CN113981121B - Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family - Google Patents
Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family Download PDFInfo
- Publication number
- CN113981121B CN113981121B CN202111034566.2A CN202111034566A CN113981121B CN 113981121 B CN113981121 B CN 113981121B CN 202111034566 A CN202111034566 A CN 202111034566A CN 113981121 B CN113981121 B CN 113981121B
- Authority
- CN
- China
- Prior art keywords
- functional
- disease
- gene
- target gene
- specific
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 201000010099 disease Diseases 0.000 title claims abstract description 138
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title claims abstract description 138
- 108700028369 Alleles Proteins 0.000 title claims abstract description 107
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 57
- 235000009566 rice Nutrition 0.000 title claims abstract description 56
- 238000009412 basement excavation Methods 0.000 title claims description 3
- 240000007594 Oryza sativa Species 0.000 title description 2
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 332
- 239000003550 marker Substances 0.000 claims abstract description 87
- 241000209094 Oryza Species 0.000 claims abstract description 60
- 238000001514 detection method Methods 0.000 claims abstract description 56
- 238000005065 mining Methods 0.000 claims abstract description 30
- 208000035240 Disease Resistance Diseases 0.000 claims abstract description 26
- 102000054766 genetic haplotypes Human genes 0.000 claims description 125
- 239000003147 molecular marker Substances 0.000 claims description 64
- 238000000034 method Methods 0.000 claims description 43
- 238000012360 testing method Methods 0.000 claims description 30
- 238000005516 engineering process Methods 0.000 claims description 18
- 239000000969 carrier Substances 0.000 claims description 17
- 238000004458 analytical method Methods 0.000 claims description 10
- 238000012163 sequencing technique Methods 0.000 claims description 7
- 238000012217 deletion Methods 0.000 claims description 5
- 230000037430 deletion Effects 0.000 claims description 5
- 238000003780 insertion Methods 0.000 claims description 4
- 230000037431 insertion Effects 0.000 claims description 4
- 230000008569 process Effects 0.000 claims description 2
- 238000012956 testing procedure Methods 0.000 claims 1
- 238000009395 breeding Methods 0.000 abstract description 9
- 230000001488 breeding effect Effects 0.000 abstract description 9
- 230000004069 differentiation Effects 0.000 abstract description 6
- 230000009897 systematic effect Effects 0.000 abstract description 2
- 238000002474 experimental method Methods 0.000 description 23
- 238000012408 PCR amplification Methods 0.000 description 21
- 108020004414 DNA Proteins 0.000 description 20
- 238000011161 development Methods 0.000 description 17
- 238000013461 design Methods 0.000 description 16
- 238000000137 annealing Methods 0.000 description 8
- 230000008901 benefit Effects 0.000 description 8
- 238000001976 enzyme digestion Methods 0.000 description 8
- 108091008146 restriction endonucleases Proteins 0.000 description 7
- 238000001962 electrophoresis Methods 0.000 description 6
- 238000012216 screening Methods 0.000 description 6
- 102000054765 polymorphisms of proteins Human genes 0.000 description 5
- 244000052616 bacterial pathogen Species 0.000 description 4
- 230000009286 beneficial effect Effects 0.000 description 4
- 238000010586 diagram Methods 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 230000002085 persistent effect Effects 0.000 description 4
- 101000975474 Homo sapiens Keratin, type I cytoskeletal 10 Proteins 0.000 description 3
- 101000614627 Homo sapiens Keratin, type I cytoskeletal 13 Proteins 0.000 description 3
- 102100023970 Keratin, type I cytoskeletal 10 Human genes 0.000 description 3
- 102100040487 Keratin, type I cytoskeletal 13 Human genes 0.000 description 3
- 241001330975 Magnaporthe oryzae Species 0.000 description 3
- 238000003556 assay Methods 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000012215 gene cloning Methods 0.000 description 3
- 108091008053 gene clusters Proteins 0.000 description 3
- 238000002372 labelling Methods 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- 238000002864 sequence alignment Methods 0.000 description 3
- 230000001225 therapeutic effect Effects 0.000 description 3
- 108091092878 Microsatellite Proteins 0.000 description 2
- 230000000680 avirulence Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000003776 cleavage reaction Methods 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 230000029087 digestion Effects 0.000 description 2
- 230000007613 environmental effect Effects 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000007017 scission Effects 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 101000869912 Cerastes vipera Disintegrin CV-11-alpha Proteins 0.000 description 1
- 108010054576 Deoxyribonuclease EcoRI Proteins 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 241001123946 Gaga Species 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 230000010429 evolutionary process Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000003976 plant breeding Methods 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 102000040430 polynucleotide Human genes 0.000 description 1
- 108091033319 polynucleotide Proteins 0.000 description 1
- 239000002157 polynucleotide Substances 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a technical system with compatibility and capable of accurately identifying and mining rice blast Pi63 disease-resistant allele families, wherein a secondary detection marker of the technical system is set according to the existence of clear functional haplotype-disease-resistant allele secondary differentiation of the gene families. The technical system can be used for identifying and mining rice blast Pi63 disease-resistant allele family functional genes and has systematic and rigorous inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a technical system which has inclusiveness and can accurately identify and mine a rice blast Pi63 disease-resistant allele family.
Background
Rice is one of the most important food crops in the world, and rice blast caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious obstacles to rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, the breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance relies on direct identification of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and identification results are easy to cause errors. In particular, the disease-resistant genes have the problems of overlapping resistance spectrums, coverage and the like due to gene interaction, and the direct selection efficiency of the phenotypes aggregated target genes of the same type is very low or even impossible. With the development of molecular marker identification technology, the application value and the prospect of the technology are more and more concerned due to the advantages of accuracy, reliability, no environmental influence and the like. In plant breeding, by developing molecular markers closely linked with target genes, particularly developing functional specific molecular markers in genes, the reliability of selection of the target genes is high, and the purposiveness and efficiency of breeding work are greatly accelerated.
Generally, in the long military competition process of host plant disease-resistant genes and pathogenic bacteria avirulence genes, the disease-resistant genes generate new disease-resistant specificity in the form of multiple-allele family (multiple-allele family) or gene cluster (gene cluster) with the lowest evolution cost, so that the rapid variation of the avirulence genes can be followed. That is, under long-term and intense selection pressure of pathogenic bacteria, the above-mentioned "gene family" generally results in functional/non-functional haplotype (haplotype) differentiation; if it is a broad-spectrum persistent resistance gene family used for a long time in breeding programs, it will further differentiate into alleles (functional alleles) with different disease resistance specificities in functional haplotypes (Zhai et al 2011, new Phytologist, 189.
There are obvious and clear nucleotide polymorphisms including Single Nucleotide Polymorphisms (SNPs) and polynucleotide polymorphisms (differentiated genomic regions) and insertions/deletions (insertions/deletions) in the secondary evolutionary processes of the above-mentioned "functional haplotype-disease resistance alleles". Herein, nucleotide polymorphisms within functional genes are collectively referred to as functional nucleotide polymorphisms. Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene family, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene families simultaneously. Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1 (Pi 37 family), 2 (Pi 63 family), 6 (Pi 2/Pi9 family), 8 (Pi 36 family), 9 (Pii family), 11 (Pik family) and 12 (Pita family) (Sharma et al.2012, agricultural Research,1, 37-52 liu and Wang 2016, national Science review, 3.
Broad-spectrum persistent field resistance genes (field resistance = quantitative resistance; QTL) Pi63 (formerly Pikahei-1; located on the long arm of chromosome 4) derived from the regional upland rice variety Kahei, kyun, japan are one of the most important broad-spectrum persistent field resistance genes (Xu et al 2008, therapeutic and Applied Genetics, 117. However, since the gene was isolated and cloned, no functional specific molecular markers have been developed in the gene, and the currently used molecular markers still remain among 2 linked markers: (RM6669,RM17496(ii) a Journal of Genetics, 98; underlining the used markers).
As described above, since Pi63 is a broad-spectrum durable field resistance gene similar to a major gene, under the continuous and strong selection pressure of Magnaporthe oryzae, complex and diverse variations are generated in the secondary evolution such as "functional haplotype-resistance allele". However, none of these results has resulted in a workable technical system that can be widely applied in production practice. In other words, the molecular markers used so far still stay at 2 linked markers: (RM6669,RM17496) The detection accuracy of co-separation (synchronous separation) with the target gene is not achieved, and clear comparability, logicality and inclusiveness among the target genes cannot be formed. This results in 3 prominent and realistic problems: (1) Any molecular marker which is not designed based on the evolutionary hierarchy is difficult to identify in a complex genome region, and a complex gene family is easy to generate sequencingErrors, etc.; (2) Any single molecular marker which is not designed based on the evolution hierarchy is difficult to avoid the problem of false positive of the marker due to the technical limitation of the molecular marker (the same specific fragment/locus does not represent that the test variety contains the gene completely consistent with the target gene); (3) Any molecular marker which is not designed based on the evolution hierarchy is difficult to form a technical system with compatibility and comparability, so that new genes are continuously mined, identified and named in a complex gene family, and the problems of 'homonymous heterogeneous genes' and 'true and false target genes' which are easily generated in the complex gene family are identified.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a technical system which is inclusive and can accurately identify and mine the rice blast Pi63 disease-resistant allele family. The technical system sets a secondary detection marker according to the clear secondary differentiation of functional haplotype-disease-resistant allele and the like of the gene family; the optimal haplotype specific molecular marker combination for functional haplotype/non-functional haplotype detection is Pi63-F/N G932A And Pi63-F/N Indel(4562) (ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pi63-KH of functional haplotype is Pi63-KH T1699C (ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pi63-9311 of functional haplotype is Pi63-9311 T280C (ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pi63-ZS of functional haplotype is Pi63-ZS T1260C (ii) a The optimal target gene specific molecular marker for detecting disease resistance allele Pi63-IR64 of functional haplotype is Pi63-IR64 A1394G (ii) a The optimal target gene specific molecular marker combination for detecting the disease-resistant allele Pi63-MH of the functional haplotype is Pi63-MH/KH A2257G And Pi63-KH T1699C (ii) a The optimal target gene specific molecular marker combination for detecting the disease-resistant allele Pi63-TTP of the functional haplotype is Pi63-TTP/IR64 G1604C And Pi63-IR64 A1394G (ii) a The identification result that any detection mark does not conform to the technical system is not the corresponding purposeThe target gene is inferred to be a possible new allele of the gene family.
The second purpose of the invention is to provide a method for comparing the sequences of the disease-resistant gene families of the rice blast Pi63 and identifying the specific sequences of the disease-resistant gene families.
The third objective of the invention is to provide a functional/non-functional haplotype specific molecular marker of a rice blast Pi63 disease-resistant gene family and an identification method thereof.
The fourth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-KH of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The fifth objective of the invention is to provide a specific molecular marker of disease-resistant allele Pi63-9311 of functional haplotype of rice blast Pi63 disease-resistant gene family and an identification method thereof.
The sixth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-ZS of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The seventh object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pi63-IR64 of the functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
An eighth object of the present invention is to provide a specific molecular marker for a disease-resistant allele Pi63-MH of a functional haplotype of the rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The ninth object of the present invention is to provide a specific molecular marker of disease-resistant allele Pi63-TTP of functional haplotype of rice blast Pi63 disease-resistant gene family and a method for identifying the same.
The tenth purpose of the invention is to provide the application and the example of screening the true and false specific genome sequence and the target gene (Pi 63-KH vs Pi 63-MH) from the gene family by using the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pi63 disease-resistant allele family.
The eleventh purpose of the invention is to provide an application and an example of screening true and false target genes (Pi 63-TTP vs Pi63-IR 64) from a rice blast Pi63 disease-resistant allele family by utilizing the set of inclusive and precise identification and mining technology system.
The twelfth purpose of the invention is to provide an application and an example for identifying and mining new and old disease-resistant alleles from Guangdong province rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pi63 disease-resistant allele families.
The thirteenth purpose of the invention is to provide the application and the example for identifying and mining the new and old disease-resistant alleles from Guangxi autonomous region rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pi63 disease-resistant allele families.
The fourteenth purpose of the invention is to provide an example of comparing the identification ability of the technical system which is an inclusion and accurate identification and mining of rice blast Pi63 disease-resistant allele family with other marking techniques by utilizing one set of the invention.
The technical solution of the present invention for achieving the above object is as described in the claims and the embodiments.
The scheme of the invention has the following beneficial effects: the technical system can be used for identifying and excavating rice blast Pi63 disease-resistant allele family functional genes and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Drawings
FIG. 1 is a schematic diagram of the development and application of a system of technologies for the accurate identification and mining of the rice blast Pi63 disease-resistant allele family.
FIG. 2. Sequence comparison of Pi63 disease resistance gene family and identification of its specific sequence. Wherein,
cloned Pi63-KH (donor variety Kahei; xu et al 2014, molecular Breeding,34 691-700) has GenBank accession numbers at the national center for Biotechnology information, USA: AB872116.1; for the convenience of sequence alignment analysis, 7 sequencing reference varieties 93-11, IR8, minghui63 (Minghui 63, MH), shuhui 498 (Shuhui 498), zhenshan97 (ZHENHAN 97, ZS), IR64, tetep (Tetep, TTP), and 4 sequencing reference varieties Nipponbare (Nipponbare), shennong 265 (Shennong 265) which are presumed to be carriers of functional genes were added; suijing18 (Suijing 18), a genome sequence corresponding to the situation of love (Hitomebore);
all validated haplotypes and allele-specific genomic differentiation regions or SNPs have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-9 for details).
In particular, since the above-mentioned 12 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequences of the Pi 63-resistance gene family and their marker information in conjunction with fig. 3 to 9.
FIG. 3 development and application of functional/non-functional haplotype-specific molecular markers of Pi63 disease-resistant gene family
3 a-b 2 haplotype-specific optimal SNPs and genome differentiation regions;
functional haplotype variety: CK1, kahei; CK2,93-11; CK3, IR8; CK4, tetep; CK5, tadukan; CK6, IR64; CK7, zhenshan 97; CK8, minghui 63; CK9, shuhui 498;
non-functional haplotype variety: CK10, nipponbare; CK11, shennong 265; CK12, suijing18; CK13, BL1; CK14, K59; m, DL-500;
description of the symbols I: description of the labeling: F/N, functional/non-functional; G932A, SNP specific for this marker; indel (4562), starting with a specific insertion/deletion at the genomic position #4562 and so on.
FIG. 4 development and application of functional haplotype disease-resistant allele Pi63-KH function-specific molecular markers of Pi63 disease-resistant gene family
4a, 1 optimal SNP with functional specificity of Pi63-KH;
bottom band, target gene) of 14 first set of reference varieties, wherein,
the target gene variety: CK1, kahei (Pi 63-KH);
non-target gene variety: CK2,93-11 (Pi 63-9311); CK3, IR8 (Pi 63-9311); CK4, tetep (Pi 63-TTP); CK5, tadukan (Pi 63-TTP); CK6, IR64 (Pi 63-IR 64); CK7, ZHENHAN 97 (Pi 63-ZS); CK8, minghui63 (Pi 63-MH); CK9, shuhui 498 (Pi 63-MH); CK10, nipponbare (Pi 63-Null); CK11, shennong 265 (Pi 63-Null); CK12, suijing18 (Pi 63-Null); CK13, BL1 (Pi 63-Null); CK14, K59 (Pi 63-Null).
Specification of test varieties: the information of the 14 first reference varieties is as described above, and if not necessary, it is not repeated.
Description of the labeling II: the gene symbol is italicized and represents a functional gene; the gene symbol is positive body, and represents a marker; with Pi63-KH T1699C For example, means a function-specific marker for the functional gene Pi63-KH, the upper marker being its specific SNP; and so on;
in particular, #1699T at 93-11, IR8, IR64, TTP is a sequencing error and should be #1699C.
FIG. 5 development and application of disease-resistant allele Pi63-9311 functional specificity molecular marker of functional haplotype of Pi63 disease-resistant gene family
5a, 1 Pi63-9311 function-specific optimal SNP;
the target gene variety: CK2,93-11 (Pi 63-9311); CK3, IR8 (Pi 63-9311);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 6 development and application of functional haplotype disease-resistant allele Pi63-ZS function-specific molecular markers of Pi63 disease-resistant gene family
6a, 1 optimal SNP for Pi63-ZS functional specificity;
6b T1260C (upper band, target gene; lower band, non-target gene) 14 examples of the identification of the first set of reference varieties, wherein,
the target gene variety: CK7, ZHENHAN 97 (Pi 63-ZS);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 7 development and application of functional haplotype disease-resistant allele Pi63-IR64 functional specific molecular marker of Pi63 disease-resistant gene family
the target gene variety: CK6, IR64 (Pi 63-IR 64);
non-target gene variety: the remaining 13 first set of reference varieties.
FIG. 8 development and application of functional haplotype disease-resistant allele Pi63-MH function-specific molecular marker of Pi63 disease-resistant gene family
8 a-b 2 optimal SNP combinations with Pi63-MH functional specificity;
the target gene variety: CK8, minghui63 (Pi 63-MH); CK9, shuhui 498 (Pi 63-MH);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 9 development and application of functional haplotype disease-resistant allele Pi63-TTP function-specific molecular marker of Pi63 disease-resistant gene family
9 a-b, 2 optimal SNP combinations with Pi63-TTP function specificity;
the target gene variety: CK4, tetep (Pi 63-TTP); CK5, tadukan (Pi 63-TTP);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 10 is a diagram of the application and example of screening true and false specific genomic sequences and target genes (Pi 63-KH vs Pi 63-MH) using the above-described suite of techniques for the accurate identification and mining of disease-resistant allele families of rice blast Pi63,
10a, 1 Pi63-KH function-specific optimal SNP, and alignment of reference sequences showed that Kahei completely agreed with the sequences of reference varieties 93-11, IR8, IR64, tetep, etc. (1699T);
10b identification of 14 first set of reference varieties with Pi63-KH optimal gene-specific markers developed from this SNP, the results showed that Kahei is not consistent with the genotypes of the reference varieties 93-11, IR8, IR64, tetep, etc., thus indicating that 93-11, IR8, IR64, tetep are wrong in the sequence of this SNP and should be #1699C;
10c, 1 Pi63-MH functional-specific optimal SNP, and alignment of the reference sequences revealed that the sequences of Kahei and other varieties were not identical to those of Minghui63 and Shuhui 498 (2257G);
10d identification of 14 first reference lines by the Pi63-MH optimal Gene-specific marker developed by this SNP, the results showed that Kahei is genotypically identical to Minghui63 and Shuhui 498, thus indicating that Kahei is missequenced at this SNP and should be #2257A. That is, the SNP should be the optimal SNP for the functional specificity of Pi 63-MH/KH;
if judged by the #3 marker genotype alone, kahei is inferred to contain Pi63-KH; however, if the genotype of the #8 marker alone is judged, it is concluded that Kahei, minghui63, shuhui 498 all contain Pi63-KH; when the two are combined, kahei contains Pi63-KH, while Minghui63 and Shuhui 498 contain Pi63-MH.
FIG. 11 is a diagram showing the application and examples of screening for true and false target genes (Pi 63-TTP vs Pi63-IR 64) using the above-mentioned set of techniques for identifying and mining disease-resistant allele families of rice blast Pi63,
11a, 1 Pi63-TTP/IR64 function-specific optimal SNP, sequence alignment showed that Tetep shares 1 SNP with IR64 (G1604C);
the result of the identification example of 14 first reference varieties by the Pi63-TTP/IR64 optimal gene specific marker developed by the SNP shows that the genotypes of Tetep and Tadukan are consistent with that of IR64, and the similarity of the Tetep and Tadukan and the IR64 is difficult to judge only by the genotype of the marker, thereby generating the big problem of 'homonymy heterogenous genes';
11c of 1 Pi63-IR64 function-specific optimal SNP (A1394G);
11d identification of 14 first set of reference varieties by Pi63-IR64 optimal gene-specific markers developed by the SNP, the result shows that IR64 is a unique genotype;
thus, if the genotypes of the #6 and #8 markers are combined, it can be concluded that IR64 contains Pi63-IR64, while Tetep and Tadukan contain Pi63-TTP
FIG. 12 is an example of identifying and mining new and old disease-resistant alleles from a Guangdong province rice seed resource population for which target genes are unknown, using the above-described set of technologies for identifying and mining families of disease-resistant alleles of rice blast Pi63 with inclusion and precision. Wherein,
in particular, in order to identify alleles that do not delete non-functional haplotype varieties due to the small population size of the assay, to maintain the alignment of the data alignment (the same below);
12b; lower band, identification of target gene (red) to 44 test varieties, and results show that no Pi63-KH carrier exists in the 44 test varieties;
12c; lower band, non-target gene ] identifies 44 tested varieties, and the result shows that 5 varieties such as CV 11-12, CV23, CV31-32 and the like are Pi63-9311 carriers;
12e; the lower band, the target gene (light red) identifies 44 test varieties, and the result shows that 1 variety such as CV14 is a Pi63-IR64 carrier;
12g; lower band, non-target gene; #6, upper lane, non-target gene; identifying 44 test varieties by the target gene, wherein CV15 is a Pi63-TTP carrier;
12 a-g, wherein 4 tested varieties CV3, CV19, CV34, CV36 and the like show different genotypes from all 6 control varieties by combining the results, and are inferred to be carriers (purple) of the novel Pi63 disease-resistant allele;
among these, 7 second set of reference varieties (used only for germplasm resource population identification) were CK1, kahei (Pi 63-KH); CK2,93-11 (Pi 63-9311); CK3, tetep (Pi 63-TTP); CK4, IR64 (Pi 63-IR 64); CK5, ZHENHAN 97 (Pi 63-ZS); CK6, minghui63 (Pi 63-MH); CK7, nipponbare (Pi 63-Null).
Specifically, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by independent color systems (the same below).
FIG. 13 is an example of identifying and mining new and old disease-resistant alleles from Guangxi province rice species resource groups with unknown target genes by using the above-mentioned technical system with inclusion and accurate identification and mining of rice blast Pi63 disease-resistant allele families. Wherein,
13g of 2 Pi63-TTP function-specific optimal markers [ 8, upper band, target gene (green); lower band, non-target gene; #6, upper lane, non-target gene; lower band, target gene ] identifies 52 test varieties, and the result shows that Pi63-TTP carriers do not exist in the 52 test varieties;
13 a-g, wherein 4 tested varieties such as CV53, CV55, CV57, CV61 and the like show different genotypes from all 6 control varieties by combining the results, and are inferred to be carriers (purple) of the novel Pi63 disease-resistant allele;
the information for the 7 second set of reference varieties is described above.
FIG. 14 is a set of comparative examples of the capability of identifying the functional genes of the Pi63 disease-resistant gene family of rice blast and other marker technologies in the invention
14a 1-7, the result of the technical system of the invention identifying 14 first set of reference varieties shows that CK 1-9 is functional haplotype variety, wherein;
CK1 is Pi63-KH carrier; CK 2-3 are Pi63-9311 carriers; CK 4-5 are Pi63-TTP carriers; CK6 is Pi63-IR64 carrier; CK7 is Pi63-ZS carrier; CK 8-9 are Pi63-MH carriers;
identification of 14 first set of reference varieties by the other marker technique (Xu et al 2008, therapeutic and Applied Genetics, 117-997-1008, xu et al 2014, molecular breeding,34 691-700 yadav et al 2019, journal of Genetics, 98), (i) the results of the marker RM6629 test show that CK1, CK 8-9 are of the same genotype, presumably Pi63-KH carriers (similar to those of my # 7), and other varieties are not judged as such (if there are only 1 marker and only 1 Pi63-KH carrier as CK); (iv) The result of detection of marker RM17496 indicates that it is still difficult to modulate PCR amplification several times with CK1, and thus no judgment can be made.
The information for the 14 first set of reference varieties is as described above.
And (4) conclusion: the technical system of the present invention has remarkable advantages.
FIG. 15 is an example of a set of secondary markers of the present invention with a technical system for inclusive and accurate identification and mining of alleles of the rice blast Pi63 disease-resistant gene family.
Detailed Description
The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
All rice varieties used in the examples: a first set of reference varieties CK 1-14 and a second set of reference varieties CK 1-7 (as described above); and test varieties CV 1-96 were collected and stored in the applicant's laboratory and are commonly used in the research field and have been disclosed in, including but not limited to, the above references [ ZHai et al 2011, new Phytologist 189, 321-334, https:// nph.onlinezolirrary.wiley.com; hua et al.2012, the scientific and Applied Genetics 125,https://www.springer.com/journal/122(ii) a She Xuemei, 2021, master paper of south china university of agriculture (no labeling-related core information is disclosed); annex charts are available at the respective magazine web sites ].
The technical route diagram developed and applied by the patent is shown in figure 1.
Example 1 sequence comparison of the Rice blast Pi63 disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 9)
1. Experimental methods
Using the cloned sequence of Pi63-KH (genbank ab872116.1), 7 sequencing reference varieties 93-11, ir8, minghui63 (Minghui 63, mh), shuhui 498 (Shuhui 498), zhenshan97 (Zhenshan 97, zs), IR64, tetep (Tetep, TTP), and 4 sequencing reference varieties Nipponbare (Nipponbare), shennong 265 (Shennong 265) presumed to be carriers of functional genes were retrieved and downloaded from public databases; suijing18 (Suijing 18) is shown in the genome sequence corresponding to the situation of Ottomebore (Hitomebore).
The range of the individual genes ATG-TAG is annotated with reference to NCBI.
Sequence comparison analysis was performed by conventional bioinformatics methods.
2. Results of the experiment
The results of the sequence comparisons are shown in FIGS. 2 to 9, which show that:
(1) The Pi63 disease-resistant gene family has obvious functional haplotypes (8 reference sequences of the 8 disease-resistant reference varieties) and non-functional haplotypes (4 reference sequences of the 4 disease-sensitive reference varieties) (the typical positions are shown as the marks # 1 and #2 in figure 3);
(2) There are individual functional specific SNPs and combinations thereof among alleles of the Pi63 disease-resistant gene family (typical positions are shown by the markers # 3 to #8 in the markers FIGS. 4 to 9).
Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pi63 disease-resistant gene family (FIG. 3)
1. Experimental methods
The experimental procedure of this example is mainly described in the papers published by the applicant (Yuan et al 2011, the door Applied Genet 122, 1017-1028, ZHai et al 2011, new Phytologist 189, 321-334, hua et al 2012, the theoretical and Applied genetics,125, 1047-1055.
The following references are the same as those described above and need not be repeated.
Briefly described, the following steps:
(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pi63 disease-resistant gene family sequences, aiming at 1 SNP and 1 Indel of the specificity of the functional/non-functional haplotypes; for SNP, according to the design principle of CAPS and dCAPS (derived dCelegant polymorphism primers; neff et al 2002, trends in Genetics 18, 613-615), firstly, the primer design of CAPS and dCAPS markers is carried out by using online software dCAPSFinder 2.0 (http:// helix. Where. The. Edu/dCAPS. Html); then, the Primer design software Primer 5.0 is used for confirming the label design;
for Indel, the primer design software was used for the design as described above.
The following molecular markers and primer design procedures are the same as those described above and are not repeated herein.
For convenience of description, the symbols are designated as #1 and #2 (the same below); the primer sequences are as follows:
for the #1 marker (upper band, functional haplotype; lower band, non-functional haplotype):
SEQ ID NO.1(Pi63-F/N G932A -F；5’-3’)：
GAACCCAAGGTGTATGGGAGAGATGCACTTA；
SEQ ID NO.2(Pi63-F/N G932A -R；5’-3’)：
TGATCTCGGTATACAAATCTAGCAAGTGTTG。
for the #2 marker (upper band, non-functional haplotype; lower band, functional haplotype):
SEQ ID NO.3(Pi63-F/N Indel(4562) -F；5’-3’)：
CTGAGATCTTGTCCCGACTGGAAAATCT；
SEQ ID NO.4(Pi63-F/N Indel(4562) -R；5’-3’)：
TCGCACCACGCTTGCTTCGTCCAG。
(2) Amplification of haplotype-specific molecular markers: and carrying out PCR amplification on the 14 first sets of reference varieties by using the 2 sets of primers. The PCR amplification system (20.0. Mu.L) was as follows:
[ the following PCR amplification System is the same as that described above, and is not repeated therein ]
The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then PCR amplification for 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate according to the object of detection) [ 94 ℃ for 30sec for denaturation, annealing for 30sec (# 1/52 ℃, #2/61 ℃), extension at 72 ℃ for 25-30 sec (which can be adjusted as appropriate according to the object of detection) ], and finally extension at 72 ℃ for 5min, and the PCR product is stored in a refrigerator at 4 ℃ for later use.
[ except for annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated
(3) Enzyme digestion of haplotype specific molecular markers: for CAPS or dCAPS marker such as the #1 marker, the PCR product was first extracted and digested with the corresponding restriction enzyme (# 1, aflII), and the reaction system (10.0. Mu.L) was as follows:
after the digestion is carried out for 5 hours at 37 ℃, 10 mu L of 10x loading is added into each tube of digestion products and the mixture is mixed evenly for standby.
[ the enzyme digestion system of PCR amplification products is the same as that described above, and will not be repeated here ]
(4) Detection of haplotype-specific molecular markers:
for the cleavage marker (# 1), the above cleavage product was taken out and detected according to the following procedure;
for the restriction-free tag (# 2), 0.25. Mu.L of the above PCR product was removed, and 0.25. Mu.L of ddH was added 2 Mixing O and 5 mu L10 x loading evenly for later use;
and (3) detection procedures: 1.5-2.0 μ L of the product is electrophoresed on 10-12% denaturing polyacrylamide gel (250V, 20-120 min; adjusted according to the detected object) by a microsyringe, and then the molecular marker is photographed and recorded according to the conventional detection method.
[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]
2. Results of the experiment
The size of each molecular marker is shown in fig. 3, and the results show that the 14 first set of reference varieties present clear genotypes (haplotypes):
functional haplotype variety: CK1, kahei; CK2,93-11; CK3, IR8; CK4, tetep; CK5, tadukan; CK6, IR64; CK7, zhenshan 97; CK8, minghui 63; CK9, shuhui 498;
non-functional haplotype variety: CK10, nipponbare; CK11, shennong 265; CK12, suijing18; CK13, BL1; CK14, K59; m, DL-500.
Specification of test varieties: the information of the 14 first reference varieties is as described above, and is not repeated herein if not necessary.
Example 3: development and application of disease-resistant allele Pi63-KH function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 4)
1. Experimental methods
(1) Design of Pi63-KH function specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, the optimal 1 SNP is selected to be designed into a Pi63-KH function specific molecular marker Pi63-KH T1699C (# 3 marker); the primer sequences are as follows:
for the #3 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.5(Pi63-KH T1699C -F；5’-3’)：
ACATTGGAGGACAGTTCAGG；
SEQ ID NO.6(Pi63-KH T1699C -R；5’-3’)：
CCAGTGATCCTCTGGAAACG。
(2) Detection of Pi63-KH function-specific molecular marker: using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system described above (annealing temperature: #3/55 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, performing enzyme digestion according to the experimental procedure by using a restriction enzyme MboII, and performing electrophoresis detection, photographing and recording.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 4, and the results indicate that Pi63-BL function-specific molecular markers can distinguish the target genes from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK1, kahei (Pi 63-KH);
non-target gene variety: the remaining 13 first set of reference varieties;
in particular, #1699T at 93-11, IR8, IR64, TTP is a sequencing error and should be #1699C. Example 4: development and application of functional specific molecular marker of disease-resistant allele Pi63-9311 of functional haplotype of Pi63 disease-resistant gene family (FIG. 5)
1. Experimental methods
(1) Design of Pi63-9311 function-specific molecular marker: according to the comparison result of the Pi63 disease-resistant gene family sequences, selecting the optimal 1 SNP to design a Pi63-9311 function specific molecular marker Pi63-9311 T280C (# 4 marker); the primer sequences are as follows:
for the #4 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.7(Pi63-9311 T280C -F；5’-3’)：
CCAATCACTGGGAAGTCTAAGAGA；
SEQ ID NO.8(Pi63-9311 T280C -R；5’-3’)：
CCTATGTCATTTAGCTGCTCTCAAGT。
(2) Detection of Pi63-9311 function-specific molecular marker: by using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system (annealing temperature: #4/55 ℃), and the products were stored in a 4 ℃ refrigerator for further use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental procedure by using the restriction enzyme HpaII, and carrying out electrophoresis detection, photographing and recording.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 5, and the results show that Pi63-9311 function-specific molecular markers can distinguish the target genes from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK2,93-11 (Pi 63-9311); CK3, IR8 (Pi 63-9311);
non-target gene variety: the remaining 12 first reference varieties.
Example 5: development and application of disease-resistant allele Pi63-ZS function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 6)
1. Experimental methods
(1) Design of Pi63-ZS function specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, selecting the optimal 1 SNP to design a Pi63-ZS function specific molecular marker Pi63-ZS T1260C (# 5 marker); the primer sequences are as follows:
for the #5 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.9(Pi63-ZS T1260C -F；5’-3’)：
CTTATCATATTGGATGATATGTGGGAATT；
SEQ ID NO.10(Pi63-ZS T1260C -R；5’-3’)：
CCTTGAAGAACAGCCAAAACTCCTTTT。
(2) Detection of Pi63-ZS function-specific molecular marker: using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system described above (annealing temperature: #5/55 ℃) and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, performing enzyme digestion according to the experimental program by using a restriction enzyme Eco RI, and performing electrophoresis detection, photographing and recording.
2. Results of the experiment
The sizes of the respective molecular markers are shown in FIG. 6, and the results show that the Pi63-ZS function-specific molecular marker can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK7, ZHENHAN 97 (Pi 63-ZS);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 6: development and application of disease-resistant allele Pi63-IR64 function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 7)
1. Experimental methods
(1) Design of Pi63-IR64 functional specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, selecting the optimal 1 SNP to design a Pi63-IR64 function specific molecular marker Pi63-IR64 A1394G (# 6 marker); the primer sequences are as follows:
for the #6 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.11(Pi63-IR64 A1394G -F；5’-3’)：
AGTGGATGGGATAAGCTGTTAGCTCCATT；
SEQ ID NO.12(Pi63-IR64 A1394G -R；5’-3’)：
AGCCAAAACTCCTTTTCGTCCAGACAA。
(2) Detection of Pi63-IR64 function-specific molecular markers: using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system described above (annealing temperature: #6/58 ℃) and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using restriction enzyme MfeI, and carrying out electrophoresis detection, photographing and recording.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 7, and the results show that Pi63-IR64 function-specific molecular markers can distinguish the target genes from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK6, IR64 (Pi 63-IR 64);
non-target gene variety: the remaining 13 first set of reference varieties.
Example 7: development and application of disease-resistant allele Pi63-MH function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 8)
1. Experimental methods
(1) Design of Pi63-MH function-specific molecular marker: according to the comparison result of the Pi63 disease-resistant gene family sequences, selecting the optimal 2 SNP combinations to be designed into Pi63-MH function specificity molecular markers, namely Pi63-MH/KH A2257G (# 7 marker); pi63-KH T1699C (the above # 3 mark);
in particular, the sequence and detection of the #3 marker is as described above.
The primer sequences are as follows:
for the #7 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.13(Pi63-MH/KH A2257G -F；5’-3’)：
GCGGTATCTTGAATTTATTGGTG；
SEQ ID NO.14(Pi63-MH/KH A2257G -R；5’-3’)：
GATTATTCATAGAAGTAGGTACATCAT。
(2) Detection of Pi63-MH function-specific molecular markers: using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system described above (annealing temperature: #7/51 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using a restriction enzyme FokI, and carrying out electrophoresis detection, photographing and recording.
2. Results of the experiment
The size of each molecular marker is shown in FIG. 8, and the results show that 2 Pi63-MH function-specific molecular marker combinations can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK8, minghui63 (Pi 63-MH); CK9, shuhui 498 (Pi 63-MH);
non-target gene variety: the remaining 12 first reference varieties.
Example 8: development and application of disease-resistant allele Pi63-TTP function-specific molecular marker of functional haplotype of Pi63 disease-resistant gene family (FIG. 9)
1. Experimental methods
(1) Design of Pi63-TTP function specific molecular marker: according to the alignment result of the Pi63 disease-resistant gene family sequences, selecting the optimal 2 SNP combinations to design a Pi63-TTP function specific molecular marker, pi63-TTP/IR64 G1604C (# 8 marker); pi63-IR64 A1394G (the #6 mark described above);
in particular, the sequence and detection of the #6 marker was as described above.
The primer sequences are as follows:
for the #8 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.15(Pi63-TTP/IR64 G1604C -F；5’-3’)：
TTGGAGGACAGTTCAGGACAAATGGAATT；
SEQ ID NO.16(Pi63-TTP/IR64 G1604C -R；5’-3’)：
CACTGAAGGTGGAAAGGTAGATAATCGTAAC。
(2) Detection of Pi63-TTP function-specific molecular markers: using the pair of primers, 14 first reference varieties were subjected to PCR amplification according to the PCR amplification system described above (annealing temperature: #8/62 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using restriction enzyme EcoRI, and carrying out electrophoresis detection, photographing and recording.
2. Results of the experiment
The size of each molecular marker is shown in FIG. 9, and the results show that 2 Pi63-TTP function-specific molecular marker combinations can distinguish the target gene from all known functional genes of the gene family, as well as non-functional genes:
the target gene variety: CK4, tetep (Pi 63-TTP); CK5, tadukan (Pi 63-TTP);
non-target gene variety: the remaining 12 first reference varieties.
Example 9: application and example of screening true-false specific genome sequence and target gene (Pi 63-KH vs Pi 63-MH) by using the technical system with compatibility and accurate identification and mining of rice blast Pi63 disease-resistant allele family (FIG. 10)
(1) As described above, the Pi63 disease-resistant allele family is a broad-spectrum durable field resistance gene similar to a major gene, and generates complex and diverse variation in the secondary evolution levels of functional haplotype-disease-resistant allele under the continuous and strong selective pressure of rice blast germs;
(2) 1 Pi63-KH function-specific optimal SNP (T1699C), alignment of the reference sequences showed that Kahei was completely identical to the sequences of the 93-11, IR8, IR64, tetep, et al reference varieties (1699T; FIG. 10 a);
(3) However, the gene-specific marker Pi63-KH, which is optimized for Pi63-KH, was developed from this SNP T1699C The results of the identification of the 14 first set of reference varieties showed that the genotypes of Kahei and the reference varieties 93-11, IR8, IR64, tetep, etc. were all inconsistent, thus indicating that the sequence of 93-11, IR8, IR64, tetep at this SNP was wrong and should be #1699C (FIG. 10 b);
(4) 1 Pi63-MH functional specific optimal SNP (A2257G), alignment of the reference sequences showed that the sequence of Kahei et al was not identical to that of Minghui63 and Shuhui 498 (2257G; FIG. 10 c);
(5) However, the Pi 63-MH-optimized gene-specific marker Pi63-MH/KH developed from this SNP A2257G The results of the identification of the 14 first reference lines showed that Kahei was genotypically identical to Minghui63 and Shuhui 498, thus indicating that Kahei is missequenced at this SNP and should be #2257A (fig. 10 c);
as described above, when the genotype of the #3 marker alone is judged, it is estimated that Kahei contains Pi63-KH; however, if the genotype of the #8 marker alone is judged, it is concluded that Kahei, minghui63, shuhui 498 all contain Pi63-KH; when the two were combined, kahei contained Pi63-KH, while Minghui63 and Shuhui 498 contained Pi63-MH (FIG. 10 d).
And (4) conclusion: the technical system of the invention has strong systematicness, logicality and inclusiveness, accurately identifies the target gene on the basis of accurately discriminating true and false specific genome sequences, and avoids generating errors of 'homonymous heterogeneous genes' and the like.
Example 10: application and example of screening true and false target genes (Pi 63-TTP vs Pi63-IR 64) by using the technical system with compatibility and accurate identification and mining of rice blast Pi63 disease-resistant allele family (FIG. 11)
(1) 1 Pi63-TTP/IR64 functionally specific optimal SNP, sequence alignment showed that Tetep shares 1 SNP with IR64 (G1604C; FIG. 11 a);
(2) The results of the identification of 14 first reference lines with the Pi63-TTP/IR 64-optimized gene-specific marker developed from this SNP showed that the genotypes of Tetep and Tadukan were identical to those of IR64, and it was difficult to determine the similarities and differences between the three only with the genotype of the marker (FIG. 11 b);
(3) 1 Pi63-IR64 function-specific optimal SNP (A1394G; FIG. 11 c);
(4) The identification of the 14 first reference lines by the Pi63-IR 64-optimized gene-specific marker developed from this SNP shows that IR64 is a unique genotype, from which it is concluded that IR64 contains the gene of interest Pi63-IR64 (fig. 11 d);
therefore, if the genotypes of the #6 and #8 markers are combined, it can be concluded that IR64 contains Pi63-IR64, while Tetep and Tadukan contain Pi63-TTP.
And (4) conclusion: the technical system of the invention has strong systematicness, logicality and inclusiveness, and can accurately identify the target gene by comparing different marked genotypes in the system, thereby avoiding errors such as 'homonymous and heterogenous genes' and the like.
Example 11: an example of identifying and mining new and old disease-resistant alleles from a Guangdong province rice variety resource population for which target genes are unknown by using the technical system for accurately identifying and mining alleles of the rice blast Pi63 disease-resistant gene family with inclusion (FIG. 12)
1. Experimental methods
(1) The technical system of the invention consists of 8 basic specific markers of secondary detection markers such as functional haplotype-disease resistance allele and the like. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele does not have the precedence. The detection procedures and schemes of the whole technical system are as described above (fig. 3-9; examples 2-8), which are not repeated herein.
In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the population of the rice species to be tested is small, the population of the rice species to be tested is entirely reserved for detection of the disease-resistant allele in order to maintain uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 44 Guangdong province rice seed resources (CV 1-44); zhai et al.2011, new Phytologist, 189; hua et al.2012, the scientific and Applied Genetics, 125; she Xuemei, 2021, master thesis of southern China university of agriculture (unpublished mark related core information) ], identifying and mining Pi63 disease-resistant gene family functional genes;
a second set of reference varieties (only used for germplasm resource population identification) identified by the above 7 target genes was also taken into the trial as controls.
(3) Using conventional PCR-based homologous gene cloning techniques (Zhai et al 2011, new Phytologist,189, 321-334, hua et al 2012, theor Appl Genet 125, 1047-1055), novel disease-resistant alleles were isolated, cloned, sequenced and deposited in GenBank;
in particular, according to the rules of GenBank, all the registered gene sequences are genetically annotated (annotated) to ensure their integrity and readability and are thus functional genes.
2. Results of the experiment
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 44 test varieties were classified as (FIG. 12a; red marker, functional haplotype; black marker, non-functional haplotype):
functional haplotype variety: CV 1-9, CV11-12, CV14-15, CV18-21, CV23, CV26, CV31-32, CV34, CV36, CV41 and other 24 varieties;
non-functional haplotype variety: 20 varieties of CV10, CV13, CV 16-17, CV22, CV24-25, CV27-30, CV33, CV35, CV37-40, CV42-44 and the like.
(2) In the secondary marker-based detection of disease-resistant alleles, 24 functional haplotype test varieties were further identified as:
the target gene Pi63-KH carries the cultivar (FIG. 12b; red marking): none;
the gene of interest Pi63-9311 carries the variety (FIG. 12c; blue indication): 5 varieties of CV11 to 12, CV23, CV31 to 32 and the like;
the target gene Pi63-ZS carries the breed (FIG. 12d; light blue designation): 12 varieties of CV 1-2, CV4-9, CV20-21, CV26, CV41 and the like;
the gene of interest Pi63-IR64 carries the variety (FIG. 12e; light red designation): 1 variety, CV14, etc.;
the target gene Pi63-MH carried the variety (FIG. 12f; light green designation): 1 variety, CV18, etc.;
the target gene Pi63-TTP carries the variety (FIG. 12g; green designation): 1 variety such as CV 15;
unknown novel disease-resistant allele Pi63-AZZ carrying variety (FIGS. 12 a-g; purple designation): 3 varieties (same genotype) such as CV3, CV19, CV34, etc.;
unknown novel disease-resistant allele Pi63-YLZ carries variety (FIGS. 12 a-g; purple designation): CV36, and the like.
Specifically, the results of the detection of secondary markers such as "functional haplotype-disease resistance allele" are indicated by independent color systems (the same below).
(3) By using a conventional homologous gene cloning method based on a PCR technology, 2 novel disease-resistant alleles such as Pi63-AZZ (GenBank MZ 983627) and Pi63-YLZ (GenBank MZ 983628) are isolated and cloned by taking CV3 (Aizizhan, AZZ) and CV36 (Yuekuzhan, YLZ) as representatives.
This example demonstrates that the present technology system has strong compatibility and comparability, since 24 functional haplotype varieties are first identified in the rice resource population of Guangdong province with unknown target genes; then, 5 identified target genes Pi63-9311, pi63-ZS, pi63-IR64, pi63-MH, pi63-TTP, in addition to 2 novel disease-resistant alleles Pi63-AZZ, pi63-YLZ were further identified.
Example 12: an example of identifying and mining new and old disease-resistant alleles from Guangxi autonomous region rice seed resource population with unknown target genes by using the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pi63 disease-resistant gene family alleles (FIG. 13)
1. Experimental methods
(1) As described above, the technical system of the present invention is composed of 8 basic specific markers of secondary detection markers such as "functional haplotype-disease resistance allele".
Likewise, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the population of the rice species to be tested is small, the population of the rice species to be tested is entirely reserved for detection of the disease-resistant allele in order to maintain uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 52 Guangxi autonomous region rice seed resources (CV 45-96); she Xuemei, 2021, master thesis of southern China university of agriculture (unpublished mark related core information) ], identifying and mining Pi63 disease-resistant gene family functional genes;
the 7 second set of reference cultivars were also included as controls in the trial.
(3) The novel disease-resistant allele is separated and cloned by utilizing the conventional homologous gene cloning technology based on the PCR technology and sequenced.
2. Results of the experiment
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 52 test varieties were classified as (FIG. 13a; red marker, functional haplotype; black marker, non-functional haplotype):
functional haplotype variety: CV 45-47, CV50-51, CV53, CV55-64, CV71-73, CV76-77, CV82, CV93, CV96 and other 24 varieties;
non-functional haplotype variety: CV 48-49, CV52, CV54, CV65-70, CV74-75, CV78-81, CV83-92, CV94-95, etc.
(2) In the secondary marker-based detection of disease-resistant alleles, 24 functional haplotype test varieties were further identified as:
the target gene Pi63-KH carries the cultivar (FIG. 13b; red marking): none;
the gene of interest Pi63-9311 carries the variety (FIG. 13c; blue designation): 12 varieties of CV 45-47, CV51, CV56, CV58, CV62, CV64, CV72-73, CV76, CV96 and the like;
the target gene Pi63-ZS carries the breed (FIG. 13d; light blue designation): 4 varieties of CV50, CV 59-60, CV63, and the like;
the gene of interest Pi63-IR64 carries the variety (FIG. 13e; light red designation): none;
the target gene Pi63-MH carried the variety (FIG. 13f; light green designation): 4 varieties, such as CV71, CV77, CV82 and CV 93;
the gene of interest Pi63-TTP carries the cultivar (FIG. 13g; green symbol): none;
unknown novel disease-resistant allele Pi63-AZZ carrying varieties (FIGS. 13 a-g; purple designation): 4 varieties CV53, CV55, CV57, CV61, etc. (the same genotypes as those of the varieties CV3, etc. of example 11).
This example further demonstrates that the present technology system has strong compatibility and comparability, since 24 functional haplotype varieties are first identified in 55 Guangxi rice seed resource populations with unknown target genes; then 3 identified target genes Pi63-9311, pi63-ZS, pi63-MH, plus 1 novel disease-resistant allele Pi63-AZZ were identified in 24 functional haplotype varieties.
Example 13: one set of the invention has the advantages of compatibility, accurate identification and mining of the functional genes of the rice blast Pi63 disease-resistant gene family and the comparative example of the identification capability of other marking technologies (figure 14)
(1) Pi63 is one of the most important broad-spectrum persistent field resistance genes (Xu et al 2008, therapeutic and Applied Genetics, 117. However, since the gene was isolated and cloned, no functional specific molecular markers have been developed in the gene, and the currently used molecular markers still remain among 2 linked markers: (RM6669,RM17496；Yadav et al.Journal of Genetics,98:73)；
The primer sequences are as follows:
for RM6669, RM17496 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.17(RM6629 233259～233342 -F；5’-3’)：
TAAACGGTGTGCAGCTTCTG；
SEQ ID NO.18(RM6629 233259～233342 -R；5’-3’)：
TATTATGGGCGGTCGCTAAC。
SEQ ID NO.19(RM17496 -97198～-97029 -F；5’-3’)：
CTCCTGAGAAGTGGGGACTG；
SEQ ID NO.20(RM17496 -97198～-97029 -R；5’-3’)：
AGTCCTCCATGCATGTGACC。
(2) The 14 first reference varieties were identified and compared using the 2 linked markers as the other marker technology (FIG. 14). The results show that compared with other marking technologies, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects (the secondary marking is shown in fig. 15):
(a) Functional/non-functional haplotype analysis using the primary markers demarcated clear functional haplotype boundaries for the subsequent functional gene mining and identification (FIG. 14a 1). In this example, CK 1-9 were identified as functional haplotype varieties and CK 10-14 were non-functional haplotype varieties in the 14 first set of reference varieties tested. The method is one of incomparable beneficial effects compared with other marking technologies;
(b) On the basis, the disease-resistant allele analysis is carried out by using the secondary marker, and clear and comparable functional gene boundaries are marked for the identification of each disease-resistant allele (FIGS. 14a 2-7). In this example, 6 optimal function-specific markers or marker combinations were selected for each of the 6 disease-resistant alleles (Pi 63-KH, pi63-9311, pi63-ZS, pi63-IR64, pi63-MH, pi 63-TTP), and were independent of each other but aligned to form a set of rigorous identification systems. This is one of the incomparable benefits of other marking technologies. Specifically, the method comprises the following steps:
the technical system of the invention is composed of a set of 8 secondary detection markers such as functional haplotype-disease resistance allele, and the like, thereby accurately identifying the 6 disease resistance alleles on the basis of clearly identifying the functional/non-functional haplotype.
2 microsatellite linked markers which are only target genes span from an upstream # 97198 locus to a downstream #233342 locus; (ii) Because the target gene cluster region is subjected to strong forward selection of pathogenic bacteria to generate severe genome differentiation, the 2 microsatellite markers all generate a band deletion problem; (iii) The result of the test using marker RM6629 indicates that the genotypes of CK1, CK 8-9 are the same and are presumed to be Pi63-KH carriers (similar to those of our # 7), while other varieties are not judged (if only 1 marker and only 1 Pi63-KH carrier is CK); (iv) The result of the detection of marker RM17496 showed that it was difficult to modulate PCR amplification many times even with Pi63-KH carriers, and therefore, it was impossible to determine.
And (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with other marking technologies.
The above examples demonstrate the remarkable ability and effect of the functional gene of Pi63 disease-resistant gene family, which is included and identified accurately.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> southern China university of agriculture
<120> a set of technical system with inclusion and accurate identification and mining of rice blast Pi63 disease-resistant allele families
<130>
<160> 20
<170> PatentIn version 3.3
<210> 1
<211> 31
<212> DNA
<213> marker Pi63-F/NG932A-F
<400> 1
gaacccaagg tgtatgggag agatgcactt a 31
<210> 2
<211> 31
<212> DNA
<213> marker Pi63-F/NG932A-R
<400> 2
tgatctcggt atacaaatct agcaagtgtt g 31
<210> 3
<211> 28
<212> DNA
<213> marker Pi63-F/NIndel (4562) -F
<400> 3
ctgagatctt gtcccgactg gaaaatct 28
<210> 4
<211> 24
<212> DNA
<213> marker Pi63-F/NIndel (4562) -R
<400> 4
tcgcaccacg cttgcttcgt ccag 24
<210> 5
<211> 20
<212> DNA
<213> Mark Pi63-KHT1699C-F
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Mark Pi63-KHT1699C-R
<400> 6
<210> 7
<211> 24
<212> DNA
<213> marker Pi63-9311T280C-F
<400> 7
ccaatcactg ggaagtctaa gaga 24
<210> 8
<211> 26
<212> DNA
<213> marker Pi63-9311T280C-R
<400> 8
cctatgtcat ttagctgctc tcaagt 26
<210> 9
<211> 29
<212> DNA
<213> marker Pi63-ZST1260C-F
<400> 9
cttatcatat tggatgatat gtgggaatt 29
<210> 10
<211> 27
<212> DNA
<213> marker Pi63-ZST1260C-R
<400> 10
ccttgaagaa cagccaaaac tcctttt 27
<210> 11
<211> 29
<212> DNA
<213> flag Pi63-IR64A1394G-F
<400> 11
agtggatggg ataagctgtt agctccatt 29
<210> 12
<211> 27
<212> DNA
<213> marker Pi63-IR64A1394G-R
<400> 12
agccaaaact ccttttcgtc cagacaa 27
<210> 13
<211> 23
<212> DNA
<213> marker Pi63-MH/KHA2257G-F
<400> 13
gcggtatctt gaatttattg gtg 23
<210> 14
<211> 27
<212> DNA
<213> marker Pi63-MH/KHA2257G-R
<400> 14
gattattcat agaagtaggt acatcat 27
<210> 15
<211> 29
<212> DNA
<213> marker Pi63-TTP/IR64G1604C-F
<400> 15
ttggaggaca gttcaggaca aatggaatt 29
<210> 16
<211> 31
<212> DNA
<213> marker Pi63-TTP/IR64G1604C-R
<400> 16
cactgaaggt ggaaaggtag ataatcgtaa c 31
<210> 17
<211> 20
<212> DNA
<213> sign RM6629233259~233342-F
<400> 17
<210> 18
<211> 20
<212> DNA
<213> sign RM6629233259~233342-R
<400> 18
<210> 19
<211> 20
<212> DNA
<213> markers RM17496-97198 to-97029-F
<400> 19
<210> 20
<211> 20
<212> DNA
<213> marker RM 17496-97198-97029-R
<400> 20
Claims (4)
1. Rice blast identification and excavation with containment and accuracyPi63The method for detecting disease-resistant gene family allele is characterized by that said method is formed from "functional haplotype-disease-resistant allele" two-stage detection marker and progressively advanced, and the test variety can be combined into the result for detecting that it has target gene or notAnd then determining;
specifically, the method comprises the following steps:
(1) The functional haplotype/non-functional haplotype detection process of the gene family:
defining genome regions with clearly differentiated haplotypes and SNPs by sequence comparison of functional genes/non-functional genes in families; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety; in subsequent tests, non-functional varieties were excluded;
(2) Disease resistance alleles of functional haplotypes of this gene familyPi63-detection procedure of KH:
defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 1 optimal functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63the-KH gene carrier belongs toPi63Functional haplotypes of the disease-resistant gene family, and the genotypes of the function-specific molecular markers andPi63-the genotype of the KH reference variety is the same; otherwise, the detection result is not the target genePi63-KH；
(3) Disease resistance alleles of functional haplotypes of the gene familyPi63-detection program of 9311:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63-9311 Gene CarrierPi63Functional haplotypes of the disease-resistant gene family, and the genotypes and identities of the functional specific molecular markersPi63-9311 reference variety is of the same genotype; otherwise, the detection result is not the target genePi63-9311；
(4) Disease resistance alleles of functional haplotypes of this gene familyPi63Detection of ZSAnd (3) testing procedures:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63the ZS gene carriers belong toPi63Functional haplotypes of the disease-resistant gene family, and the genotypes of the function-specific molecular markers andPi63-the genotypes of the ZS reference varieties are identical; otherwise, the detection result is not the target genePi63-ZS；
(5) Disease resistance alleles of functional haplotypes of this gene familyPi63Detection procedure of IR 64:
defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63the IR64 Gene Carrier belongs toPi63Functional haplotypes of the disease-resistant gene family, and the genotypes and identities of the functional specific molecular markersPi63-the genotype of the IR64 reference variety is identical; otherwise, the detection result is not the target genePi63-IR64；
(6) Disease resistance alleles of functional haplotypes of this gene familyPi63-detection procedure of MH:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 2 optimal specific molecular marker combinations; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63the-MH gene carrier belongs toPi63Functional haplotypes of the disease-resistant gene family, and the genotypes and combinations of the function-specific molecular markersPi63-genotype identity of MH reference variety; otherwise, the detection result is not the target genePi63-MH；
(7) Disease resistance alleles of functional haplotypes of this gene familyPi63-detection procedure of TTP:
defined by sequence comparison of functional genes within a familySNP specific to target genes, and designing 2 optimal specific molecular marker combinations; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability;Pi63the TTP gene carrier belongs toPi63Functional haplotypes of the disease-resistant gene family, and the genotypes and combinations of the function-specific molecular markersPi63-the TTP reference cultivars are genotypically identical; otherwise, the detection result is not the target genePi63-TTP；
Specifically, in the above method:
(1) The most optimal and simplified haplotype-specific molecular marker combination is Pi63-F/N G932A And Pi63-F/N Indel (4562) (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;
wherein, the mark indicates: F/N, functional (functional)/non-functional (non-functional); G932A is a marker-specific SNP; indel (4562), starting with specific insertions/deletions at the #4562 genomic position, and so on;
(2) The optimal target gene-specific molecular marker is Pi63-KH T1699C (ii) a The sequence is shown in SEQ ID NO. 5-6;
(3) The optimal target gene specific molecular marker is Pi63-9311 T280C (ii) a The sequence is shown as SEQ ID NO. 7-8;
(4) The optimal target gene-specific molecular marker is Pi63-ZS T1260C (ii) a The sequence is shown in SEQ ID NO. 9-10;
(5) The optimal target gene-specific molecular marker is Pi63-IR64 A1394G (ii) a The sequence is shown in SEQ ID NO. 11-12;
(6) The optimal target gene specific molecular marker combination is Pi63-MH/KH A2257G And Pi63-KH T1699C (ii) a The sequences are respectively shown in SEQ ID NO. 13-14 and SEQ ID NO. 5-6;
(7) The optimal target gene specific molecular marker combination is Pi63-TTP/IR64 G1604C And Pi63-IR64 A1394G (ii) a The sequences are shown in SEQ ID NO. 15-16 and SEQ ID NO. 11-12 respectively.
2. Use of the method according to claim 1 for the treatment of complex rice blastPi63Systematic and accurate inclusion identification and mining are carried out on functional genes in a disease-resistant gene family;
the functional genes are the following 6 target genes:
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63-KH, sequence as shown in GenBank AB872116.1;
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63-9311, sequence as GenBank MZ 983626;
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63-ZS, sequence as GenBank MZ 983625;
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63IR64, sequence as shown in GenBank MZ 983622;
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63-MH, sequence shown in GenBank MZ 983624;
blast of ricePi63Disease resistance alleles of functional haplotypes of the disease resistance gene familyPi63TTP, sequence shown in GenBank MZ 983629.
3. The method of claim 1, wherein the method is applied to identify known functional genes of the gene family in germplasm resources of unknown target genes, and mining 2 novel target genes: blast of ricePi63Novel disease-resistant alleles of functional haplotypes of the disease-resistant gene familyPi63-AZZ,Pi63-YLZ；
Disease resistance allelesPi63The sequence of AZZ is shown in GenBank MZ 983627;
disease resistance allelesPi63The sequence of-YLZ is shown in GenBank MZ 983628.
4. The method of claim 1, wherein the method is used to accurately discriminate between true and false SNPs and true and false target genes that are prevalent in the gene family due to sequencing errors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111034566.2A CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111034566.2A CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981121A CN113981121A (en) | 2022-01-28 |
| CN113981121B true CN113981121B (en) | 2023-01-17 |
Family
ID=79735355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111034566.2A Active CN113981121B (en) | 2021-09-03 | 2021-09-03 | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981121B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642803A (en) * | 2013-12-11 | 2014-03-19 | 中国农业科学院作物科学研究所 | Function specific molecular markers of rice blast resistance gene Pi63 as well as method and application of function specific molecular markers |
| CN104673917A (en) * | 2015-02-15 | 2015-06-03 | 中国农业科学院作物科学研究所 | Functional molecular marker of rice blast resistance gene Pi35, method for identifying and selecting rice blast resistance gene Pi35 and application of functional molecular marker |
| CN104774945A (en) * | 2015-04-10 | 2015-07-15 | 辽宁省农业科学院 | Molecular breeding method for new rice variety carrying gene Pi65(t) with resistance to rice blast |
| CN105961185A (en) * | 2016-05-10 | 2016-09-28 | 江苏丘陵地区镇江农业科学研究所 | Method for cultivating rice blast-resisting rice variety |
-
2021
- 2021-09-03 CN CN202111034566.2A patent/CN113981121B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642803A (en) * | 2013-12-11 | 2014-03-19 | 中国农业科学院作物科学研究所 | Function specific molecular markers of rice blast resistance gene Pi63 as well as method and application of function specific molecular markers |
| CN104673917A (en) * | 2015-02-15 | 2015-06-03 | 中国农业科学院作物科学研究所 | Functional molecular marker of rice blast resistance gene Pi35, method for identifying and selecting rice blast resistance gene Pi35 and application of functional molecular marker |
| CN104774945A (en) * | 2015-04-10 | 2015-07-15 | 辽宁省农业科学院 | Molecular breeding method for new rice variety carrying gene Pi65(t) with resistance to rice blast |
| CN105961185A (en) * | 2016-05-10 | 2016-09-28 | 江苏丘陵地区镇江农业科学研究所 | Method for cultivating rice blast-resisting rice variety |
Non-Patent Citations (4)
| Title |
|---|
| Development of New SSR Markers for Rice;S.R.McCouch等;《DNA Research》;20021231(第9期);全文 * |
| 云南省主栽水稻品种抗稻瘟病基因型鉴定;刘斌等;《分子植物育种》;20181128(第22期);全文 * |
| 水稻抗稻瘟病基因Pi35功能性分子标记的开发及其应用;马建等;《作物学报》;20151231(第12期);全文 * |
| 水稻抗稻瘟病基因研究进展;范学科等;《种子》;20180525(第05期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981121A (en) | 2022-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN113789403B (en) | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems | |
| CN110468225B (en) | SNP (Single nucleotide polymorphism) marker related to cytoplasmic male sterility recovery traits of capsicum, and specific primer and application thereof | |
| CN110452969A (en) | A kind of rat quality of heredity monitoring SNP marker classifying method and kit based on KASP | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN113981121B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family | |
| CN112695114A (en) | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof | |
| CN108456740A (en) | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application | |
| CN113744800B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| US20230183822A1 (en) | Molecular markers for identifying allele at rice-blast-resistant pik locus of rice and use thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113903397B (en) | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113981122B (en) | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy | |
| CN116064583A (en) | Highland barley spike length regulating gene and KASP molecular marker and application thereof | |
| CN114292937B (en) | One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families | |
| CN113774160B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster | |
| CN114622027B (en) | One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families | |
| CN116219048A (en) | Pea core SNP molecular marker set developed based on KASP technology and application thereof | |
| Wan et al. | Rapid development of wheat-Dasypyrum villosum compensating translocations resistant to powdery mildew using a triple marker strategy conducted on a large ph1b-induced population | |
| CN113736908B (en) | SNP locus combination for detecting tomato leaf mold resistance and application thereof | |
| CN116751887B (en) | Application of GhEIF A gene associated with cotton fiber strength character |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |