene families, this gives rise to 3 prominent and realistic problems: (1) Any single molecular marker which is not designed based on the evolutionary hierarchy is difficult to identify in a complex genome region, a complex gene family is easy to generate sequencing errors and the like; (2) Any single molecular marker which is not designed based on the evolutionary hierarchy is difficult to avoid the problem of false positive or false negative due to the technical limitation of the molecular marker; (3) Any single molecular marker which is not designed based on the evolution hierarchy cannot form a technical system with compatibility and comparability, so that new genes are continuously mined, identified and named in a complex gene family, and the problems of 'homonymous heterogeneous genes' and 'true and false target genes' which are easily generated in the complex gene family are identified.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a set of technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pita disease-resistant gene family functional alleles. The technical system sets two stages of functional haplotypes-disease-resistant alleles according to the two-stage differentiation of the gene family, such as the existence of clear functional haplotypes-disease-resistant allelesA stage detection flag; the optimal haplotype specific molecular marker combination for functional haplotype/non-functional haplotype detection is Pita-F/N G444C And Pita-F/N A527T (ii) a The optimal target gene specific molecular marker for the disease-resistant allele Pita-YM detection of the functional haplotype is Pita-YM T3387C (ii) a The optimal target gene specific molecular marker combination for disease-resistant allele Pita-KT detection of functional haplotype is Pita-YM T3387C ,Pita-KT/YM G384C ,Pita-KT/YM G4217T (ii) a The optimal target gene specific molecular marker combination for the disease-resistant allele Pita-9311 detection of the functional haplotype is Pita-9311/CO G17T , Pita-9311 T959C (ii) a The optimal target gene specific molecular marker combination for detecting the disease-resistant allele Pita-Q15 of the functional haplotype is Pita-Q15 A352G ,Pita-Q15 G4231A (ii) a The optimal target gene specific molecular marker combination for the disease-resistant allele Pita-KSL detection of the functional haplotype is the Pita-KSL A984G , Pita-KSL C1991T (ii) a The identification result of any detection marker which is not qualified by the technical system is not the corresponding target gene, so that the detection marker is inferred to be a possible new allele of the gene family.
The second purpose of the invention is to provide a method for comparing the rice blast Pita disease-resistant gene family sequence and identifying the specific sequence thereof.
The third objective of the invention is to provide a functional/non-functional haplotype specific molecular marker of rice blast Pita disease-resistant gene family and an identification method thereof.
The fourth objective of the invention is to provide a specific molecular marker of disease-resistant allele Pita-YM of the functional haplotype of the rice blast Pita disease-resistant gene family and an identification method thereof.
The fifth purpose of the invention is to provide a specific molecular marker of the disease-resistant allele Pita-KT of the functional haplotype of the rice blast Pita disease-resistant gene family and an identification method thereof.
The sixth purpose of the invention is to provide a specific molecular marker of the disease-resistant allele Pita-9311 of the functional haplotype of the rice blast Pita disease-resistant gene family and an identification method thereof.
The seventh object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pita-Q15 of the functional haplotype of the rice blast Pita disease-resistant gene family and a method for identifying the same.
The eighth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pita-KSL of the functional haplotype of the rice blast Pita disease-resistant gene family and a method for identifying the same.
The ninth purpose of the invention is to provide the application and the example of identifying and mining the novel disease-resistant alleles Pita-CO and Pita-ZS from the reference variety by using the two-stage marker of the technical system of the invention with the advantages of compatibility and accurate identification, mining and cloning of the rice blast Pita disease-resistant gene family alleles.
The tenth purpose of the invention is to provide the application and the example for screening the true and false gene specific SNP and the true and false target gene Pita-YM from the rice blast Pita disease-resistant gene family by utilizing the set of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning.
The eleventh purpose of the invention is to provide the application and the example for screening the true and false gene specific SNP and the true and false target gene Pita-9311 from the gene family by utilizing the set of compatible and accurate identification, excavation and cloning of the rice blast Pita disease-resistant gene family allele.
The twelfth purpose of the invention is to provide the application and the example for identifying and mining the new and old disease-resistant alleles from the Guangdong province rice seed resource population with unknown target genes by utilizing the set of compatible and accurate identification, mining and cloning of the rice blast Pita disease-resistant gene family alleles.
The thirteenth purpose of the invention is to provide an example of comparing the identification ability of the technical system which is used for identifying, digging and cloning the rice blast Pita disease-resistant gene family allele with other marking technologies.
The fourteenth purpose of the invention is to provide an example for cloning and verifying the resistance function of the novel disease-resistant allele Pita-Q15 by utilizing a technical system which has compatibility and can accurately identify, mine and clone the rice blast Pita disease-resistant gene family allele.
The technical solution of the present invention to achieve the above object is as described in the claims and the specific examples.
The technical system provided by the invention can be used for identifying, excavating and cloning rice blast Pita disease-resistant allele family functional genes, and has systematic and rigorous inclusion property and comparability. Can be widely applied to improving the purpose and efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and efficiency of the work of breeding for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Drawings
FIG. 1 is a set of schematic diagrams for the development and application of a technical system for the identification, mining and cloning of rice blast Pita disease-resistant gene family alleles with compatibility and precision.
FIG. 2 sequence comparison of Pita disease resistance gene family and identification of its specific sequence. Wherein,
cloned Pita-YM [ donor variety Yashiro Mochi (YM), bryan et al 2000; the accession numbers of the genes at the National Center for Biotechnology Information, NCBI, are: AF 207842); for the convenience of sequence alignment analysis, 14 sequencing reference varieties C101PKT, IR64, shennon 265, tadukan, katy (KT), tetep,9311, C101a51, zhenshan 97 (ZS), kasalath (KSL), CO39 (CO), IR8, shuhui 498, Q15, which are presumed to be carriers of the target gene, were added; and the corresponding genomic sequences of 6 sequenced reference varieties Hitomebore, nipponbare (NPB), suijing 18, MINGHui 63, tsuyuake, koshihikari, which are presumed to be carriers of non-target genes;
all validated haplotypes and allele-specific SNPs have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-8 for details).
In particular, since the above 21 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pita disease-resistant gene family and the marker information thereof in conjunction with fig. 3 to 8.
FIG. 3 development and application of functional/non-functional haplotype specific molecular markers of pita disease-resistant gene family
3a, 2 haplotype-specific optimal SNPs;
functional haplotype variety: CK1 (Yashiro Mochi; pita-YM); CK2 (Katy; pita-KT); CK3 (C101 PKT; pita-KT); CK4 (IR 8; pita-9311); CK5 (93-11; CK6 (Q15; pita-Q15); CK7 (Kasalath; pita-KSL); CK8 (CO 39; pita-CO 39); CK9 (C101A 51; pita-ZS); CK10 (ZS 97; pita-ZS);
non-functional haplotype variety: CK11 (Nipponbare; pita-NonF); CK12 (MH 63; pita-NonF); CK13 (Tsuyuake; pita-NonF); CK14 (Koshihikari; pita-NonF); m, DL-500;
specification of test varieties: the information of the 14 first reference varieties is as described above, and if not necessary, it is not repeated.
Description of the labeling: #1 and #2, the numbering of the markers; the gene symbol is italicized and represents a functional gene; the gene symbol is a positive body and represents a marker; F/N, functional/non-functional; superscript G444C, means the specific SNP at position #444 of the target gene, and so on.
FIG. 4 development and application of functional haplotype disease-resistant allele Pita-YM functional specific molecular marker of Pita disease-resistant gene family
4a, 1 optimal SNP of Pita-YM functional specificity;
bottom band, target gene) of 14 first set of reference varieties, wherein,
the target gene variety: CK1 (Yashiro Mochi; pita-YM);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 5 development and application of disease-resistant allele Pita-KT functional specific molecular marker of functional haplotype of Pita disease-resistant gene family
5a, 1 optimal SNP of Pita-YM functional specificity;
5 b-c 2 optimized SNPs shared by Pita-KT/YM;
3 Pita-KT/YM function-specific marker combinations [ #3 T3387C (upper band, non-target gene; lower band, target gene); #4, pita-KT/YM G384C (upper band, non-target gene; lower band, target gene); #5, pita-KT/YM G4217T (upper band, non-target gene; lower band, target gene) 14 examples of the identification of the first set of reference varieties, wherein,
the target gene variety: CK2 (Katy; pita-KT); CK3 (C101 PKT; pita-KT);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 6 development and application of functional haplotype disease-resistant allele Pita-9311 functional specific molecular marker of Pita disease-resistant gene family
6a, 1 optimal SNP shared by Pita-9311/CO;
6b, 1 optimal SNP with Pita-9311 functional specificity;
the target gene variety: CK4 (IR 8; pita-9311); CK5 (93-11;
non-target gene variety: the remaining 12 first reference varieties.
FIG. 7 development and application of functional haplotype disease-resistant allele Pita-Q15 functional specific molecular marker of Pita disease-resistant gene family
7 a-b 2 optimal SNPs with Pita-Q15 functional specificity;
the target gene variety: CK6 (Q15; pita-Q15);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 8 development and application of functional haplotype disease-resistant allele Pita-KSL function-specific molecular markers for Pita disease-resistant gene family
8 a-b 2 optimal SNPs of Pita-KSL functional specificity;
the target gene variety: CK7 (Kasalath; pita-KSL);
non-target gene variety: the remaining 13 first reference varieties.
FIG. 9 is a diagram of the application and examples of the identification and mining of novel disease-resistant alleles Pita-CO and Pita-ZS from reference varieties using two-stage markers of a technical system of the present invention with compatibility and accurate identification, mining and cloning of alleles of the rice blast Pita disease-resistant gene family
9a, identifying haplotypes of 14 first set of reference varieties based on the primary marker, wherein the result shows that CK 1-10 are functional haplotype varieties; CK 11-14 are non-functional haplotype varieties;
9b allele identification of 14 first set of reference varieties based on secondary markers, wherein,
b-1, allele identification based on 1 Pita-YM specific marker, and the result shows that CK1 is a Pita-YM carrier (red);
b-2, allele identification based on 3 Pita-KT specific marker combinations, wherein the result shows that CK 2-3 is a Pita-KT carrier (blue);
b-3, identifying the allele based on 2 Pita-9311 specific markers, wherein the result shows that CK 4-5 is a Pita-9311 carrier (green);
b-4, allele identification based on 2 Pita-Q15 specific markers shows that CK6 is a Pita-Q15 carrier (light red);
b-5, allele identification based on 2 Pita-KSL specific markers, wherein the result shows that CK7 is a Pita-KSL carrier (light blue);
in combination with the above results, CK8 was a Pita-CO carrier (light green), CK 9-10 were a Pita-ZS carrier (dark yellow; the two were of different genotypes from the #6 marker).
FIG. 10 shows the application and examples of screening true and false specific genome sequences and target genes (Pita-YM) using the above-mentioned set of techniques for identifying, mining and cloning alleles of rice blast Pita disease-resistant gene family with compatibility and precision
10a1, 1 optimized SNP specific to Pita-YM, and the results of the reference sequence of the region show that 1 SNP exists between Yashiro Mochi (CK 1) and other 13 reference varieties;
10b1, 4 specific SNPs for Yashiro Mochi (CK 1), and the results of reference sequences in this region showed that 4 SNPs appeared to exist between Yashiro Mochi (CK 1) and 13 other reference varieties;
10b2 identification of 14 first set of reference varieties by 4 additional markers (SEQ ID NO. 24-SEQ ID NO. 32) developed from the above 4 SNPs, the results showed that the genotypes of all 14 reference varieties were identical, from which it was concluded that the specific SNPs of the above 4 Yashiro Mochi (CK 1) were all wrong and not true;
and (4) conclusion: the sequence Yashiro Mochi (CK 1) is a carrier of Pita-YM despite errors;
in particular, C1149T is difficult to detect clearly due to its location in the A-rich, T-base region, but the SNP can still be judged unrealistic.
FIG. 11 is a set of the above-mentioned techniques for screening true and false specific genome sequences and target genes (Pita-9311) by using the above-mentioned system for identifying, mining and cloning alleles of rice blast Pita disease-resistant gene family, wherein,
11a1, optimal SNPs specific to Pita-9311, results of reference sequences showed that 9311 (CK 5) agreed with the sequences of 2 reference varieties such as IR8 (CK 4), shuhui 498 (not tested), and disagreement with the remaining 18 reference varieties;
11b1, 1 specific SNP of Pita-9311, reference sequence results show that 9311 (CK 5) seems to be identical to the sequences of 2 reference varieties such as IR8 (CK 4), shuhui 498 (not tested), etc., but not identical to the remaining 18 reference sequences;
11b2 identification of 14 first set of reference varieties with additional markers (SEQ ID NO. 33-34) developed from this SNP, the results showed that the genotypes of all reference varieties were identical, thus concluding that this SNP was wrong and not true;
and (4) conclusion: the technical system is constructed on the basis of screening main SNP, has strong compatibility and the capability of accurately identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles; although the 2 nd SNP is not authentic, it can be concluded that both 9311 (CK 5) and IR8 (CK 4) are carriers of Pita-9311.
FIG. 12 is an example of identifying and mining new and old disease-resistant alleles from Guangdong province rice seed resource populations with unknown target genes by using the above-mentioned technical system for identifying, mining and cloning rice blast Pita disease-resistant gene family alleles with inclusion and precision. Wherein,
12b; lower band, identification of 44 test varieties by target gene (red), and results show that there is no Pita-YM carrier;
12 b-c, 1 Pita-KT function specificity optimal marker combination (3, upper band, target gene); lower band, non-target gene; #4 and #5, upper band, non-target gene; the lower band, target gene (blue) identifies 44 varieties to be tested, and the result shows that 12 varieties such as CV3, CV8, CV 14-15, CV19, CV23, CV25-26, CV29, CV34, CV37, CV44 and the like are Pita-KT carriers;
12d, 1 Pita-9311 function-specific optimal marker combination [ 6 and #7, upper band, non-target gene; the lower band, target gene (green) identifies 44 varieties to be tested, and the result shows that 16 varieties such as CV 11-12, CV22, CV24, CV 27-28, CV30-33, CV38-43 and the like are Pita-9311 carriers;
12e, 2 Pita-Q15 function-specific optimal markers [ #8 and #9, upper band, non-target gene; in the lower band, the target gene (light red) identifies 44 varieties to be tested, and the result shows that only 1 variety such as CV1 is a Pita-Q15 carrier;
12a to f, from the above results, CK6 is a functional haplotype variety, and the genotype thereof is different from that of CK1 to CK5, and is estimated to be a Pita-CO carrier (light green); 2 varieties of CV 16-17 and the like are also Pita-CO carriers;
12a to f, from the above results, CK7 is a functional haplotype variety and is presumed to be a Pita-ZS carrier (dark yellow) because its genotype is different from that of CK1 to 6; the same 10 varieties of CV2, CV 4-7, CV9, CV 20-21, CV35-36 and the like are also Pita-ZS carriers;
12 a-f, CV13 is a functional haplotype variety and the genotype is different from CK 1-7, therefore, the carrier of the novel Pita disease-resistant allele (purple) is inferred, pita-IR36;
wherein 8 second reference varieties are CK1 (Yashiro Mochi, pita-YM) and are marked with red; CK2 (C101 PKT, pita-KT), blue notation; CK3 (9311, pita-9311), green notation; CK4 (Q15, pita-Q15), light red; CK5 (Kasalath, pita-KSL), light blue notation; CK6 (CO 39, pita-CO), light green notation; CK7 (ZHENHAN 97, pita-ZS), dark yellow notation; CK8 control variety Nipponbare; carrying new gene, purple label;
in particular, CV10 and CV18 were non-functional haplotype varieties and were judged to be non-functional haplotype varieties even though their genotypes were the same as those of CK 7. In other words, the carrier of Pita-ZS, which is similar to CK7, is the functional haplotype variety closest to the non-functional haplotype.
FIG. 13 is a comparative example of the ability of the technical system of the present invention to identify and clone alleles of the Pita disease-resistant gene family of rice blast and other marker technologies
13 a-b, the result of the identification of 14 first set of reference varieties by the technical system of the invention shows that CK 1-10 is a functional haplotype variety, wherein CK1 is a Pita-YM carrier; CK 2-3 is a Pita-KT carrier; CK 4-5 is Pita-9311 carrier; CK6 is Pita-Q15 carrier; CK7 is Pita-KSL carrier; CK8 is Pita-CO carrier; CK 9-10 is a Pita-ZS carrier;
13c1 identification of 14 first set of reference varieties by the other labeling technique I (Jia et al 2002, crop Science, 42; CK 4-14 carries non-functional pita gene;
and (4) conclusion: the other marking technologies which are verified by 2 groups of each other are mainly used for identifying that CK 1-3 only carry functional Pita genes, so that the problems of 'homonymous heterogeneous genes' (between CK 1-3), 'marking false negatives' (CK 4-10) and the like are caused; therefore, the technical system of the present invention has outstanding advantages.
FIG. 14 cloning and functional verification of the novel Pita disease resistance allele Pita-Q15. Wherein,
14a, structural diagram of main disease-resistant allele of Pita and specific SNP thereof, and cloning schematic diagram of Pita-Q15;
14b 2 /T 3 The disease-resistant reaction type of the inoculation identification of the strain and the donor and receptor varieties thereof;
14c recipient variety and 2 transgenic T thereof 2 /T 3 And (3) performing cosegregation analysis on the disease resistance phenotype of part of individuals of the strain and the genotype of the Hpt based on a transgenic selection marker (the additional marker Hpt-F/Hpt-R is shown as SEQ ID NO. 35-SEQ ID NO. 36).
R, resistant, disease resistance; s, susceptable, susceptibility.
Detailed Description
The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
All rice varieties used in the examples: a first set of reference varieties CK 1-14 and a second set of reference varieties CK 1-8 (as described above); and the test varieties CV 1-44 were collected and stored in the applicant's laboratory, and were commonly used in the research field and have been included but not limited to the above-mentioned documentsPublication [ Zhai et al.2011, new Phytologist 189, 321-334, https:// nph.onlineibrary.wireless.com; hua et al.2012, the Theoretical and Applied Genetics 125,https://www.springer.com/journal/122(ii) a She Xuemei, 2021, master paper of south china university of agriculture (no labeling-related core information is disclosed); appendix charts are available at the respective magazine web sites.
The technical route diagram developed and applied by the patent is shown in figure 1.
Example 1 sequence comparison of the Rice blast Pita disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 8)
1. Experimental methods
Using the genomic sequence (ATG-TGA) of the cloned Pita-YM (donor variety Yashiro Mochi (YM); genBank AF 207842), another 14 sequencing reference varieties C101PKT, IR64, shentang 265, tadukan, katy (KT), tetep,9311, C101A51, ZHENHAN 97 (ZS), kasalath (KSL), CO39 (CO), IR8, shuhui 498, Q15, which are presumed to be carriers of the target gene, were retrieved and downloaded from public databases such as NCBI as described above; to facilitate sequence alignment analysis, 6 genomic sequences corresponding to the putative non-target gene carriers of the sequenced reference variety Hitomebore, nipponbare (NPB), suijing 18, MINGHui 63, tsuyuuaake, koshihikari were added.
The range of the individual genes ATG-TAG is annotated with reference to NCBI.
Sequence comparison analysis was performed by conventional bioinformatics methods.
2. Results of the experiment
The results of the sequence comparisons are shown in FIGS. 2 to 8, which show that:
(1) The sequence of the Pita disease-resistant gene family has obvious genome differentiation of functional haplotypes (the reference sequences of the 15 disease-resistant reference varieties) and non-functional haplotypes (the reference sequences of the 6 susceptible reference varieties) (the typical positions are shown as the marks # 1 and #2 in FIG. 3);
(2) The functional specific SNPs exist between alleles of the Pita disease-resistant gene family (typical positions are shown as markers # 3 to #11 in marker FIGS. 4 to 8);
in particular, since the above 21 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to comprehensively understand the specific sequences of the Pita disease-resistant gene family and the marker information thereof in conjunction with fig. 3 to 8.
Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pita disease-resistant gene family (FIG. 3)
1. Experimental methods
The experimental procedure of this example is mainly described in the papers published by the applicant (Yuan et al 2011, the door Applied Genet 122, 1017-1028, ZHai et al 2011, new Phytologist 189, 321-334, hua et al 2012, the theoretical and Applied genetics,125, 1047-1055.
[ the following references are the same as above, and need not be repeated ]
Briefly described, the following steps:
(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pita disease-resistant gene family sequence, aiming at 2 haplotype specificity optimal SNPs with clear differentiation of functional/non-functional haplotypes, according to the design principle of CAPS and dCAPS (derived driven compatible polymorphism sequences; neff et al 2002, trends in Genetics 18; the design of the label was then confirmed using Primer design software Primer 5.0.
[ the following molecular markers and primer design procedures are the same as those described above, and are not repeated therein ]
For convenience of description, the labels are named as #1 and #2 respectively (and so on); the primer sequences are as follows:
for the #1 marker (upper band, non-functional haplotype; lower band, functional haplotype):
SEQ ID NO.1(Pita-F/N G444C -F；5’-3’)：
ACTGCTGGTGCCAAGAAGATGAT；
SEQ ID NO.2(Pita-F/N G444C -R；5’-3’)：
CCGGCCATGCAGACGATAGAAT。
for the #2 marker (upper band, functional haplotype; lower band, non-functional haplotype):
SEQ ID NO.3(Pita-F/N A527T -F；5’-3’)：
ACTGCTGGTGCCAAGAAGATGAT；
SEQ ID NO.4(Pita-F/N A527T -R；5’-3’)：
CCGGCCATGCAGACGATAGAAT。
the labeling instructions are as described above.
(2) Detection of haplotype-specific molecular markers: and carrying out PCR amplification on the 14 first sets of reference varieties by using the 2 sets of primers. The PCR amplification system (20.0. Mu.L) was as follows:
[ the following PCR amplification System is the same as that described above, and is not repeated therein ]
The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then PCR amplification for 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate according to the detection object) [ 94 ℃ denaturation for 30sec, annealing for 30sec (# 1/62 ℃, #2/62 ℃), extension at 72 ℃ for 25-30 sec (which can be adjusted as appropriate according to the detection object) ], and finally extension at 72 ℃ for 5min, and the PCR product is stored in a refrigerator at 4 ℃ for later use.
[ except for the annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated
(3) Enzyme digestion of haplotype specific molecular markers: the PCR product was first extracted from the CAPS or dCAPS tags such as the #1 and #2 tags, and cleaved with the corresponding restriction enzymes (# 1, apaI/25 ℃; #2, sal I/37 ℃) in the following reaction system (10.0. Mu.L):
after digestion at 37 ℃ for 5 hours (37 ℃ for all but ApaI/25 ℃), 10. Mu.L of 10 × loading was added to each tube of the digestion product and mixed well for use.
[ the enzyme digestion system of PCR amplification products is the same as that described above, and will not be repeated here ]
(4) Detection of haplotype-specific molecular markers:
respectively taking out the enzyme digestion products, and detecting according to the following procedures;
and (3) detection procedure: 1.5-2.0 μ L of the product is electrophoresed on 10-12% denaturing polyacrylamide gel (250V, 20-120 min; adjusted according to the detected object) by a microsyringe, and then the molecular marker is photographed and recorded according to the conventional detection method.
[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]
2. Results of the experiment
The size of each molecular marker is shown in fig. 3, and the results show that the 14 first set of reference varieties present clear genotypes (haplotypes):
functional haplotype variety: CK1 (Yashiro Mochi; pita-YM); CK2 (Katy; pita-KT); CK3 (C101 PKT; pita-KT); CK4 (IR 8; pita-9311); CK5 (93-11; CK6 (Q15; pita-Q15); CK7 (Kasalath; pita-KSL); CK8 (CO 39; pita-CO 39); CK9 (C101A 51; pita-ZS); CK10 (ZS 97; pita-ZS);
non-functional haplotype variety: CK11 (Nipponbare; pita-NonF); CK12 (MH 63; pita-NonF); CK13 (Tsuyuake; pita-NonF); CK14 (Koshihikari; pita-NonF); m, DL-500.
Specification of test varieties: the information of the 14 first reference varieties is as described above, and if not necessary, it is not repeated.
Example 3: development and application of functional haplotype disease-resistant allele Pita-YM functional specificity molecular marker of Pita disease-resistant gene family (figure 4)
1. Experimental methods
(1) Designing a Pita-YM function specific molecular marker: according to the comparison result of the Pita disease-resistant gene family sequences, selecting the optimal 1 SNP to design the Pita-YM functional specificity molecular marker Pita-YM T3387C (# 3 marker); the primer sequences are as follows:
for the #3 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.5(Pita-YM T3387C -F；5’-3’)：
AAGTGTATGCCTTCCATTGCAGATTAT；
SEQ ID NO.6(Pita-YM T3387C -R；5’-3’)：
ATCTTCAGATATCTCAGTTGTAACAGTTTA。
(2) Detection of Pita-YM function specific molecular marker: the first 14 reference varieties were PCR-amplified using the pair of primers according to the PCR amplification system described above (annealing temperature: #3/62 ℃), and then the molecular markers were detected and recorded according to the enzyme digestion (# 3/Mse I) and detection system described above.
2. Results of the experiment
The size of each molecular marker is shown in FIG. 4, and the results show that the Pita-YM function-specific molecular marker can distinguish the target gene from all known functional genes of the gene family, and non-functional genes:
the target gene variety: CK1 (Yashiro Mochi; pita-YM);
non-target gene variety: the remaining 13 first set of reference varieties;
example 4: development and application of disease-resistant allele Pita-KT function-specific molecular marker of functional haplotype of Pita disease-resistant gene family (FIG. 5)
1. Experimental methods
(1) Designing a Pita-KT function specific molecular marker combination: according to the alignment result of the Pita disease-resistant gene family sequences, no specific genome sequence is found. However, the preferred 3 optimal SNPs were designed as Pita-KT function specific molecular marker combinations: pita-YM T3387C (marker # 3 above), pita-KT/YM G384C (# 4 marker), pita-KT/YM G4217T (# 5 marker);
the primer sequences are as follows:
for the #4 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.7(Pita-KT/YM G384C -F；5’-3’)：
TAACGACCCAGCTCCTCCACC；
SEQ ID NO.8(Pita-KT/YM G384C -R；5’-3’)：
CGGTTAAGCTCCCCTCGAAG；
for the #5 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.9(Pita-KT/YM G4217T -F；5’-3’)：
CTGCCGTGGCTTCTATCTTTACAT；
SEQ ID NO.10(Pita-KT/YM G4217T -R；5’-3’)：
GTGAAGAGGATTCCGGTAGCATA。
(2) Detection of the Pita-KT function-specific molecular marker combination (# 3 markers as described above): the above 3 pairs of primers were used to perform PCR amplification on 14 first reference varieties according to the above PCR amplification system (annealing temperature: #4/62 ℃, #5/60 ℃), and then the molecular markers were detected and recorded according to the above restriction enzymes (# 4/Hha I, #5/Nla III) and detection system.
2. Results of the experiment
The sizes of the molecular markers are shown in FIG. 5, and the results show that the Pita-KT function specific molecular marker combination can distinguish target genes from all known functional genes of the gene family and non-functional genes:
the target gene variety: CK2 (Katy; pita-KT); CK3 (C101 PKT; pita-KT);
non-target gene variety: the remaining 12 first reference varieties.
Example 5: development and application of functional haplotype disease-resistant allele Pita-9311 functional specificity molecular marker of Pita disease-resistant gene family (figure 6)
1. Experimental methods
(1) Design of Pita-9311 function specific molecular marker: according to the comparison result of the Pita disease-resistant gene family sequences, 2 optimal SNPs are selected to be designed into a Pita-9311 functional specificity molecular marker combination: pita-9311/CO G17T (# 6 marker) and Pita-9311 T959C (# 7 marker), the primer sequences were as follows:
for the #6 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.11(Pita-9311/CO G17T -F；5’-3’)：
CCATCCATGGCGCCGGCGCTCA；
SEQ ID NO.12(Pita-9311/CO G17T -R；5’-3’)：
GAGGAGGATCTTCTTCCTCTCCCCCTTCCG；
for the #7 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.13(Pita-9311 T959C -F；5’-3’)：
TGCAAGATAAAAGGTAATTCATGTCGA；
SEQ ID NO.14(Pita-9311 T959C -R；5’-3’)：
TAGAATGAGGTGGGTATAATAATTGTTTAG。
(2) Detection of Pita-9311 function-specific molecular marker: the above 2 pairs of primers were used to perform PCR amplification on 14 first reference varieties according to the above PCR amplification system (annealing temperature: #6/58 ℃, #7/55 ℃), and then the molecular markers were detected and recorded according to the above digestion (# 6/Ddei, # 7/EcoRV) and detection system.
2. Results of the experiment
The sizes of the molecular markers are shown in FIG. 6, and the results show that the Pita-9311 function-specific molecular marker combination can distinguish the target gene from all known functional genes of the gene family and non-functional genes:
the target gene variety: CK4 (IR 8; pita-9311); CK5 (93-11;
non-target gene variety: the remaining 12 first reference varieties.
Example 6: development and application of disease-resistant allele Pita-Q15 functional specific molecular marker of functional haplotype of Pita disease-resistant gene family (figure 7)
1. Experimental methods
(1) Design of Pita-Q15 function specific molecular marker: according to the comparison result of the sequence of the Pita disease-resistant gene family, the optimal 2 SNPs are selected to be designed into Pita-Q15Function specific molecular marker combination: pita-Q15 A352G (# 8 marker) and Pita-Q15 G4231A (# 9 marker), the primer sequences were as follows:
for the #8 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.15(Pita-Q15 A352G -F；5’-3’)：
CTACGACGTCGACGACTTCCTC；
SEQ ID NO.16(Pita-Q15 A352G -R；5’-3’)：
TCATGCTGCTGATCATCTTCTTGG；
for the #9 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.17(Pita-Q15 G4231A -F；5’-3’)：
CTATCTTTACCTTCTATGCATCTGCA；
SEQ ID NO.18(Pita-Q15 G4231A -R；5’-3’)：
CTGAAGACGTGAAGAGGATTCC。
(2) Detection of Pita-Q15 function specific molecular marker: the above 2 pairs of primers were used to perform PCR amplification on 14 first reference varieties according to the above PCR amplification system (annealing temperature: #8/59 ℃, #9/55 ℃), and then the molecular markers were detected and recorded according to the above digestion (# 8/BfaI, #9/Pst I) and detection system.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 7, and the results show that the Pita-Q15 function-specific molecular marker combination can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK6 (Q15; pita-Q15);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 7: development and application of disease-resistant allele Pita-KSL function-specific molecular marker of functional haplotype of Pita disease-resistant gene family (FIG. 8)
1. Experimental method
(1) Pita-KSL function specific molecular markerThe design of (2): according to the comparison result of the Pita disease-resistant gene family sequences, 2 optimal SNPs are selected to be designed into a Pita-KSL functional specificity molecular marker combination: pita-KSL A984G (# 10 marker) and Pita-KSL C1991T (# 11 marker), the primer sequences were as follows:
for the #10 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.19(Pita-KSL A984G -F；5’-3’)：
TGCAAGATAAAAGGTAATTCATGTCGA；
SEQ ID NO.20(Pita-KSL A984G -R；5’-3’)：
TAGAATGAGGTGGGTATAATAATTGTTTAG；
for the #11 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.21(Pita-KSL C1991T -F1；5’-3’)：
ATGCCTTAGAACAGGTACAATAGCATG；
SEQ ID NO.22(Pita-KSL C1991T -F2；5’-3’)：
ATGTCTAAGAACAGGTACAATAGCATG；
SEQ ID NO.23(Pita-KSL C1991T -R；5’-3’)：
TGGTGAAGACATGTTCTATATCTTGTAAA。
in particular, to ensure detection of molecular markers in differentiated regions of the genome, the #11 marker used a multi-primer PCR strategy (F1 + F2 vs R).
(2) Detection of Pita-KSL function specific molecular marker: the first 14 reference varieties were PCR-amplified using the above 2 sets of primers according to the above PCR amplification system (annealing temperature: #10/55 ℃, #11/50 ℃), and then the molecular markers were detected and recorded according to the above digestion (# 10/BspHI, # 11/SphI) and detection system, respectively.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 8, and the results show that the Pita-KSL function-specific molecular marker combination can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK7 (Kasalath; pita-KSL);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 8: the application and example of the novel disease-resistant alleles Pita-CO and Pita-ZS of the rice blast disease-resistant gene are identified and excavated from the reference variety by utilizing the two-stage marker of the technical system of the invention with compatibility and accurate identification, excavation and cloning of the disease-resistant alleles of the Pita disease-resistant gene family (figure 9)
Unlike the general molecular marker patent technology, the technology of the present invention is only directed to the detection of specific genomic region DNA polymorphism of a specific target gene, and the technology system of the present invention is composed of two-stage detection markers, such as "functional haplotype-disease resistance allele". The method conforms to the evolution track and the mode of a target gene family, openly comprises main function specific genome regions and SNP, and each marker is independent but has strict logicality, so that the accurate identification and excavation of the whole gene family with containment and expansibility are realized. The genotyping of CK 8-10 of only 14 first reference varieties is exemplified:
(1) The identification results of 14 first set of reference varieties based on the primary markers (2 Pita functional haplotype specific optimal markers) show that CK 8-10 is also a functional haplotype variety (FIG. 9 a);
(2) However, the results of the identification of 14 first reference varieties based on secondary markers [ 9 function-specific optimal markers of 5 Pita disease-resistant alleles (Pita-YM, pita-KT, pita-9311, pita-Q15, pita-KSL) ] show that neither CK 8-10 is a carrier of any of the above alleles (b 1-b 5 in FIG. 9 b);
(3) However, combining the above results, it can be concluded that CK8 contains a novel Pita disease resistance allele, pita-CO; CK 9-10 contains a novel Pita disease resistance allele, pita-ZS (the two are different in genotype from the #6 marker);
in particular, CK 8-10 are judged as functional haplotype varieties in the primary marker system; in the secondary marker system (allele identification), the genotypes of the 3 reference cultivars were identical to those of the 4 non-functional haplotype cultivars (CK 11-14) except for the #6 marker. Therefore, the technical system of the invention can identify the disease-resistant allele with stronger function, and also can identify the disease-resistant alleles (Pita-CO and Pita-ZS) with weaker function and similar to the non-functional haplotype variety;
the detection procedure of the technical system of the present invention is as described above.
Example 9: application and example of screening true and false specific genome sequence and target gene (Pita-YM) by using the technical system with compatibility and accurate identification, excavation and cloning of rice blast Pita disease-resistant gene family allele (figure 10)
Since the Pita disease-resistant gene family is located in the centromere region of the 12 th chromosome of rice, sequencing errors, particularly early cloned genes, are inevitable. Specifically, the method comprises the following steps:
(1) As described in example 3, the difference between Pita-YM and other Pita disease resistance gene family alleles could be clearly identified based on the #3 marker (FIG. 4;
(2) However, the results of the identification of the 14 first set of reference varieties by 4 additional markers developed from the other 4 Pita-YM candidate SNPs revealed that all 14 reference varieties were of identical genotype, and it was concluded that these candidate SNPs were all wrong and not true;
and (4) conclusion: the sequence Yashiro Mochi (CK 1) is still a carrier of Pita-YM despite errors;
in particular, since additional markers do not fall within the scope of the present invention, the primer sequences are shown only in the "sequence listing" for reference (the same below);
in addition, C1149T is difficult to detect clearly due to its location in the a, T-rich region, but the SNP is still judged to be untrue;
as described above, the technical system of the present invention not only discriminates and corrects the SNP candidates of Pita-YM, but also confirms the same.
Example 10: the application and the example (figure 11) of screening true and false specific genome sequence and target gene (Pita-9311) by using the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pita disease-resistant gene family allele are shown in the specification
Similarly, the Pita disease resistance gene family is located in the centromere region of rice chromosome 12, and has inevitable sequencing errors. Specifically, the method comprises the following steps:
(1) As described in example 5, the difference between the Pita-9311 and other Pita disease resistance gene family alleles could be accurately identified based on the #6 and #7 marker combinations (FIG. 6;
(2) However, the identification of the 14 first reference varieties by 1 additional marker developed from another 1 Pita-9311 candidate SNP showed that all 14 reference varieties were of identical genotype, and it was concluded that the candidate SNP was wrong and not true;
and (4) conclusion: 9311 (CK 5) and IR8 (CK 4), shuhui 498 (not tested) sequences, although in error, are still carriers of Pita-9311;
in summary, the technical system of the present invention not only identifies and corrects the candidate SNP of Pita-9311, but also confirms the candidate SNP.
Example 11: an example of identifying and mining new and old disease-resistant alleles from Guangdong province rice seed resource groups with unknown target genes by using the technical system which has the advantages of inclusion and accurate identification, mining and cloning of rice blast Pita disease-resistant gene family alleles (figure 12)
1. Experimental method
(1) The technical system of the invention comprises 11 basic specific markers of two-stage detection markers, such as functional haplotype-disease-resistant allele. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above (fig. 3-9; examples 4-8), which are not repeated.
In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the number of non-functional haplotype test varieties is too small, the test varieties are integrally retained to detect the disease-resistant allele in order to maintain the uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 44 Guangdong province rice seed resources (CV 1-44); zhai et al.2011, new Phytologist, 189; hua et al.2012, the scientific and Applied Genetics, 125; she Xuemei, 2021, master thesis (unpublished mark related core information) of south China university ] identifies and mines the alleles of Pita disease resistance gene family;
a second set of reference varieties identified by the 8 genes of interest was also tested as controls.
(3) Using conventional PCR-based homologous gene cloning techniques (Zhai et al 2011, new Phytologist,189, 321-334, hua et al 2012, theor Appl Genet 125, 1047-1055), novel disease-resistant alleles were isolated, cloned, sequenced and deposited in GenBank;
in particular, according to the rules of GenBank, all the registered gene sequences are genetically annotated (annotated) to ensure their integrity and readability and are thus functional genes.
2. Results of the experiment
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 44 test varieties were classified as (FIG. 12a; red marker, functional haplotype; black marker, non-functional haplotype):
non-functional haplotype variety: 2 varieties of CV10, CV18 and the like
Functional haplotype variety: 42 varieties in addition to the 2 non-functional haplotype varieties described above.
(2) In the secondary marker-based detection of disease-resistant alleles, 42 functional haplotype test varieties were further identified as:
the target gene Pita-YM carrying variety (b-1 in FIG. 9 b; red symbol): none;
the target gene Pita-KT carries the variety (b-2 in FIG. 9 b; blue indication): 12 varieties CV3, CV8, CV 14-15, CV19, CV23, CV 25-26, CV29, CV34, CV37, CV44 and the like;
the target gene Pita-9311 carries the variety (b-3 in FIG. 9 b; green notation): 16 varieties of CV 11-12, CV22, CV24, CV 27-28, CV30-33, CV38-43 and the like;
the target gene Pita-Q15 carries the variety (b-4 in FIG. 9 b; light red indication): 1 variety such as CV 1;
the target gene Pita-KSL carries the variety (b-5 in FIG. 9 b; light blue indication): none;
the target gene Pita-CO carrying variety (b-6 in FIG. 9 b; light green designation): 2 varieties of CV16 to 17 and the like;
the target gene Pita-ZS carries the variety (b-7 in FIG. 9 b; dark yellow indication): 10 varieties of CV2, CV 4-7, CV9, CV 20-21, CV35-36, and the like;
unknown novel disease resistance allele Pita-IR36 carrying variety: CV13, etc. (genotype different from all 7 alleles described above).
In particular, the results of two-stage marker detection such as "functional haplotype-disease resistance allele" are marked with independent color systems.
(3) 1 novel disease-resistant alleles such as Pita-IR36 (GenBank OK 169581) were isolated and cloned by a conventional PCR-based homologous gene cloning method, as represented by CV13 (IR 36).
This example demonstrates that the present technology system has strong compatibility and comparability, since 42 functional haplotype varieties are first identified in 44 rice resource populations of Guangdong province with unknown target genes; then 7 determined target genes Pita-YM, pita-KT, pita-9311, pita-Q15, pita-KSL, pita-CO and Pita-ZS are further identified, and 1 novel disease-resistant allele Pita-IR36 is added.
Implementation 12: one set of the invention has the advantages of compatibility and accurate identification, mining and cloning of the functional gene of the rice blast Pita disease-resistant gene family and the comparative example of the identification capability of other marking technologies (figure 13)
(1) Although the rice blast Pita disease-resistant gene family is one of the most widely applied broad-spectrum persistent resistance sources in the global rice disease-resistant breeding program, only 2 sets of resistance/susceptibility genes are mutually verified molecular markers developed and applied so far, and the resistance/susceptibility genes are only aimed at the first separated and cloned Pita-YM and Pita-KT (from the American rice backbone variety Katy) ("Pita-YM and Pita-KTYL155/YL87(Pita),YL183/YL87(pita)(Jia et al 2002, crop Science,42, 2145-2149; houke et al, 2009, journal of plant genetic resources, 10-26; japanese bin et al, 2012, chinese Rice Science, 26, 593-599, imam et al 2014, euphytoica, 196;Pita-ID13(Pita),Pita-ID04(pita)(Kitazawa et al.2019, breeding Science, 69; underlined is a mark);
(2) From the above main references, 2 sets of most representative other labeling techniques I were selected [YL155/YL87 (Pita),YL183/YL87(pita)[ SEQ ID NO. 37-SEQ ID NO.40 ], and other labeling techniques [ II ]Pita-ID13(Pita),Pita-ID04(pita)Identification and comparison are carried out by taking the 14 first set of reference varieties as detection objects (shown as SEQ ID NO. 41-SEQ ID NO. 46) (figure 13). The results show that compared with 2 sets of other marking technologies, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects:
(a) Functional/non-functional haplotype analysis using the primary marker demarcated clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 13 a). In this example, CK 1-10 were identified as functional haplotype varieties and CK 11-14 were non-functional haplotype varieties in the 14 first set of reference varieties tested. The method is one of the incomparable beneficial effects of 2 sets of other marking technologies;
(b) On this basis, disease resistance allele analysis using secondary markers demarcated clear and comparable allele boundaries for the identification of individual disease resistance alleles (FIG. 13 b). In this example, 9 optimal disease-resistant allele function specific markers were selected, independent of each other and aligned to form a rigorous identification system. Thus, 7 disease-resistant alleles (Pita-YM, pita-KT, pita-9311, pita-Q15, pita-KSL, pita-CO, pita-ZS) were clearly identified. This is one of the incomparable benefits of 2 sets of other marking techniques. Specifically, the method comprises the following steps:
the technical system of the present invention comprises 11 optimal function-specific markers of a set of two-stage markers, namely functional haplotype-disease-resistant allele, as described above, thereby precisely identifying the 7 disease-resistant alleles on the basis of clearly identifying functional/non-functional haplotypes.
The other labeling technique I is to conclude that CV 1-3 are carriers of the target gene Pita-YM only by 2 sets of molecular markers for verifying the resistance/sensitivity genes (FIG. 13c 1). The problem that arises from this is that (i) Pita-YM and Pita-KT are not separated and become "homonymous heterogenes"; (ii) CV 4-10 were judged to be non-functional alleles, thereby creating a "false negative marker" problem. Therefore, the other-party labeling technique I cannot form an inclusive, logical and comparable technical system to identify and mine more disease-resistant alleles.
The principle and the effect of the marking technology are similar to those of the marking technology I of the other party: CV1 to CV3 were only estimated to be carriers of the target gene Pita-YM, and the detection effect was not clear (FIG. 13c 2).
In particular, since other labels do not fall within the scope of the present invention, the primer sequences are shown in the "sequence listing" only for reference;
and (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with other marking technologies.
Implementation 13: cloning of the novel Pita disease resistance allele Pita-Q15 and an example of functional verification thereof (FIG. 14)
(1) Using conventional PCR-based homologous gene cloning techniques (Zhai et al 2011, new Phytologist,189, 321-334, hua et al 2012, theor Appl Genet 125;
(2) To verify the resistance function, a TA-clone of Pita-Q15 was selected and integrated into the binary transformation vector pCPAN-MF via the Asc I site of the endonuclease at both ends (FIG. 14 a);
(3) Introducing a target gene into a receptor variety Nipponbare by a conventional genetic transformation technology based on agrobacterium mediation;
(4) The resistance function was verified by conventional cosegregation analysis of phenotype/genotype of transgenic offspring using their transgenic stable lines (Zhai et al 2011, new phytologistt, 189, 321-334 hua et al 2012, the or Appl gene 125. The results show that at 2T 3 In the lines, pita-Q15-7-3 was a resistant homozygous line, and Pita-Q15-7-5 was a resistant segregating line, and their phenotype/genotype phenotypes cosegregated (FIGS. 14 b-c).
And (4) conclusion: the novel allele of the Pita disease resistance allele family, pita-Q15, is indeed a functional gene.
The above examples demonstrate from different perspectives the remarkable abilities and effects of the present invention in identifying and mining alleles of the Pita disease resistance family.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> south China university of agriculture
<120> a set of inclusively and precisely identified, excavated and cloned alleles of rice blast Pita disease-resistant gene family
Technical system
<130>
<160> 46
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> Pita-F/NG444C-F
<400> 1
actgctggtg ccaagaagat gat 23
<210> 2
<211> 22
<212> DNA
<213> Pita-F/NG444C-R
<400> 2
ccggccatgc agacgataga at 22
<210> 3
<211> 23
<212> DNA
<213> Pita-F/NA527T-F
<400> 3
actgctggtg ccaagaagat gat 23
<210> 4
<211> 22
<212> DNA
<213> Pita-F/NA527T-R
<400> 4
ccggccatgc agacgataga at 22
<210> 5
<211> 27
<212> DNA
<213> Pita-YMT3387C-F
<400> 5
aagtgtatgc cttccattgc agattat 27
<210> 6
<211> 30
<212> DNA
<213> Pita-YMT3387C-R
<400> 6
atcttcagat atctcagttg taacagttta 30
<210> 7
<211> 21
<212> DNA
<213> Pita-KT/YMG384C-F
<400> 7
taacgaccca gctcctccac c 21
<210> 8
<211> 20
<212> DNA
<213> Pita-KT/YMG384C-R
<400> 8
<210> 9
<211> 24
<212> DNA
<213> Pita-KT/YMG4217T-F
<400> 9
ctgccgtggc ttctatcttt acat 24
<210> 10
<211> 23
<212> DNA
<213> Pita-KT/YMG4217T-R
<400> 10
<210> 11
<211> 22
<212> DNA
<213> Pita-9311/COG17T-F
<400> 11
ccatccatgg cgccggcgct ca 22
<210> 12
<211> 30
<212> DNA
<213> Pita-9311/COG17T-R
<400> 12
gaggaggatc ttcttcctct cccccttccg 30
<210> 13
<211> 27
<212> DNA
<213> Pita-9311T959C-F
<400> 13
tgcaagataa aaggtaattc atgtcga 27
<210> 14
<211> 30
<212> DNA
<213> Pita-9311T959C-R
<400> 14
tagaatgagg tgggtataat aattgtttag 30
<210> 15
<211> 22
<212> DNA
<213> Pita-Q15A352G-F
<400> 15
ctacgacgtc gacgacttcc tc 22
<210> 16
<211> 24
<212> DNA
<213> Pita-Q15A352G-R
<400> 16
tcatgctgct gatcatcttc ttgg 24
<210> 17
<211> 26
<212> DNA
<213> Pita-Q15G4231A-F
<400> 17
ctatctttac cttctatgca tctgca 26
<210> 18
<211> 22
<212> DNA
<213> Pita-Q15G4231A-R
<400> 18
ctgaagacgt gaagaggatt cc 22
<210> 19
<211> 27
<212> DNA
<213> Pita-KSLA984G-F
<400> 19
tgcaagataa aaggtaattc atgtcga 27
<210> 20
<211> 30
<212> DNA
<213> Pita-KSLA984G-R
<400> 20
tagaatgagg tgggtataat aattgtttag 30
<210> 21
<211> 27
<212> DNA
<213> Pita-KSLC1991T-F1
<400> 21
atgccttaga acaggtacaa tagcatg 27
<210> 22
<211> 27
<212> DNA
<213> Pita-KSLC1991T-F2
<400> 22
atgtctaaga acaggtacaa tagcatg 27
<210> 23
<211> 29
<212> DNA
<213> Pita-KSLC1991T-R
<400> 23
tggtgaagac atgttctata tcttgtaaa 29
<210> 24
<211> 30
<212> DNA
<213> Pita-YMT1121G-F
<400> 24
tttaaattac ttttatagtg tcctctacta 30
<210> 25
<211> 27
<212> DNA
<213> Pita-YMT1121G-R
<400> 25
gctgttagta gaatgaggtg ggtataa 27
<210> 26
<211> 33
<212> DNA
<213> Pita-YMA1124G-F
<400> 26
tttaaattac ttttatagtg tcctctatta cta 33
<210> 27
<211> 27
<212> DNA
<213> Pita-YMA1124G-R
<400> 27
gctgttagta gaatgaggtg ggtataa 27
<210> 28
<211> 32
<212> DNA
<213> Pita-YMA1129G-F1
<400> 28
ttacttttat agtgtcctct attagtagat ag 32
<210> 29
<211> 32
<212> DNA
<213> Pita-YMA1129G-F2
<400> 29
ttacttttat agtgtcctct attattaaat ag 32
<210> 30
<211> 27
<212> DNA
<213> Pita-YMA1129G-R
<400> 30
gctgttagta gaatgaggtg ggtataa 27
<210> 31
<211> 29
<212> DNA
<213> Pita-YMC1149T-F
<400> 31
atatgaattt aatttactcg acaatgcca 29
<210> 32
<211> 31
<212> DNA
<213> Pita-YMC1149T-R
<400> 32
tgggtataat aattgtttag attaccagta g 31
<210> 33
<211> 29
<212> DNA
<213> Pita-9311C2373G-F
<400> 33
gtcggctata ctattaaact tgctcttag 29
<210> 34
<211> 30
<212> DNA
<213> Pita-9311C2373G-R
<400> 34
aacatttagt acttcgtaaa cattaaacta 30
<210> 35
<211> 18
<212> DNA
<213> Hpt-F
<400> 35
<210> 36
<211> 18
<212> DNA
<213> Hpt-R
<400> 36
<210> 37
<211> 20
<212> DNA
<213> YL155/YL87-F
<400> 37
<210> 38
<211> 20
<212> DNA
<213> YL155/YL87-R
<400> 38
<210> 39
<211> 21
<212> DNA
<213> YL183/YL87-F
<400> 39
agcaggttat aagctagcta t 21
<210> 40
<211> 20
<212> DNA
<213> YL183/YL87-R
<400> 40
<210> 41
<211> 21
<212> DNA
<213> Pita-ID13-F
<400> 41
aggcaagagt acaatggaaa c 21
<210> 42
<211> 21
<212> DNA
<213> Pita-ID13-R
<400> 42
<210> 43
<211> 22
<212> DNA
<213> Pita-ID04-F1
<400> 43
cgtgaagagg attccggtag ca 22
<210> 44
<211> 24
<212> DNA
<213> Pita-ID04-F2
<400> 44
caagtcaggt tgaagatgca ttgc 24
<210> 45
<211> 24
<212> DNA
<213> Pita-ID04-R1
<400> 45
tgccgtggct tctatcttta cgtt 24
<210> 46
<211> 20
<212> DNA
<213> Pita-ID04-R2
<400> 46
Claims (4)
1. A set of method with inclusion and accurate identification, excavation and clone rice blast Pita disease-resistant gene family allele is characterized in that the method consists of two-stage detection markers of 'functional haplotype-disease-resistant allele' and is propelled step by step, and whether a test variety carries a target gene or not is determined by the comprehensive result of the test variety;
specifically, the method comprises the following steps:
(1) The functional haplotype/non-functional haplotype detection process of the gene family:
defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in a family; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety; in subsequent tests, non-functional varieties can be excluded;
(2) The detection procedure of disease-resistant allele Pita-YM of functional haplotype of the gene family:
defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 1 functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pita-YM gene carrier belongs to a functional haplotype of a Pita disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of a reference variety of the Pita-YM; on the contrary, the detection result that any detection mark does not accord with the method is not the target gene Pita-YM;
(3) The detection process of disease-resistant allele Pita-KT of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 1 specific molecular marker combination; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pita-KT gene carrier belongs to a functional haplotype of a Pita disease-resistant gene family, and the genotype of the functional specificity molecular marker combination is the same as that of a Pita-KT reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pita-KT;
(4) The detection program of disease-resistant allele Pita-9311 of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the Pita-9311 gene carrier belongs to the functional haplotype of a Pita disease-resistant gene family, and the genotypes of 2 functional specific molecular markers are the same as those of a Pita-9311 reference variety; on the contrary, the detection result that any detection mark does not accord with the method is not the target gene Pita-9311;
(5) The detection procedure of disease-resistant allele Pita-Q15 of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pita-Q15 gene carrier belongs to functional haplotypes of a Pita disease-resistant gene family, and the genotypes of 2 functional specific molecular markers are the same as the genotypes of a Pita-Q15 reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pita-Q15;
(6) The detection procedure of disease-resistant allele Pita-KSL of the functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pita-KSL gene carrier belongs to a functional haplotype of a Pita disease-resistant gene family, and the genotypes of 2 functional specific molecular markers are the same as those of a Pita-KSL reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pita-KSL;
specifically, in the above method:
(1) The haplotype-specific molecular marker combination in (A) is Pita-F/N G444C And Pita-F/N A527T (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;
wherein, the mark indicates: F/N, functional/non-functional; superscript G444C, meaning a specific SNP at position #444 of the target gene, and so on;
(2) The specific molecular marker of the target gene Pita-YM in (1) is Pita-YM T3387C (ii) a The sequence is shown in SEQ ID NO. 5-6;
(3) The specific molecular marker combination of the target gene Pita-KT in (1) is the Pita-YM T3387C And Pita-KT/YM G384C And Pita-KT/YM G4217T (ii) a The sequences are shown as SEQ ID NO. 5-6, SEQ ID NO. 7-8, and SEQ ID NO. 9-10;
(4) The specific molecular marker combination of the target gene Pita-9311 in (1) is Pita-9311/CO G17T And Pita-9311 T959C (ii) a The sequence is shown in SEQ ID NO. 11-12 and SEQ ID NO. 13-14;
(5) The specific molecular marker combination of the target gene Pita-Q15 in the gene is Pita-Q15 A352G And Pita-Q15 G4231A (ii) a The sequence is shown in SEQ ID NO. 15-16, SEQ ID NO. 17-18;
(6) The specific molecular marker combination of the target gene Pita-KSL is Pita-KSL A984G And Pita-KSL C1991T (ii) a The sequence is shown in SEQ ID NO. 19-20 and SEQ ID NO. 21-23;
in particular, pita-KSL C1991T The PCR amplification consists of 2 forward and 1 reverse primers.
2. The use of the method of claim 1 for the systematic and precise inclusive identification and mining of new and old alleles in the complex family of rice blast Pita disease resistance genes of 5 target genes:
the functional haplotype disease-resistant allele Pita-YM of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank AF 207842.1;
the functional haplotype disease-resistant allele Pita-KT of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169585;
the functional haplotype of the rice blast Pita disease-resistant gene family has the disease-resistant allele Pita-9311, the sequence of which is shown as GenBank OK 169579;
the functional haplotype of the rice blast Pita disease-resistant gene family has the disease-resistant allele Pita-Q15, and the sequence is shown as GenBank OK 169583;
the functional haplotype disease-resistant allele Pita-KSL of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169582.
3. The method of claim 1, wherein the method is applied to identifying the known functional genes of the gene family and mining new target genes through the comprehensive results of 11 marker genotypes shown in SEQ ID NO. 1-23 in germplasm resources of unknown target genes: novel disease-resistant alleles Pita-CO, pita-ZS and Pita-IR36 of functional haplotypes of the rice blast Pita disease-resistant gene family;
the functional haplotype disease-resistant allele Pita-CO of the rice blast Pita disease-resistant gene family has a sequence shown in GenBank OK 169580;
the functional haplotype disease-resistant allele Pita-ZS of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169584;
the functional haplotype of the rice blast Pita disease-resistant gene family has a disease-resistant allele Pita-IR36, and the sequence is shown in GenBank OK 169581.
4. The use of the method of claim 1 for mining the use of 7 novel disease resistant alleles and their sequences in plant breeding programs for disease resistance as follows:
the sequence of the disease-resistant allele Pita-KT of the functional haplotype of the rice blast Pita disease-resistant gene family is shown as GenBank OK 169585;
the functional haplotype disease-resistant allele Pita-9311 of the rice blast Pita disease-resistant gene family has a sequence shown in GenBank OK 169579;
the functional haplotype disease-resistant allele Pita-Q15 of the rice blast Pita disease-resistant gene family has a sequence shown in GenBank OK 169583;
the functional haplotype disease-resistant allele Pita-KSL of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169582;
the functional haplotype disease-resistant allele Pita-CO of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169580;
the functional haplotype disease-resistant allele Pita-ZS of the rice blast Pita disease-resistant gene family has the sequence shown in GenBank OK 169584;
the functional haplotype of the rice blast Pita disease-resistant gene family has a disease-resistant allele Pita-IR36, and the sequence is shown in GenBank OK 169581.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021111128850 | 2021-09-18 | ||
| CN202111112885 | 2021-09-18 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981122A CN113981122A (en) | 2022-01-28 |
| CN113981122B true CN113981122B (en) | 2023-02-03 |
Family
ID=79736443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111116143.5A Active CN113981122B (en) | 2021-09-18 | 2021-09-23 | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981122B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906427A (en) * | 2010-06-25 | 2010-12-08 | 华南农业大学 | Rice blast resistance gene Pi1 and application thereof |
| JP2015128385A (en) * | 2014-01-07 | 2015-07-16 | 国立研究開発法人農業生物資源研究所 | Utilization of true resistance gene pita-2 imparting resistance to blast disease and of allele pi19 thereof |
| CN105907884A (en) * | 2016-07-04 | 2016-08-31 | 湖北省农业科学院粮食作物研究所 | Rice blast resistant gene Pita specific molecular marker of rice and application |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
| CN111662953A (en) * | 2020-06-11 | 2020-09-15 | 华南农业大学 | Technical system capable of identifying disease-resistant genes by inoculating pathogens in different plant disease systems |
| CN112442547A (en) * | 2020-12-11 | 2021-03-05 | 华智生物技术有限公司 | Development and application of SNP molecular marker of rice blast resistance gene Pita |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103333887B (en) * | 2013-06-17 | 2015-09-30 | 华南农业大学 | A kind of functional label utilizing DNA melting temperature (Tm) analyzing rice Pita gene |
| CN106167827A (en) * | 2016-08-11 | 2016-11-30 | 江苏焦点农业科技有限公司 | Resistance gene of rice blast Pita, Pib molecule labelling method |
| CN110029187A (en) * | 2019-04-29 | 2019-07-19 | 华南农业大学 | A kind of application for marking the method for map based on competitive equipotential PCR building rice molecular and it being utilized to carry out breeding |
| CN112063744A (en) * | 2020-09-18 | 2020-12-11 | 上海市农业科学院 | KASP molecular marker for detecting rice blast resistance gene Pita of rice and detection method |
-
2021
- 2021-09-23 CN CN202111116143.5A patent/CN113981122B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906427A (en) * | 2010-06-25 | 2010-12-08 | 华南农业大学 | Rice blast resistance gene Pi1 and application thereof |
| JP2015128385A (en) * | 2014-01-07 | 2015-07-16 | 国立研究開発法人農業生物資源研究所 | Utilization of true resistance gene pita-2 imparting resistance to blast disease and of allele pi19 thereof |
| CN105907884A (en) * | 2016-07-04 | 2016-08-31 | 湖北省农业科学院粮食作物研究所 | Rice blast resistant gene Pita specific molecular marker of rice and application |
| CN107988410A (en) * | 2017-12-21 | 2018-05-04 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita |
| CN111662953A (en) * | 2020-06-11 | 2020-09-15 | 华南农业大学 | Technical system capable of identifying disease-resistant genes by inoculating pathogens in different plant disease systems |
| CN112442547A (en) * | 2020-12-11 | 2021-03-05 | 华智生物技术有限公司 | Development and application of SNP molecular marker of rice blast resistance gene Pita |
Non-Patent Citations (2)
| Title |
|---|
| 水稻抗稻瘟病基因Pita特异性分子标记开发及应用;蔡海亚等;《分子植物育种》;20170228(第02期);全文 * |
| 稻瘟病抗性基因Pita特异性分子标记的开发及应用;华丽霞等;《西南农业学报》;20161231(第10期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981122A (en) | 2022-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5960917B1 (en) | Rice whole genome breeding chip and its application | |
| CN113789403B (en) | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems | |
| Barabaschi et al. | Physical mapping of bread wheat chromosome 5A: an integrated approach | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN113744800B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker | |
| CN113981122B (en) | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN114292937B (en) | One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families | |
| CN113981121B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family | |
| KR20030040400A (en) | Method of estimating the genotype of fertility recovery locus to rice bt type male fertility cytoplasm | |
| CN113903397B (en) | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof | |
| CN113774160B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster | |
| CN114622027B (en) | One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families | |
| CN113736866A (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN108048458B (en) | SNP marker of rice lodging-resistant gene and application thereof | |
| CN113736908B (en) | SNP locus combination for detecting tomato leaf mold resistance and application thereof | |
| CN117965787B (en) | SNP (Single nucleotide polymorphism) marker and primer set for identifying authenticity of pineapple Josapine and MD2 hybrid and application of SNP marker and primer set | |
| CN116144827B (en) | KASP molecular marker closely linked with cotton fiber length QTL and application | |
| CN116751887B (en) | Application of GhEIF A gene associated with cotton fiber strength character | |
| US20230183822A1 (en) | Molecular markers for identifying allele at rice-blast-resistant pik locus of rice and use thereof | |
| CN108642202B (en) | SNP (Single nucleotide polymorphism) marker related to millet stem node number traits as well as detection primer and application thereof | |
| CN116064897A (en) | Primer group for screening background of tobacco No. 13 chromosome for resisting spot wilt and application thereof | |
| CN116064896A (en) | Primer group for screening anti-spot wilt tobacco chromosome 8 background and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |