CN114622027B

CN114622027B - One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

Info

Publication number: CN114622027B
Application number: CN202111679808.3A
Authority: CN
Inventors: 潘庆华; 张亚玲; 曾晓珊; 梁志坚; 文健强; 王思; 罗雨薇; 王丽; 张玉; 王玲
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-12-31
Filing date: 2021-12-31
Publication date: 2023-03-14
Anticipated expiration: 2041-12-31
Also published as: CN114622027A

Abstract

The invention discloses a group of two inclusive and precise identification and excavation technical systems for disease-resistant gene families of rice blast Pia and Pii. The technical system consists of two-stage detection markers of disease-resistant functional haplotype-disease-resistant allele and the like of 2 sets of self-forming systems, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The technical system can be used for identifying, excavating, cloning and utilizing rice blast Pia and Pii disease-resistant gene family alleles, and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and efficiency of the work of breeding for disease resistance, and improving the diversity and reasonable layout of disease-resistant varieties so as to prolong the service life of the gramineous crops.

Description

One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a group of two inclusive and precise identification and excavation technical systems for disease-resistant gene families of rice blast Pia and Pii.

Background

The blast disease caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious limiting factors in global rice production, and a large amount of grain loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance depends on direct identification and selection of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and the results of identification and selection are easy to cause errors. In particular, the direct selection of the aggregate phenotype of the genes of the same type is very inefficient or impossible due to the problems of overlapping resistance spectra, coverage, etc. caused by gene interaction between the resistance genes. With the development of molecular marker identification technology, the technology has the advantages of accuracy, reliability, no environmental influence and the like, so that the technology becomes the mainstream technology of plant breeding, and the purpose and the efficiency of breeding work are greatly improved.

On the other hand, in the process of long military competition of the disease-resistant gene of the host plant and the avirulence gene of pathogenic bacteria, the disease-resistant gene generates new disease-resistant specificity in the forms of 'allele family' (each member is positioned at the same gene locus, so that the homozygous diploid individual only contains one member) with the lowest evolution cost and the like, and the rapid variation of the avirulence gene can be followed. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a resistant "gene family" used for a long time in breeding programs, it will further differentiate into "alleles" with different disease resistance specificities in functional haplotypes (Zhai et al 2011, new Phytologist, 189.

In the above two-stage evolution process of "functional haplotype-disease resistance allele", there are obvious and distinct DNA polymorphisms, including Single Nucleotide Polymorphism (SNP) and polynucleotide polymorphism (differentiated genomic region) and Insertion/Deletion polymorphism (InDel). Herein, nucleotide polymorphisms within functional genes are collectively referred to as function-specific nucleotide polymorphisms (simply, function-specificity). Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same "gene family", and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of "gene families". Taking the rice blast resistance gene as an example, among the 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1 (Pit and Pi37 family), 2 (Pib family), 6 (Pi 2/Pi9 family), 9 (Pii family), 11 (Pia and Pik family) and 12 (Pita family) (Sharma et al.2012, agricultural Research, 1.

In particular, the Pii, pia and Pik families are paired genes (coupled gene, pia-1, pia-2, and so on; and so on) that express their function when present together (Okuyama et al 2011, the Plant Journal, 66.

As described above, the Pia gene family located in The middle region of The short arm of chromosome 11 is one of The most widely used resistance sources in The global rice, particularly japonica rice breeding programs (Okuyama et al 2011, the Plant Journal, 66. In order to fully utilize the antigen gene, researchers have only developed and utilized 2 patent markers [ Pia-C _1, pia-C _2, panqinghua, etc. ], a rice blast resistance gene Pia-C function-specific molecular marker and a method and application thereof (ZL 201210164522.6) ], and 2 scattered molecular markers [ Pia-ID01_2, kitazawa et al 2019, breeding science, 68-83; pia-STS, yadav et al 2019, ploss One, 14.

In particular, only Pia-C could be identified by the 2 patent markers developed by the applicant (see example 8 for details).

On the other hand, the Pii gene family located in the centromere region of chromosome 9 is also one of the most widely used resistance sources in global rice, especially japonica rice breeding programs (Takagi et al 2013, new Phytologist,200, 276-283). To fully utilize this antigen gene, researchers have developed up to now 4 scattered molecular markers [ Pii-ID07, pii-ID21, pii-ID24Kitazawaet al 2019, breeding Science, 69; 40N23R, yadav et al 2019, plos one, 14.

As described above, since the Pia and Pii gene families are both resistance sources widely used for a long time in rice breeding programs for disease resistance, under the continuous and strong selection pressure of rice blast germs, complex and diverse variations are generated in two-stage evolution levels such as "functional haplotype-disease resistance alleles". However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the reported molecular markers are developed sporadically for specific regions or sites of specific genes, and no clear technical system with comparability, logicality and inclusiveness is formed among them. For complex genomic regions, complex gene families, 2 outstanding and realistic problems arise from this: (1) Any single molecular marker which is not designed based on the evolutionary hierarchy is difficult to avoid the problem of false positive or false negative due to the technical limitation of the molecular marker; (2) Any single molecular marker that is not designed based on its evolutionary hierarchy cannot constitute an inclusive and comparable technical system to continuously mine, identify and name new genes in a complex gene family.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a group of two inclusive and precise technical systems for identifying, excavating and cloning rice blast Pia and Pii disease-resistant gene family alleles. The technical system consists of two-stage detection markers of functional haplotype-disease-resistant allele and the like of 2 sets of self-forming systems, and the two-stage detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of technical system. The method specifically comprises the following steps:

(1) The second purpose of the invention is to provide a set of technical system which has the advantages of inclusion and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele. Which comprises the following steps:

(a) Provides a specific molecular marker of functional haplotype/non-functional haplotype of Pia gene family and an identification method thereof;

(b) Provides a specific molecular marker of disease-resistant allele Pia-C of functional haplotype of Pia gene family and an identification method thereof;

(c) The application and the example of the disease-resistant allele Pia-A are identified, excavated and cloned by utilizing the technical system which has the advantages of inclusiveness, accurate identification, excavation and cloning of the rice blast Pia disease-resistant gene family allele;

(d) Screening the application and example of sequencing errors by using the technical system which has the advantages of inclusion and accurate identification, mining and cloning of rice blast Pia disease-resistant gene family alleles;

(e) The application and the example of the true and false alleles of the rice blast Pia disease-resistant gene family are screened by utilizing the technical system which has the advantages of inclusion and accurate identification, excavation and cloning;

(f) The application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice variety resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusiveness, accurate identification, mining and cloning of the rice blast Pia disease-resistant gene family alleles are disclosed;

(g) Provides an example for comparing the identification capability of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele with other marking technologies.

(2) The third purpose of the invention is to provide a set of technical system which has inclusion and can accurately identify, mine and clone the rice blast Pii disease-resistant gene family allele. Which comprises the following steps:

(h) Provides a specific molecular marker of functional haplotype/non-functional haplotype of Pii gene family and an identification method thereof;

(i) Provides a specific molecular marker of disease-resistant allele Pii-F of functional haplotype of Pii gene family and an identification method thereof;

(j) Provides a specific molecular marker of disease-resistant allele Pii-M of functional haplotype of Pii gene family and an identification method thereof;

(k) The application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusiveness, accurate identification, mining and cloning of the rice blast Pii disease-resistant gene family alleles are disclosed;

(l) The application and the example of identifying and mining the new and old disease-resistant alleles from the Liaoning rice variety resource population with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification, mining and cloning of the rice blast Pii disease-resistant gene family alleles are disclosed;

(m) providing an example of the comparison of the identification capability of the technical system which has the advantages of compatibility and accurate identification, excavation and cloning of rice blast Pii disease-resistant gene family alleles with other marking technologies.

(3) The fourth purpose of the invention is to provide the application and examples of separating and cloning the homologous gene cloning means based on PCR technology and verifying the allele.

The technical solution of the present invention to achieve the above object is as described in the claims and the specific examples.

The invention provides a set of two technical systems which can be used for identifying, excavating and cloning rice blast Pia and Pii disease-resistant allele family alleles and have systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and efficiency of the work of breeding for disease resistance, and improving the diversity and reasonable layout of disease-resistant varieties so as to prolong the service life of the gramineous crops.

Drawings

FIG. 1 is a set of two compatible and precise identification schemes for the development and application of the rice blast Pia and Pii disease-resistant gene families.

And 2. Sequence comparison of the Pia disease-resistant gene family and identification of specific sequences thereof. Wherein, the first and the second end of the pipe are connected with each other,

cloned Pia (noted as Pia-a in this patent for distinction) [ donor variety Aichi Asahi; okuyama et al.2011 ] has the gene accession numbers for the paired genes: AB604626.1 and AB60421; to facilitate sequence alignment analysis, 5 sequencing reference varieties Sasanishiki, CO39, nipponbare (NPB), hitomebore, shennong265, which are presumed to be carriers of the target gene, were added; and 2 genomic sequences corresponding to the sequencing reference varieties Suijing 18, koshihikari, presumed to be non-carriers of the gene of interest;

all validated haplotypes and allele-specific SNPs have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-4 for details).

In particular, since the reference sequence of the above-described sequenced variety is already disclosed, the figure shows only the first of its paired genes in the following "figure of the specification" in order to fully understand the specific sequence of the Pia disease resistance gene family and its marker information in conjunction with fig. 3 to 4.

FIG. 3 development and application of functional/non-functional haplotype specific molecular markers of Pia disease-resistant gene family

3a #1 paired gene haplotype-specific optimal SNPs for 1 Pia family;

3b, #2 pairwise gene haplotype-specific optimal SNPs for 1 Pia family;

3c 2 Pia family optimal haplotype specific markers [ a-1, upper band, non-functional haplotype; lower band, functional haplotype; # a-2, upper lane, functional haplotype; lower band, non-functional haplotype ] identification examples of the first set of 14 Pia reference varieties, wherein,

functional haplotype variety: CK1, aichi Asahi (Pia-A); CK2, sasanishiki (Pia-A); CK3, nipponbare (Pia-A); CK4, shennong265 (Pia-A); CK5, CO39 (Pia-C); CK6, C101LAC (Pia-C); CK7, C101A51 (Pia-C); CK8, guangchangai (Pia-C);

non-functional haplotype variety: CK9, shin 2 (Pia-Null); CK10, fujisaka5 (Pia-Null); CK11, kusabue (Pia-Null); CK12, kasalath (Pia-Null); CK13, koshihikari (Pia-Null); CK14, suijing 18 (Pia-Null); m, DL-500size marker;

in particular, the test varieties CK3 and CK4 should be functional haplotype varieties due to sequence errors, which are different from the sequences of the non-functional haplotype varieties Suijing 18 and Koshihikari;

specification of test varieties: the information of the 14 first set of Pia reference varieties is as described above, and if not necessary, it will not be described in detail below.

Description of the labeling: # a-1 and # a-2, which are the numbers of labels, means #1 and #2 labels of Pia; pia-F/N ^G1-303T The gene symbol is italicized and represents a functional gene; the gene symbol is a positive body and represents a marker; F/N, functional/non-functional; superscript G1-303T, meaning the specific SNP at position #303 of the #1 paired gene, and so on;

in particular, when the genotypes of the 2 haplotype-specific markers of the specimen variety are all functional haplotypes, the specimen variety can be determined as a functional haplotype variety.

FIG. 4 development and application of disease-resistant allele Pia-C function-specific molecular markers of functional haplotypes of Pia disease-resistant gene family

The optimal SNP specific to #1 paired genes of Pia-C of 4 a;

4b #2 paired gene-specific optimal SNPs for Pia-C; 4C, 2 Pia-C specific markers [ a-3 and # a-4, upper band and non-target gene; lower band, target genes ] identification examples of a first set of 14 Pia reference varieties, wherein,

the target gene variety: CK5, CO39 (Pia-C); CK6, C101LAC (Pia-C); CK7, C101A51 (Pia-C); CK8, guangchangai (Pia-C);

non-target gene variety: the remaining 10 Pia first set of reference varieties.

FIG. 5 shows the application and example of the above-mentioned technical system for identifying disease-resistant allele Pia-A by using the above-mentioned set of techniques with inclusion and accurate identification, mining and cloning of disease-resistant gene family allele of rice blast Pia

Optimal SNP specific for the #1 paired genes of the 5a;

5b, #2 pairwise gene-specific optimal SNPs for Pia-C of 1 (see FIG. 4 for further details);

5c 2 Pia family optimal haplotype specific markers [ a-1, upper band, non-functional haplotype; lower band, functional haplotype; # a-2, upper lane, functional haplotype; lower band, non-functional haplotype ] is an identification example of a first set of 14 Pia reference varieties, and the result shows that CK 1-4 and CK 5-8 belong to functional haplotype varieties;

5d of 2 Pia-C specific markers [ a-3 and # a-4, upper band, non-target gene; the lower band, target gene ] identifies 14 first set of reference varieties of Pia, and the result shows that the genotypes of CK 1-4 and CK 5-8 are different and do not belong to Pia-C;

from the above results, it was concluded that CK 1-4 are Pia-A carriers of functional haplotypes. That is to say, the amount of the chemical reaction,

the target gene variety: CK1, aichi Asahi (Pia-A); CK2, sasanishiki (Pia-A); CK3, nipponbare (Pia-A); CK4, shennong265 (Pia-A);

non-target gene variety: the remaining 10 Pia first set of reference cultivars.

FIG. 6 shows the application and example of the above-mentioned technical system for screening sequencing errors by using the allele of rice blast Pia disease-resistant gene family with the advantages of compatibility and accurate identification, mining and cloning

6a, 3 optimal SNPs with haplotype specificity for the paired genes of the #1 Pia family, wherein the # a-1 is a patent marker SNP, and the other 2 are newly added screening marker SNPs in the embodiment;

6b, #2 paired gene haplotype-specific optimal SNPs of 1 Pia family, as newly added discrimination marker SNPs in this example;

6c, identification examples of 14 first Pia reference varieties by 2 optimal haplotype specific patent markers of Pia families (see figure 3 in detail), and results show that the sequences of test varieties such as Nipponbare, shennong265 and the like are wrong, the sequences are different from the sequences of non-functional haplotype varieties Suijing 18, and CK 1-8 belong to functional haplotype varieties;

6d, 3 newly-increased screening markers are used for identifying 14 first sets of Pia reference varieties, and the results show that, like the results, sequences of Nipponbare, shennong265 and other test varieties are wrong, the sequences are different from the sequence of a non-functional haplotype variety Suijing 18, and CK 1-8 belong to functional haplotype varieties;

and (4) conclusion: sequencing varieties such as Nipponbare, shennong265 and the like have integral sequencing errors in 2 paired genes of the Pia family; that is, in the sequence table, 6 sequenced varieties above Shennong265 are functional haplotype varieties, and the sequences thereof are classified with Aichi Asahi.

FIG. 7 shows the application and example of screening true and false alleles of rice blast Pia disease-resistant gene family by using the above-mentioned technical system with the advantages of compatibility and accurate identification, mining and cloning

The optimal SNP for Pia-C allele specificity of the #1 paired gene of the 7a;

the optimal SNP for Pia-C allele specificity of the #2 paired gene of the 7b;

candidate SNPs specific for alleles of 7 c;

identification examples of optimal allele-specific patent markers for Pia-C of the 7d;

7 e; specifically, SNPs of all functional haplotype varieties above Shennong265 are not enzymatically cleavable CCs, while SNPs of non-functional haplotype varieties such as Suijing 18 are enzymatically cleavable TAs;

and (4) conclusion: the Pia family has so far only 2 alleles, pia-C and Pia-A.

FIG. 8 shows the application and example of identifying and mining new and old disease-resistant alleles from Guangxi rice variety resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pia disease-resistant gene family alleles with compatibility and accuracy. Wherein, the first and the second end of the pipe are connected with each other,

8a, identifying 52 test varieties based on 2 optimal primary markers, wherein the results show that only 19 varieties such as Q2634-38, Q2670-71, Q2673, Q2675-77, Q2679-80, Q2687-88, Q2695, Q2704-06 and the like are non-functional haplotype varieties (black); the remaining 33 varieties were functional haplotype varieties (red);

8b, identifying 52 test varieties based on 2 optimal secondary markers (Pia-C functional specificity), wherein the result shows that only 3 varieties such as Q2684, Q2689, Q2691 and the like are Pia-C carriers (blue); the remaining 30 functional haplotype varieties were Pia-A carriers (green);

wherein, the second set of 3 Pia reference varieties is CK1, aichi Asahi (Pia-A); CK2, CO39 (Pia-C); CK3, nipponbare (Pia-A).

FIG. 9 is an example of comparison of identification ability of a technical system for inclusively and accurately identifying, mining and cloning rice blast Pia disease-resistant gene family alleles with other marker technologies according to the present invention

9 a-b, the result of the identification of the first set of reference varieties of 14 Pia by the technical system of the invention shows that CK 1-8 is functional haplotype variety, wherein CK 1-4 is Pia-A carrier; CK 5-8 are Pia-C carriers;

9C1 (Pia-C _1, pia-C _2, ZL201210164522.6) to identify a first set of 14 Pia reference varieties, and the results show that the patent marker has similar effect to a two-stage marker of the technical system and can clearly identify Pia-C carriers, but cannot perfectly identify carriers of alleles Pia-A and Pia-C on the basis of identifying functional/non-functional haplotypes by the two-stage marker system like the technical system;

9c2 (Pia-ID 01_2, kitazawa et al 2019, breeding science,69, 68-83, ploss One, 14;

and (4) conclusion: compared with the 2 sets of other marking technologies, the technical system of the invention has substantial innovation, rigor and superiority.

FIG. 10 sequence comparison of Pii disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,

2 alleles of Pii-M (= Pi5; genBank EU869185.1 and EU869186.1; lee et al.2009, genetics,181, 1627-1638; donor species IRBL 5-M) have been isolated and cloned so far; pii-F (= Pii; genBank MH490982.1 and MH490983.1; takagi et al 2009, new Phytolist, 200-276-283; donor variety: fujisaka 5). For the convenience of sequence alignment analysis, in addition to the above 2 donor varieties, 2 sequencing reference varieties Minghui 63 (MH 63), shuhui 498 (SH 498) presumed to be carriers of the target gene were added; and 5 genome sequences corresponding to the sequencing reference varieties Nipponbare (NPB), shennong265 (SN 265), suijing 18 (SJ 18), tetep (TTP) and IR64 which are presumed to be carriers of the non-target genes;

all validated haplotype and allele-specific SNPs have been numbered (in order of marker usage) and labeled in green (see FIGS. 10-13 for details);

in particular, since the reference sequence of the above-mentioned sequenced variety is already disclosed, the figure shows only the first of its paired genes in the following "drawings of the specification" in order to fully understand the specific sequence of the Pii disease-resistant gene family and its marker information in conjunction with FIGS. 11 to 13.

FIG. 11 development and application of functional/non-functional haplotype specific markers for Pii disease resistance allele families.

11a, #1 paired gene haplotype-specific optimal SNPs for 1 Pii family;

11b, #2 paired gene haplotype-specific optimal SNPs for 1 Pii family;

11c of 2 Pii-optimized haplotype-specific markers [ i-1 and # i-2, upper band, non-functional haplotype; lower band, functional haplotypes ] identification examples of 14 first set of reference varieties of Pii, wherein,

functional haplotype variety: CK1, fujisaka5 (Pii-F); CK2, IRBLi-F5 (Pii-F); CK3, IRBL3-CP4 (Pii-F); CK4, IRBL5-M (Pii-M); CK5, C104PKT (Pii-M); CK6, minghui 63 (Pii-M); CK7, shuhui 498 (Pii-M);

non-functional haplotype variety: CK8, shin 2 (Pii-Null); CK9, aichi Asahi (Pii-Null); CK10, IR64 (Pii-Null); CK11, tetep (Pii-Null); CK12, shennong265 (Pii-Null); CK13, suijing 18 (Pii-Null); CK14, nipponbare (Pii-Null); m, DL-500size marker;

specification of test varieties: the information of the 14 first Pii reference varieties is as described above, and if unnecessary, it is not repeated herein.

FIG. 12 development and application of disease-resistant allele Pii-F specific molecular markers of functional haplotypes of Pii disease-resistant gene cluster

12 a-b 2 optimal SNPs specific to the #1 paired genes of Pii-F (# 2 paired genes none);

12c, 2 Pii-F specific markers [ i-3 and # i-4, upper band, target gene; band below, non-target genes ] are examples of the identification of 14 first set of Pii reference varieties, wherein,

the target gene variety: CK1, fujisaka5 (Pii-F); CK2, IRBLi-F5 (Pii-F); CK3, IRBL3-CP4 (Pii-F);

non-target gene variety: the remaining 11 Pii first set of reference varieties.

FIG. 13 development and application of disease-resistant allele Pii-M specific molecular markers of functional haplotypes of Pii disease-resistant gene family

13a, #1 paired gene-specific optimal SNP for 1 Pii-M;

13b, #2 paired gene-specific optimal SNPs for 1 Pii-M;

13c, 2 Pii-M specific markers [ i-5, upper band, target gene; lower band, non-target gene; # i-6, upper band, non-target gene; lower band, target genes ] identification examples of a first set of 14 Pii reference varieties, wherein,

the target gene variety: CK4, IRBL5-M (Pii-M); CK5, C104PKT (Pii-M); CK6, minghui 63 (Pii-M); CK7, shuhui 498 (Pii-M);

non-target gene variety: the remaining 10 Pii first set of reference varieties.

FIG. 14 is an application and an example of identifying and mining new and old disease-resistant alleles from Guangxi rice seed resource populations with unknown target genes by using the technical system which has the advantages of compatibility and accurate identification, mining and cloning of rice blast Pii disease-resistant gene family alleles. Wherein, the first and the second end of the pipe are connected with each other,

14a, identifying 52 test varieties based on 2 optimal primary markers, wherein the results show that 23 varieties such as Q2674-76, Q2678-79, Q2682-83, Q2687-2702 and the like are functional haplotype varieties (red); the other 29 varieties are non-functional haplotype varieties (black color);

14b identification of 52 test varieties based on secondary markers, wherein,

b1, 2 optimal Pii-F specific markers are used for identifying 52 test varieties, and the result shows that no Pii-F carrier exists (blue);

b2, 2 identification of the optimal Pii-M specific markers on 52 test varieties, wherein the results show that 18 varieties such as Q2674-76, Q2678-79, Q2683, Q2687-89 and the like are Pii-M carriers (green);

based on the above results, it was concluded that 5 varieties such as Q2682, Q2699 to 2702 had the same genotype and were different from Pii-F and Pii-M, and therefore, they were assumed to be carriers of the novel alleles of Pii family and were described as: pii-F036 (Q2682; purple).

Wherein, the second set of 3 Pii reference varieties is CK1, fijisaka 5 (Pii-F); CK2, IRBL5-M (Pii-M); CK3, nipponbare (Pii-Null).

FIG. 15 shows the application and example of identifying and mining new and old disease-resistant alleles from Liaoning rice variety resource population with unknown target genes by using the technical system for identifying, mining and cloning rice blast Pii disease-resistant gene family alleles with compatibility and accuracy. Wherein, the first and the second end of the pipe are connected with each other,

15a, based on the identification of 58 test varieties by 2 optimal primary markers, the results show that 20 varieties such as Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like are functional haplotype varieties (red); the rest 38 varieties are non-functional haplotype varieties (black color);

15b, identifying 58 test varieties based on the secondary markers, wherein,

b1, identifying 58 test varieties by 2 optimal Pii-F specific markers, wherein the results show that 18 varieties such as Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-50, Q2753-54, Q2758, Q2760, Q2762, Q2765, Q2771 and the like are Pii-F carriers (blue);

b2, 2 identification of the optimal Pii-M specific markers on 52 test varieties, wherein the result shows that only 1 variety such as Q2757 is a Pii-M carrier (green);

based on the above results, it was concluded that 1 variety such as Q2751 is a carrier of the Pii family novel allele (purple), and the variety is named Pii-BJ (Q2751) because its genotype is different from Pii-F, pii-M and Pii-F036;

the information for the 3 Pii second set of reference cultivars is described above.

FIG. 16 is an example of comparison of identification ability of rice blast Pii disease resistance gene family allele with other marker technologies using a technical system of the present invention with the advantages of compatibility and accurate identification, mining and cloning

16 a-b, the result of the identification of the first set of reference varieties of the 14 Pii by the technical system of the invention shows that CK 1-7 are functional haplotype varieties, wherein CK 1-3 are Pii-F carriers; CK 4-7 are Pii-M carriers;

1695 (Pii-ID 07, pii-ID21, pii-ID24, kitazawa et al 2019, breeding Science, 69-68-83 N40N23R, yadav et al 2019, plos one, 14;

and (4) conclusion: the technical system of the invention has substantial innovation, rigor and superiority;

the information for the 14 Pii first set of reference varieties is as described above.

FIG. 17 application and examples of cloning and verifying rice blast Pia and Pii disease-resistant gene family alleles by means of homologous gene cloning based on PCR technology

17a structural diagram and cloning schematic diagram of major disease resistance allele of pia;

17b structural diagram and cloning schematic diagram of the main disease resistance allele of Pii;

17c for the Pia-C transgene T ₁ The disease-resistant phenotype identified by inoculating strains and donor varieties (CO 39) and acceptor varieties (Fujisaka 5) of the strains and the genotypes of the transgenic selection marker Hpt are subjected to coseparation analysis,the results show that the phenotype and the genotype of most of the self offspring are consistent; #7,9,10 individuals were inconsistent and may be involved in vaccination evasion and transgene silencing problems;

among them, pGEM-T (Promage Corporation, WI, USA) which is a commonly used vector in laboratories is used for cloning and sequencing of a target gene, and a polygenic polymeric transformation vector pYLCC 380DTH (Lin et al 2003, PNAS,100 5962-5967; panjinmei 2013, master thesis of south China university of agriculture) is used for genetic transformation of a target gene; r, resistant, disease resistance; s, susceptable, susceptibility.

FIG. 18 shows a set of two experimental graphs (attached to the abstract) of the technical system (two-stage marker system) for identification and mining of alleles of rice blast Pia and Pii disease-resistant gene families

Detecting a first set of 14 Pia reference varieties by using a primary marker of 18a;

detecting 14 first set of reference varieties of Pia by using a secondary marker of 18b;

detecting a first set of 14 Pii reference varieties by using a primary marker of 18c;

detecting a first set of 14 Pii reference varieties by using a secondary marker of 18d;

the information for the 14 Pia first set of reference cultivars and the 14 Pii first set of reference cultivars is as described above;

in particular, 2 sets of technical systems are indicated in separate colors.

Detailed Description

The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

All rice varieties used in the examples: 14 first Pia reference varieties (comprising 2 second Pia reference varieties) and 14 first Pii reference varieties (comprising 3 second Pii reference varieties); the Guangxi germplasm resource group (Q2631-2706) of the test variety and the likeAnd Heilongjiang germplasm resources (Q2709-2773) were collected, maintained, and commonly used in the research field and have been disclosed in, including but not limited to, the above references [ Zhai et al.2011, new Phytolist 189; hua et al.2012, the scientific and Applied Genetics 125,https://www.springer.com/ journal/122(ii) a Snow plum, 2021, master paper of south china university of agriculture (no relevant core information for labeling is disclosed); linlism, 2021, university of south china master paper (no relevant core information for labeling is disclosed); appendix charts are available at the respective magazine web sites.

The technical route diagram developed and applied by the patent is shown in figure 1.

Example 1 sequence comparison of the Rice blast Pia disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 4)

1. Experimental method

Cloned Pia-A [ original name: pia; donor variety Aichi Asahi; okuyama et al.2011 in GenBank accession numbers: AB604626.1 and AB60421; to facilitate sequence alignment analysis, 5 sequencing reference varieties Sasanishiki, CO39, nipponbare (NPB), hitomebore, shennong265, which are presumed to be carriers of the target gene, were added; and 2 genomic sequences corresponding to the sequencing reference varieties Suijing 18, koshihikari, presumed to be non-carriers of the gene of interest;

the range of the individual genes ATG to TGA/TAA is annotated with reference to NCBI.

Sequence comparison analysis was performed by conventional bioinformatics methods.

2. Results of the experiment

The results of the sequence comparisons are shown in FIGS. 2 to 4, which show that:

(1) The sequences of the paired genes of the Pia disease-resistant gene family have obvious genome differentiation (typical positions are shown as the marks # a-1 and # a-2 in figure 3) of functional haplotypes (12 reference sequences of the 6 disease-resistant reference varieties) and non-functional haplotypes (4 reference sequences of the 2 susceptible reference varieties);

(2) Functional specific SNPs exist between alleles of the Pia disease resistance gene family (typical positions are shown as markers # a-3 to # a-4 in FIG. 4);

in particular, the reference sequence of 3 varieties such as the sequencing reference variety Nipponbare, hitomebore, shennong265, etc. has a global error and should be a functional haplotype variety (see examples 2-6 for details);

in addition, since the 16 reference sequences are already disclosed, the figure shows only the first half of the first gene pair in the following "figure of the specification", so as to fully understand the specific sequences of the Pia disease-resistant gene family and the labeling information thereof with reference to fig. 3 to 4.

Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pia disease-resistant gene family (FIG. 3)

1. Experimental methods

The experimental procedure of this example is described mainly in the papers published by the applicant (Zhai et al 2011, new Phytologist 189, 321-334, hua et al 2012, therapeutic and Applied genetics, 125.

[ the following references are the same as above, and need not be repeated ]

Briefly described, the following steps:

(1) Design of haplotype-specific molecular markers (SNP markers): according to the comparison result of the Pia disease-resistant gene family sequence, aiming at 2 haplotype specificity optimal SNPs with clear differentiation of functional/non-functional haplotypes, the design principle of the marks of CAPS and dCAPS (derived significant polymorphism) is adopted, and the online software dCAPSFinder 2.0 (http:// helix.wustl.e.edu/dCAPS/dcaps.html. Html) is utilized to design primers marked by dCAPS and dCAPS (derived significant polymorphism sequences; neff et al 2002, trends in Genetics 18; then, the Primer design software Primer 5.0 is used for confirming the mark design;

(2) Design of haplotype-specific molecular markers (Indel markers): for the insertion/deletion (Indel) polymorphic region with clear functional/non-functional haplotype differentiation, the label design and confirmation are carried out by using Primer design software Primer 5.0 on the conserved and specific genome region at the two sides directly;

[ molecular markers and primer design procedures below are the same as those described above, and are not repeated

For descriptive convenience, the labels are named as # a-1 and # a-2 respectively (and so on); the primer sequences are as follows:

for the # a-1 marker (upper band, non-functional haplotype; lower band, functional haplotype):

SEQ ID NO.1(Pia-F/N ^G1-303T -F；5’-3’)：

ACGACGGCAAGCCCAGA；

SEQ ID NO.2(Pia-F/N ^G1-303T -R；5’-3’)：

AGAGCCCTGAGCTCCGCGAT。

for the # a-2 marker (upper band, functional haplotype; lower band, non-functional haplotype):

SEQ ID NO.3(Pia-F/N ^{Indel(2-1007)} -F；5’-3’)：

AGGTGCTCGGCGAATTGCT；

SEQ ID NO.4(Pia-F/N ^{Indel(2-1007)} -R；5’-3’)：

AGCTGACCAGCATCGGAGT。

(2) PCR amplification of haplotype-specific molecular markers: the 14 first set of Pia reference varieties were subjected to PCR amplification using the 2 sets of primers. The PCR amplification system (20.0. Mu.L) was as follows:

[ PCR amplification System is the same as described above, and its description is not repeated ]

The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, followed by PCR amplification for 25-40 cycles (typical CAPS/dCAPS marker is 35 cycles, typical Indel marker is 25 cycles; appropriate adjustment is made depending on the object of detection) [ 94 ℃ denaturation for 30sec, annealing for 30sec (# a-1/57 ℃, # a-2/60 ℃), extension at 72 ℃ for 25-30 sec (appropriate adjustment is made depending on the object of detection) ], and finally extension at 72 ℃ for 5min, the PCR product is stored in a refrigerator at 4 ℃ for further use.

[ except for the annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated

(3) Enzyme digestion of haplotype-specific molecular markers (Indel marker does not need enzyme digestion): for CAPS or dCAPS tags such as the # a-1 tag, the PCR product was first extracted and cleaved with the corresponding restriction enzyme and its optimum temperature (# a-1, hhaI/37 ℃), and the reaction system (10.0. Mu.L) was as follows:

after 5 hours of digestion, the mixture was stored in a refrigerator at 4 ℃ until use.

[ PCR amplification product enzyme digestion System is the same as that described above, and details are not repeated ] below

(4) Detection of haplotype-specific molecular markers:

respectively taking out the CAPS or dCAPS marked enzyme digestion product and Indel marked PCR product, adding 10 mu L of 10x loading into each tube of enzyme digestion product or PCR product, uniformly mixing, and detecting according to the following program;

1.5-2.5 mul of the product is taken by a microsyringe and electrophoresed on 10% -12% denaturing polyacrylamide gel (250V, 20-120 min; can be adjusted according to the detected object), and then the molecular marker is photographed and recorded according to the conventional detection method.

[ the following molecular marker detection procedures are the same as those described above, and their descriptions are omitted ]

2. Results of the experiment

The size of each molecular marker is shown in fig. 3, and the results show that the 14 Pia first set of reference varieties present clear genotypes (haplotypes):

non-functional haplotype variety: CK9, shin 2 (Pia-Null); CK10, fujisaka5 (Pia-Null); CK11, kusabue (Pia-Null); CK12, kasalath (Pia-Null); CK13, koshihikari (Pia-Null); CK14, suijing 18 (Pia-Null).

In particular, only when 2 functional/non-functional haplotype-specific molecular markers of the test variety are functional haplotypes, the test variety can be judged as a functional haplotype variety

Description of varieties to be tested: the information of the 14 first set of Pia reference varieties is as described above, and if not necessary, it will not be described in detail below.

Example 3: development and application of disease-resistant allele Pia-C function-specific molecular marker of functional haplotype of Pia disease-resistant gene family (figure 4)

1. Experimental methods

(1) Designing a Pia-C function specific molecular marker: according to the comparison result of the Pia disease-resistant gene family sequences, 2 optimal SNPs are selected to be designed into a Pia-C function specific molecular marker Pia-C ^T1-2214C (# a-3 marker), pia-C ^{Indel(2-3038)} (# a-4 marker); the primer sequences are as follows:

for the # a-3 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.5(Pia-C ^T1-2214C -F1；5’-3’)：

AATAAAGTTTTTGGCTCCGAAGATCAATGTCCT；

SEQ ID NO.6(Pia-C ^T1-2214C -F2；5’-3’)：

AATAGAGTTTTTGGATCAGAGCAACAATGTCCT；

SEQ ID NO.7(Pia-C ^T1-2214C -R1；5’-3’)：

CGGTTGGCTTCCTAGAAGACCTGCTAT；

SEQ ID NO.8(Pia-C ^T1-2214C -R2；5’-3’)：

CGGCAGGCTTGCTAAAAGACCGGCTAT；

for the # a-4 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.9(Pia-C ^{Indel(2-3038)} -F；5’-3’)：

GCCTTTCATCTACTAAATTTACAACAGG；

SEQ ID NO.10(Pia-C ^{Indel(2-3038)} -R；5’-3’)：

CAAGTAGCTCAAATTACTCAAGGC；

in particular, since the # a-3 marker is located in a region where the genome is significantly differentiated, the marker is optimized to be a marker of 4 primer combinations (2F vs 2R) in order to ensure reliability and accuracy of the detection result.

(2) Detection of Pia-C function specific molecular markers: and (3) carrying out PCR amplification on 14 first Pia reference varieties according to the PCR amplification system (annealing temperature: # a-3/57 ℃ and # a-4/58 ℃) by utilizing the 2 marked primer combinations, and then carrying out detection and recording of the molecular marker according to the enzyme digestion system (# a-3/MseI/37; # a-4 does not need enzyme digestion) and the detection system.

2. Results of the experiment

The sizes of the molecular markers are shown in FIG. 4, and the results show that the Pia-C function-specific molecular markers can distinguish target genes from all known functional genes of the gene family, and non-functional genes:

non-target gene variety: the remaining 10 Pia first set of reference cultivars.

Example 4: the application and example of the disease-resistant allele Pia-A are identified by using the technical system which has the advantages of inclusion and accurate identification, excavation and cloning of the disease-resistant allele family of the rice blast Pia (figure 5)

(1) As described in example 2, the results of the detection of 14 first sets of Pia reference varieties by 2 functional/non-functional haplotype-specific molecular markers indicate that CK 1-8 are functional haplotype varieties (carriers of Pia disease-resistant gene family alleles);

(2) As described in example 3, the results of the detection of 14 first sets of Pia reference varieties by 2 Pia-C function-specific molecular markers indicate that CK 5-8 are carriers of Pia-C, and CK 1-4 are the same in genotype but non-functional haplotype variety pairs;

(3) Taken together with the above results, it was concluded that CK 5-8 should be carriers of Pia-A, since they are functional haplotype varieties and that CK1 is the donor variety of Pia-A.

This example illustrates: although the alleles of the Pia disease-resistant gene family are relatively simple (only 2 alleles are found at present), the technical system has remarkable inclusiveness and the capability of accurately identifying and mining the alleles.

Example 5: the application and example of the technical system for screening sequencing errors by using the technical system with inclusion and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family alleles (figure 6)

As described in example 2, the results of the detection of 14 Pia first set of reference varieties by 2 functional/non-functional haplotype-specific molecular markers indicate that CK 1-8 are functional haplotype varieties (carriers of Pia disease-resistant gene family alleles) and CK 9-14 are non-functional haplotype varieties (carriers of non-Pia disease-resistant gene family alleles). This result is clearly inconsistent with the results of sequencing, as the latter result indicates that Nipponbare, shennong265, etc. should be non-functional haplotype varieties (FIG. 6 c). In order to confirm whether the sequencing error of the Pia disease-resistant gene locus of the varieties such as Nipponbare, shennong265 and the like is individual or integral, 3 screening markers are further developed in the embodiment, and more genome segments of the Pia disease-resistant gene locus are detected and confirmed.

1. Experimental methods

(1) Designing a sequencing error screening marker of a Pia disease-resistant gene family: according to the comparison result of the Pia disease-resistant gene family sequence, further randomly selecting optimal 2 SNPs and 1 Indel to design as a functional haplotype/non-functional haplotype specific molecular marker Pia-F/N ^T1-68C (# screen a-1 marker, SEQ ID NO.33-34 for sequence), pia-F/N ^T1-200A (# distinguishes a-2 marker, the sequence is shown in SEQ ID NO. 35-36), pia-F/N ^{Indel(2-3489)} (# screen a-3 marker, sequence shown in SEQ ID NO. 37-38);

in particular, since the screening marker is not in the scope of protection of this patent (a marker that is not sufficiently necessary for a patent), the primer sequence thereof is arranged in the "screening marker" series following the "patent marker" series, and is only referred to (the same below).

(2) Detection of a sequencing error discrimination marker of a Pia disease-resistant gene family: and performing PCR amplification on 14 first Pia reference varieties according to the PCR amplification system (annealing temperature: a-1/54 ℃, a-2/58 ℃ and a-3/56 ℃ for # discrimination) by using the 3 marked primer combinations, and then performing detection and recording of the molecular markers according to the enzyme digestion system (# a-1 and a-2/Bsr I/65 ℃, a-3 for # discrimination) and the detection system.

2. Results of the experiment

The 3 discrimination markers exhibited results completely consistent with the 2 functional/non-functional haplotype-specific molecular markers (# a-1 and # a-2). Thus, it was demonstrated that sequencing errors in the Pia resistance gene locus of Nipponbare, shennong265, etc. varieties were global (FIG. 6 d);

the example proves that the technical system has strong inclusion and reliability, not only can accurately identify the functional/non-functional haplotypes and alleles thereof of the Pia disease-resistant gene family, but also can reliably identify the sequencing errors existing in the reference sequence, even the Nipponbare reference sequence with the highest quality.

Example 6: application and example of screening true and false alleles by using the technical system which is inclusive and can accurately identify, mine and clone the alleles of the Pia disease-resistant gene family (figure 7)

1. Experimental method

(1) To develop a function-specific molecular marker for Pia-A, only 2 candidate SNPs (T2-624C, A2-627C) were found in the reference sequences of the Pia anti-disease gene family (including the #1 and #2 paired genes) (FIG. 7C), with possible polymorphisms between Aichi Asahi (Pia-A) and CO39 (Pia-C) (FIG. 7C);

in particular, the above-mentioned Pia-C function-specific molecular marker (Pia-C) was used as a control for comparative analysis (FIG. 7 d);

(2) 2 SNPs were developed as function-specific molecular markers for Pia-A according to the above procedure: pia-A ^T2-624C (# screen a-4, sequence shown in SEQ ID NO. 39-40), Pia-A ^A2-627C (screening a-5, the sequence is shown in SEQ ID NO. 41-42), and the primer sequence is arranged in a screening marker series after a patent marker series and is only used as reference;

(3) Detection of the 2 discrimination markers: and (2) carrying out PCR amplification on 14 first Pia reference varieties according to the PCR amplification system (annealing temperature: a-4/62 ℃ for # screening and a-5/62 ℃ for # screening) by utilizing the 2 marked primer combinations, and then carrying out detection and recording of the molecular markers according to the enzyme digestion system (# a-4/XcmI/37 ℃ for # screening and a-5/TaqI/65 ℃) and the detection system.

2. Results of the experiment

The results show that both are deduced as haplotype specific markers for the Pia family, but not as CK2 (Sasanishiki) and CK5 (CO 39) specific markers; specifically, SNPs of all functional haplotype varieties above Shennong265 are not cleavable CCs, while SNPs of non-functional haplotype varieties such as Suijing 18 are cleavable TAs (FIG. 7 c);

and (4) conclusion: the Pia family has so far only 2 alleles, pia-C and Pia-A, and they can only be precisely identified by the patented technical system (see example 8 below for details).

Example 7 application and example of identifying and mining new and old disease-resistant alleles from Guangxi rice variety resource population with unknown target genes by using the above-mentioned technical system for identifying, mining and cloning alleles of rice blast Pia disease-resistant gene family with inclusion and accuracy (FIG. 8)

(1) The Pia technology system of the invention is composed of 4 basic specific markers of two-stage detection markers of 'functional haplotype-disease resistance allele'. Wherein, the detection of functional/non-functional haplotypes needs to be advanced preferentially to detect disease-resistant alleles. The detection procedures and schemes of the whole technical system are as described above (fig. 3-4; examples 2-3), which are not repeated herein.

(2) Utilizing the technical system to identify and mine 44 randomly selected Guangxi rice seed resource groups [ leaf snow plum, 2021, master thesis of southern China agriculture university (relevant core information is not disclosed) for Pia disease-resistant gene family alleles;

3 varieties CK1, aichi Asahi (Pia-A); CK2, CO39 (Pia-C); CK3, nipponbare (Pia-A) was also included in the trial as a second set of reference varieties of Pia.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 52 test varieties were classified (FIG. 8 a):

functional haplotype variety (red marker): 33 varieties such as Q2631-33, Q2663-69, Q2672, Q2674, Q2678, Q2681-86, Q2689-94, Q2696-2703 and the like are functional haplotype varieties;

non-functional haplotype varieties (black markers): 19 varieties such as Q2634-38, Q2670-71, Q2673, Q2675-77, Q2679-80, Q2687-88, Q2695, Q2704-06 and the like are non-functional haplotype varieties.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 6 b), 33 functional haplotype test varieties were further identified as:

the target gene Pia-C carries the variety (blue indication): only 3 varieties such as Q2684, Q2689 and Q2691;

(3) Combining the detection results of the primary and secondary markers (FIG. 6 b), 33 functional haplotype test varieties were further identified as:

the target gene Pia-A carries the variety (green designation): 30 varieties of Q2631-33, Q2663-69, Q2672, Q2674, Q2678, Q2681-83, Q2685-86, Q2690, Q2692-94, Q2696-2703 and the like;

the example demonstrates that the technical system has strong compatibility and reliability, because 33 functional haplotype varieties are firstly identified in 52 Guangxi rice seed resource groups with unknown target genes; then identifying carriers of 3 novel target genes Pia-C; combining the detection results of the primary marker and the secondary marker, 30 carriers of known allele Pia-A are further identified.

Implementation 8: one set of the invention has the advantages of inclusion and accurate identification example of comparison of discrimination ability of technical System for digging and cloning Rice blast Pia disease-resistant Gene family functional Gene with other marker techniques (FIG. 9)

(1) Although The rice blast Pia disease resistance gene family is one of The most widely used resistance sources in global rice, especially japonica rice Breeding programs (Okuyama et al.2011, the Plant Journal,66 467-479), only 2 patent markers of Pia other marker technology-1 (noted as # other a-1), pia-C _2 (# other a-2), panhua, etc., rice blast resistance gene Pia-C function-specific molecular markers and methods and applications thereof (ZL 210164522.6), and 2 sporadic molecular markers of Pia other marker technology-2 [ Pia-ID01_2 (# other a-3), kitazawa et al.2019, breeding Science, 69; pia-STS (# of the other party a-4), yadav et al 2019, ploss One, 14;

in particular, the Pia other-party markers a-1 to a-4 are only used as reference because the Pia other-party markers are not necessary markers of the technical system, the primer sequences are respectively shown as SEQ ID NO. 43-44, SEQ ID NO. 45-46, SEQ ID NO. 47-48 and SEQ ID NO. 49-50, and the detection procedures are described in the literature;

(2) The 14 first sets of Pia reference varieties were used as detection targets for identification and comparison by the Pia other marker technique-1 and the Pia other marker technique-2 (FIG. 9). The result shows that compared with the Pia other marking technology, the technical system of the invention has the following prominent and definite innovativeness and beneficial effects:

(a) Firstly, functional/non-functional haplotype analysis is performed by using 2 optimal primary markers of the technical system, and clear functional haplotype boundaries are marked for the subsequent excavation and identification of functional genes (red boxes; fig. 9 a). In this example, CK 1-8 were identified as functional haplotype varieties and CK 9-14 as non-functional haplotype varieties in the 14 Pia first set of reference varieties tested. This is one of the incomparable benefits of Pia other party marking technology;

(b) On the basis, 2 optimal secondary markers of the technical system are utilized to carry out disease-resistant allele analysis, and clear and comparable allele boundaries are marked for the identification of the disease-resistant allele Pia-C (blue boxes; fig. 8 b). In this example, 4 functional haplotype varieties CK 5-8 were identified by the carriers of Pia-C;

(c) Further, based on the results of the primary marker and the secondary marker detection, the carriers of Pia-A of the other 4 functional haplotype varieties CK 1-4 are deduced. This is one of the incomparable benefits of Pia other party marking technology;

(d) The detection effect of the Pia other party labeling technology-1 and 2 issued patents is similar to that of the two-stage labeling of the patent, so that the Pia-C carriers can be clearly identified, but the carriers of alleles Pia-A and Pia-C cannot be perfectly identified on the basis of identifying functional/non-functional haplotypes by a two-stage labeling system like the technical system (FIG. 9C 1);

(e) Pia other-party marking technology-2. The 2 marks are similar to the first-level mark of the technical system, can clearly identify the carriers of the Pia disease-resistant gene family, but can not further identify the alleles therein (FIG. 9c 2)

And (4) conclusion: the technical system of the invention has substantial innovation, rigor and superiority.

Example 9 sequence comparison of the Pii disease resistance Gene family and identification of its specific sequence (FIGS. 10 to 13)

1. Experimental methods

This gene family is composed of 2 functional genes to date: pii-F (formerly: pii; donor variety Fujisaka5; lin et al.2007; genBank of paired genes: MH490982.1, MH 490983.1), pii-M (formerly: pi5; recombinant inbred line RIL260 of donor variety Morobekan; takagi et al.2013; genBank of paired genes: EU869185.1, EU 869186.1); in order to facilitate the sequence alignment analysis, in addition to the above 2 donor varieties, 2 sequencing reference varieties Minghui 63, shuhui 498 presumed as target gene carriers were added; and 5 genomic sequences corresponding to the reference species Nipponbare, shennong265, suijing 18, tetep, IR64 for sequencing which are presumed to be carriers of the non-target genes;

the range of each gene ATG-TGA is annotated with reference to NCBI;

2. Results of the experiment

The results of the sequence comparisons are shown in FIGS. 10 to 13, which show that:

(1) The Pii disease-resistant gene family has obvious genome differentiation (typical positions are shown as the marks # i-1 and # i-2 in figure 11) of functional haplotypes (8 reference sequences of the 4 target gene carriers) and non-functional haplotypes (10 reference sequences of the 5 non-target gene carriers) of the sequences of paired genes;

(2) There are SNPs specific to each other among alleles of the Pii disease resistance gene family (typical positions are shown by the markers # i-3 and # i-4 in FIG. 12, and the markers # i-5 and # i-6 in FIG. 13);

in addition, since the above 18 reference sequences are already disclosed, the figure shows only the first half of the paired genes in the following "figure of the specification", respectively, so as to fully understand the specific sequences of the Pii disease-resistant gene family and the marker information thereof, in combination with FIGS. 11 to 13.

Example 10: development and application of functional/non-functional haplotype specific molecular markers of Pii disease-resistant gene family (FIG. 11)

1. Experimental methods

(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pii disease-resistant gene family sequences, 2 indels are selected as the optimal 2 indels to be designed as haplotype specific molecular markers Pii-F/N ^{Indel(1-1333)} (# i-1 marker) and Pii-F/N ^{Indel(2-1323)} (# i-2 marker), the primer sequences were as follows:

for # i-1 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.11(Pii-F/N ^{Indel(1-1333)} -F；5’-3’)：

ATTTTTGTTCTTCCAGCAACA；

SEQ ID NO.12(Pii-F/N ^{Indel(1-1333)} -R；5’-3’)：

ACCTTTCAGAAGCATTGGATT。

for # i-2 marker [ upper band, non-functional haplotype (black); lower band, functional haplotype (red) ]:

SEQ ID NO.13(Pii-F/N ^{Indel(2-1323)} -F1；5’-3’)：

GGAGAAGGGTGGAATTTTGATCAGCGCATA；

SEQ ID NO.14(Pii-F/N ^{Indel(2-1323)} -F2；5’-3’)：

GGAGAAGAGTGGAACTTTGATCAACGTATA；

SEQ ID NO.15(Pii-F/N ^{Indel(2-1323)} -R1；5’-3’)：

ACTATCAAACTGCTTTGGTCACAAAGAAC；

SEQ ID NO.16(Pii-F/N ^{Indel(2-1323)} -R2；5’-3’)：

GACTATCAAACTGCTTTTGTCAGAAAGAAC；

in particular, since the # i-2 marker is located in a region where genomic differentiation is significant, the marker is optimized to be a marker of 4 primer combinations (2F vs 2R) in order to ensure reliability and accuracy of the detection result.

(2) Detection of haplotype-specific molecular markers: performing PCR amplification on a first set of 14 Pii reference varieties according to the PCR amplification system (annealing temperature: # i-1/52-54 ℃ and # i-2/58 ℃) by using the 2 marked 2 groups of primers; and taking out the PCR product, and detecting and recording the molecular marker according to the detection system.

2. Results of the experiment

The size of each molecular marker is shown in fig. 11, and the results show that the 14 Pii first set of reference varieties present clear genotypes (haplotypes):

non-functional haplotype variety: CK8, shin 2 (Pii-Null); CK9, aichi Asahi (Pii-Null); CK10, IR64 (Pii-Null); CK11, tetep (Pii-Null); CK12, shennong265 (Pii-Null); CK13, suijing 18 (Pii-Null); CK14, nipponbare (Pii-Null).

Example 11: development and application of functional haplotype disease-resistant allele Pii-F function-specific molecular marker of Pii disease-resistant gene family (FIG. 12)

1. Experimental methods

(1) Designing a Pii-F function specific molecular marker: according to the comparison result of the Pii disease-resistant gene family sequences, selecting optimal 2 SNPs to respectively design as Pii-F functional specific molecular markers Pii-F ^G1-4603A (# i-3 marker) and Pii-F ^C1-5687T (# i-4 marker); the primer sequences are as follows:

for the # i-3 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.17(Pii-F ^G1-4603A -F；5’-3’)：

GGTCACTAATTTTCAAGAATAGTGGTA；

SEQ ID NO.18(Pii-F ^G1-4603A -R；5’-3’)：

CACTGAGATCCAAAACACGCA；

for the # i-4 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.19(Pii-F ^C1-5687T -F；5’-3’)：

CCTCCATCTCACACCTAAATG；

SEQ ID NO.20(Pii-F ^C1-5687T -R；5’-3’)：

CATAAGGAAATTTCAAAGGAAACAC。

(2) Detection of Pii-F function specific molecular markers: and (3) carrying out PCR amplification on the 14 first set of Pii reference varieties by using the 2 pairs of primers according to the PCR amplification system (the annealing temperature is: # i-3/54 ℃; # i-4/54 ℃), taking out PCR products, and respectively carrying out detection and recording of molecular markers according to the enzyme digestion system (# i-3, nlaIII/37 ℃; # i-4, mseI/37 ℃) and the detection system.

2. Results of the experiment

The sizes of the molecular markers are shown in FIG. 12, and the results show that the Pii-F function specific molecular marker can distinguish the target gene from all known functional genes of the gene family, and non-functional genes:

non-target gene variety: the remaining 11 Pii first set of reference varieties.

Example 12: development and application of functional haplotype disease-resistant allele Pii-M functional specific molecular marker of Pii disease-resistant gene family (FIG. 13)

1. Experimental methods

(1) Designing a Pii-M function specific molecular marker: according to the comparison result of the Pii disease-resistant gene family sequences, selecting the optimal 2 SNPs to respectively design as a Pii-M functional specific molecular marker Pii-M ^T1 - ^4591C (# i-5 marker) and Pii-M ^A2-1832C (# i-6 marker); the primer sequences are as follows:

for the # i-5 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.21(Pii-M ^T1-4591C -F；5’-3’)：

GGTCACTAATTTTCAAGAATAGTGGTA；

SEQ ID NO.22(Pii-M ^T1-4591C -R；5’-3’)：

CACTGAGATCCAAAACACGCA；

for the # i-6 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.23(Pii-M ^A2-1832C -F；5’-3’)：

GGTTTGAATTACTTGCATCGTTCAGTGAAATGTAC；

SEQ ID NO.24(Pii-M ^A2-1832C -R；5’-3’)：

CCAACCATGTCAAGTGCTATCCACTGTT。

(2) Detection of Pii-M function-specific molecular markers: the first set of 14 Pii reference varieties was subjected to PCR amplification using the above 2 pairs of primers according to the above PCR amplification system (annealing temperature: # I-5/54 ℃; # I-6/54 ℃), PCR products were taken out, and molecular markers were detected and recorded according to the above enzyme digestion system (# I-5, rsa I/37 ℃; # I-6, nde I/37 ℃) and detection system, respectively.

2. Results of the experiment

The sizes of the respective molecular markers are shown in FIG. 13, and the results show that the Pii-M function-specific molecular markers can distinguish target genes from all known functional genes of the gene family, as well as non-functional genes:

non-target gene variety: the remaining 7 Pii first set of reference varieties.

Example 13: the application and the example of identifying and mining the new and old disease-resistant alleles from Guangxi rice variety resource groups with unknown target genes by utilizing the technical system which has the advantages of inclusion and accurate identification, mining and cloning of the disease-resistant gene family alleles of the rice blast Pii (figure 14)

1. Experimental method

(1) The Pii technology system of the present invention is composed of 4 basic specific markers of two-stage detection markers, such as 'functional haplotype-disease-resistant allele'. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above, and are not repeated.

(2) Identifying and excavating Pii disease-resistant gene family alleles for 52 randomly selected Guangxi rice seed resource groups [ leaf Chimonanthus praecox, 2021, master thesis of southern China agriculture university (related core information is not disclosed) by utilizing the technical system;

3 varieties CK1, fijisaka 5 (Pii-F); CK2, IRBL5-M (Pii-M); CK3, nipponbare (Pii-Null) was also tested as a second set of Pii reference varieties.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 52 test varieties were classified (fig. 14 a):

functional haplotype varieties (red marker): 23 varieties of Q2674-76, Q2678-79, Q2682-83, Q2687-2702 and the like;

non-functional haplotype varieties (black markers): 29 varieties such as Q2631-73, Q2677, Q2680-81, Q2684-86, Q2703-06, and the like.

(2) In the secondary marker-based detection of disease-resistant alleles (FIG. 14 b), the 23 functional haplotype test varieties described above were further identified as:

the target gene Pii-F carries the variety (blue indication): none;

the target gene Pii-M carries the species (green designation): 18 varieties such as Q2674-76, Q2678-79, Q2683, Q2687-98 and the like;

the novel target gene Pii-F036 carries a variety (purple designation): 5 varieties Q2682, Q2699-2702 and the like (the genotypes of the varieties are consistent and different from Pii-F and Pii-M);

the example demonstrates that the technical system has strong compatibility and reliability, because 23 functional haplotype varieties are firstly identified in 52 Guangxi rice seed resource groups with unknown target genes; then identifying carriers of 18 target genes Pii-M; the detection results of the primary marker and the secondary marker are combined, and then carriers of 5 novel alleles Pii-F036 are further identified.

Example 14: the application and the example of identifying and mining the new and old disease-resistant alleles from the Liaoning rice variety resource population with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification, mining and cloning of the disease-resistant gene family alleles of the rice blast Pii (figure 15)

1. Experimental method

(1) The detection procedure and scheme of the Pii technology system of the present invention are as described above, and are not repeated.

(2) 58 randomly selected Liaoning rice seed resource groups (Q2709-41, Q2743-51, Q2753-60, Q2762 and Q2764-73) are subjected to the technical system; linlisanna, 2021, master thesis (unpublished mark relevant core information) of south China university ] identifies and mines Pii disease-resistant gene family alleles;

the second set of reference 3 Pii varieties was also included as controls in the trial.

2. Results of the experiment

(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 58 test varieties were classified (fig. 15 a):

functional haplotype varieties (red marker): 20 varieties of Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like;

non-functional haplotype varieties (black markers): q2709-11, Q2713-16, Q2718-19, Q2721-26, Q2731-41, Q2743-45, Q2748, Q2755-56, Q2759, Q2764, Q2766-70, Q2772-73 and other 38 varieties.

(2) In the secondary marker-based detection of disease-resistant alleles (fig. 15 b), 58 functional haplotype test varieties were further identified as:

the target gene Pii-F carries the variety (blue indication): 18 varieties of Q2712, Q2717, Q2720, Q2727-30, Q2746-47, Q2749-51, Q2753-54, Q2757-58, Q2760, Q2762, Q2765, Q2771 and the like;

the target gene Pii-M carries the species (green designation): only 1 variety such as Q2757;

novel target gene Pii-BJ carrying varieties (purple designation): only 1 variety Q2751 (genotype different from each of Pii-F and Pii-M and Pii-F036) was used.

This example demonstrates that the technical system has strong containment and reliability, since in 58 Liaoning rice species resource populations with unknown target genes, 20 functional haplotype varieties are first identified; then identifying carriers of 18 target genes Pii-F and carriers of 1 target gene Pii-M; combining the above detection results, the carriers of 1 novel allele Pii-BJ were further identified.

Implementation 15: an example of the present invention is a set of functional gene identification system with compatibility and accurate identification, excavation and cloning of rice blast Pii disease resistance gene and other marker technology identification ability comparison (figure 16)

(1) Although the rice blast Pii disease-resistant gene family is one of the most widely applied resistance sources in global rice, particularly japonica rice disease-resistant breeding programs, researchers have developed only a few scattered molecular markers so far, and only the functional specific markers developed in the genes are selected for comparative analysis of discriminative power. That is: pii other party labeling technique (Pii-ID 07 (noted as # other party i-1), pii-ID21 (# other party i-2), pii-ID24 (# other party i-3); kitazawaet al.2019, breeding Science, 69-83 N4023R (# other party i-3); yadav et al.2019, plos One, 14;

particularly, the primer sequences of Pii other party markers Pii-ID07, pii-ID21, pii-ID24 and 40N23R are respectively shown as SEQ ID NO. 51-52, 53-54, 55-56 and 57-58; since it is not a necessary reference for the present technology system, but is merely a reference;

(2) The first set of 14 Pii reference varieties are used as detection objects for identification and comparison, and the result shows that compared with the Pii other-party marking technology, the technical system provided by the invention has the following outstanding and definite innovations and beneficial effects:

(a) First, functional/non-functional haplotype analysis was performed using 2 optimal primary markers of the present technology system, which marked clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 16 a). In this example, CK 1-7 were identified as functional haplotype varieties and CK 8-14 were non-functional haplotype varieties in the 14 Pii first set of reference varieties tested. This is one of the incomparable benefits of Pii other party labeling techniques;

(b) On the basis, 2 optimal secondary markers of the technical system are utilized to carry out disease-resistant allele analysis, and clear and comparable allele boundaries are marked for the identification of various disease-resistant alleles (figure 16 b). In this example, 7 functional haplotype varieties were further clearly identified as carriers of Pii-F and Pii-M. This is also one of the incomparable benefits of Pii other party labeling techniques;

(c) On the contrary, the identification results of the Pii other marker technology on the first set of 14 Pii reference varieties show that the detection results of all 4 markers and the combination thereof have no comparability and logicality, and can not distinguish functional/non-functional haplotypes, can not distinguish 2 known alleles, and can not distinguish and mine novel alleles (FIG. 16 c);

and (4) conclusion: the technical system of the invention has novelty, rigor and superiority which Pii other marking technology can not compare.

EXAMPLE 16 cloning and verification of the application and examples of alleles of the disease-resistant Gene families of Rice blast Pia and Pii by means of homologous Gene cloning based on PCR technology (FIG. 17)

The experimental procedures of this example are mainly described in the art in published papers (Wang Li 2012, the Master university of south China university paper; pan Jinmei 2013, the Master university of south China university paper; lin et al 2003, PNAS, 100. Briefly described, the following steps:

(1) According to the results of the sequence comparison of the 2 disease-resistant gene families, fine allele secondary structure chart comparison diagrams are respectively constructed, and then gene cloning primers are respectively designed in the upper and lower conserved regions of the genes on the premise of ensuring the structural integrity of the respective genes (fig. 17 a-b); the primer sequences are shown below:

for the # Pia-1KL primer (annealing temperature: 60 ℃):

SEQ ID NO.25(Pia-1KLF；5’-3’)：

CCAGATAATATCGTGGGGTACATGTTG；

SEQ ID NO.26(Pia-1KLR；5’-3’)：

CTGTCCATCTTAAATGTGCACTTTATG。

for the # Pia-2KL primer (annealing temperature: 60 ℃):

SEQ ID NO.27(Pia-2KLF；5’-3’)：

CTTCCCCAATAGAGAGGACATCATTGC；

SEQ ID NO.28(Pia-2KLR；5’-3’)：

AAGGCATGCTAGTTGGCACGTTCGTTA。

for the # Pii-1KL primer (annealing temperature: 58 ℃):

SEQ ID NO.29(Pii-1KLF；5’-3’)：

CACAACTCCACTTCAGATCTAACTCCT；

SEQ ID NO.30(Pii-1KLR；5’-3’)：

AAGATCTCCTGGCGAGTAGGCTTCACAG。

for the # Pi2-2KL primer (annealing temperature: 58 ℃):

SEQ ID NO.31(Pii-2KLF；5’-3’)：

TGCTTATTGAGTGGGACGGAGGGAGTA；

SEQ ID NO.32(Pii-2KLR；5’-3’)：

ATGTCAATCAACGTGAAAGATGGCTAA。

(2) Amplifying target genes respectively by using high-fidelity long-fragment DNA polymerase, phata Max (Vazyme Biotech Co., ltd, nanjing, china) and high-quality DNA of each target gene as a template according to a PCR amplification program;

(3) The PCR product was ligated to pGEM-T Vector using pGEM-T Easy Vector (Promerge Corporation, wis., USA) commonly used in the laboratory, sequenced according to the procedure, and stored for future use;

(4) Taking the pGEM-T vector of each target gene as a template, adding a corresponding enzyme cutting site sequence (Asc I) on the basis of the gene cloning primer, and respectively connecting the paired genes of each target gene to a binary transformation vector pYLCC 380 DTH;

(5) Connecting the molecular identification with a correct vector, respectively transforming target genes into corresponding susceptible varieties according to a conventional genetic transformation method, and identifying and analyzing transgenic offspring;

the results show that the disease resistant alleles excavated and cloned according to the invention are both intact and functional (FIG. 17C shows the results for Pia-C only), with most of the transgenic T ₁ The phenotype of the strain co-segregates well with the genotype (hygromycin selection marker based on its transformation vector backbone, hpt) (individual individuals may not co-segregate due to vaccination evasion or post-transgene silencing);

(6) The complete sequence of the novel disease-resistant allele mined and cloned by the invention has been registered in a public database: pia-C (GenBank OL773678, OL 773679), pii-BJ (GenBank OL689231, OL 689232), pii-F036 (GenBank OL689233, OL 689234).

The above 16 embodiments prove that the technical system of the invention has the remarkable capabilities and effects of inclusively and accurately identifying, excavating and cloning the alleles of the Pia and Pii disease resistance gene families.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> a group of two technologies with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families

System of

<130>

<160> 58

<170> PatentIn version 3.3

<210> 1

<211> 17

<212> DNA

<213> Pia-F/NG1-303T-F

<400> 1

acgacggcaa gcccaga 17

<210> 2

<211> 20

<212> DNA

<213> Pia-F/NG1-303T-R

<400> 2

agagccctga gctccgcgat 20

<210> 3

<211> 19

<212> DNA

<213> Pia-F/NIndel (2-1007)-F

<400> 3

aggtgctcgg cgaattgct 19

<210> 4

<211> 19

<212> DNA

<213> Pia-F/NIndel (2-1007)-R

<400> 4

agctgaccag catcggagt 19

<210> 5

<211> 33

<212> DNA

<213> Pia-CT1-2214C-F1

<400> 5

aataaagttt ttggctccga agatcaatgt cct 33

<210> 6

<211> 33

<212> DNA

<213> Pia-CT1-2214C-F2

<400> 6

aatagagttt ttggatcaga gcaacaatgt cct 33

<210> 7

<211> 27

<212> DNA

<213> Pia-CT1-2214C-R1

<400> 7

cggttggctt cctagaagac ctgctat 27

<210> 8

<211> 27

<212> DNA

<213> Pia-CT1-2214C-R2

<400> 8

cggcaggctt gctaaaagac cggctat 27

<210> 9

<211> 28

<212> DNA

<213> Pia-CIndel (2-3038)-F

<400> 9

gcctttcatc tactaaattt acaacagg 28

<210> 10

<211> 24

<212> DNA

<213> Pia-CIndel (2-3038)-R

<400> 10

caagtagctc aaattactca aggc 24

<210> 11

<211> 21

<212> DNA

<213> Pii-F/NIndel(1-1333)-F

<400> 11

atttttgttc ttccagcaac a 21

<210> 12

<211> 21

<212> DNA

<213> Pii-F/NIndel(1-1333)-R

<400> 12

acctttcaga agcattggat t 21

<210> 13

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-F1

<400> 13

ggagaagggt ggaattttga tcagcgcata 30

<210> 14

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-F2

<400> 14

ggagaagagt ggaactttga tcaacgtata 30

<210> 15

<211> 29

<212> DNA

<213> Pii-F/NIndel(2-1323)-R1

<400> 15

actatcaaac tgctttggtc acaaagaac 29

<210> 16

<211> 30

<212> DNA

<213> Pii-F/NIndel(2-1323)-R2

<400> 16

gactatcaaa ctgcttttgt cagaaagaac 30

<210> 17

<211> 27

<212> DNA

<213> Pii-FG1-4603A-F

<400> 17

ggtcactaat tttcaagaat agtggta 27

<210> 18

<211> 21

<212> DNA

<213> Pii-FG1-4603A-R

<400> 18

cactgagatc caaaacacgc a 21

<210> 19

<211> 21

<212> DNA

<213> Pii-FC1-5687T-F

<400> 19

cctccatctc acacctaaat g 21

<210> 20

<211> 25

<212> DNA

<213> Pii-FC1-5687T-R

<400> 20

cataaggaaa tttcaaagga aacac 25

<210> 21

<211> 27

<212> DNA

<213> Pii-MT1-4591C-F

<400> 21

ggtcactaat tttcaagaat agtggta 27

<210> 22

<211> 21

<212> DNA

<213> Pii-MT1-4591C-R

<400> 22

cactgagatc caaaacacgc a 21

<210> 23

<211> 35

<212> DNA

<213> Pii-MA2-1832C-F

<400> 23

ggtttgaatt acttgcatcg ttcagtgaaa tgtac 35

<210> 24

<211> 28

<212> DNA

<213> Pii-MA2-1832C-R

<400> 24

ccaaccatgt caagtgctat ccactgtt 28

<210> 25

<211> 27

<212> DNA

<213> Pia-1KLF

<400> 25

ccagataata tcgtggggta catgttg 27

<210> 26

<211> 27

<212> DNA

<213> Pia-1KLR

<400> 26

ctgtccatct taaatgtgca ctttatg 27

<210> 27

<211> 27

<212> DNA

<213> Pia-2KLF

<400> 27

cttccccaat agagaggaca tcattgc 27

<210> 28

<211> 27

<212> DNA

<213> Pia-2KLR

<400> 28

aaggcatgct agttggcacg ttcgtta 27

<210> 29

<211> 27

<212> DNA

<213> Pii-1KLF

<400> 29

cacaactcca cttcagatct aactcct 27

<210> 30

<211> 28

<212> DNA

<213> Pii-1KLR

<400> 30

aagatctcct ggcgagtagg cttcacag 28

<210> 31

<211> 27

<212> DNA

<213> Pii-2KLF

<400> 31

tgcttattga gtgggacgga gggagta 27

<210> 32

<211> 27

<212> DNA

<213> Pii-2KLR

<400> 32

atgtcaatca acgtgaaaga tggctaa 27

<210> 33

<211> 22

<212> DNA

<213> Pia-F/NT1-68C-F

<400> 33

ctcaggaagc tcgattcgct ac 22

<210> 34

<211> 21

<212> DNA

<213> Pia-F/NT1-68C-R

<400> 34

ttccttgagc agctcgattc c 21

<210> 35

<211> 21

<212> DNA

<213> Pia-F/NT1-200A-F

<400> 35

ggaatcgagc tgctcaagga a 21

<210> 36

<211> 22

<212> DNA

<213> Pia-F/NT1-200A-R

<400> 36

ctcgatgtgg taggagaggt ca 22

<210> 37

<211> 20

<212> DNA

<213> Pia-F/NIndel(2-3489)-F

<400> 37

caccagaggg accagaacaa 20

<210> 38

<211> 22

<212> DNA

<213> Pia-F/NIndel(2-3489)-R

<400> 38

tcagcacaga agaggattcc aa 22

<210> 39

<211> 24

<212> DNA

<213> Pia-AT2-624C-F

<400> 39

agytgcagcg gcccaagagg atgg 24

<210> 40

<211> 22

<212> DNA

<213> Pia-AT2-624C-R

<400> 40

cgtggatgcg cggatctgag gc 22

<210> 41

<211> 24

<212> DNA

<213> Pia-AA2-627C-F

<400> 41

tgcagcggct gaagaggatg gtcg 24

<210> 42

<211> 22

<212> DNA

<213> Pia-AA2-627C-R

<400> 42

cgtggatgcg cggatctgag gc 22

<210> 43

<211> 21

<212> DNA

<213> Pia-C_1-F

<400> 43

tgcaagctaa tggctggtcg a 21

<210> 44

<211> 21

<212> DNA

<213> Pia-C_1-R

<400> 44

tagactggtg tagttgcgga c 21

<210> 45

<211> 21

<212> DNA

<213> Pia-C_2-F

<400> 45

gtgcagtcct gatcagtact c 21

<210> 46

<211> 19

<212> DNA

<213> Pia-C_2-R

<400> 46

agagccacca ggcgaacag 19

<210> 47

<211> 26

<212> DNA

<213> Pia-ID01_2-F

<400> 47

acggtagagc aatttagaag cagtga 26

<210> 48

<211> 25

<212> DNA

<213> Pia-ID01_2-R

<400> 48

agtgcgactg acactttcaa tagca 25

<210> 49

<211> 22

<212> DNA

<213> Pia-STS-F

<400> 49

cttttgagct tgattggtct gc 22

<210> 50

<211> 21

<212> DNA

<213> Pia-STS-R

<400> 50

ctattgcacc agagggacca g 21

<210> 51

<211> 20

<212> DNA

<213> Pii-ID07-F

<400> 51

ttcggtcatt agccggtgct 20

<210> 52

<211> 21

<212> DNA

<213> Pii-ID07-R

<400> 52

ggcggcaggt atggtacttc a 21

<210> 53

<211> 22

<212> DNA

<213> Pii-ID21-F

<400> 53

aagcgaacga ctctagctag aa 22

<210> 54

<211> 26

<212> DNA

<213> Pii-ID21-R

<400> 54

tctccatatg tatgtataac tggctt 26

<210> 55

<211> 22

<212> DNA

<213> Pii-ID24-F

<400> 55

atgaggagat gacaacgagg ag 22

<210> 56

<211> 18

<212> DNA

<213> Pii-ID24-R

<400> 56

gaagagggga acgccgag 18

<210> 57

<211> 24

<212> DNA

<213> 40N23R-F

<400> 57

tgtgaggcaa caatgcctat tgcg 24

<210> 58

<211> 24

<212> DNA

<213> 40N23R-R

<400> 58

ctatgagttc actatgtgga ggct 24

Claims

1. A method for identifying, excavating and cloning rice blast Pia and Pii disease-resistant gene family alleles with compatibility and precision is characterized in that the method consists of 2 sets of disease-resistant functional haplotype-disease-resistant allele two-stage detection markers of a self-formed system, and the detection markers are respectively promoted step by step; whether the variety to be tested carries the target gene or not is independently determined by the comprehensive results detected by each set of methods;

specifically, the method comprises the following steps:

(1) A set of method with inclusion and accurate identification, excavation and cloning of rice blast Pia disease-resistant gene family allele comprises the following steps:

(a) The functional haplotype/non-functional haplotype detection program for the gene family:

defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in families; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety;

(b) The detection process of disease-resistant allele Pia-C of functional haplotype of the gene family:

the sequence of the gene Pia-C is shown in GenBank OL773678 and OL 773679;

defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 2 functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the Pia-C gene carrier belongs to functional haplotype of Pia disease-resistant gene family, and 2 varieties with the genotype of the function-specific molecular marker being the same as that of the Pia-C reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pia-C;

(2) A set of method for identifying, excavating and cloning rice blast Pii disease-resistant gene family alleles with compatibility and precision comprises the following steps:

(c) The functional haplotype/non-functional haplotype detection process of the gene family:

defining a genome region with clear haplotype differentiation by comparing the sequences of functional genes/non-functional genes in a gene family; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety;

(d) The detection process of disease-resistant allele Pii-F of functional haplotype of the gene family:

the sequence of the gene Pii-F is shown in GenBank MH490982.1 and MH490983.1;

defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 2 functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the Pii-F gene carrier belongs to functional haplotype of Pii disease-resistant gene family, and 2 varieties with the genotype of the functional specific molecular marker being the same as that of the Pii-F reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pii-F;

(e) The detection procedure of the disease-resistant allele Pii-M of the functional haplotype of the gene family:

the sequence of the gene Pii-M is shown in GenBank EU869185.1 and EU869186.1;

defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 2 functional specific molecular markers; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pii-M gene carrier belongs to functional haplotype of Pii disease-resistant gene family, and 2 varieties with the genotype of the functional specific molecular marker being the same as that of the Pii-M reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pii-M;

the method comprises the following steps:

(a) The specific molecular marker combination of the medium haplotype is Pia-F/N ^G1-303T And Pia-F/N ^{Indel(2-1007)} (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;

wherein, the mark indicates: F/N, functional/non-functional; superscript G1-303T means the specific SNP located at position #303 of the #1 gene of the Pia paired gene; the superscript Indel (2-1007) means the specific insertion/deletion polymorphism at position #1007 in gene #2 of the Pia paired gene, and so on;

(b) The specific molecular marker combination of the medium target gene is Pia-C ^T1-2214C And Pia-C ^{Indel(2-3038)} (ii) a The sequences are respectively shown in SEQ ID NO. 5-8 and SEQ ID NO. 9-10;

wherein, pia-C ^T1-2214C The labeling needs 2 forward primers and 2 reverse primers to be paired to ensure the stability and reliability of the primer;

(c) The specific molecular marker combination of the medium target gene is Pii-F/N ^{Indel(1-1333)} And Pii-F/N ^{Indel(2-1323)} (ii) a The sequences are respectively shown in SEQ ID NO. 11-12 and SEQ ID NO. 13-16;

wherein, pii-F/N ^{Indel(2-1323)} The labeling needs 2 forward primers and 2 reverse primers to be paired to ensure the stability and reliability of the primer;

(d) The specific molecular marker combination of the medium target gene is Pii-F ^G1-4603A And Pii-F ^C1-5687T (ii) a The sequences are SEQ ID NO. 17-18 and SEQ ID NO. 19-20 respectively;

(e) The specific molecular marker combination of the medium target gene is Pii-M ^T1-4591C And Pii-M ^A2-1832C (ii) a The sequences are respectively SEQ ID NO. 21-22 and SEQ ID NO. 23-24.

2. The method of claim 1, wherein the method is used for systematic and accurate inclusionary identification and mining of new and old alleles in the 2 complex families of rice blast disease-resistant genes.

3. The use of claim 2, wherein the following 6 target genes are systematically and precisely inclusively identified and mined in the 2 complex rice blast disease-resistant gene families:

the functional haplotype new disease resistance allele Pia-C of rice blast Pia disease resistance gene family has the paired gene sequence shown in GenBank OL773678 and OL 773679;

the functional haplotype disease-resistant allele Pia-A of the rice blast Pia disease-resistant gene family has the sequence of the paired genes shown in GenBank AB604626.1 and AB 604621.1;

the functional haplotype disease-resistant allele Pii-F of the rice blast Pii disease-resistant gene cluster has the paired gene sequences shown in GenBank MH490982.1 and MH490983.1;

the functional haplotype disease-resistant allele Pii-M of the rice blast Pii disease-resistant gene cluster has the sequence of paired genes shown in GenBank EU869185.1 and EU869186.1;

novel disease-resistant allele Pii-BJ of functional haplotype of rice blast Pii disease-resistant gene cluster, the sequence of the paired genes is shown in GenBank OL689231 and OL 689232;

a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene cluster has the sequence of the paired genes shown in GenBank OL689233 and OL 689234.

4. Use of the method according to claim 1, characterized in that the use of the principle and procedure for the detection of functional/non-functional haplotypes of the Pia gene family for the identification and the inference of global sequencing errors in this gene family is used.

5. The use of the method of claim 1, wherein the use of the method for identifying true and false disease-resistant alleles of the rice blast Pia disease-resistant gene family is used by using the method for identifying, mining and cloning the alleles of the gene family with the advantages of compatibility and precision.

6. The method of claim 1, wherein the method is applied to identifying known target genes of the 2 gene families in germplasm resources of unknown target genes.

7. The use of claim 6, and the mining of novel target genes: the functional haplotype of rice blast Pia disease-resistant gene family has novel disease-resistant allele Pia-C, and the sequences of the paired genes are shown in GenBank OL773678 and OL 773679.

8. The use of claim 6, and the mining of novel target genes: a novel disease-resistant allele Pii-BJ of functional haplotype of the rice blast Pii disease-resistant gene cluster is shown in GenBank OL689231 and OL689232, and the sequences of the paired genes are shown in the sequence chart.

9. The use of claim 6, and the mining of novel target genes: a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene cluster has the sequence of the paired genes shown in GenBank OL689233 and OL 689234.

10. The use of the method of claim 1 for mining and cloning 3 novel disease resistant alleles and their sequences for use in plant breeding programs for disease resistance:

the cloning primer sequences of the paired genes of the rice blast Pia-C disease-resistant gene family allele are shown as SEQ ID NO. 25-26 and SEQ ID NO. 27-28;

the sequences of novel disease-resistant allele Pia-C of functional haplotype of rice blast Pia disease-resistant gene family are shown in GenBank OL773678 and OL 773679;

the sequences of the cloning primers of the paired genes of the rice blast Pii disease-resistant gene family alleles are shown as SEQ ID NO. 29-30 and SEQ ID NO. 31-32;

the functional haplotype of rice blast Pii disease-resistant gene family has novel disease-resistant allele Pii-BJ, and the sequence of the paired genes is shown in GenBank OL689231 and OL 689232;

a novel disease-resistant allele Pii-F036 of a functional haplotype of the rice blast Pii disease-resistant gene family has the sequence of a paired gene shown in GenBank OL689233 and OL 689234.